#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MYOM3	127294	broad.mit.edu	37	1	24419571	24419571	+	Missense_Mutation	SNP	C	C	A	rs374208248		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:24419571C>A	ENST00000374434.3	-	10	1118	c.956G>T	c.(955-957)cGg>cTg	p.R319L	MYOM3_ENST00000330966.7_Missense_Mutation_p.R320L|MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000329601.7_Missense_Mutation_p.R319L	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	319	Ig-like C2-type 2.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)	p.R319L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GAGGATCTTCCGACGTCTCGA	0.622																																							uc001bin.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(955-957)CGG>CTG		myomesin family, member 3							53.0	58.0	56.0					1																	24419571		1936	4124	6060	SO:0001583	missense	127294							g.chr1:24419571C>A	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.956G>T	1.37:g.24419571C>A	ENSP00000363557:p.Arg319Leu		Somatic				MYOM3_uc001bim.3_5'UTR|MYOM3_uc001bio.2_Missense_Mutation_p.R319L|MYOM3_uc001bip.1_5'UTR	p.R319L	NM_152372	NP_689585	WXS	Illumina HiSeq	Unspecified	Q5VTT5	MYOM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)	10	1119	-		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	319			Ig-like C2-type 2.		A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	c.956G>T	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	C	5.120	0.207775	0.09704	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.64260	-0.09;-0.09;-0.09	5.06	2.08	0.27032	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.704821	0.13938	N	0.352390	T	0.47116	0.1428	L	0.46157	1.445	0.09310	N	1	B;B	0.32918	0.043;0.39	B;B	0.32864	0.11;0.154	T	0.29488	-1.0010	10	0.09590	T	0.72	.	6.0702	0.19885	0.0:0.6723:0.1551:0.1727	.	319;319	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	L	319;320;319	ENSP00000363557:R319L;ENSP00000332670:R320L;ENSP00000328415:R319L	ENSP00000328415:R319L	R	-	2	0	MYOM3	24292158	0.365000	0.25006	0.010000	0.14722	0.025000	0.11179	1.235000	0.32671	0.229000	0.21039	0.650000	0.86243	CGG		0.622	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372		18	3	1	0	6.33239e-15	0.010504	9.59909e-15	18	3				
ZMYM1	79830	broad.mit.edu	37	1	35570213	35570213	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:35570213G>T	ENST00000373330.1	+	7	824	c.650G>T	c.(649-651)tGc>tTc	p.C217F	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.C217F			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	217						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.C217F(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGTAATGCCTGCCTTTCAAAG	0.358																																							uc001bym.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(649-651)TGC>TTC		zinc finger, MYM domain containing 1							82.0	75.0	77.0					1																	35570213		2042	4233	6275	SO:0001583	missense	79830					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding	g.chr1:35570213G>T	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.650G>T	1.37:g.35570213G>T	ENSP00000362427:p.Cys217Phe		Somatic				ZMYM1_uc009vus.1_RNA|ZMYM1_uc001byn.2_Missense_Mutation_p.C217F|ZMYM1_uc010ohu.1_Missense_Mutation_p.C217F|ZMYM1_uc001byo.2_5'UTR|ZMYM1_uc009vut.2_Missense_Mutation_p.C142F	p.C217F	NM_024772	NP_079048	WXS	Illumina HiSeq	Unspecified	Q5SVZ6	ZMYM1_HUMAN			7	798	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	217			MYM-type 3.		D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	c.650G>T	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623946	0.46840	.	.	ENSG00000197056	ENST00000417119;ENST00000359858;ENST00000373329;ENST00000373330	D;D;D;D	0.82344	-1.6;-1.52;-1.54;-1.52	4.53	3.61	0.41365	TRASH (1);	0.000000	0.50627	D	0.000110	D	0.89949	0.6863	M	0.77820	2.39	0.58432	D	0.999999	D;D	0.89917	1.0;0.973	D;P	0.91635	0.999;0.687	D	0.90715	0.4630	10	0.87932	D	0	-7.0757	12.057	0.53540	0.0849:0.0:0.9151:0.0	.	217;217	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	F	217;217;142;217	ENSP00000394233:C217F;ENSP00000352920:C217F;ENSP00000362426:C142F;ENSP00000362427:C217F	ENSP00000352920:C217F	C	+	2	0	ZMYM1	35342800	1.000000	0.71417	0.994000	0.49952	0.489000	0.33432	6.159000	0.71856	1.238000	0.43771	0.655000	0.94253	TGC		0.358	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772		29	10	1	0	6.07407e-21	0.007291	1.00013e-20	29	10				
PGM1	5236	broad.mit.edu	37	1	64114274	64114274	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:64114274G>C	ENST00000371084.3	+	8	1444	c.1231G>C	c.(1231-1233)Gac>Cac	p.D411H	PGM1_ENST00000540265.1_Missense_Mutation_p.D214H|PGM1_ENST00000371083.4_Missense_Mutation_p.D429H	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	411					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)	p.D429H(1)|p.D411H(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GAGTGTGGAGGACATTCTCAA	0.562																																							uc001dbh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(1)	3						c.(1231-1233)GAC>CAC		phosphoglucomutase 1							88.0	81.0	83.0					1																	64114274		2203	4300	6503	SO:0001583	missense	5236				cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity	g.chr1:64114274G>C	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1231G>C	1.37:g.64114274G>C	ENSP00000360125:p.Asp411His		Somatic				PGM1_uc010ooy.1_Missense_Mutation_p.D214H|PGM1_uc010ooz.1_Missense_Mutation_p.D429H	p.D411H	NM_002633	NP_002624	WXS	Illumina HiSeq	Unspecified	P36871	PGM1_HUMAN			8	1444	+			411					B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Missense_Mutation	SNP	ENST00000371084.3	37	c.1231G>C	CCDS625.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444708	0.63178	.	.	ENSG00000079739	ENST00000538673;ENST00000371084;ENST00000540265;ENST00000371083	T;T;T	0.47177	0.85;0.85;0.85	5.9	5.0	0.66597	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.107676	0.64402	D	0.000006	T	0.45155	0.1328	M	0.84511	2.7	0.44595	D	0.997563	P;P	0.39326	0.486;0.668	B;B	0.39706	0.086;0.307	T	0.58317	-0.7657	10	0.87932	D	0	-28.754	15.0424	0.71803	0.0679:0.0:0.9321:0.0	.	429;411	P36871-2;P36871	.;PGM1_HUMAN	H	387;411;214;429	ENSP00000360125:D411H;ENSP00000443449:D214H;ENSP00000360124:D429H	ENSP00000360124:D429H	D	+	1	0	PGM1	63886862	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	7.876000	0.87215	1.519000	0.48950	-0.136000	0.14681	GAC		0.562	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633		3	44	0	0	0	0.004672	0	3	44				
CELF3	11189	broad.mit.edu	37	1	151677546	151677546	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:151677546G>T	ENST00000290583.4	-	12	2162	c.1369C>A	c.(1369-1371)Cgg>Agg	p.R457R	CELF3_ENST00000290585.4_Silent_p.R407R|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000392706.3_Silent_p.R252R|RP11-98D18.1_ENST00000457548.1_RNA	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	457	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R457R(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						TCCTTAGGCCGCTTTAGCTGG	0.632																																							uc001eys.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1369-1371)CGG>AGG		trinucleotide repeat containing 4							65.0	63.0	64.0					1																	151677546		2203	4300	6503	SO:0001819	synonymous_variant	11189				nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding	g.chr1:151677546G>T	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1369C>A	1.37:g.151677546G>T			Somatic				CELF3_uc010pdh.1_Silent_p.R243R|CELF3_uc001eyr.2_Silent_p.R456R|CELF3_uc009wmy.2_Silent_p.R407R|CELF3_uc009wmx.1_Silent_p.R456R	p.R457R	NM_007185	NP_009116	WXS	Illumina HiSeq	Unspecified	Q5SZQ8	CELF3_HUMAN			12	2163	-			457			RRM 3.		B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	c.1369C>A	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	10.15	1.270880	0.23221	.	.	ENSG00000159409	ENST00000420342	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	T	0.64538	0.2607	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62992	-0.6736	4	.	.	.	-17.2679	15.7783	0.78242	0.0:0.0:1.0:0.0	.	.	.	.	R	457	.	.	S	-	3	2	CELF3	149944170	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.144000	0.42197	2.588000	0.87417	0.561000	0.74099	AGC		0.632	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185		25	36	1	0	2.41591e-17	0.004656	3.84532e-17	25	36				
RXFP4	339403	broad.mit.edu	37	1	155912009	155912009	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:155912009C>A	ENST00000368318.3	+	1	530	c.509C>A	c.(508-510)gCc>gAc	p.A170D		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)	p.A170D(1)		endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCGGCGGCTGCCCTGGTGACG	0.682																																							uc010pgs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(508-510)GCC>GAC		relaxin 3 receptor 2							46.0	49.0	48.0					1																	155912009		2203	4300	6503	SO:0001583	missense	339403					integral to membrane|plasma membrane	angiotensin type II receptor activity	g.chr1:155912009C>A	AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.509C>A	1.37:g.155912009C>A	ENSP00000357301:p.Ala170Asp		Somatic					p.A170D	NM_181885	NP_871001	WXS	Illumina HiSeq	Unspecified	Q8TDU9	RL3R2_HUMAN			1	530	+	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		170			Helical; Name=4; (Potential).		B0M0L4|Q3MJB1|Q8NGZ8	Missense_Mutation	SNP	ENST00000368318.3	37	c.509C>A	CCDS1124.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158035	0.57368	.	.	ENSG00000173080	ENST00000368318	T	0.38887	1.11	4.54	3.63	0.41609	GPCR, rhodopsin-like superfamily (1);	0.579096	0.16195	N	0.225209	T	0.31231	0.0790	M	0.70842	2.15	0.34986	D	0.754565	P	0.41498	0.752	P	0.46389	0.515	T	0.17806	-1.0357	10	0.35671	T	0.21	-17.8117	6.8114	0.23807	0.0:0.7948:0.0:0.2052	.	170	Q8TDU9	RL3R2_HUMAN	D	170	ENSP00000357301:A170D	ENSP00000357301:A170D	A	+	2	0	RXFP4	154178633	0.000000	0.05858	0.992000	0.48379	0.872000	0.50106	0.753000	0.26376	1.135000	0.42183	0.462000	0.41574	GCC		0.682	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885		22	76	1	0	3.28513e-13	0.021523	4.75348e-13	22	76				
SPTA1	6708	broad.mit.edu	37	1	158605807	158605807	+	Silent	SNP	T	T	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:158605807T>A	ENST00000368147.4	-	38	5508	c.5328A>T	c.(5326-5328)gcA>gcT	p.A1776A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1776					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.A1776A(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCAGCTTCTCTGCCATATCCA	0.507																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(5326-5328)GCA>GCT		spectrin, alpha, erythrocytic 1							170.0	171.0	171.0					1																	158605807		1998	4179	6177	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158605807T>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5328A>T	1.37:g.158605807T>A			Somatic					p.A1776A	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			38	5527	-	all_hematologic(112;0.0378)		1776			Spectrin 17.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.5328A>T	CCDS41423.1																																																																																				0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		88	126	0	0	0	0.01441	0	88	126				
OR6N2	81442	broad.mit.edu	37	1	158747003	158747003	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:158747003A>C	ENST00000339258.1	-	1	422	c.423T>G	c.(421-423)tgT>tgG	p.C141W		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C141W(1)		endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					CCATCTTGGCACAGAGTGTGG	0.502																																							uc010pir.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)TGT>TGG		olfactory receptor, family 6, subfamily N,							83.0	85.0	84.0					1																	158747003		2203	4300	6503	SO:0001583	missense	81442				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158747003A>C	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.423T>G	1.37:g.158747003A>C	ENSP00000344101:p.Cys141Trp		Somatic					p.C141W	NM_001005278	NP_001005278	WXS	Illumina HiSeq	Unspecified	Q8NGY6	OR6N2_HUMAN			1	423	-	all_hematologic(112;0.0378)		141			Helical; Name=4; (Potential).		Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	c.423T>G	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	A	9.726	1.161051	0.21538	.	.	ENSG00000188340	ENST00000339258	T	0.01347	4.99	5.17	1.57	0.23409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	D	0.000833	T	0.06280	0.0162	H	0.98487	4.245	0.21256	N	0.999749	D	0.69078	0.997	D	0.65573	0.936	T	0.09314	-1.0680	10	0.87932	D	0	-11.8988	8.5441	0.33410	0.7629:0.0:0.2371:0.0	.	141	Q8NGY6	OR6N2_HUMAN	W	141	ENSP00000344101:C141W	ENSP00000344101:C141W	C	-	3	2	OR6N2	157013627	0.000000	0.05858	0.565000	0.28409	0.543000	0.35085	-0.297000	0.08276	0.451000	0.26802	0.528000	0.53228	TGT		0.502	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			16	59	0	0	0	0.006122	0	16	59				
HMCN1	83872	broad.mit.edu	37	1	185985107	185985107	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:185985107G>T	ENST00000271588.4	+	32	5156	c.4927G>T	c.(4927-4929)Ggc>Tgc	p.G1643C	HMCN1_ENST00000367492.2_Missense_Mutation_p.G1643C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1643	Ig-like C2-type 14.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G1643C(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AATGATTGAAGGCAACTTGGC	0.403																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(4927-4929)GGC>TGC		hemicentin 1 precursor							83.0	77.0	79.0					1																	185985107		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:185985107G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4927G>T	1.37:g.185985107G>T	ENSP00000271588:p.Gly1643Cys		Somatic					p.G1643C	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			32	5156	+			1643			Ig-like C2-type 14.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.4927G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.732955	0.69189	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66280	-0.18;-0.2	5.87	5.87	0.94306	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.192184	0.56097	D	0.000040	T	0.75117	0.3806	M	0.69358	2.11	0.54753	D	0.999983	D	0.64830	0.994	P	0.56216	0.794	T	0.74022	-0.3798	10	0.51188	T	0.08	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1643	Q96RW7	HMCN1_HUMAN	C	1643	ENSP00000271588:G1643C;ENSP00000356462:G1643C	ENSP00000271588:G1643C	G	+	1	0	HMCN1	184251730	1.000000	0.71417	0.999000	0.59377	0.669000	0.39330	6.003000	0.70701	2.941000	0.99782	0.655000	0.94253	GGC		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		38	50	1	0	5.73237e-09	0.00623	7.55091e-09	38	50				
TMEM81	388730	broad.mit.edu	37	1	205052919	205052919	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:205052919C>A	ENST00000367167.3	-	1	726	c.530G>T	c.(529-531)gGg>gTg	p.G177V		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	177						integral component of membrane (GO:0016021)		p.G177V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			GACCCTCAACCCAAAATAGAG	0.418																																							uc001hbt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(529-531)GGG>GTG		transmembrane protein 81 precursor							80.0	81.0	81.0					1																	205052919		2203	4300	6503	SO:0001583	missense	388730					integral to membrane		g.chr1:205052919C>A	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.530G>T	1.37:g.205052919C>A	ENSP00000356135:p.Gly177Val		Somatic					p.G177V	NM_203376	NP_976310	WXS	Illumina HiSeq	Unspecified	Q6P7N7	TMM81_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0923)		1	670	-	all_cancers(21;0.144)|Breast(84;0.0437)		177			Extracellular (Potential).		Q6UVZ4	Missense_Mutation	SNP	ENST00000367167.3	37	c.530G>T	CCDS1450.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.892197	0.72524	.	.	ENSG00000174529	ENST00000367167	T	0.46451	0.87	5.93	4.97	0.65823	Immunoglobulin subtype (1);	0.057430	0.64402	D	0.000001	T	0.63988	0.2558	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.66224	-0.5977	10	0.72032	D	0.01	-22.113	16.8316	0.85946	0.0:0.8613:0.1387:0.0	.	177	Q6P7N7	TMM81_HUMAN	V	177	ENSP00000356135:G177V	ENSP00000356135:G177V	G	-	2	0	TMEM81	203319542	0.981000	0.34729	1.000000	0.80357	0.900000	0.52787	2.517000	0.45529	2.826000	0.97356	0.655000	0.94253	GGG		0.418	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376		26	40	1	0	1.42536e-11	0.004656	1.95858e-11	26	40				
KCNH1	3756	broad.mit.edu	37	1	211276891	211276891	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:211276891G>A	ENST00000271751.4	-	3	284	c.257C>T	c.(256-258)aCa>aTa	p.T86I	KCNH1_ENST00000367007.4_Missense_Mutation_p.T86I			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	86	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.T86I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GTTCTCAAATGTTTGCCGCAC	0.338																																							uc001hib.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(256-258)ACA>ATA		potassium voltage-gated channel, subfamily H,							171.0	160.0	163.0					1																	211276891		2201	4299	6500	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:211276891G>A	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.257C>T	1.37:g.211276891G>A	ENSP00000271751:p.Thr86Ile		Somatic				KCNH1_uc001hic.2_Missense_Mutation_p.T86I	p.T86I	NM_172362	NP_758872	WXS	Illumina HiSeq	Unspecified	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	3	427	-			86			Cytoplasmic (Potential).|PAS.		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.257C>T	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903575	0.92035	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99532	-6.1;-6.1	5.46	5.46	0.80206	PAS (3);PAS fold (1);	0.000000	0.85682	D	0.000000	D	0.99414	0.9793	M	0.67397	2.05	0.80722	D	1	P;D	0.53462	0.763;0.96	P;P	0.58130	0.686;0.833	D	0.99038	1.0823	10	0.59425	D	0.04	.	18.6768	0.91531	0.0:0.0:1.0:0.0	.	86;86	Q14CL3;O95259	.;KCNH1_HUMAN	I	86	ENSP00000271751:T86I;ENSP00000355974:T86I	ENSP00000271751:T86I	T	-	2	0	KCNH1	209343514	1.000000	0.71417	0.929000	0.37066	0.981000	0.71138	9.362000	0.97126	2.706000	0.92434	0.655000	0.94253	ACA		0.338	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		15	57	0	0	0	0.00499	0	15	57				
CCDC185	164127	broad.mit.edu	37	1	223567018	223567018	+	Silent	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:223567018C>A	ENST00000366875.3	+	1	304	c.201C>A	c.(199-201)acC>acA	p.T67T		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		67								p.T67T(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		GTTCGTTCACCCCGCGGCCTC	0.721																																							uc001hoa.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(199-201)ACC>ACA		hypothetical protein LOC164127							6.0	8.0	7.0					1																	223567018		1921	3969	5890	SO:0001819	synonymous_variant	164127							g.chr1:223567018C>A																												ENST00000366875.3:c.201C>A	1.37:g.223567018C>A			Somatic					p.T67T	NM_152610	NP_689823	WXS	Illumina HiSeq	Unspecified	Q8N715	CA065_HUMAN		GBM - Glioblastoma multiforme(131;0.0704)	1	304	+			67					Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	37	c.201C>A	CCDS1537.1																																																																																				0.721	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1			10	12	1	0	6.40141e-05	0.010729	7.27779e-05	10	12				
OBSCN	84033	broad.mit.edu	37	1	228554800	228554800	+	Missense_Mutation	SNP	G	G	T	rs201469382		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:228554800G>T	ENST00000422127.1	+	86	19596	c.19552G>T	c.(19552-19554)Gcg>Tcg	p.A6518S	OBSCN_ENST00000366707.4_Missense_Mutation_p.A4152S|OBSCN_ENST00000570156.2_Missense_Mutation_p.A7475S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6518	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A7230S(1)|p.A7100S(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CATCCTGGCCGCGCTGAGCCA	0.612																																							uc009xez.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(19552-19554)GCG>TCG		obscurin, cytoskeletal calmodulin and							37.0	40.0	39.0					1																	228554800		2062	4198	6260	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228554800G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.19552G>T	1.37:g.228554800G>T	ENSP00000409493:p.Ala6518Ser		Somatic				OBSCN_uc001hsr.1_Missense_Mutation_p.A1147S	p.A6518S	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			86	19596	+		Prostate(94;0.0405)	6518			Protein kinase 1.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.19552G>T	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.98|14.98	2.697295|2.697295	0.48202|0.48202	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000422127;ENST00000366707|ENST00000441106	T;T|.	0.63580|.	-0.05;-0.05|.	4.68|4.68	-0.592|-0.592	0.11671|0.11671	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.09069|0.09069	0.0224|0.0224	N|N	0.02391|0.02391	-0.57|-0.57	0.18873|0.18873	N|N	0.999983|0.999983	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.31475|0.31475	-0.9942|-0.9942	9|5	0.07482|.	T|.	0.82|.	.|.	3.6473|3.6473	0.08189|0.08189	0.3267:0.0:0.2831:0.3901|0.3267:0.0:0.2831:0.3901	.|.	6518|.	Q5VST9|.	OBSCN_HUMAN|.	S|L	6518;4152|1134	ENSP00000409493:A6518S;ENSP00000355668:A4152S|.	ENSP00000355668:A4152S|.	A|R	+|+	1|2	0|0	OBSCN|OBSCN	226621423|226621423	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.704000|0.704000	0.40688|0.40688	0.235000|0.235000	0.17948|0.17948	-0.264000|-0.264000	0.09365|0.09365	-0.475000|-0.475000	0.04921|0.04921	GCG|CGC		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		5	6	1	0	4.096e-09	0.001168	5.43289e-09	5	6				
MTR	4548	broad.mit.edu	37	1	237057847	237057847	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:237057847G>T	ENST00000366577.5	+	30	3789	c.3395G>T	c.(3394-3396)cGg>cTg	p.R1132L	MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_Missense_Mutation_p.R1081L	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1132	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.R1132L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CTGGGGGACCGGCTGGCAGAG	0.607																																							uc001hyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(3394-3396)CGG>CTG		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						63.0	58.0	60.0					1																	237057847		2203	4300	6503	SO:0001583	missense	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237057847G>T	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3395G>T	1.37:g.237057847G>T	ENSP00000355536:p.Arg1132Leu		Somatic				MTR_uc010pxw.1_Missense_Mutation_p.R725L|MTR_uc010pxx.1_Missense_Mutation_p.R1081L|MTR_uc010pxy.1_Missense_Mutation_p.R986L	p.R1132L	NM_000254	NP_000245	WXS	Illumina HiSeq	Unspecified	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	30	3818	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	1132			AdoMet activation.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	c.3395G>T	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	G	34	5.403364	0.96051	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;T	0.79352	-1.26;-1.26;-1.26	5.57	5.57	0.84162	Vitamin B12-dependent methionine synthase, activation domain (4);	0.000000	0.85682	D	0.000000	D	0.92215	0.7531	H	0.95611	3.695	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93831	0.7128	10	0.87932	D	0	-16.1662	19.9066	0.97010	0.0:0.0:1.0:0.0	.	1132;1081;1132	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	L	986;1132;1081;686	ENSP00000355536:R1132L;ENSP00000441845:R1081L;ENSP00000355535:R686L	ENSP00000355535:R686L	R	+	2	0	MTR	235124470	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.228000	0.95250	2.779000	0.95612	0.655000	0.94253	CGG		0.607	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		13	28	1	0	2.62699e-14	0.003163	3.91996e-14	13	28				
OR2T2	401992	broad.mit.edu	37	1	248616264	248616264	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr1:248616264C>A	ENST00000342927.3	+	1	188	c.166C>A	c.(166-168)Ctc>Atc	p.L56I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L56I(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACTCCCGCCTCCACACACC	0.512																																							uc001iek.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(166-168)CTC>ATC		olfactory receptor, family 2, subfamily T,							88.0	99.0	95.0					1																	248616264		2203	4296	6499	SO:0001583	missense	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616264C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.166C>A	1.37:g.248616264C>A	ENSP00000343062:p.Leu56Ile		Somatic					p.L56I	NM_001004136	NP_001004136	WXS	Illumina HiSeq	Unspecified	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	166	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		56			Cytoplasmic (Potential).		B2RNM1|B9EH01	Missense_Mutation	SNP	ENST00000342927.3	37	c.166C>A	CCDS31116.1	.	.	.	.	.	.	.	.	.	.	c	15.74	2.921404	0.52653	.	.	ENSG00000196240	ENST00000342927	T	0.13778	2.56	3.15	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	D	0.000650	T	0.48642	0.1511	H	0.96175	3.78	0.41539	D	0.988506	D	0.71674	0.998	D	0.80764	0.994	T	0.67288	-0.5708	10	0.87932	D	0	.	13.2101	0.59819	0.0:1.0:0.0:0.0	.	56	Q6IF00	OR2T2_HUMAN	I	56	ENSP00000343062:L56I	ENSP00000343062:L56I	L	+	1	0	OR2T2	246682887	1.000000	0.71417	0.043000	0.18650	0.414000	0.31173	5.202000	0.65169	1.584000	0.49913	0.298000	0.19748	CTC		0.512	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		4	86	1	0	5.9392e-07	0.001168	7.56258e-07	4	86				
CUBN	8029	broad.mit.edu	37	10	16982064	16982064	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr10:16982064T>C	ENST00000377833.4	-	37	5580	c.5515A>G	c.(5515-5517)Agc>Ggc	p.S1839G		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1839	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S1839G(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCGTGCCGCTGCCAGAACCA	0.413																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(5515-5517)AGC>GGC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						148.0	161.0	156.0					10																	16982064		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16982064T>C	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5515A>G	10.37:g.16982064T>C	ENSP00000367064:p.Ser1839Gly		Somatic					p.S1839G	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			37	5567	-			1839			CUB 12.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.5515A>G	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651428	0.29336	.	.	ENSG00000107611	ENST00000377833	T	0.19532	2.14	6.16	3.8	0.43715	CUB (5);	0.509465	0.18115	N	0.151243	T	0.16128	0.0388	L	0.38838	1.175	0.80722	D	1	B	0.31026	0.304	B	0.26614	0.071	T	0.03630	-1.1018	10	0.72032	D	0.01	.	8.7316	0.34503	0.0:0.0655:0.1297:0.8048	.	1839	O60494	CUBN_HUMAN	G	1839	ENSP00000367064:S1839G	ENSP00000367064:S1839G	S	-	1	0	CUBN	17022070	0.998000	0.40836	0.040000	0.18447	0.015000	0.08874	4.736000	0.62059	0.542000	0.28846	0.528000	0.53228	AGC		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		116	39	0	0	0	0.01441	0	116	39				
ARHGAP21	57584	broad.mit.edu	37	10	24874156	24874156	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr10:24874156G>A	ENST00000396432.2	-	26	5548	c.5062C>T	c.(5062-5064)Cgg>Tgg	p.R1688W		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1687	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.R1687W(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						AGCTGTCTCCGGCTATCTAAA	0.428																																							uc001isb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(1)	8						c.(5062-5064)CGG>TGG		Rho GTPase activating protein 21							21.0	23.0	22.0					10																	24874156		2102	4216	6318	SO:0001583	missense	57584				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding	g.chr10:24874156G>A	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.5062C>T	10.37:g.24874156G>A	ENSP00000379709:p.Arg1688Trp		Somatic				ARHGAP21_uc010qdb.1_RNA	p.R1688W	NM_020824	NP_065875	WXS	Illumina HiSeq	Unspecified	Q5T5U3	RHG21_HUMAN			26	5549	-			1687			Interaction with CTNNA1.		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	c.5062C>T	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804830	0.50315	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.14893	2.47	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.43344	0.1243	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.42137	-0.9469	10	0.87932	D	0	.	18.4491	0.90696	0.0:0.0:1.0:0.0	.	1687	Q5T5U3	RHG21_HUMAN	W	1688;1137	ENSP00000379709:R1688W	ENSP00000379709:R1688W	R	-	1	2	ARHGAP21	24914162	1.000000	0.71417	0.832000	0.32986	0.826000	0.46750	3.302000	0.51849	2.332000	0.79248	0.591000	0.81541	CGG		0.428	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824		17	40	0	0	0	0.01892	0	17	40				
ZEB1	6935	broad.mit.edu	37	10	31815998	31815998	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr10:31815998G>T	ENST00000320985.10	+	9	3291	c.3181G>T	c.(3181-3183)Ggg>Tgg	p.G1061W	ZEB1_ENST00000361642.5_Missense_Mutation_p.G1062W|ZEB1_ENST00000542815.3_Missense_Mutation_p.G994W|ZEB1_ENST00000446923.2_Missense_Mutation_p.G1045W|ZEB1_ENST00000560721.2_Missense_Mutation_p.G1041W			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	1061	Glu-rich (acidic).				cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G1061W(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				aaaaccacaaggggatgagga	0.438																																					Ovarian(40;423 959 14296 36701 49589)	Ovarian(40;423 959 14296 36701 49589)	uc001ivs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)	5						c.(3181-3183)GGG>TGG		zinc finger E-box binding homeobox 1 isoform b							90.0	93.0	92.0					10																	31815998		2202	4299	6501	SO:0001583	missense	6935				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr10:31815998G>T	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.3181G>T	10.37:g.31815998G>T	ENSP00000319248:p.Gly1061Trp		Somatic				ZEB1_uc001ivr.3_Missense_Mutation_p.G843W|ZEB1_uc010qee.1_Missense_Mutation_p.G843W|ZEB1_uc010qef.1_Missense_Mutation_p.G843W|ZEB1_uc001ivt.3_Missense_Mutation_p.G843W|ZEB1_uc001ivu.3_Missense_Mutation_p.G1062W|ZEB1_uc001ivv.3_Missense_Mutation_p.G1041W|ZEB1_uc010qeh.1_Missense_Mutation_p.G994W|ZEB1_uc009xlp.2_Missense_Mutation_p.G1045W	p.G1061W	NM_030751	NP_110378	WXS	Illumina HiSeq	Unspecified	P37275	ZEB1_HUMAN			9	3244	+		Prostate(175;0.0156)	1061			Glu-rich (acidic).		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	c.3181G>T	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591653	0.46214	.	.	ENSG00000148516	ENST00000542879;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.14391	2.8;2.51;2.55;2.51;2.55	5.38	4.47	0.54385	.	2.186940	0.02233	N	0.065022	T	0.25158	0.0611	L	0.44542	1.39	0.28798	N	0.898913	P;D;P;P;P	0.57257	0.793;0.979;0.69;0.69;0.69	P;P;B;B;B	0.49252	0.487;0.604;0.293;0.293;0.293	T	0.36237	-0.9756	10	0.72032	D	0.01	0.0512	13.5794	0.61893	0.0758:0.0:0.9242:0.0	.	994;1045;1041;1062;1061	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	W	843;1062;1056;994;1061;1041;952;1045	ENSP00000444282:G843W;ENSP00000354487:G1062W;ENSP00000444891:G994W;ENSP00000319248:G1061W;ENSP00000391612:G1045W	ENSP00000319248:G1061W	G	+	1	0	ZEB1	31856004	1.000000	0.71417	0.154000	0.22540	0.909000	0.53808	6.706000	0.74649	1.280000	0.44463	0.650000	0.86243	GGG		0.438	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		10	5	1	0	9.70103e-10	0.008291	1.29573e-09	10	5				
ZNF33A	7581	broad.mit.edu	37	10	38343661	38343661	+	Silent	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr10:38343661T>C	ENST00000458705.2	+	5	764	c.606T>C	c.(604-606)caT>caC	p.H202H	ZNF33A_ENST00000374618.3_Silent_p.H203H|ZNF33A_ENST00000432900.2_Silent_p.H209H|ZNF33A_ENST00000307441.9_Silent_p.H202H|ZNF33A_ENST00000469037.2_Intron			Q06730	ZN33A_HUMAN	zinc finger protein 33A	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H202H(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TGAGTCATCATGAGGAGACTT	0.348																																							uc001izh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(604-606)CAT>CAC		zinc finger protein 33A isoform b							80.0	79.0	79.0					10																	38343661		2203	4300	6503	SO:0001819	synonymous_variant	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38343661T>C	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.606T>C	10.37:g.38343661T>C			Somatic				ZNF33A_uc001izg.2_Silent_p.H203H|ZNF33A_uc010qev.1_Silent_p.H209H|ZNF33A_uc001izi.1_Intron	p.H202H	NM_006974	NP_008905	WXS	Illumina HiSeq	Unspecified	Q06730	ZN33A_HUMAN			5	784	+			202					A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	ENST00000458705.2	37	c.606T>C	CCDS31182.1																																																																																				0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		19	65	0	0	0	0.008871	0	19	65				
FAM204A	63877	broad.mit.edu	37	10	120095077	120095077	+	Missense_Mutation	SNP	C	C	T	rs148686616		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr10:120095077C>T	ENST00000369183.4	-	4	570	c.311G>A	c.(310-312)cGc>cAc	p.R104H	FAM204A_ENST00000469758.1_5'UTR|FAM204A_ENST00000369172.4_Missense_Mutation_p.R104H	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	104								p.R104H(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TTTTCTGGAGCGTTTTCTTCT	0.303													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16732	0.0		0.0	False		,,,				2504	0.0						uc001ldo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)CGC>CAC		hypothetical protein LOC63877		C	HIS/ARG,HIS/ARG	2,4400	4.2+/-10.8	0,2,2199	98.0	89.0	92.0		311,311	5.3	1.0	10	dbSNP_134	92	0,8600		0,0,4300	no	missense,missense	FAM204A	NM_001134672.1,NM_022063.2	29,29	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	104/234,104/234	120095077	2,13000	2201	4300	6501	SO:0001583	missense	63877							g.chr10:120095077C>T	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.311G>A	10.37:g.120095077C>T	ENSP00000358183:p.Arg104His		Somatic				C10orf84_uc010qss.1_Missense_Mutation_p.R104H	p.R104H	NM_022063	NP_071346	WXS	Illumina HiSeq	Unspecified	Q9H8W3	F204A_HUMAN		all cancers(201;0.0244)	4	578	-		Colorectal(252;0.101)	104					D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	ENST00000369183.4	37	c.311G>A	CCDS7605.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055683	0.36277	4.54E-4	0.0	ENSG00000165669	ENST00000369183;ENST00000369172;ENST00000369170	.	.	.	6.17	5.27	0.74061	.	0.117382	0.56097	D	0.000023	T	0.56558	0.1993	L	0.54323	1.7	0.47547	D	0.999456	B	0.29805	0.257	B	0.26202	0.067	T	0.56661	-0.7942	9	0.45353	T	0.12	0.3053	12.8443	0.57821	0.0:0.9242:0.0:0.0758	.	104	Q9H8W3	F204A_HUMAN	H	104	.	ENSP00000358168:R104H	R	-	2	0	FAM204A	120085067	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	1.950000	0.40323	1.632000	0.50472	-0.140000	0.14226	CGC		0.303	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050596.2	NM_022063		22	12	0	0	0	0.014323	0	22	12				
OR56A3	390083	broad.mit.edu	37	11	5968696	5968696	+	Silent	SNP	C	C	A	rs267603044		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:5968696C>A	ENST00000329564.6	+	1	127	c.120C>A	c.(118-120)ctC>ctA	p.L40L	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L40L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCTTTTCCTCTTGGCCGTAG	0.597																																							uc010qzt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(118-120)CTC>CTA		olfactory receptor, family 56, subfamily A,							103.0	106.0	105.0					11																	5968696		2201	4296	6497	SO:0001819	synonymous_variant	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5968696C>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.120C>A	11.37:g.5968696C>A			Somatic					p.L40L	NM_001003443	NP_001003443	WXS	Illumina HiSeq	Unspecified	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	120	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	40			Helical; Name=1; (Potential).		A6NN77|Q6IFF7	Silent	SNP	ENST00000329564.6	37	c.120C>A	CCDS41614.1																																																																																				0.597	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		62	18	1	0	6.52717e-41	0.01441	1.29863e-40	62	18				
TRIM3	10612	broad.mit.edu	37	11	6477727	6477727	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:6477727C>A	ENST00000525074.1	-	6	1623	c.1229G>T	c.(1228-1230)cGc>cTc	p.R410L	TRIM3_ENST00000529058.1_Intron|TRIM3_ENST00000536344.1_Missense_Mutation_p.R291L|TRIM3_ENST00000359518.3_Missense_Mutation_p.R410L|TRIM3_ENST00000345851.3_Missense_Mutation_p.R410L|TRIM3_ENST00000537602.1_Missense_Mutation_p.R332L	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	410					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R410L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGGCTGCCGCGCACTGGCTG	0.677																																					Melanoma(6;5 510 1540 25169 29084)	Melanoma(6;5 510 1540 25169 29084)	uc001mdh.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(1228-1230)CGC>CTC		tripartite motif-containing 3							16.0	16.0	16.0					11																	6477727		2191	4284	6475	SO:0001583	missense	10612				nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding	g.chr11:6477727C>A	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1229G>T	11.37:g.6477727C>A	ENSP00000433102:p.Arg410Leu		Somatic				TRIM3_uc001mdi.2_Missense_Mutation_p.R410L|TRIM3_uc010raj.1_Missense_Mutation_p.R291L|TRIM3_uc009yfd.2_Missense_Mutation_p.R410L|TRIM3_uc010rak.1_Missense_Mutation_p.R410L|TRIM3_uc001mdj.2_Missense_Mutation_p.R291L	p.R410L	NM_006458	NP_006449	WXS	Illumina HiSeq	Unspecified	O75382	TRIM3_HUMAN		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)	7	1616	-		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	410			Filamin.		B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	c.1229G>T	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773552	0.69992	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93	4.99	4.99	0.66335	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.202488	0.49305	D	0.000146	D	0.89153	0.6634	M	0.65975	2.015	0.48452	D	0.999651	P;P;P	0.47545	0.875;0.832;0.897	P;P;P	0.61328	0.749;0.647;0.887	D	0.87339	0.2330	10	0.33141	T	0.24	-18.2592	10.5053	0.44830	0.0:0.9096:0.0:0.0904	.	291;291;410	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	L	410;410;410;410;399;332;410;291	ENSP00000433102:R410L;ENSP00000340797:R410L;ENSP00000441091:R332L;ENSP00000352508:R410L;ENSP00000445460:R291L	ENSP00000337094:R399L	R	-	2	0	TRIM3	6434303	0.000000	0.05858	1.000000	0.80357	0.979000	0.70002	0.834000	0.27518	2.309000	0.77851	0.563000	0.77884	CGC		0.677	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458		14	5	1	0	4.93089e-13	0.020292	7.0812e-13	14	5				
AMBRA1	55626	broad.mit.edu	37	11	46419198	46419198	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:46419198C>A	ENST00000458649.2	-	18	4117	c.3699G>T	c.(3697-3699)tgG>tgT	p.W1233C	AMBRA1_ENST00000533727.1_Missense_Mutation_p.W1114C|AMBRA1_ENST00000314845.3_Missense_Mutation_p.W1143C|AMBRA1_ENST00000534300.1_Missense_Mutation_p.W1173C|AMBRA1_ENST00000426438.1_Missense_Mutation_p.W1204C|AMBRA1_ENST00000528950.1_Missense_Mutation_p.W1204C|AMBRA1_ENST00000298834.3_Missense_Mutation_p.W1173C			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1233					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)		p.W1233C(1)|p.W1143C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CAGGCTGGTCCCAGGAAGCTG	0.687																																							uc010rgu.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(3697-3699)TGG>TGT		activating molecule in beclin-1-regulated							54.0	58.0	56.0					11																	46419198		2202	4299	6501	SO:0001583	missense	55626				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle		g.chr11:46419198C>A	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3699G>T	11.37:g.46419198C>A	ENSP00000415327:p.Trp1233Cys		Somatic				AMBRA1_uc010rgt.1_3'UTR|AMBRA1_uc009ylc.1_Missense_Mutation_p.W1204C|AMBRA1_uc001ncu.1_Missense_Mutation_p.W1143C|AMBRA1_uc001ncv.2_Missense_Mutation_p.W1236C|AMBRA1_uc001ncw.2_Missense_Mutation_p.W1114C|AMBRA1_uc001ncx.2_Missense_Mutation_p.W1173C	p.W1233C	NM_017749	NP_060219	WXS	Illumina HiSeq	Unspecified	Q9C0C7	AMRA1_HUMAN		GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)	18	4059	-			1233					A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37	c.3699G>T		.	.	.	.	.	.	.	.	.	.	C	16.26	3.073694	0.55646	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.70869	-0.36;-0.52;-0.11;-0.23;-0.11;-0.22;-0.23	4.49	4.49	0.54785	.	0.177595	0.38326	N	0.001734	T	0.61035	0.2315	N	0.08118	0	0.80722	D	1	P;D;D;P;D;P	0.63046	0.934;0.961;0.961;0.932;0.992;0.932	B;B;B;B;P;B	0.50192	0.253;0.437;0.437;0.437;0.634;0.437	T	0.70498	-0.4855	10	0.87932	D	0	.	16.6299	0.85030	0.0:1.0:0.0:0.0	.	1233;1204;1173;1114;1236;1143	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	C	1143;1114;1173;1204;1173;1233;191;1204	ENSP00000318313:W1143C;ENSP00000433372:W1114C;ENSP00000431926:W1173C;ENSP00000410899:W1204C;ENSP00000298834:W1173C;ENSP00000415327:W1233C;ENSP00000433945:W1204C	ENSP00000298834:W1173C	W	-	3	0	AMBRA1	46375774	0.999000	0.42202	1.000000	0.80357	0.838000	0.47535	1.662000	0.37418	2.791000	0.96007	0.561000	0.74099	TGG		0.687	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		17	5	1	0	3.32936e-07	0.006122	4.26784e-07	17	5				
OR4X2	119764	broad.mit.edu	37	11	48267190	48267190	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:48267190C>A	ENST00000302329.3	+	1	583	c.535C>A	c.(535-537)Ctt>Att	p.L179I		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L179I(1)		breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						CCTTCTCAAACTTGCCTGCTC	0.478																																							uc001ngs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)CTT>ATT		olfactory receptor, family 4, subfamily X,							283.0	257.0	266.0					11																	48267190		2201	4298	6499	SO:0001583	missense	119764				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48267190C>A	AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.535C>A	11.37:g.48267190C>A	ENSP00000307751:p.Leu179Ile		Somatic					p.L179I	NM_001004727	NP_001004727	WXS	Illumina HiSeq	Unspecified	Q8NGF9	OR4X2_HUMAN			1	535	+			179			Extracellular (Potential).		B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	ENST00000302329.3	37	c.535C>A	CCDS31486.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793849	0.70452	.	.	ENSG00000172208	ENST00000302329	T	0.00379	7.65	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000181	T	0.00998	0.0033	M	0.82056	2.57	0.30248	N	0.794324	D	0.89917	1.0	D	0.91635	0.999	T	0.20706	-1.0267	10	0.87932	D	0	.	12.3631	0.55215	0.0:0.8301:0.1698:0.0	.	179	Q8NGF9	OR4X2_HUMAN	I	179	ENSP00000307751:L179I	ENSP00000307751:L179I	L	+	1	0	OR4X2	48223766	0.000000	0.05858	1.000000	0.80357	0.853000	0.48598	-0.075000	0.11431	2.496000	0.84212	0.650000	0.86243	CTT		0.478	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383376.2	NM_001004727		87	72	1	0	2.5963e-48	0.01441	5.33219e-48	87	72				
OR8J3	81168	broad.mit.edu	37	11	55904448	55904448	+	Silent	SNP	C	C	A	rs529152876		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:55904448C>A	ENST00000301529.1	-	1	746	c.747G>T	c.(745-747)acG>acT	p.T249T		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T249T(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					CATAGAAAACCGTGACTGCTA	0.398																																							uc010riz.1		NA																	2	Substitution - coding silent(2)		lung(1)|endometrium(1)	skin(2)	2						c.(745-747)ACG>ACT		olfactory receptor, family 8, subfamily J,							131.0	124.0	126.0					11																	55904448		2201	4296	6497	SO:0001819	synonymous_variant	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904448C>A		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.747G>T	11.37:g.55904448C>A			Somatic					p.T249T	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	747	-	Esophageal squamous(21;0.00693)		249			Helical; Name=6; (Potential).		Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	37	c.747G>T	CCDS31520.1																																																																																				0.398	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		29	21	1	0	3.65163e-15	0.00632	5.62469e-15	29	21				
MYRF	745	broad.mit.edu	37	11	61533653	61533653	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:61533653C>A	ENST00000278836.5	+	3	454	c.358C>A	c.(358-360)Ccc>Acc	p.P120T	TMEM258_ENST00000535042.1_5'Flank|MYRF_ENST00000265460.5_Missense_Mutation_p.P111T	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	120	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P111T(1)									GGGCACCGGGCCCCCCATCAA	0.692																																							uc001nsc.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(358-360)CCC>ACC		myelin gene regulatory factor isoform 2							15.0	20.0	18.0					11																	61533653		2063	4104	6167	SO:0001583	missense	745				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:61533653C>A		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.358C>A	11.37:g.61533653C>A	ENSP00000278836:p.Pro120Thr		Somatic				C11orf9_uc001nse.1_Missense_Mutation_p.P111T	p.P120T	NM_001127392	NP_001120864	WXS	Illumina HiSeq	Unspecified	Q9Y2G1	MRF_HUMAN			3	454	+			120			Pro-rich.		O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	c.358C>A	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660768	0.67700	.	.	ENSG00000124920	ENST00000278836;ENST00000265460	T;T	0.33438	1.41;1.47	4.44	4.44	0.53790	.	0.127351	0.52532	D	0.000062	T	0.24547	0.0595	N	0.19112	0.55	0.80722	D	1	B;B	0.15141	0.008;0.012	B;B	0.20955	0.032;0.007	T	0.07693	-1.0759	10	0.56958	D	0.05	-26.6133	17.949	0.89046	0.0:1.0:0.0:0.0	.	111;120	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	T	120;111	ENSP00000278836:P120T;ENSP00000265460:P111T	ENSP00000265460:P111T	P	+	1	0	C11orf9	61290229	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	3.709000	0.54853	2.420000	0.82092	0.561000	0.74099	CCC		0.692	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279		10	20	1	0	1.3612e-06	0.003163	1.69928e-06	10	20				
C11orf30	56946	broad.mit.edu	37	11	76162966	76162966	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:76162966G>T	ENST00000529032.1	+	2	135	c.135G>T	c.(133-135)aaG>aaT	p.K45N	C11orf30_ENST00000343878.3_Missense_Mutation_p.K45N|C11orf30_ENST00000533988.1_Missense_Mutation_p.K45N|C11orf30_ENST00000525919.1_Missense_Mutation_p.K45N|C11orf30_ENST00000334736.3_Missense_Mutation_p.K45N|C11orf30_ENST00000524767.1_Missense_Mutation_p.K45N|C11orf30_ENST00000524490.1_Missense_Mutation_p.K45N|C11orf30_ENST00000525959.1_3'UTR|C11orf30_ENST00000525038.1_Missense_Mutation_p.K45N|C11orf30_ENST00000533248.1_Missense_Mutation_p.K45N			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	45	ENT. {ECO:0000255|PROSITE- ProRule:PRU00476}.|Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.K45N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CCAAGGAAAAGAAAGATCTTC	0.348																																							uc001oxl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(1)	6						c.(133-135)AAG>AAT		EMSY protein							36.0	37.0	37.0					11																	76162966		2200	4292	6492	SO:0001583	missense	56946				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr11:76162966G>T	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.135G>T	11.37:g.76162966G>T	ENSP00000432327:p.Lys45Asn		Somatic				C11orf30_uc001oxj.2_Missense_Mutation_p.K45N|C11orf30_uc001oxk.2_Missense_Mutation_p.K45N|C11orf30_uc009yuj.1_Missense_Mutation_p.K45N|C11orf30_uc010rsa.1_Missense_Mutation_p.K45N|C11orf30_uc001oxm.2_Missense_Mutation_p.K45N|C11orf30_uc010rsb.1_Missense_Mutation_p.K45N|C11orf30_uc010rsc.1_Missense_Mutation_p.K45N|C11orf30_uc001oxn.2_Missense_Mutation_p.K45N|C11orf30_uc010rsd.1_Missense_Mutation_p.K45N	p.K45N	NM_020193	NP_064578	WXS	Illumina HiSeq	Unspecified	Q7Z589	EMSY_HUMAN			3	278	+			45			Interaction with BRCA2.|ENT.		B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	c.135G>T	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743341	0.69418	.	.	ENSG00000158636	ENST00000533988;ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	5.7	4.79	0.61399	EMSY N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.84005	0.5377	M	0.88450	2.955	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;0.999;1.0;0.999;1.0;0.995	D	0.87302	0.2306	9	0.87932	D	0	-7.6152	14.4541	0.67404	0.0703:0.0:0.9297:0.0	.	45;45;45;45;45;45;45;45;45	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;E9PMC9;Q7Z589;B4E1Z2	.;.;.;.;.;.;.;EMSY_HUMAN;.	N	45	.	ENSP00000334130:K45N	K	+	3	2	C11orf30	75840614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.790000	0.69038	1.422000	0.47177	0.557000	0.71058	AAG		0.348	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		17	12	1	0	8.10497e-08	0.010504	1.0531e-07	17	12				
LRRC32	2615	broad.mit.edu	37	11	76372262	76372262	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:76372262G>A	ENST00000407242.2	-	3	617	c.375C>T	c.(373-375)cgC>cgT	p.R125R	LRRC32_ENST00000404995.1_Silent_p.R125R|LRRC32_ENST00000260061.5_Silent_p.R125R|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	125					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.R125R(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGGAGGTCACGCGTGGCAGGG	0.692																																							uc001oxq.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(373-375)CGC>CGT		leucine rich repeat containing 32 precursor							32.0	37.0	36.0					11																	76372262		2200	4291	6491	SO:0001819	synonymous_variant	2615					integral to plasma membrane		g.chr11:76372262G>A	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.375C>T	11.37:g.76372262G>A			Somatic				LRRC32_uc001oxr.3_Silent_p.R125R|LRRC32_uc010rsf.1_Silent_p.R125R	p.R125R	NM_005512	NP_005503	WXS	Illumina HiSeq	Unspecified	Q14392	LRC32_HUMAN			3	618	-			125			Extracellular (Potential).|LRR 4.		Q86V06	Silent	SNP	ENST00000407242.2	37	c.375C>T	CCDS8245.1																																																																																				0.692	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512		32	34	0	0	0	0.017118	0	32	34				
DLG2	1740	broad.mit.edu	37	11	83170879	83170879	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:83170879G>T	ENST00000532653.1	-	23	2843	c.2541C>A	c.(2539-2541)ccC>ccA	p.P847P	DLG2_ENST00000524982.1_Silent_p.P861P|DLG2_ENST00000376106.3_Silent_p.P329P|DLG2_ENST00000426717.2_Silent_p.P329P|DLG2_ENST00000543673.1_Silent_p.P970P|DLG2_ENST00000537455.1_Silent_p.P615P|DLG2_ENST00000418306.2_Silent_p.P744P|DLG2_ENST00000398309.2_Silent_p.P865P|DLG2_ENST00000280241.8_Silent_p.P904P|DLG2_ENST00000376104.2_Silent_p.P970P|DLG2_ENST00000404783.3_Silent_p.P343P|DLG2_ENST00000330014.6_Silent_p.P786P			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	571					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.P744P(1)|p.P865P(1)|p.P970P(1)|p.P904P(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTTCCTTTGAGGGAATCCAGA	0.353																																							uc001paj.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|pancreas(2)|skin(1)	6						c.(2593-2595)CCC>CCA		chapsyn-110 isoform 2							91.0	86.0	87.0					11																	83170879		1829	4082	5911	SO:0001819	synonymous_variant	1740					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding	g.chr11:83170879G>T	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2541C>A	11.37:g.83170879G>T			Somatic				DLG2_uc001pai.2_Silent_p.P744P|DLG2_uc010rsy.1_Silent_p.P814P|DLG2_uc010rsz.1_Silent_p.P861P|DLG2_uc010rta.1_Silent_p.P847P|DLG2_uc001pak.2_Silent_p.P970P|DLG2_uc010rsw.1_Silent_p.P329P|DLG2_uc010rsx.1_Silent_p.P342P	p.P865P	NM_001364	NP_001355	WXS	Illumina HiSeq	Unspecified	Q15700	DLG2_HUMAN			23	2898	-		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)	865					B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	ENST00000532653.1	37	c.2595C>A																																																																																					0.353	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364		19	46	1	0	2.37509e-13	0.010504	3.46292e-13	19	46				
DLG2	1740	broad.mit.edu	37	11	83177805	83177805	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:83177805G>T	ENST00000532653.1	-	21	2608	c.2306C>A	c.(2305-2307)gCc>gAc	p.A769D	DLG2_ENST00000524982.1_Missense_Mutation_p.A783D|DLG2_ENST00000376106.3_Missense_Mutation_p.A251D|DLG2_ENST00000426717.2_Missense_Mutation_p.A251D|DLG2_ENST00000543673.1_Missense_Mutation_p.A892D|DLG2_ENST00000537455.1_Missense_Mutation_p.A537D|DLG2_ENST00000418306.2_Missense_Mutation_p.A666D|DLG2_ENST00000398309.2_Missense_Mutation_p.A787D|DLG2_ENST00000280241.8_Missense_Mutation_p.A826D|DLG2_ENST00000376104.2_Missense_Mutation_p.A892D|DLG2_ENST00000404783.3_Missense_Mutation_p.A265D|DLG2_ENST00000531015.1_Missense_Mutation_p.A754D|DLG2_ENST00000330014.6_Missense_Mutation_p.A708D			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	483					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.A787D(1)|p.A826D(1)|p.A666D(1)|p.A892D(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATAGAGCTGGGCAACTTGTAA	0.433																																							uc001paj.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|pancreas(2)|skin(1)	6						c.(2359-2361)GCC>GAC		chapsyn-110 isoform 2							146.0	143.0	144.0					11																	83177805		1884	4107	5991	SO:0001583	missense	1740					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding	g.chr11:83177805G>T	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2306C>A	11.37:g.83177805G>T	ENSP00000435849:p.Ala769Asp		Somatic				DLG2_uc001pai.2_Missense_Mutation_p.A666D|DLG2_uc010rsy.1_Missense_Mutation_p.A736D|DLG2_uc010rsz.1_Missense_Mutation_p.A783D|DLG2_uc010rta.1_Missense_Mutation_p.A769D|DLG2_uc001pak.2_Missense_Mutation_p.A892D|DLG2_uc010rtb.1_Missense_Mutation_p.A754D|DLG2_uc010rsw.1_Missense_Mutation_p.A251D|DLG2_uc010rsx.1_Missense_Mutation_p.A264D	p.A787D	NM_001364	NP_001355	WXS	Illumina HiSeq	Unspecified	Q15700	DLG2_HUMAN			21	2663	-		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)	787			Guanylate kinase-like.		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37	c.2360C>A		.	.	.	.	.	.	.	.	.	.	G	33	5.270211	0.95429	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.84	5.84	0.93424	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000003	T	0.74935	0.3782	M	0.86740	2.835	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.992;1.0;0.996;1.0;1.0;0.986	D;D;D;D;D;D;D;D	0.97110	0.993;1.0;0.969;0.998;0.97;0.997;0.999;0.92	T	0.76814	-0.2820	9	.	.	.	.	20.1454	0.98074	0.0:0.0:1.0:0.0	.	754;769;783;708;265;892;787;666	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	D	787;251;892;666;892;826;265;708;537;251;783;769;892;754;139	ENSP00000381355:A787D;ENSP00000393049:A251D;ENSP00000365272:A892D;ENSP00000402275:A666D;ENSP00000441994:A892D;ENSP00000280241:A826D;ENSP00000385113:A265D;ENSP00000381353:A708D;ENSP00000443248:A537D;ENSP00000365274:A251D;ENSP00000432894:A783D;ENSP00000435849:A769D;ENSP00000433848:A754D;ENSP00000409133:A139D	.	A	-	2	0	DLG2	82855453	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.748000	0.94277	0.650000	0.86243	GCC		0.433	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364		19	64	1	0	1.45105e-14	0.006122	2.18229e-14	19	64				
TRIM49	57093	broad.mit.edu	37	11	89531774	89531774	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:89531774C>A	ENST00000329758.1	-	8	1211	c.883G>T	c.(883-885)Gaa>Taa	p.E295*	TRIM49_ENST00000532501.2_Nonsense_Mutation_p.E218*	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	295	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.E295*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTGTTGGCTTCTTCATGATGC	0.308																																							uc001pdb.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(883-885)GAA>TAA		ring finger protein 18							30.0	40.0	37.0					11																	89531774		2123	4286	6409	SO:0001587	stop_gained	57093					intracellular	zinc ion binding	g.chr11:89531774C>A	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.883G>T	11.37:g.89531774C>A	ENSP00000327604:p.Glu295*		Somatic					p.E295*	NM_020358	NP_065091	WXS	Illumina HiSeq	Unspecified	P0CI25	TRI49_HUMAN			8	1212	-		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	295			B30.2/SPRY.		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Nonsense_Mutation	SNP	ENST00000329758.1	37	c.883G>T	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	C	9.727	1.161141	0.21538	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	.	.	.	0.539	-1.08	0.09936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	X	295;218	.	.	E	-	1	0	TRIM49	89171422	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.379000	0.07437	-0.371000	0.08004	-1.050000	0.02344	GAA		0.308	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358		8	19	1	0	1.06961e-07	0.00308	1.38038e-07	8	19				
FAT3	120114	broad.mit.edu	37	11	92534753	92534753	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:92534753G>T	ENST00000298047.6	+	9	8591	c.8574G>T	c.(8572-8574)caG>caT	p.Q2858H	FAT3_ENST00000409404.2_Missense_Mutation_p.Q2858H|FAT3_ENST00000525166.1_Missense_Mutation_p.Q2708H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2858	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q2858H(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CGGATTCCCAGCCCGAAAAGG	0.498										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(8572-8574)CAG>CAT		FAT tumor suppressor homolog 3							60.0	61.0	61.0					11																	92534753		1973	4156	6129	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534753G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8574G>T	11.37:g.92534753G>T	ENSP00000298047:p.Gln2858His	TCGA Ovarian(4;0.039)	Somatic					p.Q2858H	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	8591	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2858			Cadherin 26.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.8574G>T		.	.	.	.	.	.	.	.	.	.	G	8.445	0.851699	0.17034	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52295	0.67;0.67;0.67	6.04	0.0579	0.14325	.	.	.	.	.	T	0.34629	0.0904	L	0.52266	1.64	0.58432	D	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.10989	-1.0606	9	0.36615	T	0.2	.	4.1287	0.10139	0.1288:0.0889:0.4503:0.332	.	2858	Q8TDW7-3	.	H	2858;2858;2708	ENSP00000298047:Q2858H;ENSP00000387040:Q2858H;ENSP00000432586:Q2708H	ENSP00000298047:Q2858H	Q	+	3	2	FAT3	92174401	0.423000	0.25482	0.954000	0.39281	0.874000	0.50279	0.545000	0.23268	0.090000	0.17273	0.563000	0.77884	CAG		0.498	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		4	2	1	0	0.00909568	0.009096	0.00954547	4	2				
MMP13	4322	broad.mit.edu	37	11	102816458	102816458	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:102816458A>G	ENST00000260302.3	-	9	1260	c.1232T>C	c.(1231-1233)aTt>aCt	p.I411T	MMP13_ENST00000340273.4_Missense_Mutation_p.I411T	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	411	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I411T(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TTTATCCATAATATGGTTAGT	0.303																																							uc001phl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1231-1233)ATT>ACT		matrix metalloproteinase 13 preproprotein							108.0	110.0	110.0					11																	102816458		2202	4298	6500	SO:0001583	missense	4322				collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding	g.chr11:102816458A>G	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1232T>C	11.37:g.102816458A>G	ENSP00000260302:p.Ile411Thr		Somatic					p.I411T	NM_002427	NP_002418	WXS	Illumina HiSeq	Unspecified	P45452	MMP13_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0144)	9	1260	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	411			Hemopexin-like 3.		A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	c.1232T>C	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	A	7.210	0.595302	0.13875	.	.	ENSG00000137745	ENST00000260302;ENST00000340273	T;T	0.01981	4.52;4.52	6.16	-2.29	0.06805	Hemopexin/matrixin (2);	1.456600	0.03973	N	0.291993	T	0.00784	0.0026	N	0.00517	-1.405	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46400	-0.9194	10	0.19590	T	0.45	.	3.4605	0.07531	0.4273:0.1089:0.3574:0.1064	.	411	P45452	MMP13_HUMAN	T	411	ENSP00000260302:I411T;ENSP00000339672:I411T	ENSP00000260302:I411T	I	-	2	0	MMP13	102321668	0.000000	0.05858	0.001000	0.08648	0.788000	0.44548	-0.144000	0.10280	-0.274000	0.09232	0.528000	0.53228	ATT		0.303	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427		18	42	0	0	0	0.010504	0	18	42				
DDI1	414301	broad.mit.edu	37	11	103907704	103907704	+	Silent	SNP	C	C	A	rs375454517		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:103907704C>A	ENST00000302259.3	+	1	397	c.154C>A	c.(154-156)Cga>Aga	p.R52R	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	52	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.						aspartic-type endopeptidase activity (GO:0004190)	p.R52R(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CCACATGGAGCGACTCCTCAT	0.572																																							uc001phr.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(154-156)CGA>AGA		DDI1, DNA-damage inducible 1, homolog 1							131.0	122.0	125.0					11																	103907704		2202	4299	6501	SO:0001819	synonymous_variant	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103907704C>A		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.154C>A	11.37:g.103907704C>A			Somatic				PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.R52R	NM_001001711	NP_001001711	WXS	Illumina HiSeq	Unspecified	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	397	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	52			Ubiquitin-like.		Q7Z4U6|Q8WTS3	Silent	SNP	ENST00000302259.3	37	c.154C>A	CCDS31660.1																																																																																				0.572	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		62	25	1	0	5.10508e-28	0.01441	9.28639e-28	62	25				
ATM	472	broad.mit.edu	37	11	108153446	108153446	+	Nonsense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:108153446A>T	ENST00000452508.2	+	26	3775	c.3586A>T	c.(3586-3588)Aaa>Taa	p.K1196*	ATM_ENST00000278616.4_Nonsense_Mutation_p.K1196*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1196					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.K1196*(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGTTTTAGAGAAAGTTTCTGA	0.289			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		2	Substitution - Nonsense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(3586-3588)AAA>TAA	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							83.0	87.0	86.0					11																	108153446		2200	4291	6491	SO:0001587	stop_gained	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108153446A>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3586A>T	11.37:g.108153446A>T	ENSP00000388058:p.Lys1196*	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Nonsense_Mutation_p.K1196*	p.K1196*	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	25	3971	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	1196					B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	c.3586A>T	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	39	7.398951	0.98258	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.47	4.32	0.51571	.	0.403314	0.32244	N	0.006375	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	11.236	0.48940	0.8468:0.1532:0.0:0.0	.	.	.	.	X	1196	.	ENSP00000278616:K1196X	K	+	1	0	ATM	107658656	1.000000	0.71417	0.540000	0.28089	0.081000	0.17604	4.137000	0.58010	0.892000	0.36259	0.533000	0.62120	AAA		0.289	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		47	18	0	0	0	0.01441	0	47	18				
TMEM225	338661	broad.mit.edu	37	11	123756006	123756006	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:123756006C>T	ENST00000375026.2	-	1	343	c.127G>A	c.(127-129)Gcc>Acc	p.A43T		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	43					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.A43T(2)		endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						TTCATCTTGGCTCTTTCATCT	0.463																																							uc001pzi.2		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						c.(127-129)GCC>ACC		transmembrane protein 225							159.0	140.0	147.0					11																	123756006		2202	4299	6501	SO:0001583	missense	338661					integral to membrane		g.chr11:123756006C>T	AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.127G>A	11.37:g.123756006C>T	ENSP00000364166:p.Ala43Thr		Somatic					p.A43T	NM_001013743	NP_001013765	WXS	Illumina HiSeq	Unspecified	Q6GV28	TM225_HUMAN			1	335	-			43						Missense_Mutation	SNP	ENST00000375026.2	37	c.127G>A	CCDS31697.1	.	.	.	.	.	.	.	.	.	.	C	3.531	-0.095825	0.07010	.	.	ENSG00000204300	ENST00000375026	T	0.69175	-0.38	4.65	-7.21	0.01490	.	3.750420	0.00582	N	0.000339	T	0.44829	0.1312	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39820	-0.9595	10	0.12103	T	0.63	3.5133	10.6426	0.45602	0.0:0.6089:0.1346:0.2565	.	43	Q6GV28	TM225_HUMAN	T	43	ENSP00000364166:A43T	ENSP00000364166:A43T	A	-	1	0	TMEM225	123261216	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.564000	0.00918	-1.662000	0.01482	-1.004000	0.02495	GCC		0.463	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743		25	46	0	0	0	0.008361	0	25	46				
NANOG	79923	broad.mit.edu	37	12	7942298	7942298	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:7942298G>A	ENST00000229307.4	+	1	307	c.88G>A	c.(88-90)Ggg>Agg	p.G30R	NANOG_ENST00000526286.1_Missense_Mutation_p.G30R	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	30					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.G30R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		TGTGATTTGTGGGCCTGAAGA	0.448																																							uc009zfy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(88-90)GGG>AGG		Nanog homeobox							136.0	128.0	131.0					12																	7942298		2203	4300	6503	SO:0001583	missense	79923				cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:7942298G>A	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.88G>A	12.37:g.7942298G>A	ENSP00000229307:p.Gly30Arg		Somatic					p.G30R	NM_024865	NP_079141	WXS	Illumina HiSeq	Unspecified	Q9H9S0	NANOG_HUMAN		Kidney(36;0.0872)	1	304	+			30					D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	37	c.88G>A	CCDS31736.1	.	.	.	.	.	.	.	.	.	.	.	11.29	1.596061	0.28445	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91068	-2.72;-2.78;-2.77	3.12	0.103	0.14526	.	1.903180	0.02328	N	0.073675	D	0.84615	0.5511	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.64385	-0.6420	10	0.14656	T	0.56	0.3688	3.2484	0.06806	0.2769:0.2411:0.482:0.0	.	30	Q9H9S0	NANOG_HUMAN	R	6;30;30	ENSP00000444434:G6R;ENSP00000229307:G30R;ENSP00000435288:G30R	ENSP00000229307:G30R	G	+	1	0	NANOG	7833565	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	0.385000	0.20685	0.015000	0.14971	0.462000	0.41574	GGG		0.448	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	NM_024865		43	78	0	0	0	0.013114	0	43	78				
PZP	5858	broad.mit.edu	37	12	9305844	9305844	+	Silent	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:9305844C>T	ENST00000261336.2	-	30	3898	c.3870G>A	c.(3868-3870)caG>caA	p.Q1290Q	PZP_ENST00000381997.2_Silent_p.Q1076Q	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1290					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q1076Q(1)|p.Q1290Q(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TAGAAAAGGTCTGTGAATCCT	0.478																																					Melanoma(125;1402 1695 4685 34487 38571)	Melanoma(125;1402 1695 4685 34487 38571)	uc001qvl.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						c.(3868-3870)CAG>CAA		pregnancy-zone protein precursor							131.0	132.0	132.0					12																	9305844		2203	4300	6503	SO:0001819	synonymous_variant	5858							g.chr12:9305844C>T	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3870G>A	12.37:g.9305844C>T			Somatic				PZP_uc009zgl.2_Silent_p.Q1076Q	p.Q1290Q	NM_002864	NP_002855	WXS	Illumina HiSeq	Unspecified					30	3899	-								A6ND27|Q15273|Q2NKL2|Q7M4N7	Silent	SNP	ENST00000261336.2	37	c.3870G>A	CCDS8600.1																																																																																				0.478	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		30	85	0	0	0	0.009535	0	30	85				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		15	10	1	0	1.49906e-05	0.020292	1.76741e-05	15	10				
KMT2D	8085	broad.mit.edu	37	12	49419995	49419995	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:49419995C>A	ENST00000301067.7	-	48	15753	c.15754G>T	c.(15754-15756)Gac>Tac	p.D5252Y		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5252	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.D4982Y(1)|p.D5252Y(1)									AAGACCAGGTCCTCCAGGCCC	0.537																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		2	Substitution - Missense(2)		lung(2)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(15754-15756)GAC>TAC		myeloid/lymphoid or mixed-lineage leukemia 2							69.0	73.0	71.0					12																	49419995		1929	4130	6059	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49419995C>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.15754G>T	12.37:g.49419995C>A	ENSP00000301067:p.Asp5252Tyr	HNSCC(34;0.089)	Somatic					p.D5252Y	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			48	15754	-			5252			FYR C-terminal.		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.15754G>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363954	0.41902	.	.	ENSG00000167548	ENST00000301067	T	0.50001	0.76	5.11	5.11	0.69529	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.38548	N	0.001653	T	0.69771	0.3148	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73534	-0.3952	10	0.87932	D	0	.	17.6991	0.88289	0.0:1.0:0.0:0.0	.	5252	O14686	MLL2_HUMAN	Y	5252	ENSP00000301067:D5252Y	ENSP00000301067:D5252Y	D	-	1	0	MLL2	47706262	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.560000	0.86352	0.650000	0.86243	GAC		0.537	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			10	58	1	0	2.17888e-05	0.006214	2.55316e-05	10	58				
DPY19L2	283417	broad.mit.edu	37	12	64061909	64061909	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:64061909G>T	ENST00000324472.4	-	1	448	c.265C>A	c.(265-267)Ctg>Atg	p.L89M	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	89					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L89M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		AGCTGCGCCAGGGAATTACGG	0.607																																							uc001srp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(265-267)CTG>ATG		dpy-19-like 2							69.0	74.0	73.0					12																	64061909		2203	4300	6503	SO:0001583	missense	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:64061909G>T		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.265C>A	12.37:g.64061909G>T	ENSP00000315988:p.Leu89Met		Somatic				DPY19L2_uc009zqk.1_RNA	p.L89M	NM_173812	NP_776173	WXS	Illumina HiSeq	Unspecified	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	1	446	-			89					A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	c.265C>A	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	9.116	1.007833	0.19199	.	.	ENSG00000177990	ENST00000324472;ENST00000542209	T;T	0.54071	0.59;1.4	1.75	1.75	0.24633	.	.	.	.	.	T	0.36193	0.0958	L	0.32530	0.975	0.24426	N	0.994592	P	0.46395	0.877	B	0.39185	0.293	T	0.13282	-1.0515	8	.	.	.	.	6.9703	0.24644	0.0:0.0:1.0:0.0	.	89	Q6NUT2	D19L2_HUMAN	M	89	ENSP00000315988:L89M;ENSP00000444932:L89M	.	L	-	1	2	DPY19L2	62348176	0.044000	0.20184	0.075000	0.20258	0.173000	0.22820	0.135000	0.15952	1.269000	0.44280	0.195000	0.17529	CTG		0.607	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		74	52	1	0	1.45978e-39	0.01441	2.87441e-39	74	52				
NTN4	59277	broad.mit.edu	37	12	96107067	96107067	+	Missense_Mutation	SNP	T	T	C	rs373667972		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:96107067T>C	ENST00000343702.4	-	4	1362	c.914A>G	c.(913-915)cAg>cGg	p.Q305R	NTN4_ENST00000552603.1_5'Flank|NTN4_ENST00000553059.1_Missense_Mutation_p.Q305R|NTN4_ENST00000344911.4_Missense_Mutation_p.Q268R|NTN4_ENST00000538383.1_Missense_Mutation_p.Q268R	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	305	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)		p.Q305R(1)		NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GGCACAGTGCTGGCAGTGGCT	0.522																																							uc001tei.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(913-915)CAG>CGG		netrin 4 precursor		T	ARG/GLN	1,4405	2.1+/-5.4	0,1,2202	109.0	95.0	100.0		914	5.2	1.0	12		100	0,8600		0,0,4300	no	missense	NTN4	NM_021229.3	43	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	305/629	96107067	1,13005	2203	4300	6503	SO:0001583	missense	59277				axon guidance	basement membrane|plasma membrane		g.chr12:96107067T>C	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.914A>G	12.37:g.96107067T>C	ENSP00000340998:p.Gln305Arg		Somatic				NTN4_uc009ztf.2_Missense_Mutation_p.Q305R|NTN4_uc009ztg.2_Missense_Mutation_p.Q268R	p.Q305R	NM_021229	NP_067052	WXS	Illumina HiSeq	Unspecified	Q9HB63	NET4_HUMAN			4	1363	-			305			Laminin EGF-like 1.		B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Missense_Mutation	SNP	ENST00000343702.4	37	c.914A>G	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741467	0.89573	2.27E-4	0.0	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	5.18	5.18	0.71444	EGF-like, laminin (3);	0.052584	0.64402	D	0.000001	T	0.68888	0.3050	M	0.85373	2.75	0.48975	D	0.999733	P;P	0.45715	0.865;0.814	P;P	0.47015	0.503;0.534	T	0.76244	-0.3030	10	0.87932	D	0	.	15.0234	0.71650	0.0:0.0:0.0:1.0	.	305;305	Q9HB63-2;Q9HB63	.;NET4_HUMAN	R	305;268;268;305	ENSP00000340998:Q305R;ENSP00000339436:Q268R;ENSP00000444432:Q268R;ENSP00000447292:Q305R	ENSP00000340998:Q305R	Q	-	2	0	NTN4	94631198	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	5.977000	0.70492	1.964000	0.57103	0.402000	0.26972	CAG		0.522	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229		11	38	0	0	0	0.010729	0	11	38				
RASAL1	8437	broad.mit.edu	37	12	113554954	113554954	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr12:113554954G>T	ENST00000261729.5	-	9	970	c.655C>A	c.(655-657)Cca>Aca	p.P219T	RASAL1_ENST00000446861.3_Missense_Mutation_p.P219T|RASAL1_ENST00000546530.1_Missense_Mutation_p.P219T|RASAL1_ENST00000548055.1_Missense_Mutation_p.P219T|RASAL1_ENST00000418411.2_5'UTR			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	219					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.P219T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AGGGTCTTTGGAGAGAACTCC	0.612																																							uc001tum.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(655-657)CCA>ACA		RAS protein activator like 1							50.0	47.0	48.0					12																	113554954		2203	4300	6503	SO:0001583	missense	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113554954G>T	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.655C>A	12.37:g.113554954G>T	ENSP00000261729:p.Pro219Thr		Somatic				RASAL1_uc010syp.1_Missense_Mutation_p.P219T|RASAL1_uc001tul.2_Missense_Mutation_p.P219T|RASAL1_uc001tun.1_Missense_Mutation_p.P219T|RASAL1_uc010syq.1_Missense_Mutation_p.P219T|RASAL1_uc001tuo.3_Missense_Mutation_p.P219T|RASAL1_uc010syr.1_Missense_Mutation_p.P219T	p.P219T	NM_004658	NP_004649	WXS	Illumina HiSeq	Unspecified	O95294	RASL1_HUMAN			9	948	-			219					B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	c.655C>A	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	G	4.579	0.107632	0.08780	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.58	3.72	0.42706	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.523547	0.21102	N	0.080158	T	0.74152	0.3679	L	0.60455	1.87	0.09310	N	0.999992	B;B;B;B;B;B;P	0.36315	0.282;0.215;0.404;0.411;0.074;0.286;0.547	B;B;B;B;B;B;B	0.38755	0.146;0.103;0.281;0.146;0.173;0.184;0.168	T	0.68880	-0.5292	10	0.62326	D	0.03	.	3.3995	0.07317	0.1393:0.1405:0.5755:0.1447	.	219;219;219;231;219;219;219	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	T	219	ENSP00000450244:P219T;ENSP00000261729:P219T;ENSP00000395920:P219T;ENSP00000448510:P219T	ENSP00000261729:P219T	P	-	1	0	RASAL1	112039337	0.967000	0.33354	0.931000	0.37212	0.220000	0.24768	0.608000	0.24223	1.322000	0.45245	0.655000	0.94253	CCA		0.612	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		25	16	1	0	1.2476e-16	0.00632	1.95321e-16	25	16				
NUFIP1	26747	broad.mit.edu	37	13	45523952	45523952	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr13:45523952G>T	ENST00000379161.4	-	8	1089	c.1043C>A	c.(1042-1044)cCa>cAa	p.P348Q		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	348					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)	p.P348Q(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		AGAATGTTGTGGTTTCTCCTC	0.448																																							uc001uzp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1042-1044)CCA>CAA		nuclear fragile X mental retardation protein							190.0	160.0	170.0					13																	45523952		2203	4300	6503	SO:0001583	missense	26747				box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding	g.chr13:45523952G>T	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1043C>A	13.37:g.45523952G>T	ENSP00000368459:p.Pro348Gln		Somatic					p.P348Q	NM_012345	NP_036477	WXS	Illumina HiSeq	Unspecified	Q9UHK0	NUFP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)	8	1085	-		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	348					Q8WVM5|Q96SG1	Missense_Mutation	SNP	ENST00000379161.4	37	c.1043C>A	CCDS9393.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366570	0.61513	.	.	ENSG00000083635	ENST00000379161	T	0.49139	0.79	5.93	5.93	0.95920	.	0.476190	0.24251	N	0.040163	T	0.57873	0.2083	M	0.74258	2.255	0.26236	N	0.978943	D	0.54397	0.966	P	0.50440	0.641	T	0.56517	-0.7966	10	0.25106	T	0.35	-1.9826	15.8405	0.78842	0.0:0.0:1.0:0.0	.	348	Q9UHK0	NUFP1_HUMAN	Q	348	ENSP00000368459:P348Q	ENSP00000368459:P348Q	P	-	2	0	NUFIP1	44421952	0.354000	0.24912	0.930000	0.37139	0.853000	0.48598	1.511000	0.35801	2.812000	0.96745	0.637000	0.83480	CCA		0.448	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345		3	33	1	0	0.004672	0.004672	0.00498521	3	33				
TMEM255B	348013	broad.mit.edu	37	13	114507949	114507949	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr13:114507949G>T	ENST00000375353.3	+	8	788	c.761G>T	c.(760-762)cGc>cTc	p.R254L	TMEM255B_ENST00000467169.1_3'UTR	NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B	254						integral component of membrane (GO:0016021)		p.R254L(1)									GCAGGCTTCCGCCTGACGCCC	0.677																																							uc001vuh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(760-762)CGC>CTC		family with sequence similarity 70, member B							65.0	64.0	64.0					13																	114507949		2202	4300	6502	SO:0001583	missense	348013					integral to membrane		g.chr13:114507949G>T	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.761G>T	13.37:g.114507949G>T	ENSP00000364502:p.Arg254Leu		Somatic					p.R254L	NM_182614	NP_872420	WXS	Illumina HiSeq	Unspecified	Q8WV15	FA70B_HUMAN	all cancers(43;0.181)		8	788	+	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	254						Missense_Mutation	SNP	ENST00000375353.3	37	c.761G>T	CCDS45071.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615977	0.28801	.	.	ENSG00000184497	ENST00000375353	T	0.41400	1.0	4.46	3.59	0.41128	.	.	.	.	.	T	0.34513	0.0900	L	0.51422	1.61	0.24914	N	0.992025	B	0.27997	0.197	B	0.25614	0.062	T	0.15694	-1.0428	9	0.12103	T	0.63	-14.1107	12.2736	0.54721	0.0917:0.0:0.9083:0.0	.	254	Q8WV15	FA70B_HUMAN	L	254	ENSP00000364502:R254L	ENSP00000364502:R254L	R	+	2	0	FAM70B	113605994	1.000000	0.71417	0.379000	0.26080	0.003000	0.03518	5.103000	0.64578	2.190000	0.69967	0.543000	0.68304	CGC		0.677	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045953.4	NM_182614		36	7	1	0	6.2361e-21	0.007835	1.01803e-20	36	7				
MYH7	4625	broad.mit.edu	37	14	23894904	23894904	+	Splice_Site	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr14:23894904C>G	ENST00000355349.3	-	20	2448	c.2286G>C	c.(2284-2286)aaG>aaC	p.K762N		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	762	Actin-binding.|Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.K762N(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTTCCTCACCTTGGTGTGGC	0.448																																							uc001wjx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2284-2286)AAG>AAC		myosin, heavy chain 7, cardiac muscle, beta							111.0	101.0	105.0					14																	23894904		2203	4300	6503	SO:0001630	splice_region_variant	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23894904C>G	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2286+1G>C	14.37:g.23894904C>G			Somatic					p.K762N	NM_000257	NP_000248	WXS	Illumina HiSeq	Unspecified	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	20	2392	-	all_cancers(95;2.54e-05)		762			Actin-binding.|Myosin head-like.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.2286G>C	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807096	0.90623	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.92048	-2.96	4.88	4.88	0.63580	Myosin head, motor domain (2);	.	.	.	.	D	0.98182	0.9399	H	0.99764	4.76	0.80722	D	1	D	0.76494	0.999	D	0.97110	1.0	D	0.99811	1.1041	8	.	.	.	.	18.2206	0.89901	0.0:1.0:0.0:0.0	.	762	P12883	MYH7_HUMAN	N	762	ENSP00000347507:K762N	.	K	-	3	2	MYH7	22964744	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.324000	0.79115	2.531000	0.85337	0.655000	0.94253	AAG		0.448	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	Missense_Mutation	34	60	0	0	0	0.017118	0	34	60				
SEC23A	10484	broad.mit.edu	37	14	39560913	39560913	+	Missense_Mutation	SNP	C	C	A	rs148560912	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr14:39560913C>A	ENST00000307712.6	-	5	888	c.371G>T	c.(370-372)gGt>gTt	p.G124V	SEC23A_ENST00000537403.1_5'Flank|SEC23A_ENST00000545328.2_Missense_Mutation_p.G95V|SEC23A_ENST00000536508.1_5'UTR	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	124					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.G124V(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CATCTGAGGACCACGCTTTTA	0.343													C|||	5	0.000998403	0.0038	0.0	5008	,	,		18165	0.0		0.0	False		,,,				2504	0.0						uc001wup.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)	5						c.(370-372)GGT>GTT		SEC23-related protein A		C	VAL/GLY	2,4404	4.2+/-10.8	0,2,2201	62.0	61.0	62.0		371	5.6	1.0	14	dbSNP_134	62	0,8600		0,0,4300	no	missense	SEC23A	NM_006364.2	109	0,2,6501	AA,AC,CC		0.0,0.0454,0.0154	benign	124/766	39560913	2,13004	2203	4300	6503	SO:0001583	missense	10484				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding	g.chr14:39560913C>A	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.371G>T	14.37:g.39560913C>A	ENSP00000306881:p.Gly124Val		Somatic				SEC23A_uc010tqa.1_5'UTR|SEC23A_uc010tqb.1_Missense_Mutation_p.G95V|SEC23A_uc010tqc.1_5'UTR	p.G124V	NM_006364	NP_006355	WXS	Illumina HiSeq	Unspecified	Q15436	SC23A_HUMAN	Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)	5	594	-	Hepatocellular(127;0.213)		124					B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	c.371G>T	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348757	0.41599	4.54E-4	0.0	ENSG00000100934	ENST00000307712;ENST00000545328;ENST00000555017;ENST00000556092	D;D;D;D	0.87491	-2.26;-2.19;-1.67;-1.65	5.6	5.6	0.85130	Zinc finger, Sec23/Sec24-type (1);	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	L	0.41961	1.31	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.78802	-0.2061	10	0.41790	T	0.15	-17.7477	19.612	0.95610	0.0:1.0:0.0:0.0	.	95;124	F5H365;Q15436	.;SC23A_HUMAN	V	124;95;124;124	ENSP00000306881:G124V;ENSP00000445393:G95V;ENSP00000450819:G124V;ENSP00000451230:G124V	ENSP00000306881:G124V	G	-	2	0	SEC23A	38630664	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	7.744000	0.85034	2.632000	0.89209	0.563000	0.77884	GGT		0.343	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			35	34	1	0	9.45814e-24	0.021022	1.64228e-23	35	34				
NEMF	9147	broad.mit.edu	37	14	50272777	50272777	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr14:50272777G>T	ENST00000298310.5	-	19	2268	c.1819C>A	c.(1819-1821)Cga>Aga	p.R607R	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Silent_p.R586R|NEMF_ENST00000545773.1_Silent_p.R565R			O60524	NEMF_HUMAN	nuclear export mediator factor	607					nuclear export (GO:0051168)	nucleus (GO:0005634)		p.R607R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						GTGATAACTCGTGCATCCCAA	0.448																																							uc001wxc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1819-1821)CGA>AGA		serologically defined colon cancer antigen 1							115.0	97.0	103.0					14																	50272777		2203	4300	6503	SO:0001819	synonymous_variant	9147					cytoplasm|nucleus		g.chr14:50272777G>T	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1819C>A	14.37:g.50272777G>T			Somatic				SDCCAG1_uc010anj.1_Silent_p.R607R|SDCCAG1_uc010tqi.1_Silent_p.R586R|SDCCAG1_uc001wxe.2_Silent_p.R565R|SDCCAG1_uc001wxd.1_Silent_p.R12R	p.R607R	NM_004713	NP_004704	WXS	Illumina HiSeq	Unspecified	O60524	NEMF_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)	19	1887	-	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)	607					A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Silent	SNP	ENST00000298310.5	37	c.1819C>A	CCDS9694.1																																																																																				0.448	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713		24	20	1	0	9.90768e-06	0.004656	1.19017e-05	24	20				
ACOT2	10965	broad.mit.edu	37	14	74036534	74036534	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr14:74036534G>C	ENST00000238651.5	+	1	772	c.590G>C	c.(589-591)cGg>cCg	p.R197P	ACOT2_ENST00000538782.1_Intron	NM_006821.5	NP_006812.3	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	197					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.R197P(1)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		CCCGGGGTGCGGCGCGAGCCG	0.697																																							uc001xon.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(589-591)CGG>CCG		acyl-CoA thioesterase 2							6.0	6.0	6.0					14																	74036534		1752	3599	5351	SO:0001583	missense	10965				acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding	g.chr14:74036534G>C	AY005822, AK001939	CCDS9816.1	14q24.3	2013-09-20			ENSG00000119673	ENSG00000119673		"""Acyl CoA thioesterases"""	18431	protein-coding gene	gene with protein product	"""mitochondrial acyl-CoA thioesterase 1"""	609972				16103133, 16940157	Standard	NM_006821		Approved	Mte1, ZAP128	uc001xon.5	P49753	OTTHUMG00000171608	ENST00000238651.5:c.590G>C	14.37:g.74036534G>C	ENSP00000238651:p.Arg197Pro		Somatic				ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	p.R197P	NM_006821	NP_006812	WXS	Illumina HiSeq	Unspecified	P49753	ACOT2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)	1	763	+			197					Q3I5F8|Q53EK4|Q9NUX4	Missense_Mutation	SNP	ENST00000238651.5	37	c.590G>C	CCDS9816.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443441	0.25987	.	.	ENSG00000119673	ENST00000238651	T	0.71461	-0.57	3.38	3.38	0.38709	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	0.181292	0.42172	D	0.000758	T	0.76350	0.3975	M	0.90252	3.1	0.41564	D	0.988646	P	0.38048	0.616	B	0.42245	0.381	T	0.80605	-0.1308	10	0.87932	D	0	-10.4856	9.098	0.36651	0.1055:0.0:0.8945:0.0	.	197	P49753	ACOT2_HUMAN	P	197	ENSP00000238651:R197P	ENSP00000238651:R197P	R	+	2	0	ACOT2	73106287	0.476000	0.25901	0.958000	0.39756	0.044000	0.14063	0.541000	0.23207	1.587000	0.49959	0.313000	0.20887	CGG		0.697	ACOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414435.1	NM_006821		13	7	0	0	0	0.016723	0	13	7				
OR4M2	390538	broad.mit.edu	37	15	22369186	22369186	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr15:22369186G>T	ENST00000332663.2	+	1	709	c.611G>T	c.(610-612)gGt>gTt	p.G204V	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G204V(1)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGTAGTAGTGGTCTGATCTCT	0.468																																							uc010tzu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(610-612)GGT>GTT		olfactory receptor, family 4, subfamily M,							602.0	415.0	479.0					15																	22369186		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369186G>T	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.611G>T	15.37:g.22369186G>T	ENSP00000329467:p.Gly204Val		Somatic				LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.G204V	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	611	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	204			Helical; Name=5; (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.611G>T	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	14.79	2.639859	0.47153	.	.	ENSG00000182974	ENST00000332663	T	0.33865	1.39	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000107	T	0.48768	0.1518	L	0.54863	1.705	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.48636	-0.9018	10	0.87932	D	0	-8.1112	6.6792	0.23111	0.0:0.0:0.7179:0.2821	.	204	Q8NGB6	OR4M2_HUMAN	V	204	ENSP00000329467:G204V	ENSP00000329467:G204V	G	+	2	0	OR4M2	19870550	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.040000	0.57333	1.422000	0.47177	0.448000	0.29417	GGT		0.468	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			77	30	1	0	2.02726e-29	0.01441	3.79615e-29	77	30				
TMOD3	29766	broad.mit.edu	37	15	52188673	52188673	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr15:52188673G>A	ENST00000308580.7	+	7	966	c.685G>A	c.(685-687)Gtg>Atg	p.V229M	RP11-56B16.5_ENST00000558142.1_RNA|TMOD3_ENST00000544199.1_Missense_Mutation_p.V229M	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	229						striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)	p.V229M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		CAACACACATGTGAAATGTTT	0.383																																					Colon(122;1837 2251 18387 22826)	Colon(122;1837 2251 18387 22826)	uc002abm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(685-687)GTG>ATG		tropomodulin 3 (ubiquitous)							111.0	107.0	108.0					15																	52188673		2195	4293	6488	SO:0001583	missense	29766					cytoplasm|cytoskeleton	actin binding|tropomyosin binding	g.chr15:52188673G>A	AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.685G>A	15.37:g.52188673G>A	ENSP00000308753:p.Val229Met		Somatic				TMOD3_uc010bfc.1_RNA	p.V229M	NM_014547	NP_055362	WXS	Illumina HiSeq	Unspecified	Q9NYL9	TMOD3_HUMAN		all cancers(107;0.00194)	7	904	+			229					B2R6G7|Q9NT43|Q9NZR0	Missense_Mutation	SNP	ENST00000308580.7	37	c.685G>A	CCDS10145.1	.	.	.	.	.	.	.	.	.	.	G	32	5.136009	0.94517	.	.	ENSG00000138594	ENST00000308580;ENST00000544199	T;T	0.20200	2.09;2.09	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.52709	0.1751	M	0.84511	2.7	0.80722	D	1	D	0.65815	0.995	D	0.66084	0.941	T	0.57435	-0.7812	10	0.87932	D	0	-16.5314	19.9801	0.97322	0.0:0.0:1.0:0.0	.	229	Q9NYL9	TMOD3_HUMAN	M	229	ENSP00000308753:V229M;ENSP00000438909:V229M	ENSP00000308753:V229M	V	+	1	0	TMOD3	49975965	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.950000	0.87804	2.797000	0.96272	0.655000	0.94253	GTG		0.383	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254740.3			24	34	0	0	0	0.021523	0	24	34				
PCSK6	5046	broad.mit.edu	37	15	101865129	101865129	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr15:101865129C>T	ENST00000348070.1	-	18	2299	c.2300G>A	c.(2299-2301)cGc>cAc	p.R767H	PCSK6_ENST00000358417.3_Missense_Mutation_p.R754H|PCSK6_ENST00000561177.1_5'UTR	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	768	CRM (Cys-rich motif).				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.R767H(2)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAACCCGCGGCGGCAAGACAG	0.567																																							uc002bwy.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)	2						c.(2302-2304)CGC>CAC		paired basic amino acid cleaving system 4							49.0	55.0	53.0					15																	101865129		2034	4174	6208	SO:0001583	missense	5046				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity	g.chr15:101865129C>T		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.2300G>A	15.37:g.101865129C>T	ENSP00000305056:p.Arg767His		Somatic				PCSK6_uc010bpd.2_Missense_Mutation_p.R564H|PCSK6_uc010bpe.2_Missense_Mutation_p.R755H|PCSK6_uc002bxa.2_Missense_Mutation_p.R768H|PCSK6_uc002bxb.2_Missense_Mutation_p.R755H	p.R768H	NM_002570	NP_002561	WXS	Illumina HiSeq	Unspecified	P29122	PCSK6_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		18	2617	-	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		768			CRM (Cys-rich motif).		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37	c.2303G>A		.	.	.	.	.	.	.	.	.	.	C	17.08	3.297001	0.60086	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185	T;D	0.86297	1.53;-2.1	5.21	5.21	0.72293	Growth factor, receptor (1);	0.660669	0.15240	N	0.272951	D	0.89245	0.6660	L	0.43152	1.355	0.80722	D	1	B;D;D;P;P	0.89917	0.148;0.977;1.0;0.72;0.544	B;P;D;B;B	0.65773	0.007;0.579;0.938;0.125;0.082	D	0.87084	0.2168	10	0.44086	T	0.13	-39.0193	9.8163	0.40853	0.0:0.9061:0.0:0.0939	.	768;599;755;768;754	P29122;Q59H04;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.	H	767;754;598	ENSP00000305056:R767H;ENSP00000351193:R754H	ENSP00000305056:R767H	R	-	2	0	PCSK6	99682652	0.986000	0.35501	1.000000	0.80357	0.989000	0.77384	2.588000	0.46137	2.410000	0.81850	0.561000	0.74099	CGC		0.567	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570		7	30	0	0	0	0.00308	0	7	30				
ABCA3	21	broad.mit.edu	37	16	2338079	2338079	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:2338079C>A	ENST00000301732.5	-	21	3652	c.2952G>T	c.(2950-2952)gaG>gaT	p.E984D	ABCA3_ENST00000382381.3_Missense_Mutation_p.E926D	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	984					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.E984D(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CTTTCAGATGCTCTGACAGCT	0.677																																							uc002cpy.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16						c.(2950-2952)GAG>GAT		ATP-binding cassette, sub-family A member 3							44.0	40.0	41.0					16																	2338079		2198	4300	6498	SO:0001583	missense	21				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:2338079C>A	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2952G>T	16.37:g.2338079C>A	ENSP00000301732:p.Glu984Asp		Somatic				ABCA3_uc010bsk.1_Missense_Mutation_p.E926D	p.E984D	NM_001089	NP_001080	WXS	Illumina HiSeq	Unspecified	Q99758	ABCA3_HUMAN			21	3664	-		Ovarian(90;0.17)	984					B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	c.2952G>T	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.346842	0.24426	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.87103	-2.21	5.27	3.21	0.36854	.	0.118436	0.64402	D	0.000014	T	0.75042	0.3796	N	0.25094	0.71	0.80722	D	1	B;B	0.18013	0.006;0.025	B;B	0.21360	0.021;0.034	T	0.67329	-0.5698	10	0.30854	T	0.27	.	5.8057	0.18438	0.16:0.66:0.0:0.18	.	988;984	Q4LE27;Q99758	.;ABCA3_HUMAN	D	984;988	ENSP00000301732:E984D	ENSP00000301732:E984D	E	-	3	2	ABCA3	2278080	0.902000	0.30710	0.433000	0.26760	0.941000	0.58515	0.171000	0.16685	1.459000	0.47892	0.655000	0.94253	GAG		0.677	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		5	7	1	0	1.23904e-05	0.014758	1.46992e-05	5	7				
OR2C1	4993	broad.mit.edu	37	16	3406340	3406340	+	Missense_Mutation	SNP	G	G	A	rs147461021	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:3406340G>A	ENST00000304936.2	+	1	452	c.400G>A	c.(400-402)Gcc>Acc	p.A134T		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	134					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A134T(1)		kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CCGCTACACCGCCATCATGAA	0.612																																							uc002cuw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(400-402)GCC>ACC		olfactory receptor, family 2, subfamily C,			THR/ALA	2,4392	4.2+/-10.8	0,2,2195	39.0	38.0	38.0		400	1.0	0.0	16	dbSNP_134	38	0,8600		0,0,4300	yes	missense	OR2C1	NM_012368.2	58	0,2,6495	AA,AG,GG		0.0,0.0455,0.0154	benign	134/313	3406340	2,12992	2197	4300	6497	SO:0001583	missense	4993				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr16:3406340G>A	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.400G>A	16.37:g.3406340G>A	ENSP00000307726:p.Ala134Thr		Somatic					p.A134T	NM_012368	NP_036500	WXS	Illumina HiSeq	Unspecified	O95371	OR2C1_HUMAN			1	452	+			134			Cytoplasmic (Potential).		A0AVA4|Q6IF34|Q6IF55	Missense_Mutation	SNP	ENST00000304936.2	37	c.400G>A	CCDS10502.1	.	.	.	.	.	.	.	.	.	.	g	0.595	-0.831251	0.02713	4.55E-4	0.0	ENSG00000168158	ENST00000304936	T	0.01981	4.52	4.63	1.01	0.19927	GPCR, rhodopsin-like superfamily (1);	0.763586	0.11112	N	0.598385	T	0.00998	0.0033	N	0.02202	-0.64	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48885	-0.8995	10	0.26408	T	0.33	.	4.1262	0.10128	0.6733:0.0:0.1755:0.1512	.	134	O95371	OR2C1_HUMAN	T	134	ENSP00000307726:A134T	ENSP00000307726:A134T	A	+	1	0	OR2C1	3346341	0.000000	0.05858	0.008000	0.14137	0.116000	0.19942	-1.495000	0.02294	-0.001000	0.14495	-0.424000	0.05967	GCC		0.612	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206993.3			14	27	0	0	0	0.007413	0	14	27				
C16orf71	146562	broad.mit.edu	37	16	4790576	4790576	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:4790576G>A	ENST00000299320.5	+	4	1177	c.699G>A	c.(697-699)gcG>gcA	p.A233A	C16orf71_ENST00000590191.1_Silent_p.A247A|RP11-127I20.7_ENST00000588099.1_RNA	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	233								p.A233A(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						TGAAGGAGGCGCCCTGCCACG	0.637																																							uc002cxn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(697-699)GCG>GCA		hypothetical protein LOC146562							35.0	34.0	35.0					16																	4790576		2197	4300	6497	SO:0001819	synonymous_variant	146562							g.chr16:4790576G>A	AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.699G>A	16.37:g.4790576G>A			Somatic					p.A233A	NM_139170	NP_631909	WXS	Illumina HiSeq	Unspecified	Q8IYS4	CP071_HUMAN			4	1161	+			233					Q8NCV0	Silent	SNP	ENST00000299320.5	37	c.699G>A	CCDS10521.1																																																																																				0.637	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1	NM_139170		10	16	0	0	0	0.010729	0	10	16				
ABCC11	85320	broad.mit.edu	37	16	48256677	48256677	+	Silent	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:48256677C>A	ENST00000394747.1	-	5	958	c.609G>T	c.(607-609)gtG>gtT	p.V203V	ABCC11_ENST00000537808.1_Silent_p.V203V|ABCC11_ENST00000394748.1_Silent_p.V203V|ABCC11_ENST00000353782.5_Silent_p.V203V|ABCC11_ENST00000356608.2_Silent_p.V203V	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	203	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.V203V(2)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AGCAGAGTCCCACTCCATGGA	0.458																																							uc002eff.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(607-609)GTG>GTT		ATP-binding cassette, sub-family C, member 11							101.0	96.0	98.0					16																	48256677		2200	4300	6500	SO:0001819	synonymous_variant	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48256677C>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.609G>T	16.37:g.48256677C>A			Somatic				ABCC11_uc002efg.1_Silent_p.V203V|ABCC11_uc002efh.1_Silent_p.V203V|ABCC11_uc010vgl.1_Silent_p.V203V	p.V203V	NM_033151	NP_149163	WXS	Illumina HiSeq	Unspecified	Q96J66	ABCCB_HUMAN			5	959	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	203			ABC transmembrane type-1 1.|Helical; (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	c.609G>T	CCDS10732.1																																																																																				0.458	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		9	23	1	0	3.86212e-05	0.008291	4.44376e-05	9	23				
PLEKHG4	25894	broad.mit.edu	37	16	67322099	67322099	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:67322099G>T	ENST00000360461.5	+	19	5785	c.3250G>T	c.(3250-3252)Gcc>Tcc	p.A1084S	PLEKHG4_ENST00000450733.1_Missense_Mutation_p.A1003S|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.A1084S|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.A1084S	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	1084							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1084S(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CATTGCCGTAGCCCCGTTTGA	0.607																																							uc002eso.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)|pancreas(1)	2						c.(3250-3252)GCC>TCC		pleckstrin homology domain containing, family G							112.0	110.0	111.0					16																	67322099		2198	4300	6498	SO:0001583	missense	25894				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr16:67322099G>T	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.3250G>T	16.37:g.67322099G>T	ENSP00000353646:p.Ala1084Ser		Somatic				PLEKHG4_uc002esp.3_Missense_Mutation_p.A891S|PLEKHG4_uc002esq.3_Missense_Mutation_p.A1084S|PLEKHG4_uc010cef.2_Missense_Mutation_p.A1084S|PLEKHG4_uc002ess.3_Missense_Mutation_p.A1084S|PLEKHG4_uc010ceg.2_Missense_Mutation_p.A1003S	p.A1084S	NM_015432	NP_056247	WXS	Illumina HiSeq	Unspecified	Q58EX7	PKHG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)	19	5785	+			1084					Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	37	c.3250G>T	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	G	1.720	-0.496766	0.04291	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	4.95	3.93	0.45458	.	.	.	.	.	T	0.12817	0.0311	N	0.04746	-0.17	0.29865	N	0.827349	B;B	0.16166	0.016;0.016	B;B	0.17979	0.02;0.009	T	0.14200	-1.0481	9	0.02654	T	1	.	9.8526	0.41066	0.0:0.0:0.5823:0.4177	.	1003;1084	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	S	1084;1084;1084;1003	ENSP00000353646:A1084S;ENSP00000401118:A1084S;ENSP00000368649:A1084S;ENSP00000398030:A1003S	ENSP00000353646:A1084S	A	+	1	0	PLEKHG4	65879600	1.000000	0.71417	0.970000	0.41538	0.115000	0.19883	4.407000	0.59754	2.296000	0.77279	0.462000	0.41574	GCC		0.607	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432		18	61	1	0	1.01871e-10	0.008871	1.37024e-10	18	61				
IRF8	3394	broad.mit.edu	37	16	85946755	85946755	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr16:85946755A>G	ENST00000268638.5	+	5	888	c.466A>G	c.(466-468)Atg>Gtg	p.M156V	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	156					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.M156V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GGACGATTACATGGGGATGAT	0.602																																							uc002fjh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(466-468)ATG>GTG		interferon regulatory factor 8							115.0	121.0	119.0					16																	85946755		2198	4300	6498	SO:0001583	missense	3394				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:85946755A>G	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.466A>G	16.37:g.85946755A>G	ENSP00000268638:p.Met156Val		Somatic				IRF8_uc010chp.2_Intron	p.M156V	NM_002163	NP_002154	WXS	Illumina HiSeq	Unspecified	Q02556	IRF8_HUMAN			5	523	+		Prostate(104;0.0771)	156					A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	c.466A>G	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	A	9.923	1.212742	0.22289	.	.	ENSG00000140968	ENST00000268638	D	0.96619	-4.07	4.86	0.523	0.17060	.	0.593662	0.19398	N	0.115259	D	0.92182	0.7521	L	0.53249	1.67	0.80722	D	1	B	0.10296	0.003	B	0.14578	0.011	T	0.82806	-0.0275	10	0.11794	T	0.64	-25.0436	8.0085	0.30340	0.3184:0.5769:0.1047:0.0	.	156	Q02556	IRF8_HUMAN	V	156	ENSP00000268638:M156V	ENSP00000268638:M156V	M	+	1	0	IRF8	84504256	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	1.175000	0.31944	0.259000	0.21709	-0.366000	0.07423	ATG		0.602	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		32	60	0	0	0	0.021022	0	32	60				
SPNS3	201305	broad.mit.edu	37	17	4337281	4337281	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:4337281G>T	ENST00000355530.2	+	1	299	c.19G>T	c.(19-21)Gcg>Tcg	p.A7S	SPNS3_ENST00000576069.1_3'UTR|SPNS3_ENST00000333476.2_5'UTR	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	7					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.A7S(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GGGGATGTCAGCGGAGTGCCC	0.667																																							uc002fxt.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(19-21)GCG>TCG		spinster homolog 3							20.0	21.0	20.0					17																	4337281		2201	4295	6496	SO:0001583	missense	201305				lipid transport|transmembrane transport	integral to membrane		g.chr17:4337281G>T		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.19G>T	17.37:g.4337281G>T	ENSP00000347721:p.Ala7Ser		Somatic				SPNS3_uc002fxu.2_5'UTR	p.A7S	NM_182538	NP_872344	WXS	Illumina HiSeq	Unspecified	Q6ZMD2	SPNS3_HUMAN			1	63	+			7					Q8IZ31	Missense_Mutation	SNP	ENST00000355530.2	37	c.19G>T	CCDS11045.1	.	.	.	.	.	.	.	.	.	.	G	9.091	1.001776	0.19121	.	.	ENSG00000182557	ENST00000355530	T	0.14022	2.54	4.16	-3.53	0.04667	Major facilitator superfamily domain, general substrate transporter (1);	1.678070	0.02839	N	0.127684	T	0.06005	0.0156	N	0.08118	0	0.09310	N	0.99999	B	0.19331	0.035	B	0.19946	0.027	T	0.30937	-0.9961	10	0.09084	T	0.74	3.4588	5.7074	0.17915	0.5836:0.157:0.2593:0.0	.	7	Q6ZMD2	SPNS3_HUMAN	S	7	ENSP00000347721:A7S	ENSP00000347721:A7S	A	+	1	0	SPNS3	4284030	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.229000	0.09098	-0.596000	0.05821	-0.150000	0.13652	GCG		0.667	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538		6	8	1	0	8.12818e-05	0.001984	9.13225e-05	6	8				
PIK3R5	23533	broad.mit.edu	37	17	8791618	8791618	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:8791618C>T	ENST00000447110.1	-	10	1610	c.1486G>A	c.(1486-1488)Gct>Act	p.A496T	PIK3R5_ENST00000584803.1_Missense_Mutation_p.A496T|PIK3R5_ENST00000581552.1_Missense_Mutation_p.A496T	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	496					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)	p.A496T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GGGCGTGAAGCAGGGGCCAGA	0.662																																					NSCLC(18;589 615 7696 20311 50332)	NSCLC(18;589 615 7696 20311 50332)	uc002glt.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(1486-1488)GCT>ACT		phosphoinositide-3-kinase, regulatory subunit 5							32.0	36.0	34.0					17																	8791618		2203	4300	6503	SO:0001583	missense	23533				platelet activation	cytosol|membrane|nucleus		g.chr17:8791618C>T	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1486G>A	17.37:g.8791618C>T	ENSP00000392812:p.Ala496Thr		Somatic				PIK3R5_uc010vuz.1_Missense_Mutation_p.A496T|PIK3R5_uc002glu.3_Missense_Mutation_p.A110T|PIK3R5_uc010coa.1_3'UTR|PIK3R5_uc010cob.1_Missense_Mutation_p.A110T	p.A496T	NM_014308	NP_055123	WXS	Illumina HiSeq	Unspecified	Q8WYR1	PI3R5_HUMAN			10	1553	-			496					B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	c.1486G>A	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	C	5.030	0.191158	0.09547	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.77620	-1.11	5.48	3.4	0.38934	.	0.580338	0.18006	N	0.154744	T	0.61110	0.2321	N	0.19112	0.55	0.09310	N	1	B	0.24043	0.096	B	0.28385	0.089	T	0.50457	-0.8826	10	0.37606	T	0.19	-15.5567	5.2039	0.15279	0.146:0.6234:0.1506:0.08	.	496	Q8WYR1	PI3R5_HUMAN	T	496	ENSP00000392812:A496T	ENSP00000269300:A496T	A	-	1	0	PIK3R5	8732343	0.001000	0.12720	0.034000	0.17996	0.037000	0.13140	0.806000	0.27126	0.610000	0.30035	0.650000	0.86243	GCT		0.662	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308		16	28	0	0	0	0.004007	0	16	28				
MYH13	8735	broad.mit.edu	37	17	10212976	10212976	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:10212976G>A	ENST00000418404.3	-	33	4991	c.4828C>T	c.(4828-4830)Cgc>Tgc	p.R1610C	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R1610C			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1610					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1610C(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTCCGGCTGCGGATTTCAGCA	0.552																																							uc002gmk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(4828-4830)CGC>TGC		myosin, heavy polypeptide 13, skeletal muscle							53.0	54.0	53.0					17																	10212976		2175	4292	6467	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10212976G>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4828C>T	17.37:g.10212976G>A	ENSP00000404570:p.Arg1610Cys		Somatic					p.R1610C	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			34	4918	-			1610			Potential.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.4828C>T	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259609	0.59321	.	.	ENSG00000006788	ENST00000252172	D	0.82344	-1.6	4.18	-0.786	0.10946	Myosin tail (1);	.	.	.	.	D	0.92541	0.7631	H	0.95114	3.625	0.39981	D	0.974917	D	0.89917	1.0	D	0.72338	0.977	D	0.93749	0.7057	9	0.87932	D	0	.	13.7656	0.62992	0.0:0.0:0.2291:0.7709	.	1610	Q9UKX3	MYH13_HUMAN	C	1610	ENSP00000252172:R1610C	ENSP00000252172:R1610C	R	-	1	0	MYH13	10153701	0.006000	0.16342	0.991000	0.47740	0.919000	0.55068	-0.074000	0.11450	0.107000	0.17824	0.462000	0.41574	CGC		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		6	11	0	0	0	0.001168	0	6	11				
MYH2	4620	broad.mit.edu	37	17	10426814	10426814	+	Splice_Site	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:10426814C>T	ENST00000245503.5	-	37	5855	c.5471G>A	c.(5470-5472)aGg>aAg	p.R1824K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Splice_Site_p.R1824K	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1824					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1824K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GAGACCCACCCTGGCCTCCAG	0.517																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5470-5472)AGG>AAG		myosin heavy chain IIa							96.0	100.0	99.0					17																	10426814		2203	4300	6503	SO:0001630	splice_region_variant	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10426814C>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5472+1G>A	17.37:g.10426814C>T			Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1824K|MYH2_uc010coj.2_Intron	p.R1824K	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			37	5599	-			1824			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5471G>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664931	0.67700	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.81996	-1.56;-1.56	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.43416	U	0.000569	T	0.81795	0.4898	L	0.49640	1.575	0.50313	D	0.999867	B	0.11235	0.004	B	0.23574	0.047	T	0.75750	-0.3208	10	0.44086	T	0.13	.	19.5916	0.95514	0.0:1.0:0.0:0.0	.	1824	Q9UKX2	MYH2_HUMAN	K	1824	ENSP00000245503:R1824K;ENSP00000380367:R1824K	ENSP00000245503:R1824K	R	-	2	0	MYH2	10367539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.861000	0.98227	0.655000	0.94253	AGG		0.517	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	Missense_Mutation	22	42	0	0	0	0.014323	0	22	42				
GAS2L2	246176	broad.mit.edu	37	17	34072791	34072791	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:34072791G>T	ENST00000254466.6	-	6	1752	c.1725C>A	c.(1723-1725)tcC>tcA	p.S575S	GAS2L2_ENST00000587565.1_Silent_p.S559S	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	575					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.S575S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCAGGTCCCAGGACTCTCTGG	0.612																																							uc002hjv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1723-1725)TCC>TCA		growth arrest-specific 2 like 2							57.0	57.0	57.0					17																	34072791		2203	4300	6503	SO:0001819	synonymous_variant	246176				cell cycle arrest	cytoplasm|cytoskeleton		g.chr17:34072791G>T	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1725C>A	17.37:g.34072791G>T			Somatic					p.S575S	NM_139285	NP_644814	WXS	Illumina HiSeq	Unspecified	Q8NHY3	GA2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	6	1753	-		Ovarian(249;0.17)	575					Q8NHY4	Silent	SNP	ENST00000254466.6	37	c.1725C>A	CCDS11298.1																																																																																				0.612	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		22	79	1	0	5.45024e-15	0.01892	8.32797e-15	22	79				
MLLT6	4302	broad.mit.edu	37	17	36873066	36873066	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:36873066G>T	ENST00000325718.7	+	10	1574	c.1483G>T	c.(1483-1485)Gcc>Tcc	p.A495S	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	495					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A495S(1)		breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					GGGCCCAGCTGCCCCATCCTT	0.662			T	MLL	AL																																		uc002hqi.3		NA		Dom	yes		17	17q21	4302	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""			L	MLL		AL		1	Substitution - Missense(1)		lung(1)	breast(3)|prostate(1)|lung(1)|skin(1)	6						c.(1483-1485)GCC>TCC		myeloid/lymphoid or mixed-lineage leukemia							25.0	28.0	27.0					17																	36873066		2203	4300	6503	SO:0001583	missense	4302				regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding	g.chr17:36873066G>T		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.1483G>T	17.37:g.36873066G>T	ENSP00000316426:p.Ala495Ser		Somatic				MLLT6_uc002hqj.2_Intron|MLLT6_uc002hqk.3_5'Flank	p.A495S	NM_005937	NP_005928	WXS	Illumina HiSeq	Unspecified	P55198	AF17_HUMAN			10	1496	+	Breast(7;4.43e-21)		495					Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	ENST00000325718.7	37	c.1483G>T	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	G	8.013	0.758017	0.15846	.	.	ENSG00000108292	ENST00000325718	T	0.12361	2.69	5.17	-3.5	0.04710	.	1.549410	0.03190	N	0.173170	T	0.09247	0.0228	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31641	-0.9936	10	0.15952	T	0.53	.	6.3881	0.21572	0.2824:0.3491:0.3685:0.0	.	495	P55198	AF17_HUMAN	S	495	ENSP00000316426:A495S	ENSP00000316426:A495S	A	+	1	0	MLLT6	34126592	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	0.108000	0.15396	-0.771000	0.04608	-0.254000	0.11334	GCC		0.662	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937		5	25	1	0	3.59834e-05	0.001168	4.16535e-05	5	25				
KRT12	3859	broad.mit.edu	37	17	39021155	39021155	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:39021155C>T	ENST00000251643.4	-	3	733	c.710G>A	c.(709-711)cGg>cAg	p.R237Q	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	237	Coil 1B.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R237Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GTCCAGCACCCGGCGCAGGCC	0.572																																							uc002hvk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(709-711)CGG>CAG		keratin 12							101.0	97.0	98.0					17																	39021155		2203	4300	6503	SO:0001583	missense	3859				visual perception	intermediate filament	structural molecule activity	g.chr17:39021155C>T		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.710G>A	17.37:g.39021155C>T	ENSP00000251643:p.Arg237Gln		Somatic					p.R237Q	NM_000223	NP_000214	WXS	Illumina HiSeq	Unspecified	Q99456	K1C12_HUMAN			3	734	-		Breast(137;0.000301)	237			Rod.|Coil 1B.		B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	c.710G>A	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623542	0.87460	.	.	ENSG00000187242	ENST00000251643	D	0.89617	-2.54	5.96	0.639	0.17747	Filament (1);	0.120677	0.34628	N	0.003809	D	0.84160	0.5411	M	0.66439	2.03	0.09310	N	0.999998	P	0.36768	0.569	B	0.29176	0.099	T	0.75031	-0.3461	10	0.62326	D	0.03	.	11.0227	0.47728	0.0:0.6335:0.0:0.3665	.	237	Q99456	K1C12_HUMAN	Q	237	ENSP00000251643:R237Q	ENSP00000251643:R237Q	R	-	2	0	KRT12	36274681	0.000000	0.05858	0.275000	0.24674	0.977000	0.68977	0.444000	0.21661	-0.054000	0.13266	0.655000	0.94253	CGG		0.572	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223		36	114	0	0	0	0.021022	0	36	114				
BECN1	8678	broad.mit.edu	37	17	40962818	40962818	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:40962818C>A	ENST00000361523.4	-	12	1445	c.1313G>T	c.(1312-1314)tGg>tTg	p.W438L	BECN1_ENST00000438274.3_3'UTR|BECN1_ENST00000590099.1_Missense_Mutation_p.W438L|CNTD1_ENST00000315066.5_3'UTR	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	438					autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)		p.W438L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		AGCAAGACCCCACTTAAGATT	0.428																																							uc002ibo.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1312-1314)TGG>TTG		beclin 1							101.0	96.0	98.0					17																	40962818		2203	4300	6503	SO:0001583	missense	8678				anti-apoptosis|cell cycle|cellular defense response|cytokinesis|response to virus	membrane	protein binding	g.chr17:40962818C>A	AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.1313G>T	17.37:g.40962818C>A	ENSP00000355231:p.Trp438Leu		Somatic				CNTD1_uc002ibm.3_3'UTR|CNTD1_uc010wha.1_3'UTR|BECN1_uc010whb.1_Missense_Mutation_p.W351L|BECN1_uc010whc.1_3'UTR|BECN1_uc002ibn.2_Missense_Mutation_p.W438L	p.W438L	NM_003766	NP_003757	WXS	Illumina HiSeq	Unspecified	Q14457	BECN1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0745)	12	1448	-		Breast(137;0.00104)	438					B2R6N7|O75595|Q9UNA8	Missense_Mutation	SNP	ENST00000361523.4	37	c.1313G>T	CCDS11441.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653279	0.88056	.	.	ENSG00000126581	ENST00000361523;ENST00000543382	T	0.49432	0.78	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73644	0.3613	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74788	-0.3546	10	0.59425	D	0.04	.	20.3261	0.98701	0.0:1.0:0.0:0.0	.	438	Q14457	BECN1_HUMAN	L	438;351	ENSP00000355231:W438L	ENSP00000355231:W438L	W	-	2	0	BECN1	38216344	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.786000	0.85741	2.814000	0.96858	0.655000	0.94253	TGG		0.428	BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	NM_003766		22	80	1	0	1.64293e-13	0.01892	2.41385e-13	22	80				
WNT9B	7484	broad.mit.edu	37	17	44950100	44950100	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:44950100A>T	ENST00000290015.2	+	2	348	c.295A>T	c.(295-297)Aac>Tac	p.N99Y	WNT9B_ENST00000393461.2_Missense_Mutation_p.N99Y	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	99					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.N99Y(1)|p.N105Y(1)		large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			TGAGCGCTGGAACTGTAGCCT	0.672																																							uc002ikw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)	2						c.(295-297)AAC>TAC		wingless-type MMTV integration site family,							18.0	21.0	20.0					17																	44950100		2196	4298	6494	SO:0001583	missense	7484				anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding	g.chr17:44950100A>T	AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.295A>T	17.37:g.44950100A>T	ENSP00000290015:p.Asn99Tyr		Somatic				WNT9B_uc002ikx.1_Missense_Mutation_p.N99Y	p.N99Y	NM_003396	NP_003387	WXS	Illumina HiSeq	Unspecified	O14905	WNT9B_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0257)		2	332	+			99					Q6UXT4|Q96Q09	Missense_Mutation	SNP	ENST00000290015.2	37	c.295A>T	CCDS11506.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682053	0.68042	.	.	ENSG00000158955	ENST00000393461;ENST00000290015	D;D	0.83837	-1.77;-1.77	4.49	3.41	0.39046	.	0.139775	0.64402	D	0.000006	D	0.93403	0.7896	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.916;0.999	D	0.93481	0.6827	9	.	.	.	.	10.1415	0.42738	0.9204:0.0:0.0796:0.0	.	99;99	E7EPC3;O14905	.;WNT9B_HUMAN	Y	99	ENSP00000377105:N99Y;ENSP00000290015:N99Y	.	N	+	1	0	WNT9B	42305099	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	8.957000	0.93082	0.869000	0.35703	-0.464000	0.05259	AAC		0.672	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440433.1	NM_003396		4	24	0	0	0	0.014758	0	4	24				
ABI3	51225	broad.mit.edu	37	17	47299555	47299555	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:47299555C>A	ENST00000225941.1	+	7	1403	c.905C>A	c.(904-906)cCc>cAc	p.P302H	ABI3_ENST00000419580.2_Missense_Mutation_p.P296H	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	302	Pro-rich.				cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)		p.P302H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CCTGATGAGCCCAGCTGGGTG	0.612										HNSCC(55;0.14)																													uc002iop.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(904-906)CCC>CAC		NESH protein isoform 1							76.0	72.0	73.0					17																	47299555		2203	4300	6503	SO:0001583	missense	51225				cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding	g.chr17:47299555C>A	AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.905C>A	17.37:g.47299555C>A	ENSP00000225941:p.Pro302His	HNSCC(55;0.14)	Somatic				ABI3_uc002ioq.1_Missense_Mutation_p.P296H	p.P302H	NM_016428	NP_057512	WXS	Illumina HiSeq	Unspecified	Q9P2A4	ABI3_HUMAN	Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)		7	1403	+			302			Pro-rich.		C9IZN8|Q9H0P6	Missense_Mutation	SNP	ENST00000225941.1	37	c.905C>A	CCDS11546.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270004	0.80469	.	.	ENSG00000108798	ENST00000225941;ENST00000419580	T;T	0.33654	1.4;1.4	4.93	4.93	0.64822	Src homology-3 domain (1);	0.342659	0.25642	N	0.029265	T	0.56702	0.2003	M	0.70595	2.14	0.43647	D	0.996058	D;D	0.69078	0.997;0.996	D;P	0.63192	0.912;0.819	T	0.61397	-0.7071	10	0.72032	D	0.01	-13.4177	14.9359	0.70954	0.0:1.0:0.0:0.0	.	296;302	Q9P2A4-2;Q9P2A4	.;ABI3_HUMAN	H	302;296	ENSP00000225941:P302H;ENSP00000406651:P296H	ENSP00000225941:P302H	P	+	2	0	ABI3	44654554	0.978000	0.34361	1.000000	0.80357	0.951000	0.60555	3.187000	0.50950	2.294000	0.77228	0.456000	0.33151	CCC		0.612	ABI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364475.1	NM_016428		70	33	1	0	1.74474e-33	0.01441	3.40047e-33	70	33				
DNAH17	8632	broad.mit.edu	37	17	76503840	76503840	+	Silent	SNP	G	G	A	rs375092080	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:76503840G>A	ENST00000585328.1	-	28	4399	c.4275C>T	c.(4273-4275)caC>caT	p.H1425H	DNAH17_ENST00000389840.5_Silent_p.H1424H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1424	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H1425H(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GGTGCGGCTCGTGCTGGAATT	0.552													G|||	3	0.000599042	0.0008	0.0029	5008	,	,		19049	0.0		0.0	False		,,,				2504	0.0						uc010wtu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|breast(2)|skin(1)	9						c.(157-159)CAC>CAT		full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).		G		10,4004		0,10,1997	20.0	21.0	21.0		4284	-0.1	1.0	17		21	1,8371		0,1,4185	no	coding-synonymous	DNAH17	NM_173628.3		0,11,6182	AA,AG,GG		0.0119,0.2491,0.0888		1428/4463	76503840	11,12375	2007	4186	6193	SO:0001819	synonymous_variant	8632							g.chr17:76503840G>A	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4275C>T	17.37:g.76503840G>A			Somatic					p.H53H			WXS	Illumina HiSeq	Unspecified			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		2	336	-								O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37	c.159C>T																																																																																					0.552	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		4	10	0	0	0	0.014758	0	4	10				
ZNF521	25925	broad.mit.edu	37	18	22804516	22804516	+	Silent	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr18:22804516C>T	ENST00000361524.3	-	4	3514	c.3366G>A	c.(3364-3366)gaG>gaA	p.E1122E	ZNF521_ENST00000584787.1_Silent_p.E902E|ZNF521_ENST00000538137.2_Silent_p.E1122E	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1122					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.E1122E(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CACTCAGATTCTCATTCTGGC	0.547			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)	7						c.(3364-3366)GAG>GAA		zinc finger protein 521							124.0	110.0	115.0					18																	22804516		2203	4300	6503	SO:0001819	synonymous_variant	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22804516C>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3366G>A	18.37:g.22804516C>T			Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.E1122E|ZNF521_uc002kvl.2_Silent_p.E902E	p.E1122E	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	3613	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		1122					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	c.3366G>A	CCDS32806.1																																																																																				0.547	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		22	16	0	0	0	0.016522	0	22	16				
ZNF532	55205	broad.mit.edu	37	18	56651409	56651409	+	Missense_Mutation	SNP	G	G	T	rs200537436		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr18:56651409G>T	ENST00000336078.4	+	11	4393	c.3617G>T	c.(3616-3618)cGg>cTg	p.R1206L	ZNF532_ENST00000591083.1_Missense_Mutation_p.R1206L|ZNF532_ENST00000589288.1_Missense_Mutation_p.R1206L|ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000591808.1_Missense_Mutation_p.R1206L|ZNF532_ENST00000591230.1_Missense_Mutation_p.R1206L	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1206L(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						TACCAGTGCCGGGAGTGTGGC	0.532																																							uc002lho.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(3616-3618)CGG>CTG		zinc finger protein 532							54.0	47.0	49.0					18																	56651409		2202	4294	6496	SO:0001583	missense	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56651409G>T	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3617G>T	18.37:g.56651409G>T	ENSP00000338217:p.Arg1206Leu		Somatic				ZNF532_uc002lhp.2_Missense_Mutation_p.R1204L|ZNF532_uc010xeg.1_Missense_Mutation_p.R1204L|ZNF532_uc002lhr.2_Missense_Mutation_p.R1204L|ZNF532_uc002lhs.2_Missense_Mutation_p.R1204L|ZNF532_uc010xeh.1_Missense_Mutation_p.R294L	p.R1206L	NM_018181	NP_060651	WXS	Illumina HiSeq	Unspecified	Q9HCE3	ZN532_HUMAN			11	4164	+			1206			C2H2-type 11.		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	c.3617G>T	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	G	8.079	0.772012	0.16051	.	.	ENSG00000074657	ENST00000336078	T	0.28454	1.61	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.057286	0.64402	D	0.000002	T	0.26629	0.0651	N	0.25647	0.755	0.37110	D	0.900282	P;P	0.50066	0.931;0.799	B;B	0.41764	0.366;0.131	T	0.04991	-1.0913	10	0.28530	T	0.3	-0.5538	19.7382	0.96215	0.0:0.0:1.0:0.0	.	1206;1206	B3KXW2;Q9HCE3	.;ZN532_HUMAN	L	1206	ENSP00000338217:R1206L	ENSP00000338217:R1206L	R	+	2	0	ZNF532	54802389	1.000000	0.71417	0.975000	0.42487	0.967000	0.64934	7.614000	0.82996	2.769000	0.95229	0.561000	0.74099	CGG		0.532	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		3	35	1	0	0.004672	0.004672	0.00498521	3	35				
SPPL2B	56928	broad.mit.edu	37	19	2337525	2337525	+	RNA	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:2337525C>A	ENST00000452401.2	+	0	350							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.I90I(1)					Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAACCAGATCCCGCTGGTGG	0.672																																							uc002lvs.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(268-270)ATC>ATA		signal peptide peptidase-like 2B isoform 2							56.0	64.0	61.0					19																	2337525		2016	4169	6185			56928					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity	g.chr19:2337525C>A		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2337525C>A			Somatic				SPPL2B_uc010dsw.1_Silent_p.I62I|SPPL2B_uc010dsy.1_Silent_p.I62I|SPPL2B_uc010dsz.1_Silent_p.I90I|SPPL2B_uc002lvr.2_Silent_p.I90I|SPPL2B_uc010dta.1_5'Flank|SPPL2B_uc002lvu.2_5'Flank	p.I90I	NM_152988	NP_694533	WXS	Illumina HiSeq	Unspecified	Q8TCT7	PSL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	350	+		Hepatocellular(1079;0.137)	90			Cytoplasmic (Potential).|PA.		D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	Silent	SNP	ENST00000452401.2	37	c.270C>A																																																																																					0.672	SPPL2B-202	KNOWN	basic	processed_transcript	processed_transcript		NM_020172		38	9	1	0	9.85913e-13	0.009718	1.40529e-12	38	9				
ACER1	125981	broad.mit.edu	37	19	6306758	6306758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:6306758G>T	ENST00000301452.4	-	6	839	c.762C>A	c.(760-762)taC>taA	p.Y254*		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	254					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)	p.Y254*(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						GGATTTCCACGTAGGGCAGCC	0.577																																							uc002mel.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(760-762)TAC>TAA		alkaline ceramidase 1							79.0	62.0	68.0					19																	6306758		2203	4300	6503	SO:0001587	stop_gained	125981					endoplasmic reticulum membrane|integral to membrane	ceramidase activity	g.chr19:6306758G>T	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.762C>A	19.37:g.6306758G>T	ENSP00000301452:p.Tyr254*		Somatic					p.Y254*	NM_133492	NP_597999	WXS	Illumina HiSeq	Unspecified	Q8TDN7	ACER1_HUMAN			6	840	-			254			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000301452.4	37	c.762C>A	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	A	9.350	1.065221	0.20067	.	.	ENSG00000167769	ENST00000301452	.	.	.	5.49	-7.25	0.01470	.	0.057939	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.2683	16.8869	0.86078	0.7831:0.0:0.2169:0.0	.	.	.	.	X	254	.	ENSP00000301452:Y254X	Y	-	3	2	ACER1	6257758	0.901000	0.30685	0.002000	0.10522	0.038000	0.13279	0.035000	0.13797	-1.631000	0.01543	-0.977000	0.02584	TAC		0.577	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1	NM_133492		13	3	1	0	2.23348e-06	0.004007	2.73459e-06	13	3				
CCNE1	898	broad.mit.edu	37	19	30314605	30314606	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:30314605_30314606GG>CT	ENST00000262643.3	+	12	1433_1434	c.1154_1155GG>CT	c.(1153-1155)aGG>aCT	p.R385T	CCNE1_ENST00000444983.2_Missense_Mutation_p.R370T|CCNE1_ENST00000357943.5_Missense_Mutation_p.R342T	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	385					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)	p.R385T(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			GAACAAAATAGGGCTTCTCCTC	0.525			A		serous ovarian																																		uc002nsn.2		NA		Dom	yes		19	19q12	898		cyclin E1			E					1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1153-1155)AGG>ACT		cyclin E1 isoform 1																																				SO:0001583	missense	898				androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity	g.chr19:30314605_30314606GG>CT	M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	Exception_encountered	19.37:g.30314605_30314606delinsCT	ENSP00000262643:p.Arg385Thr		Somatic				CCNE1_uc002nso.2_Missense_Mutation_p.R370T|CCNE1_uc002nsp.2_Missense_Mutation_p.R132T	p.R385T	NM_001238	NP_001229	WXS	Illumina HiSeq	Unspecified	P24864	CCNE1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)		12	1337_1338	+	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		385					A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	DNP	ENST00000262643.3	37	c.1154_1155GG>CT	CCDS12419.1																																																																																				0.525	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438138.1	NM_001238		17	39	0	0	0	0.004672	0	17	39				
TSHZ3	57616	broad.mit.edu	37	19	31770491	31770491	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:31770491G>T	ENST00000240587.4	-	2	535	c.208C>A	c.(208-210)Cat>Aat	p.H70N		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	70					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H70N(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCCATTTCATGGCAGGAAAAC	0.592																																							uc002nsy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(208-210)CAT>AAT		zinc finger protein 537							44.0	45.0	45.0					19																	31770491		1972	4135	6107	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770491G>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.208C>A	19.37:g.31770491G>T	ENSP00000240587:p.His70Asn		Somatic					p.H70N	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	273	-	Esophageal squamous(110;0.226)		70					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.208C>A	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172513	0.38315	.	.	ENSG00000121297	ENST00000240587	T	0.11277	2.79	5.92	5.92	0.95590	.	0.070421	0.56097	U	0.000027	T	0.14270	0.0345	L	0.43152	1.355	0.80722	D	1	B	0.25105	0.118	B	0.21917	0.037	T	0.02505	-1.1149	10	0.72032	D	0.01	-25.2134	20.3116	0.98642	0.0:0.0:1.0:0.0	.	70	Q63HK5	TSH3_HUMAN	N	70	ENSP00000240587:H70N	ENSP00000240587:H70N	H	-	1	0	TSHZ3	36462331	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	9.437000	0.97535	2.793000	0.96121	0.650000	0.86243	CAT		0.592	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		8	17	1	0	0.000157383	0.00308	0.000174769	8	17				
KIR3DL1	3811	broad.mit.edu	37	19	55331209	55331209	+	Silent	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:55331209C>T	ENST00000391728.4	+	4	430	c.397C>T	c.(397-399)Ctg>Ttg	p.L133L	KIR3DL1_ENST00000358178.4_Silent_p.L38L|KIR3DL1_ENST00000326542.7_Silent_p.L133L|KIR3DL1_ENST00000541392.1_Silent_p.L133L|KIR3DL1_ENST00000402254.2_Silent_p.L133L|KIR3DL1_ENST00000538269.1_Silent_p.L133L	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	133					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.L133L(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CCCAGGTCCCCTGGTGAAATC	0.488																																							uc002qhk.3		NA																	2	Substitution - coding silent(2)	p.L133Q(1)	lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(397-399)CTG>TTG		killer cell immunoglobulin-like receptor, three							36.0	34.0	35.0					19																	55331209		2169	4107	6276	SO:0001819	synonymous_variant	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55331209C>T	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.397C>T	19.37:g.55331209C>T			Somatic				KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Silent_p.L75L|KIR3DL1_uc010esf.2_Silent_p.L38L|KIR3DL1_uc010yfo.1_Silent_p.L75L|KIR3DL1_uc002qhl.3_Silent_p.L133L	p.L133L	NM_013289	NP_037421	WXS	Illumina HiSeq	Unspecified	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	4	460	+			133			Extracellular (Potential).		O43473|Q14946|Q16541	Silent	SNP	ENST00000391728.4	37	c.397C>T	CCDS42621.1																																																																																				0.488	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		40	29	0	0	0	0.01441	0	40	29				
NLRP8	126205	broad.mit.edu	37	19	56466759	56466759	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:56466759G>A	ENST00000291971.3	+	3	1406	c.1335G>A	c.(1333-1335)aaG>aaA	p.K445K	NLRP8_ENST00000590542.1_Silent_p.K445K	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	445	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.K445K(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TTTCCAGAAAGATCCACCAAG	0.483																																							uc002qmh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13						c.(1333-1335)AAG>AAA		NLR family, pyrin domain containing 8							90.0	90.0	90.0					19																	56466759		2203	4300	6503	SO:0001819	synonymous_variant	126205					cytoplasm	ATP binding	g.chr19:56466759G>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1335G>A	19.37:g.56466759G>A			Somatic				NLRP8_uc010etg.2_Silent_p.K445K	p.K445K	NM_176811	NP_789781	WXS	Illumina HiSeq	Unspecified	Q86W28	NALP8_HUMAN		GBM - Glioblastoma multiforme(193;0.0695)	3	1406	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	445			NACHT.		Q7RTR4	Silent	SNP	ENST00000291971.3	37	c.1335G>A	CCDS12937.1																																																																																				0.483	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811		25	33	0	0	0	0.004656	0	25	33				
PDIA6	10130	broad.mit.edu	37	2	10927471	10927471	+	Missense_Mutation	SNP	G	G	A	rs138012463		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:10927471G>A	ENST00000272227.3	-	11	1240	c.1093C>T	c.(1093-1095)Cgc>Tgc	p.R365C	PDIA6_ENST00000404824.2_Missense_Mutation_p.R413C|PDIA6_ENST00000404371.2_Missense_Mutation_p.R417C|PDIA6_ENST00000540494.1_Missense_Mutation_p.R362C|PDIA6_ENST00000381611.4_Missense_Mutation_p.R370C	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	365					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)	p.R365C(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		TTCATCTTGCGTGCATTGATG	0.493																																					GBM(73;509 1219 34219 41343 41551)	GBM(73;509 1219 34219 41343 41551)	uc002rau.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1093-1095)CGC>TGC		protein disulfide isomerase A6 precursor		G	CYS/ARG	0,4406		0,0,2203	114.0	114.0	114.0		1093	4.2	1.0	2	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	missense	PDIA6	NM_005742.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	365/441	10927471	1,13005	2203	4300	6503	SO:0001583	missense	10130				cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr2:10927471G>A	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.1093C>T	2.37:g.10927471G>A	ENSP00000272227:p.Arg365Cys		Somatic				PDIA6_uc010yjg.1_Missense_Mutation_p.R362C|PDIA6_uc002rav.2_Missense_Mutation_p.R417C|PDIA6_uc010yjh.1_Missense_Mutation_p.R370C|PDIA6_uc002raw.2_Missense_Mutation_p.R413C	p.R365C	NM_005742	NP_005733	WXS	Illumina HiSeq	Unspecified	Q15084	PDIA6_HUMAN		Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)	11	1231	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		365					B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	37	c.1093C>T	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669654	0.88348	0.0	1.16E-4	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4	6.17	4.22	0.49857	Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.44222	0.1283	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;P	0.67725	0.953;0.921;0.921;0.791	T	0.47071	-0.9145	10	0.87932	D	0	.	14.7041	0.69176	0.0:0.0:0.6921:0.3079	.	362;413;417;365	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	C	365;417;413;362;370	ENSP00000272227:R365C;ENSP00000385385:R417C;ENSP00000384459:R413C;ENSP00000438778:R362C;ENSP00000371024:R370C	ENSP00000272227:R365C	R	-	1	0	PDIA6	10844922	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	3.155000	0.50700	2.941000	0.99782	0.655000	0.94253	CGC		0.493	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742		39	64	0	0	0	0.00623	0	39	64				
DDX1	1653	broad.mit.edu	37	2	15742716	15742716	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:15742716G>T	ENST00000381341.2	+	8	741	c.352G>T	c.(352-354)Gaa>Taa	p.E118*	DDX1_ENST00000233084.3_Nonsense_Mutation_p.E118*			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	118	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)	p.E118*(1)|p.E118K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AGAAGTAAAGGAATGGCATGG	0.373																																							uc002rce.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)	p.E118K(1)	lung(1)|central_nervous_system(1)	central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(352-354)GAA>TAA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 1							155.0	145.0	148.0					2																	15742716		2203	4300	6503	SO:0001587	stop_gained	1653				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity	g.chr2:15742716G>T	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.352G>T	2.37:g.15742716G>T	ENSP00000370745:p.Glu118*		Somatic				DDX1_uc010yjq.1_Nonsense_Mutation_p.E26*	p.E118*	NM_004939	NP_004930	WXS	Illumina HiSeq	Unspecified	Q92499	DDX1_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)	7	640	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	118			B30.2/SPRY.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.|Helicase ATP-binding.		B4DME8|B4DPN6	Nonsense_Mutation	SNP	ENST00000381341.2	37	c.352G>T	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	G	41	9.001709	0.99031	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-27.7156	19.5331	0.95237	0.0:0.0:1.0:0.0	.	.	.	.	X	118;118;102	.	ENSP00000233084:E118X	E	+	1	0	DDX1	15660167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.369000	0.97156	2.627000	0.88993	0.655000	0.94253	GAA		0.373	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939		21	41	1	0	6.36457e-07	0.021523	8.05055e-07	21	41				
DNMT3A	1788	broad.mit.edu	37	2	25468194	25468195	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:25468194_25468195GC>AG	ENST00000264709.3	-	13	1818_1819	c.1481_1482GC>CT	c.(1480-1482)tGC>tCT	p.C494S	DNMT3A_ENST00000321117.5_Missense_Mutation_p.C494S|DNMT3A_ENST00000380746.4_Missense_Mutation_p.C305S|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000402667.1_Missense_Mutation_p.C271S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	494	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.C305S(1)|p.C494S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACAGGAGATGCAGATGTCTGG	0.604			"""Mis, F, N, S"""		AML																																		uc002rgc.2		NA		Rec	yes		2	2p23	1788	Mis|F|N|S	DNA (cytosine-5-)-methyltransferase 3 alpha			L			AML		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140						c.(1480-1482)TGC>TCT		DNA cytosine methyltransferase 3 alpha isoform																																				SO:0001583	missense	1788				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	g.chr2:25468194_25468195GC>AG		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1481_1482delinsAG	2.37:g.25468194_25468195delinsAG	ENSP00000264709:p.Cys494Ser		Somatic				DNMT3A_uc002rgd.2_Missense_Mutation_p.C494S|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.C305S	p.C494S	NM_022552	NP_072046	WXS	Illumina HiSeq	Unspecified	Q9Y6K1	DNM3A_HUMAN			13	1738_1739	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		494			Interaction with the PRC2/EED-EZH2 complex (By similarity).|GATA-type; atypical.|ADD.		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	DNP	ENST00000264709.3	37	c.1481_1482GC>CT	CCDS33157.1																																																																																				0.604	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552		8	17	0	0	0	0.004672	0	8	17				
NRXN1	9378	broad.mit.edu	37	2	50779824	50779824	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:50779824G>T	ENST00000406316.2	-	9	3136	c.1660C>A	c.(1660-1662)Ctg>Atg	p.L554M	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000402717.3_Missense_Mutation_p.L546M|NRXN1_ENST00000406859.3_Missense_Mutation_p.L554M|NRXN1_ENST00000401669.2_Missense_Mutation_p.L554M|NRXN1_ENST00000405472.3_Missense_Mutation_p.L546M|NRXN1_ENST00000404971.1_Missense_Mutation_p.L594M	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	554	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.L595M(1)|p.L594M(1)|p.L554M(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCCATGTCCAGGAGGAGGTAG	0.473																																							uc010fbq.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(1780-1782)CTG>ATG		neurexin 1 isoform alpha2 precursor							138.0	127.0	131.0					2																	50779824		1902	4109	6011	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50779824G>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1660C>A	2.37:g.50779824G>T	ENSP00000384311:p.Leu554Met		Somatic				NRXN1_uc002rxb.3_Missense_Mutation_p.L226M|NRXN1_uc002rxe.3_Missense_Mutation_p.L554M|NRXN1_uc002rxc.1_RNA	p.L594M	NM_001135659	NP_001129131	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		9	3257	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.1780C>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098776	0.56183	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28;-1.28	5.93	2.11	0.27256	.	0.000000	0.64402	D	0.000001	T	0.81955	0.4932	L	0.33753	1.03	0.34171	D	0.669755	D;D;P	0.76494	0.958;0.999;0.943	P;D;P	0.91635	0.835;0.999;0.854	D	0.83877	0.0277	10	0.51188	T	0.08	.	9.8096	0.40815	0.4306:0.0:0.5694:0.0	.	594;554;546	Q9ULB1-3;F8WB18;A7E294	.;.;.	M	594;554;546;554;595;546;554	ENSP00000385142:L594M;ENSP00000384311:L554M;ENSP00000434015:L546M;ENSP00000385017:L554M;ENSP00000385434:L546M;ENSP00000385681:L554M	ENSP00000385017:L554M	L	-	1	2	NRXN1	50633328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.586000	0.36611	0.409000	0.25649	0.591000	0.81541	CTG		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			58	83	1	0	9.59835e-30	0.01441	1.81513e-29	58	83				
LRRTM4	80059	broad.mit.edu	37	2	77745683	77745683	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:77745683T>C	ENST00000409093.1	-	3	1648	c.1312A>G	c.(1312-1314)Atg>Gtg	p.M438V	LRRTM4_ENST00000409088.3_Missense_Mutation_p.M438V|LRRTM4_ENST00000409282.1_Missense_Mutation_p.M439V|LRRTM4_ENST00000409911.1_Missense_Mutation_p.M439V|LRRTM4_ENST00000409884.1_Missense_Mutation_p.M438V			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	438					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.M438V(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		AAGAGGATCATGGCCACTGAG	0.493																																							uc002snr.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(3)|ovary(1)	4						c.(1312-1314)ATG>GTG		leucine rich repeat transmembrane neuronal 4							69.0	71.0	70.0					2																	77745683		1984	4177	6161	SO:0001583	missense	80059					integral to membrane		g.chr2:77745683T>C	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1312A>G	2.37:g.77745683T>C	ENSP00000386357:p.Met438Val		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.M438V|LRRTM4_uc002sns.2_Missense_Mutation_p.M438V|LRRTM4_uc002snt.2_Missense_Mutation_p.M439V	p.M438V	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1727	-			438			Helical; (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1312A>G	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	T	0.386	-0.926250	0.02377	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.68	5.68	0.88126	.	0.129233	0.64402	D	0.000001	T	0.59500	0.2198	N	0.25647	0.755	0.51767	D	0.999938	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.55872	-0.8072	10	0.06494	T	0.89	.	14.7537	0.69546	0.0:0.0:0.0:1.0	.	439;438;438	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	V	439;438;438;438;439	ENSP00000387228:M439V;ENSP00000387297:M438V;ENSP00000386357:M438V;ENSP00000386236:M438V;ENSP00000386286:M439V	ENSP00000386236:M438V	M	-	1	0	LRRTM4	77599191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.150000	0.64869	2.156000	0.67533	0.533000	0.62120	ATG		0.493	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		39	33	0	0	0	0.00874	0	39	33				
MAP3K19	80122	broad.mit.edu	37	2	135756462	135756462	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:135756462G>T	ENST00000375845.3	-	5	450	c.420C>A	c.(418-420)ccC>ccA	p.P140P	MAP3K19_ENST00000392915.1_Silent_p.P157P|MAP3K19_ENST00000375844.3_Silent_p.P140P|MAP3K19_ENST00000392917.3_Silent_p.P140P|MAP3K19_ENST00000358371.4_Intron|MAP3K19_ENST00000392918.3_Silent_p.P140P|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	140							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P140P(1)									GCAAAACTAAGGGCCGCATGG	0.433																																							uc002tue.1		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(418-420)CCC>CCA		Yeast Sps1/Ste20-related kinase 4 isoform 1							84.0	84.0	84.0					2																	135756462		2203	4300	6503	SO:0001819	synonymous_variant	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135756462G>T	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.420C>A	2.37:g.135756462G>T			Somatic				YSK4_uc010fne.1_Silent_p.P112P|YSK4_uc002tuf.1_Silent_p.P140P|YSK4_uc010fnc.1_Silent_p.P140P|YSK4_uc010fnd.1_Intron|YSK4_uc010zbg.1_Silent_p.P140P|YSK4_uc002tui.3_Silent_p.P157P	p.P140P	NM_025052	NP_079328	WXS	Illumina HiSeq	Unspecified	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	5	451	-			140					B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	37	c.420C>A	CCDS2176.2																																																																																				0.433	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		11	43	1	0	3.07112e-06	0.010729	3.71255e-06	11	43				
GALNT5	11227	broad.mit.edu	37	2	158142621	158142621	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:158142621G>T	ENST00000259056.4	+	3	2201	c.1716G>T	c.(1714-1716)agG>agT	p.R572S		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	572	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R572S(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TAAGGGCCAGGCTGGCAGGAG	0.343																																							uc002tzg.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|skin(1)	4						c.(1714-1716)AGG>AGT		N-acetylgalactosaminyltransferase 5							74.0	83.0	80.0					2																	158142621		2203	4300	6503	SO:0001583	missense	11227				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:158142621G>T	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1716G>T	2.37:g.158142621G>T	ENSP00000259056:p.Arg572Ser		Somatic				GALNT5_uc010zci.1_RNA	p.R572S	NM_014568	NP_055383	WXS	Illumina HiSeq	Unspecified	Q7Z7M9	GALT5_HUMAN			3	1971	+			572			Catalytic subdomain A.|Lumenal (Potential).		A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	c.1716G>T	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015095	0.75161	.	.	ENSG00000136542	ENST00000259056	T	0.64260	-0.09	5.87	1.28	0.21552	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.85084	0.5616	H	0.98818	4.34	0.46701	D	0.99916	D	0.89917	1.0	D	0.87578	0.998	D	0.85889	0.1427	10	0.87932	D	0	.	9.7079	0.40227	0.4529:0.0:0.5471:0.0	.	572	Q7Z7M9	GALT5_HUMAN	S	572	ENSP00000259056:R572S	ENSP00000259056:R572S	R	+	3	2	GALNT5	157850867	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	0.306000	0.19279	0.320000	0.23234	0.655000	0.94253	AGG		0.343	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568		9	40	1	0	5.16669e-11	0.010729	6.99884e-11	9	40				
CHRNA1	1134	broad.mit.edu	37	2	175622341	175622341	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:175622341G>C	ENST00000261007.5	-	5	438	c.372C>G	c.(370-372)caC>caG	p.H124Q	CHRNA1_ENST00000409219.1_Missense_Mutation_p.H99Q|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Intron|CHRNA1_ENST00000409323.1_Missense_Mutation_p.H99Q|CHRNA1_ENST00000348749.5_Missense_Mutation_p.H99Q	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	124					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.H124Q(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CTGAAGGAATGTGAATTTTTT	0.438																																							uc002ujd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(370-372)CAC>CAG		nicotinic cholinergic receptor alpha 1 isoform a							81.0	80.0	80.0					2																	175622341		2203	4300	6503	SO:0001583	missense	1134				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr2:175622341G>C	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.372C>G	2.37:g.175622341G>C	ENSP00000261007:p.His124Gln		Somatic				uc002uiw.2_Intron|CHRNA1_uc002uje.2_Missense_Mutation_p.H99Q|CHRNA1_uc002ujf.3_Missense_Mutation_p.H99Q	p.H124Q	NM_001039523	NP_001034612	WXS	Illumina HiSeq	Unspecified	P02708	ACHA_HUMAN			5	450	-			124			Extracellular.		B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	c.372C>G	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548755	0.45383	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409219;ENST00000409323	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.97	3.25	0.37280	Neurotransmitter-gated ion-channel ligand-binding (3);	0.046101	0.85682	D	0.000000	T	0.68550	0.3013	L	0.45228	1.405	0.35204	D	0.774505	B;B;B	0.24317	0.025;0.049;0.101	B;B;B	0.29440	0.057;0.062;0.102	T	0.68100	-0.5498	10	0.66056	D	0.02	.	6.3439	0.21339	0.1991:0.0:0.6723:0.1286	.	99;99;124	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	Q	99;124;99;99	ENSP00000261008:H99Q;ENSP00000261007:H124Q;ENSP00000386611:H99Q;ENSP00000386684:H99Q	ENSP00000261007:H124Q	H	-	3	2	CHRNA1	175330587	0.999000	0.42202	0.826000	0.32828	0.990000	0.78478	1.625000	0.37029	0.444000	0.26612	-0.216000	0.12614	CAC		0.438	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			38	36	0	0	0	0.005524	0	38	36				
COL5A2	1290	broad.mit.edu	37	2	189927933	189927933	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:189927933C>A	ENST00000374866.3	-	27	2108	c.1834G>T	c.(1834-1836)Ggg>Tgg	p.G612W		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	612					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G612W(2)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCCATGCTCCCGGGCTGCCCT	0.517																																							uc002uqk.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1834-1836)GGG>TGG		alpha 2 type V collagen preproprotein							81.0	92.0	88.0					2																	189927933		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189927933C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1834G>T	2.37:g.189927933C>A	ENSP00000364000:p.Gly612Trp		Somatic				COL5A2_uc010frx.2_Missense_Mutation_p.G188W	p.G612W	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		27	2109	-			612					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.1834G>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375781	0.82682	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99637	-6.29	4.56	4.56	0.56223	.	0.000000	0.46442	D	0.000283	D	0.99768	0.9905	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96884	0.9648	9	.	.	.	.	17.7045	0.88304	0.0:1.0:0.0:0.0	.	252;612	Q5PR22;P05997	.;CO5A2_HUMAN	W	612;252	ENSP00000364000:G612W	.	G	-	1	0	COL5A2	189636178	1.000000	0.71417	0.991000	0.47740	0.918000	0.54935	7.445000	0.80570	2.244000	0.73946	0.467000	0.42956	GGG		0.517	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		58	69	1	0	2.01871e-26	0.01441	3.63749e-26	58	69				
ANKAR	150709	broad.mit.edu	37	2	190554683	190554683	+	Silent	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:190554683T>C	ENST00000520309.1	+	3	1120	c.1032T>C	c.(1030-1032)ccT>ccC	p.P344P	ANKAR_ENST00000461516.1_3'UTR|ANKAR_ENST00000281412.6_Silent_p.P108P|ANKAR_ENST00000313581.4_Silent_p.P344P|ANKAR_ENST00000431575.2_Silent_p.P273P|ANKAR_ENST00000438402.2_Silent_p.P344P	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	344						integral component of membrane (GO:0016021)		p.P344P(1)|p.P273P(1)|p.S346fs*59(1)|p.S275fs*59(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TGCTTCAGCCTTTTTCAGGTA	0.289																																							uc002uqw.1		NA																	4	Deletion - Frameshift(2)|Substitution - coding silent(2)		lung(4)	ovary(2)|pancreas(1)|skin(1)	4						c.(817-819)CCT>CCC		ankyrin and armadillo repeat containing							39.0	44.0	42.0					2																	190554683		2064	4223	6287	SO:0001819	synonymous_variant	150709					integral to membrane	binding	g.chr2:190554683T>C	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1032T>C	2.37:g.190554683T>C			Somatic				ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqv.1_Silent_p.P344P	p.P273P	NM_144708	NP_653309	WXS	Illumina HiSeq	Unspecified	Q7Z5J8	ANKAR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)		2	819	+			344					Q3ZCS6|Q4G0M2|Q6ZU02	Silent	SNP	ENST00000520309.1	37	c.819T>C	CCDS33351.2																																																																																				0.289	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708		3	65	0	0	0	0.009096	0	3	65				
CAPN10	11132	broad.mit.edu	37	2	241536200	241536200	+	Silent	SNP	G	G	T	rs370493316		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr2:241536200G>T	ENST00000391984.2	+	9	1780	c.1584G>T	c.(1582-1584)acG>acT	p.T528T	CAPN10_ENST00000404753.3_Silent_p.T528T|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000354082.4_Intron|CAPN10_ENST00000352879.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	528	Domain III 2.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.T528T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		TCGGCCAGACGGCGGGGGGCA	0.701																																							uc002vzk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|lung(1)	6						c.(1582-1584)ACG>ACT		calpain 10 isoform a							29.0	36.0	34.0					2																	241536200		1942	4131	6073	SO:0001819	synonymous_variant	11132				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding	g.chr2:241536200G>T	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1584G>T	2.37:g.241536200G>T			Somatic				CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Silent_p.T400T|CAPN10_uc002vzo.1_Intron|CAPN10_uc010fzg.1_Intron|CAPN10_uc002vzp.1_Intron|CAPN10_uc002vzq.1_Intron	p.T528T	NM_023083	NP_075571	WXS	Illumina HiSeq	Unspecified	Q9HC96	CAN10_HUMAN		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)	9	1768	+		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	528			Domain III 2.		A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Silent	SNP	ENST00000391984.2	37	c.1584G>T	CCDS42838.1																																																																																				0.701	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083		27	26	1	0	2.24059e-21	0.00632	3.75398e-21	27	26				
SIRPB1	10326	broad.mit.edu	37	20	1559087	1559087	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:1559087G>T	ENST00000381605.4	-	2	394	c.330C>A	c.(328-330)atC>atA	p.I110I	SIRPB1_ENST00000262929.5_Silent_p.I109I|RP4-576H24.4_ENST00000564763.1_Silent_p.I110I|SIRPB1_ENST00000381603.3_Silent_p.I110I	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	110	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.I110I(1)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						CTGCTGGGGTGATGTTACTGA	0.502																																							uc010gai.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(328-330)ATC>ATA		signal-regulatory protein beta 1 isoform 1							231.0	198.0	210.0					20																	1559087		2197	4252	6449	SO:0001819	synonymous_variant	10326				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding	g.chr20:1559087G>T	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.330C>A	20.37:g.1559087G>T			Somatic				SIRPB1_uc002wfk.3_Silent_p.I110I	p.I110I	NM_006065	NP_006056	WXS	Illumina HiSeq	Unspecified	O00241	SIRB1_HUMAN			2	429	-			110			Extracellular (Potential).|Ig-like V-type.		A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Silent	SNP	ENST00000381605.4	37	c.330C>A	CCDS13019.1																																																																																				0.502	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065		39	83	1	0	2.58029e-29	0.009718	4.7848e-29	39	83				
MYLK2	85366	broad.mit.edu	37	20	30408221	30408221	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:30408221G>A	ENST00000375994.2	+	2	618	c.345G>A	c.(343-345)caG>caA	p.Q115Q	MYLK2_ENST00000375985.4_Silent_p.Q115Q			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	115					cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.Q115Q(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGCTGAGCAGGGAGCCTCAG	0.692																																							uc002wwq.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6						c.(343-345)CAG>CAA		skeletal myosin light chain kinase							28.0	32.0	30.0					20																	30408221		2202	4297	6499	SO:0001819	synonymous_variant	85366				cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity	g.chr20:30408221G>A	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.345G>A	20.37:g.30408221G>A			Somatic					p.Q115Q	NM_033118	NP_149109	WXS	Illumina HiSeq	Unspecified	Q9H1R3	MYLK2_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		3	447	+			115					Q569L1|Q96I84	Silent	SNP	ENST00000375994.2	37	c.345G>A	CCDS13191.1																																																																																				0.692	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118		23	33	0	0	0	0.004656	0	23	33				
MYBL2	4605	broad.mit.edu	37	20	42331478	42331478	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:42331478G>T	ENST00000217026.4	+	8	1427	c.1300G>T	c.(1300-1302)Gat>Tat	p.D434Y	MYBL2_ENST00000396863.4_Missense_Mutation_p.D410Y	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	434					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D434Y(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GTCCTTCCTGGATTCCTGTAA	0.602																																							uc002xlb.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|kidney(2)	5						c.(1300-1302)GAT>TAT		MYB-related protein B							130.0	105.0	113.0					20																	42331478		2203	4300	6503	SO:0001583	missense	4605					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:42331478G>T		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1300G>T	20.37:g.42331478G>T	ENSP00000217026:p.Asp434Tyr		Somatic				MYBL2_uc010zwj.1_Missense_Mutation_p.D410Y|MYBL2_uc002xla.1_Missense_Mutation_p.D434Y	p.D434Y	NM_002466	NP_002457	WXS	Illumina HiSeq	Unspecified	P10244	MYBB_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		8	1515	+		Myeloproliferative disorder(115;0.00452)	434					B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	c.1300G>T	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218950	0.58560	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.16457	2.34;2.34	4.99	4.99	0.66335	.	0.183612	0.44902	D	0.000418	T	0.26159	0.0638	L	0.27053	0.805	0.49389	D	0.999785	D;D	0.76494	0.998;0.999	D;D	0.68192	0.929;0.956	T	0.01360	-1.1375	10	0.72032	D	0.01	-34.7343	11.0276	0.47753	0.0877:0.0:0.9123:0.0	.	410;434	F8W6N6;P10244	.;MYBB_HUMAN	Y	410;434	ENSP00000380072:D410Y;ENSP00000217026:D434Y	ENSP00000217026:D434Y	D	+	1	0	MYBL2	41764892	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	7.419000	0.80179	2.488000	0.83962	0.462000	0.41574	GAT		0.602	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466		23	46	1	0	4.16121e-05	0.016522	4.75923e-05	23	46				
SLC12A5	57468	broad.mit.edu	37	20	44685923	44685923	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:44685923C>A	ENST00000454036.2	+	25	3358	c.3309C>A	c.(3307-3309)aaC>aaA	p.N1103K	SLC12A5_ENST00000243964.3_Missense_Mutation_p.N1080K	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1103					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.N1080K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CTCCCCGCAACCGCAATGGTG	0.567																																							uc010zxl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(3307-3309)AAC>AAA		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						93.0	97.0	95.0					20																	44685923		2203	4300	6503	SO:0001583	missense	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44685923C>A	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3309C>A	20.37:g.44685923C>A	ENSP00000387694:p.Asn1103Lys		Somatic				SLC12A5_uc002xrb.2_Missense_Mutation_p.N1080K	p.N1103K	NM_001134771	NP_001128243	WXS	Illumina HiSeq	Unspecified	Q9H2X9	S12A5_HUMAN			25	3385	+		Myeloproliferative disorder(115;0.0122)	1103			Cytoplasmic (Potential).		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	37	c.3309C>A	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026176	0.54683	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.45276	0.9;0.9	4.57	2.63	0.31362	.	0.111608	0.64402	D	0.000013	T	0.46541	0.1398	L	0.40543	1.245	0.80722	D	1	B;P	0.37548	0.083;0.599	B;P	0.51657	0.04;0.676	T	0.41662	-0.9496	10	0.56958	D	0.05	.	10.2066	0.43116	0.0:0.8376:0.0:0.1624	.	1103;1080	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	K	1103;1080	ENSP00000387694:N1103K;ENSP00000243964:N1080K	ENSP00000243964:N1080K	N	+	3	2	SLC12A5	44119330	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.886000	0.48578	0.544000	0.28883	-0.300000	0.09419	AAC		0.567	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			15	116	1	0	7.07596e-05	0.006122	7.99709e-05	15	116				
SLC2A10	81031	broad.mit.edu	37	20	45355567	45355567	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:45355567C>G	ENST00000359271.2	+	3	1603	c.1353C>G	c.(1351-1353)tgC>tgG	p.C451W		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	451					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.C451W(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				TCGCCTTCTGCAACAGCTTCA	0.567																																							uc002xsl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1351-1353)TGC>TGG		solute carrier family 2 member 10							164.0	149.0	154.0					20																	45355567		2203	4300	6503	SO:0001583	missense	81031					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr20:45355567C>G	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1353C>G	20.37:g.45355567C>G	ENSP00000352216:p.Cys451Trp		Somatic					p.C451W	NM_030777	NP_110404	WXS	Illumina HiSeq	Unspecified	O95528	GTR10_HUMAN			3	1450	+		Myeloproliferative disorder(115;0.0122)	451			Helical; Name=11; (Potential).		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	c.1353C>G	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297464	0.40694	.	.	ENSG00000197496	ENST00000359271	T	0.74209	-0.82	5.8	3.84	0.44239	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.160951	0.56097	D	0.000029	D	0.83995	0.5375	M	0.77712	2.385	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.82376	-0.0488	10	0.38643	T	0.18	-26.7812	11.1023	0.48182	0.0:0.7881:0.0:0.2119	.	451	O95528	GTR10_HUMAN	W	451	ENSP00000352216:C451W	ENSP00000352216:C451W	C	+	3	2	SLC2A10	44788974	0.984000	0.35163	1.000000	0.80357	0.430000	0.31655	0.226000	0.17776	0.750000	0.32877	-0.444000	0.05651	TGC		0.567	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			6	153	0	0	0	0.001168	0	6	153				
ATP9A	10079	broad.mit.edu	37	20	50244178	50244178	+	Silent	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:50244178T>C	ENST00000338821.5	-	17	2070	c.1806A>G	c.(1804-1806)gcA>gcG	p.A602A	ATP9A_ENST00000402822.1_Silent_p.A481A|ATP9A_ENST00000311637.5_Silent_p.A466A	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	602					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A602A(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GAGACTTCTTTGCCACCACGA	0.562																																							uc002xwg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1804-1806)GCA>GCG		ATPase, class II, type 9A							236.0	217.0	224.0					20																	50244178		2203	4300	6503	SO:0001819	synonymous_variant	10079				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr20:50244178T>C	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1806A>G	20.37:g.50244178T>C			Somatic				ATP9A_uc010gih.1_Silent_p.A466A|ATP9A_uc002xwf.1_Intron	p.A602A	NM_006045	NP_006036	WXS	Illumina HiSeq	Unspecified	O75110	ATP9A_HUMAN			17	1806	-			602			Cytoplasmic (Potential).		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	c.1806A>G	CCDS33489.1																																																																																				0.562	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		67	256	0	0	0	0.01441	0	67	256				
LAMA5	3911	broad.mit.edu	37	20	60913645	60913645	+	Silent	SNP	T	T	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:60913645T>A	ENST00000252999.3	-	12	1563	c.1497A>T	c.(1495-1497)gcA>gcT	p.A499A		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	499	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.A499A(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CCTGGGTCCCTGCCGCGCTGC	0.647																																							uc002ycq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(1495-1497)GCA>GCT		laminin alpha 5 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						30.0	29.0	30.0					20																	60913645		2198	4294	6492	SO:0001819	synonymous_variant	3911				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding	g.chr20:60913645T>A	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.1497A>T	20.37:g.60913645T>A			Somatic					p.A499A	NM_005560	NP_005551	WXS	Illumina HiSeq	Unspecified	O15230	LAMA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		12	1564	-	Breast(26;1.57e-08)		499			Laminin EGF-like 4.		Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	c.1497A>T	CCDS33502.1																																																																																				0.647	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560		10	6	0	0	0	0.010729	0	10	6				
ADAMTS5	11096	broad.mit.edu	37	21	28315732	28315732	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr21:28315732C>A	ENST00000284987.5	-	3	1493	c.1372G>T	c.(1372-1374)Gcc>Tcc	p.A458S		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	458	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A458S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GTGATGGTGGCTGAAGTGCAT	0.423																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(1372-1374)GCC>TCC		ADAM metallopeptidase with thrombospondin type 1							114.0	95.0	101.0					21																	28315732		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28315732C>A	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1372G>T	21.37:g.28315732C>A	ENSP00000284987:p.Ala458Ser		Somatic					p.A458S	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			3	2101	-			458			Peptidase M12B.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.1372G>T	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237500	0.58886	.	.	ENSG00000154736	ENST00000284987	T	0.03496	3.91	5.1	5.1	0.69264	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.051907	0.85682	D	0.000000	T	0.05640	0.0148	L	0.41492	1.28	0.58432	D	0.999997	B	0.23735	0.09	B	0.32149	0.141	T	0.46857	-0.9161	10	0.12103	T	0.63	.	19.1373	0.93433	0.0:1.0:0.0:0.0	.	458	Q9UNA0	ATS5_HUMAN	S	458	ENSP00000284987:A458S	ENSP00000284987:A458S	A	-	1	0	ADAMTS5	27237603	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	1.469000	0.35343	2.828000	0.97474	0.650000	0.86243	GCC		0.423	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			11	20	1	0	3.07112e-06	0.010729	3.71255e-06	11	20				
RIPK4	54101	broad.mit.edu	37	21	43187057	43187057	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr21:43187057C>T	ENST00000352483.2	-	1	209	c.145G>A	c.(145-147)Gcc>Acc	p.A49T	RIPK4_ENST00000542057.1_5'Flank|RIPK4_ENST00000544709.1_5'Flank|RIPK4_ENST00000332512.3_Missense_Mutation_p.A49T			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A49T(2)		NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CACTTGATGGCCAGCCAGGTC	0.731																																							uc002yzn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(145-147)GCC>ACC		ankyrin repeat domain 3							29.0	26.0	27.0					21																	43187057		2202	4300	6502	SO:0001583	missense	54101					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr21:43187057C>T	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.145G>A	21.37:g.43187057C>T	ENSP00000330161:p.Ala49Thr		Somatic					p.A49T	NM_020639	NP_065690	WXS	Illumina HiSeq	Unspecified	P57078	RIPK4_HUMAN			1	193	-			49					Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37	c.145G>A		.	.	.	.	.	.	.	.	.	.	C	32	5.129822	0.94473	.	.	ENSG00000183421	ENST00000332512;ENST00000352483	T;T	0.80480	-1.38;-1.38	3.67	3.67	0.42095	.	0.000000	0.53938	U	0.000052	D	0.92140	0.7508	H	0.95539	3.685	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.94445	0.7662	10	0.87932	D	0	-20.4522	14.3845	0.66934	0.0:1.0:0.0:0.0	.	49	P57078-2	.	T	49	ENSP00000332454:A49T;ENSP00000330161:A49T	ENSP00000332454:A49T	A	-	1	0	RIPK4	42060126	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	6.676000	0.74498	1.588000	0.49971	0.305000	0.20034	GCC		0.731	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639		9	7	0	0	0	0.006214	0	9	7				
MYO18B	84700	broad.mit.edu	37	22	26165124	26165124	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr22:26165124A>T	ENST00000407587.2	+	4	1410	c.1241A>T	c.(1240-1242)aAg>aTg	p.K414M	MYO18B_ENST00000536101.1_Missense_Mutation_p.K414M|MYO18B_ENST00000335473.7_Missense_Mutation_p.K414M			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	414						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K414M(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAGACAGAGAAGGGCTGTGAA	0.607																																							uc003abz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(1240-1242)AAG>ATG		myosin XVIIIB							29.0	36.0	34.0					22																	26165124		2162	4264	6426	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26165124A>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1241A>T	22.37:g.26165124A>T	ENSP00000386096:p.Lys414Met		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.K295M|MYO18B_uc010guy.1_Missense_Mutation_p.K295M|MYO18B_uc010guz.1_Missense_Mutation_p.K295M|MYO18B_uc011aka.1_Translation_Start_Site|MYO18B_uc011akb.1_5'Flank	p.K414M	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			4	1491	+			414					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.1241A>T		.	.	.	.	.	.	.	.	.	.	A	14.15	2.448573	0.43531	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88277	-2.34;-2.34;-2.36	4.73	3.67	0.42095	.	.	.	.	.	D	0.89273	0.6668	L	0.57536	1.79	0.09310	N	1	P;P;P	0.43094	0.697;0.799;0.799	B;P;P	0.50378	0.436;0.639;0.639	T	0.81081	-0.1094	9	0.87932	D	0	.	6.6611	0.23014	0.6894:0.1583:0.0:0.1523	.	414;414;414	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	M	414	ENSP00000441229:K414M;ENSP00000334563:K414M;ENSP00000386096:K414M	ENSP00000334563:K414M	K	+	2	0	MYO18B	24495124	0.033000	0.19621	0.001000	0.08648	0.039000	0.13416	1.479000	0.35453	0.727000	0.32360	0.402000	0.26972	AAG		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		4	4	0	0	0	0.001168	0	4	4				
SH3BP1	23616	broad.mit.edu	37	22	38046636	38046636	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr22:38046636C>T	ENST00000357436.4	+	16	1815	c.1502C>T	c.(1501-1503)tCc>tTc	p.S501F	SH3BP1_ENST00000599616.1_Missense_Mutation_p.S437F|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	501					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)	p.S501F(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GAACTTCCGTCCACTGCCGTG	0.622																																							uc003ati.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1501-1503)TCC>TTC		SH3-domain binding protein 1							49.0	45.0	47.0					22																	38046636		2203	4300	6503	SO:0001583	missense	23616				signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding	g.chr22:38046636C>T		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1502C>T	22.37:g.38046636C>T	ENSP00000350018:p.Ser501Phe		Somatic				SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_3'UTR|SH3BP1_uc003ath.1_Missense_Mutation_p.S501F|SH3BP1_uc003atj.1_Missense_Mutation_p.S437F|SH3BP1_uc003atk.1_Missense_Mutation_p.S415F|uc003atl.1_RNA	p.S501F	NM_018957	NP_061830	WXS	Illumina HiSeq	Unspecified	Q9Y3L3	3BP1_HUMAN			16	1613	+	Melanoma(58;0.0574)		501					Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	c.1502C>T	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526974	0.27299	.	.	ENSG00000100092	ENST00000357436;ENST00000397014	T	0.18502	2.21	4.54	1.05	0.20165	.	2.382590	0.01620	N	0.022973	T	0.07908	0.0198	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.26775	0.159;0.0;0.0;0.159	B;B;B;B	0.18871	0.023;0.0;0.0;0.023	T	0.22487	-1.0215	10	0.10902	T	0.67	.	3.8752	0.09053	0.1678:0.5787:0.1624:0.0911	.	415;437;501;415	E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;3BP1_HUMAN;.	F	501;415	ENSP00000350018:S501F	ENSP00000350018:S501F	S	+	2	0	SH3BP1	36376582	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.975000	0.29449	0.202000	0.20498	0.655000	0.94253	TCC		0.622	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957		15	32	0	0	0	0.004007	0	15	32				
IL17RE	132014	broad.mit.edu	37	3	9948463	9948463	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:9948463A>T	ENST00000383814.3	+	5	545	c.440A>T	c.(439-441)cAc>cTc	p.H147L	IL17RE_ENST00000295980.3_Missense_Mutation_p.H147L|IL17RE_ENST00000454190.2_Missense_Mutation_p.H147L|IL17RE_ENST00000421412.1_Missense_Mutation_p.H180L	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	147					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H147L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		GACATCTCCCACAAGGGACTT	0.542																																							uc003btu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(439-441)CAC>CTC		interleukin 17 receptor E isoform 1							142.0	140.0	141.0					3																	9948463		2203	4300	6503	SO:0001583	missense	132014					cytoplasm|extracellular region|integral to membrane	receptor activity	g.chr3:9948463A>T	AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.440A>T	3.37:g.9948463A>T	ENSP00000373325:p.His147Leu		Somatic				CIDEC_uc003bto.2_Intron|IL17RE_uc003btv.2_Missense_Mutation_p.H147L|IL17RE_uc011atn.1_RNA|IL17RE_uc003btw.2_Missense_Mutation_p.H147L|IL17RE_uc003btx.2_Missense_Mutation_p.H31L|IL17RE_uc010hcq.2_Missense_Mutation_p.H147L|IL17RE_uc003bty.2_RNA	p.H147L	NM_153483	NP_705616	WXS	Illumina HiSeq	Unspecified	Q8NFR9	I17RE_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)	6	557	+			147			Extracellular (Potential).		B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Missense_Mutation	SNP	ENST00000383814.3	37	c.440A>T	CCDS2589.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114171	0.37339	.	.	ENSG00000163701	ENST00000421412;ENST00000295980;ENST00000383814;ENST00000454190;ENST00000454992;ENST00000441648	T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46	5.5	-1.85	0.07784	.	0.846840	0.10665	N	0.648238	T	0.13841	0.0335	L	0.53249	1.67	0.09310	N	1	B;B;B	0.33103	0.397;0.358;0.255	B;B;B	0.30316	0.114;0.086;0.053	T	0.21280	-1.0250	10	0.72032	D	0.01	-0.2348	5.7026	0.17891	0.3894:0.4146:0.196:0.0	.	147;147;147	Q8NFR9-3;Q8NFR9-5;Q8NFR9	.;.;I17RE_HUMAN	L	180;147;147;147;107;30	ENSP00000404916:H180L;ENSP00000295980:H147L;ENSP00000373325:H147L;ENSP00000388086:H147L;ENSP00000400768:H107L	ENSP00000295980:H147L	H	+	2	0	IL17RE	9923463	0.000000	0.05858	0.000000	0.03702	0.780000	0.44128	0.452000	0.21795	-0.232000	0.09811	-0.314000	0.08810	CAC		0.542	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250529.1	NM_153480		6	88	0	0	0	0.001168	0	6	88				
HTR1F	3355	broad.mit.edu	37	3	88040430	88040430	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:88040430C>A	ENST00000319595.4	+	1	585	c.531C>A	c.(529-531)gaC>gaA	p.D177E		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	177					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.D177E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TCAAGCACGACCACATTGTTT	0.378																																							uc003dqr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(529-531)GAC>GAA		5-hydroxytryptamine (serotonin) receptor 1F	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)						82.0	83.0	83.0					3																	88040430		2203	4300	6503	SO:0001583	missense	3355				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity	g.chr3:88040430C>A	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.531C>A	3.37:g.88040430C>A	ENSP00000322924:p.Asp177Glu		Somatic					p.D177E	NM_000866	NP_000857	WXS	Illumina HiSeq	Unspecified	P30939	5HT1F_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	2	689	+	all_cancers(8;0.147)	Lung NSC(201;0.0283)	177			Extracellular (By similarity).			Missense_Mutation	SNP	ENST00000319595.4	37	c.531C>A	CCDS2920.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878913	0.72294	.	.	ENSG00000179097	ENST00000319595	T	0.38887	1.11	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.169548	0.52532	D	0.000078	T	0.49762	0.1576	L	0.35854	1.095	0.44136	D	0.996925	D	0.56287	0.975	P	0.58266	0.836	T	0.32455	-0.9906	10	0.28530	T	0.3	.	16.5191	0.84309	0.0:1.0:0.0:0.0	.	177	P30939	5HT1F_HUMAN	E	177	ENSP00000322924:D177E	ENSP00000322924:D177E	D	+	3	2	HTR1F	88123120	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.543000	0.45752	2.512000	0.84698	0.460000	0.39030	GAC		0.378	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		27	8	1	0	7.76418e-22	0.005443	1.31235e-21	27	8				
ZPLD1	131368	broad.mit.edu	37	3	102189285	102189285	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:102189285G>T	ENST00000491959.1	+	16	1863	c.981G>T	c.(979-981)tgG>tgT	p.W327C	ZPLD1_ENST00000306176.1_Missense_Mutation_p.W343C|ZPLD1_ENST00000466937.1_Missense_Mutation_p.W327C			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	327						integral component of membrane (GO:0016021)		p.W343C(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						GGACGACTTGGAGCCCCCAGA	0.507																																							uc003dvs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(979-981)TGG>TGT		zona pellucida-like domain containing 1							105.0	99.0	101.0					3																	102189285		2203	4300	6503	SO:0001583	missense	131368					integral to membrane		g.chr3:102189285G>T	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.981G>T	3.37:g.102189285G>T	ENSP00000420265:p.Trp327Cys		Somatic				ZPLD1_uc003dvt.1_Missense_Mutation_p.W343C|ZPLD1_uc011bhg.1_Missense_Mutation_p.W327C	p.W327C	NM_175056	NP_778226	WXS	Illumina HiSeq	Unspecified	Q8TCW7	ZPLD1_HUMAN			16	1863	+			327			Extracellular (Potential).		Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37	c.981G>T		.	.	.	.	.	.	.	.	.	.	G	8.860	0.946720	0.18356	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	T;T;T	0.80994	-1.42;-1.44;-1.42	5.65	5.65	0.86999	.	0.796954	0.12457	N	0.467268	T	0.69233	0.3088	N	0.19112	0.55	0.58432	D	0.999998	B;P	0.42785	0.284;0.79	B;B	0.37550	0.18;0.253	T	0.70375	-0.4889	10	0.52906	T	0.07	-26.6239	13.3068	0.60357	0.0726:0.0:0.9274:0.0	.	343;327	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	C	327;343;327	ENSP00000420265:W327C;ENSP00000307801:W343C;ENSP00000418253:W327C	ENSP00000307801:W343C	W	+	3	0	ZPLD1	103671975	0.989000	0.36119	0.901000	0.35422	0.274000	0.26718	2.253000	0.43205	2.821000	0.97095	0.561000	0.74099	TGG		0.507	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056		17	7	1	0	5.03518e-11	0.007413	6.86943e-11	17	7				
PARP9	83666	broad.mit.edu	37	3	122259566	122259566	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:122259566C>G	ENST00000360356.2	-	8	1850	c.1623G>C	c.(1621-1623)caG>caC	p.Q541H	PARP9_ENST00000462315.1_Missense_Mutation_p.Q506H|PARP9_ENST00000492382.1_Missense_Mutation_p.Q86H|PARP9_ENST00000477522.2_Missense_Mutation_p.Q506H|PARP9_ENST00000471785.1_Missense_Mutation_p.Q506H	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	541					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.Q541H(1)		endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TGTGGTGGTTCTGGAGACTCA	0.443																																							uc010hri.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|prostate(1)|skin(1)	4						c.(1621-1623)CAG>CAC		poly (ADP-ribose) polymerase family, member 9							154.0	152.0	152.0					3																	122259566		2203	4300	6503	SO:0001583	missense	83666				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr3:122259566C>G	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.1623G>C	3.37:g.122259566C>G	ENSP00000353512:p.Gln541His		Somatic				PARP9_uc003eff.3_Missense_Mutation_p.Q506H|PARP9_uc011bjs.1_Missense_Mutation_p.Q506H|PARP9_uc003efg.2_Missense_Mutation_p.Q86H|PARP9_uc003efi.2_Missense_Mutation_p.Q506H|PARP9_uc003efh.2_Missense_Mutation_p.Q541H|PARP9_uc003efj.2_Missense_Mutation_p.Q506H	p.Q541H	NM_001146102	NP_001139574	WXS	Illumina HiSeq	Unspecified	Q8IXQ6	PARP9_HUMAN		GBM - Glioblastoma multiforme(114;0.0519)	8	1768	-			541					A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	37	c.1623G>C	CCDS3014.1	.	.	.	.	.	.	.	.	.	.	C	8.887	0.953101	0.18431	.	.	ENSG00000138496	ENST00000360356;ENST00000492382;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T;T	0.20738	3.07;2.8;2.92;2.92;2.05	4.98	3.2	0.36748	.	1.342190	0.04949	N	0.459918	T	0.15478	0.0373	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.19331	0.011;0.002;0.035;0.009	B;B;B;B	0.18871	0.016;0.003;0.023;0.016	T	0.26744	-1.0094	10	0.46703	T	0.11	.	6.2865	0.21037	0.1814:0.7261:0.0:0.0925	.	506;541;86;506	E9PFM7;Q8IXQ6;G5E9U8;Q8IXQ6-2	.;PARP9_HUMAN;.;.	H	541;86;506;506;464;506	ENSP00000353512:Q541H;ENSP00000417664:Q86H;ENSP00000419506:Q506H;ENSP00000419001:Q506H;ENSP00000418894:Q506H	ENSP00000353512:Q541H	Q	-	3	2	PARP9	123742256	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.901000	0.28445	0.700000	0.31782	-0.158000	0.13435	CAG		0.443	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458		6	98	0	0	0	0.001168	0	6	98				
CEP70	80321	broad.mit.edu	37	3	138219359	138219359	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:138219359G>A	ENST00000264982.3	-	15	1685	c.1419C>T	c.(1417-1419)ttC>ttT	p.F473F	CEP70_ENST00000484888.1_Silent_p.F473F|CEP70_ENST00000542237.1_Silent_p.F453F|CEP70_ENST00000489254.1_Silent_p.F321F|CEP70_ENST00000481834.1_Silent_p.F473F	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	473					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.F473F(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						ATAACTTTTGGAAGTGAGAAA	0.353																																							uc003esl.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1417-1419)TTC>TTT		centrosomal protein 70 kDa							203.0	235.0	224.0					3																	138219359		2203	4300	6503	SO:0001819	synonymous_variant	80321				G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding	g.chr3:138219359G>A	AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1419C>T	3.37:g.138219359G>A			Somatic				CEP70_uc011bmk.1_Silent_p.F453F|CEP70_uc011bml.1_Silent_p.F455F|CEP70_uc011bmm.1_Silent_p.F321F|CEP70_uc003esm.2_Silent_p.F473F	p.F473F	NM_024491	NP_077817	WXS	Illumina HiSeq	Unspecified	Q8NHQ1	CEP70_HUMAN			15	1617	-			473					B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Silent	SNP	ENST00000264982.3	37	c.1419C>T	CCDS3102.1																																																																																				0.353	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491		88	125	0	0	0	0.01441	0	88	125				
LIPH	200879	broad.mit.edu	37	3	185251403	185251403	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr3:185251403C>T	ENST00000296252.4	-	3	623	c.482G>A	c.(481-483)gGg>gAg	p.G161E	LIPH_ENST00000424591.2_Missense_Mutation_p.G161E	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	161					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.G161E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			TCCAACAAACCCAGATATGTG	0.483																																							uc003fpm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(481-483)GGG>GAG		lipase, member H precursor							173.0	156.0	161.0					3																	185251403		2203	4300	6503	SO:0001583	missense	200879				lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity	g.chr3:185251403C>T	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.482G>A	3.37:g.185251403C>T	ENSP00000296252:p.Gly161Glu		Somatic				LIPH_uc010hyh.2_Missense_Mutation_p.G161E	p.G161E	NM_139248	NP_640341	WXS	Illumina HiSeq	Unspecified	Q8WWY8	LIPH_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)		3	592	-	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		161					A2IBA7|Q8TEC7	Missense_Mutation	SNP	ENST00000296252.4	37	c.482G>A	CCDS3272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.55|18.55	3.648148|3.648148	0.67358|0.67358	.|.	.|.	ENSG00000163898|ENSG00000163898	ENST00000296252;ENST00000424591|ENST00000452897	D;D|D	0.95885|0.95724	-3.84;-2.99|-3.79	5.3|5.3	5.3|5.3	0.74995|0.74995	Lipase, N-terminal (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.98883|0.98883	0.9622|0.9622	H|H	0.99182|0.99182	4.46|4.46	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.99453|0.99453	1.0941|1.0941	10|8	0.87932|0.87932	D|D	0|0	-17.0096|-17.0096	17.9204|17.9204	0.88964|0.88964	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	161;161|.	A2IBA6;Q8WWY8|.	.;LIPH_HUMAN|.	E|S	161|16	ENSP00000296252:G161E;ENSP00000396384:G161E|ENSP00000408218:G16S	ENSP00000296252:G161E|ENSP00000408218:G16S	G|G	-|-	2|1	0|0	LIPH|LIPH	186734097|186734097	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.910000|0.910000	0.53928|0.53928	6.938000|6.938000	0.75904|0.75904	2.454000|2.454000	0.82982|0.82982	0.591000|0.591000	0.81541|0.81541	GGG|GGT		0.483	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1			22	47	0	0	0	0.004656	0	22	47				
GABRG1	2565	broad.mit.edu	37	4	46125866	46125866	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:46125866C>G	ENST00000295452.4	-	1	232	c.65G>C	c.(64-66)aGg>aCg	p.R22T		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	22					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R22T(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAAGACCAACCTCACCCCTCT	0.453																																							uc003gxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(64-66)AGG>ACG		gamma-aminobutyric acid A receptor, gamma 1							76.0	80.0	79.0					4																	46125866		2203	4300	6503	SO:0001583	missense	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46125866C>G	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.65G>C	4.37:g.46125866C>G	ENSP00000295452:p.Arg22Thr		Somatic					p.R22T	NM_173536	NP_775807	WXS	Illumina HiSeq	Unspecified	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	1	217	-			22					Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	c.65G>C	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	9.720	1.159416	0.21454	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.67171	-0.25	4.88	4.03	0.46877	.	0.473916	0.22551	N	0.058584	T	0.51346	0.1669	L	0.44542	1.39	0.35884	D	0.829172	B	0.33694	0.421	B	0.29862	0.108	T	0.53746	-0.8395	10	0.12430	T	0.62	.	9.1332	0.36857	0.0:0.9006:0.0:0.0994	.	22	Q8N1C3	GBRG1_HUMAN	T	22	ENSP00000295452:R22T	ENSP00000295452:R22T	R	-	2	0	GABRG1	45820623	0.992000	0.36948	1.000000	0.80357	0.328000	0.28507	2.169000	0.42434	1.419000	0.47118	0.563000	0.77884	AGG		0.453	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		5	38	0	0	0	0.001168	0	5	38				
EPHA5	2044	broad.mit.edu	37	4	66231689	66231689	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:66231689C>G	ENST00000273854.3	-	11	2611	c.2011G>C	c.(2011-2013)Gaa>Caa	p.E671Q	EPHA5_ENST00000432638.2_Missense_Mutation_p.E508Q|EPHA5_ENST00000511294.1_Missense_Mutation_p.E672Q|EPHA5_ENST00000354839.4_Missense_Mutation_p.E649Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	671					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.E671Q(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CATGATGCTTCTATCTCCTTA	0.358										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2011-2013)GAA>CAA		ephrin receptor EphA5 isoform a precursor							241.0	193.0	209.0					4																	66231689		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66231689C>G	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2011G>C	4.37:g.66231689C>G	ENSP00000273854:p.Glu671Gln	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.E603Q|EPHA5_uc003hcz.2_Missense_Mutation_p.E649Q|EPHA5_uc011cah.1_Missense_Mutation_p.E672Q|EPHA5_uc011cai.1_Missense_Mutation_p.E650Q|EPHA5_uc003hda.2_Missense_Mutation_p.E672Q	p.E671Q	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			11	2204	-			671			Cytoplasmic (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2011G>C	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646835	0.67358	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	5.54	5.54	0.83059	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000016	T	0.19287	0.0463	M	0.69823	2.125	0.51482	D	0.999925	B;B;B;P	0.36048	0.072;0.123;0.117;0.534	B;B;B;B	0.27500	0.036;0.08;0.08;0.062	T	0.03184	-1.1063	10	0.87932	D	0	.	19.478	0.94996	0.0:1.0:0.0:0.0	.	650;672;649;671	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	671;508;649;672	ENSP00000273854:E671Q;ENSP00000389208:E508Q;ENSP00000346899:E649Q;ENSP00000427638:E672Q	ENSP00000273854:E671Q	E	-	1	0	EPHA5	65914284	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.042000	0.70996	2.609000	0.88269	0.557000	0.71058	GAA		0.358	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		46	40	0	0	0	0.01441	0	46	40				
MUC7	4589	broad.mit.edu	37	4	71346861	71346861	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:71346861C>A	ENST00000304887.5	+	3	590	c.400C>A	c.(400-402)Cag>Aag	p.Q134K	MUC7_ENST00000413702.1_Missense_Mutation_p.Q134K|MUC7_ENST00000456088.1_Missense_Mutation_p.Q134K|MUC7_ENST00000514512.1_3'UTR	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	134	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q134K(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			TTTTCTTCCCCAGAATGCCAC	0.453																																							uc011cat.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(400-402)CAG>AAG		mucin 7, secreted precursor							153.0	143.0	146.0					4																	71346861		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71346861C>A	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.400C>A	4.37:g.71346861C>A	ENSP00000302021:p.Gln134Lys		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.Q134K|MUC7_uc003hfj.2_Missense_Mutation_p.Q134K|uc011cav.1_RNA	p.Q134K	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	688	+			134			Thr-rich.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.400C>A	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	1.809	-0.475090	0.04414	.	.	ENSG00000171195	ENST00000413702;ENST00000505411;ENST00000456088;ENST00000304887	T;T;T;T	0.50813	0.74;0.73;0.74;0.74	3.25	1.42	0.22433	.	.	.	.	.	T	0.27205	0.0667	N	0.24115	0.695	0.09310	N	1	P	0.46512	0.879	B	0.36885	0.235	T	0.08764	-1.0706	9	0.18276	T	0.48	1.2473	9.5559	0.39339	0.3775:0.6225:0.0:0.0	.	134	Q8TAX7	MUC7_HUMAN	K	134	ENSP00000407422:Q134K;ENSP00000427594:Q134K;ENSP00000400585:Q134K;ENSP00000302021:Q134K	ENSP00000302021:Q134K	Q	+	1	0	MUC7	71381450	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.092000	0.30927	0.341000	0.23771	0.655000	0.94253	CAG		0.453	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		38	59	1	0	4.32679e-17	0.006999	6.82989e-17	38	59				
PDHA2	5161	broad.mit.edu	37	4	96761794	96761794	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:96761794G>A	ENST00000295266.4	+	1	556	c.493G>A	c.(493-495)Gtc>Atc	p.V165I		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	165					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.V165I(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		CAATGGCATCGTCGGTGCACA	0.507																																							uc003htr.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(493-495)GTC>ATC		pyruvate dehydrogenase E1 alpha 2 precursor	NADH(DB00157)						69.0	71.0	71.0					4																	96761794		2203	4300	6503	SO:0001583	missense	5161				glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity	g.chr4:96761794G>A		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.493G>A	4.37:g.96761794G>A	ENSP00000295266:p.Val165Ile		Somatic					p.V165I	NM_005390	NP_005381	WXS	Illumina HiSeq	Unspecified	P29803	ODPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	1	556	+		Hepatocellular(203;0.114)	165					B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	c.493G>A	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659398	0.47467	.	.	ENSG00000163114	ENST00000295266	D	0.95853	-3.83	4.67	4.67	0.58626	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.93367	0.7885	M	0.68952	2.095	0.80722	D	1	P	0.43750	0.816	B	0.34873	0.191	D	0.94488	0.7699	10	0.87932	D	0	-1.6001	15.4624	0.75369	0.0:0.0:1.0:0.0	.	165	P29803	ODPAT_HUMAN	I	165	ENSP00000295266:V165I	ENSP00000295266:V165I	V	+	1	0	PDHA2	96980817	1.000000	0.71417	0.849000	0.33467	0.107000	0.19398	8.809000	0.91944	2.587000	0.87381	0.467000	0.42956	GTC		0.507	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			29	67	0	0	0	0.00632	0	29	67				
ADH5	128	broad.mit.edu	37	4	100009932	100009932	+	5'Flank	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:100009932C>A	ENST00000296412.8	-	0	0				RP11-696N14.1_ENST00000499178.2_RNA|RP11-696N14.1_ENST00000500358.2_RNA	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		TGGCGAGCGCCTAGCGAGGGG	0.711																																							uc003hui.2		NA																	0				ovary(1)	1						c.e1-1		class III alcohol dehydrogenase, chi subunit	NADH(DB00157)						3.0	3.0	3.0					4																	100009932		628	1444	2072	SO:0001631	upstream_gene_variant	128				ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding	g.chr4:100009932C>A	M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230		4.37:g.100009932C>A	Exception_encountered		Somatic				ADH5_uc003huk.1_Splice_Site|uc003hum.1_5'Flank|uc003hul.1_5'Flank		NM_000671	NP_000662	WXS	Illumina HiSeq	Unspecified	P11766	ADHX_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	1	1	-									Splice_Site	SNP	ENST00000296412.8	37	c.-79_splice	CCDS47111.1																																																																																				0.711	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364224.1	NM_000671		5	15	1	0	0.00116845	0.001168	0.0012826	5	15				
DNAH5	1767	broad.mit.edu	37	5	13717423	13717424	+	Splice_Site	DNP	CC	CC	AA			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:13717423_13717424CC>AA	ENST00000265104.4	-	73	12809_12810	c.12705_12706GG>TT	c.(12703-12708)aaGGgt>aaTTgt	p.4235_4236KG>NC		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4235					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.?(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGCGGCAGTACCTTTTTGACAT	0.495									Kartagener syndrome																														uc003jfd.2		NA																	1	Unknown(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.e73+1		dynein, axonemal, heavy chain 5																																				SO:0001630	splice_region_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13717423_13717424CC>AA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12705_12706delinsAA	5.37:g.13717423_13717424delinsAA			Somatic				DNAH5_uc003jfc.2_Splice_Site_p.K403_splice	p.K4235_splice	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			73	12747	-	Lung NSC(4;0.00476)							Q92860|Q96L74|Q9H5S7|Q9HCG9	Splice_Site	DNP	ENST00000265104.4	37	c.12705_splice	CCDS3882.1																																																																																				0.495	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	Missense_Mutation	13	19	0	0	0	0.004672	0	13	19				
CDH10	1008	broad.mit.edu	37	5	24511534	24511534	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:24511534C>A	ENST00000264463.4	-	6	1411	c.904G>T	c.(904-906)Gct>Tct	p.A302S		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	302	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A302S(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCTACTTCAGCATTTTTCCCA	0.428										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(904-906)GCT>TCT		cadherin 10, type 2 preproprotein							197.0	161.0	173.0					5																	24511534		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24511534C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.904G>T	5.37:g.24511534C>A	ENSP00000264463:p.Ala302Ser	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.A302S	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	6	1236	-			302			Cadherin 3.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.904G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984432	0.93044	.	.	ENSG00000040731	ENST00000264463	T	0.37752	1.18	5.22	5.22	0.72569	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.63200	0.2491	M	0.62209	1.925	0.53005	D	0.999967	B	0.34241	0.444	D	0.65323	0.934	T	0.62534	-0.6834	10	0.56958	D	0.05	.	17.7511	0.88434	0.0:1.0:0.0:0.0	.	302	Q9Y6N8	CAD10_HUMAN	S	302	ENSP00000264463:A302S	ENSP00000264463:A302S	A	-	1	0	CDH10	24547291	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.410000	0.81850	0.650000	0.86243	GCT		0.428	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		26	104	1	0	7.92952e-12	0.021523	1.1055e-11	26	104				
PAPD4	167153	broad.mit.edu	37	5	78964730	78964730	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:78964730G>T	ENST00000296783.3	+	13	1386	c.1087G>T	c.(1087-1089)Gct>Tct	p.A363S	PAPD4_ENST00000453514.1_Missense_Mutation_p.A363S|PAPD4_ENST00000504233.1_Missense_Mutation_p.A320S|PAPD4_ENST00000423041.2_Missense_Mutation_p.A359S|PAPD4_ENST00000428308.2_Missense_Mutation_p.A363S			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	363					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)	p.A363S(1)		biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TTTTAGTCCTGCTATACAGCT	0.393																																							uc010jae.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1087-1089)GCT>TCT		PAP associated domain containing 4							182.0	181.0	181.0					5																	78964730		2203	4300	6503	SO:0001583	missense	167153				histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity	g.chr5:78964730G>T	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.1087G>T	5.37:g.78964730G>T	ENSP00000296783:p.Ala363Ser		Somatic				PAPD4_uc003kgb.2_Missense_Mutation_p.A363S|PAPD4_uc010jaf.1_Missense_Mutation_p.A363S|PAPD4_uc003kga.2_Missense_Mutation_p.A359S|PAPD4_uc003kfz.2_Missense_Mutation_p.A320S	p.A363S	NM_001114393	NP_001107865	WXS	Illumina HiSeq	Unspecified	Q6PIY7	GLD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)	13	1505	+		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)	363					Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	37	c.1087G>T	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285249	0.23478	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	5.5	2.41	0.29592	.	0.676477	0.15451	N	0.261669	T	0.15609	0.0376	N	0.00621	-1.32	0.24546	N	0.994042	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.28235	-1.0050	10	0.08599	T	0.76	-5.6927	4.729	0.12955	0.142:0.0:0.2687:0.5893	.	363;359;320	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	S	363;359;320;363;363	ENSP00000397563:A363S;ENSP00000393412:A359S;ENSP00000421966:A320S;ENSP00000396861:A363S;ENSP00000296783:A363S	ENSP00000296783:A363S	A	+	1	0	PAPD4	79000486	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.996000	0.29719	0.812000	0.34326	0.650000	0.86243	GCT		0.393	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797		92	163	1	0	1.66795e-42	0.01441	3.35345e-42	92	163				
EDIL3	10085	broad.mit.edu	37	5	83525673	83525673	+	Splice_Site	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:83525673C>A	ENST00000296591.5	-	3	644	c.226G>T	c.(226-228)Ggt>Tgt	p.G76C	EDIL3_ENST00000380138.3_Intron	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	76	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.G76C(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GGAACTTTACCTGCTGAAGTT	0.378																																							uc003kio.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(226-228)GGT>TGT		EGF-like repeats and discoidin I-like							84.0	89.0	87.0					5																	83525673		2203	4300	6503	SO:0001630	splice_region_variant	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83525673C>A	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.226+1G>T	5.37:g.83525673C>A			Somatic				EDIL3_uc003kip.1_Intron	p.G76C	NM_005711	NP_005702	WXS	Illumina HiSeq	Unspecified	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	3	645	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	76			EGF-like 2.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.226G>T	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447184	0.63178	.	.	ENSG00000164176	ENST00000296591	D	0.91945	-2.94	5.59	5.59	0.84812	Epidermal growth factor-like, type 3 (1);	0.133420	0.48767	D	0.000176	D	0.95332	0.8485	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94809	0.7977	9	.	.	.	-9.6208	15.0879	0.72170	0.0:1.0:0.0:0.0	.	76	O43854	EDIL3_HUMAN	C	76	ENSP00000296591:G76C	.	G	-	1	0	EDIL3	83561429	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	3.498000	0.53302	2.651000	0.90000	0.491000	0.48974	GGT		0.378	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	Missense_Mutation	16	51	1	0	2.23348e-06	0.004007	2.73459e-06	16	51				
SEMA6A	57556	broad.mit.edu	37	5	115783135	115783135	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:115783135G>A	ENST00000343348.6	-	19	3054	c.2267C>T	c.(2266-2268)cCc>cTc	p.P756L	CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.P756L|CTB-118N6.3_ENST00000512128.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.P773L|SEMA6A_ENST00000282394.6_Missense_Mutation_p.P233L|SEMA6A_ENST00000513137.1_Missense_Mutation_p.P183L|SEMA6A_ENST00000503865.1_Missense_Mutation_p.P135L|CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000508424.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	756					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.P756L(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CTCTGGGGTGGGGAGGGCCGT	0.627																																							uc010jck.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2266-2268)CCC>CTC		sema domain, transmembrane domain (TM), and							96.0	109.0	105.0					5																	115783135		2176	4251	6427	SO:0001583	missense	57556				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity	g.chr5:115783135G>A	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2267C>T	5.37:g.115783135G>A	ENSP00000345512:p.Pro756Leu		Somatic				SEMA6A_uc003krx.3_Missense_Mutation_p.P773L|SEMA6A_uc011cwe.1_Missense_Mutation_p.P135L|SEMA6A_uc003krv.3_Missense_Mutation_p.P183L|SEMA6A_uc003krw.3_Missense_Mutation_p.P233L|SEMA6A_uc010jcj.2_Missense_Mutation_p.P300L	p.P756L	NM_020796	NP_065847	WXS	Illumina HiSeq	Unspecified	Q9H2E6	SEM6A_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)	19	2976	-		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)	756			Cytoplasmic (Potential).		Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	c.2267C>T	CCDS47256.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.16|18.16	3.563166|3.563166	0.65538|0.65538	.|.	.|.	ENSG00000092421|ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000513137;ENST00000282394;ENST00000503865;ENST00000510263|ENST00000515129	T;T;D;T;D;T|T	0.88046|0.62941	-0.81;-0.67;-2.33;-0.33;-2.18;-0.81|-0.01	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.064020|0.064020	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.74673|0.74673	0.3747|0.3747	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.999;1.0;0.999;0.999;0.999;0.999|.	T|T	0.77517|0.77517	-0.2558|-0.2558	10|8	0.87932|0.87932	D|D	0|0	.|.	18.3307|18.3307	0.90268|0.90268	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	135;756;300;773;233;183|.	E9PDV9;Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3;B3KU01|.	.;SEM6A_HUMAN;.;.;.;.|.	L|S	756;773;183;233;135;756|271	ENSP00000345512:P756L;ENSP00000257414:P773L;ENSP00000422997:P183L;ENSP00000282394:P233L;ENSP00000425364:P135L;ENSP00000424388:P756L|ENSP00000422275:P271S	ENSP00000257414:P773L|ENSP00000422275:P271S	P|P	-|-	2|1	0|0	SEMA6A|SEMA6A	115811034|115811034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.645000|0.645000	0.38454|0.38454	9.417000|9.417000	0.97391|0.97391	2.421000|2.421000	0.82119|0.82119	0.650000|0.650000	0.86243|0.86243	CCC|CCA		0.627	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796		67	74	0	0	0	0.01441	0	67	74				
PCDHA2	56146	broad.mit.edu	37	5	140176284	140176284	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:140176284G>T	ENST00000526136.1	+	1	1735	c.1735G>T	c.(1735-1737)Gag>Tag	p.E579*	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Nonsense_Mutation_p.E579*|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Nonsense_Mutation_p.E579*	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	579					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E579*(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGTGAGTGAGCTGGTGCC	0.662																																							uc003lhd.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)	4						c.(1735-1737)GAG>TAG		protocadherin alpha 2 isoform 1 precursor							108.0	101.0	103.0					5																	140176284		2203	4299	6502	SO:0001587	stop_gained	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140176284G>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1735G>T	5.37:g.140176284G>T	ENSP00000431748:p.Glu579*		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Nonsense_Mutation_p.E579*|PCDHA2_uc011czy.1_Nonsense_Mutation_p.E579*	p.E579*	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1841	+			579			Extracellular (Potential).		O75287|Q9BTV3	Nonsense_Mutation	SNP	ENST00000526136.1	37	c.1735G>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	15.94	2.980362	0.53827	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	.	.	.	3.8	1.92	0.25849	.	0.000000	0.40144	U	0.001164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	13.1611	0.59544	0.0:0.3212:0.6788:0.0	.	.	.	.	X	579	.	ENSP00000367372:E579X	E	+	1	0	PCDHA2	140156468	0.862000	0.29867	0.029000	0.17559	0.009000	0.06853	1.869000	0.39519	0.203000	0.20529	0.549000	0.68633	GAG		0.662	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		39	34	1	0	2.35958e-20	0.009718	3.81933e-20	39	34				
PCDHB12	56124	broad.mit.edu	37	5	140588899	140588899	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:140588899A>T	ENST00000239450.2	+	1	609	c.420A>T	c.(418-420)ttA>ttT	p.L140F	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	140	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L140F(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATGCTCTTAGAAATCCCAG	0.388																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(418-420)TTA>TTT		protocadherin beta 12 precursor							90.0	98.0	95.0					5																	140588899		2202	4300	6502	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140588899A>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.420A>T	5.37:g.140588899A>T	ENSP00000239450:p.Leu140Phe		Somatic				PCDHB12_uc011dak.1_Intron	p.L140F	NM_018932	NP_061755	WXS	Illumina HiSeq	Unspecified	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	609	+			140			Extracellular (Potential).|Cadherin 2.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.420A>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.546633	0.45383	.	.	ENSG00000120328	ENST00000239450	T	0.20598	2.06	4.25	0.327	0.15913	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.39708	0.1088	M	0.81341	2.54	0.80722	D	1	D	0.67145	0.996	D	0.70716	0.97	T	0.31971	-0.9924	9	0.62326	D	0.03	.	5.0942	0.14725	0.6006:0.1546:0.2448:0.0	.	140	Q9Y5F1	PCDBC_HUMAN	F	140	ENSP00000239450:L140F	ENSP00000239450:L140F	L	+	3	2	PCDHB12	140569083	0.000000	0.05858	0.854000	0.33618	0.823000	0.46562	-2.120000	0.01323	0.615000	0.30124	0.459000	0.35465	TTA		0.388	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		54	48	0	0	0	0.01441	0	54	48				
PCDHGB2	56103	broad.mit.edu	37	5	140741968	140741968	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:140741968G>T	ENST00000522605.1	+	1	2266	c.2266G>T	c.(2266-2268)Gtt>Ttt	p.V756F	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	756					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V756F(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACCTGTGTGTTGCCTCACA	0.507																																							uc003ljs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2266-2268)GTT>TTT		protocadherin gamma subfamily B, 2 isoform 1							151.0	154.0	153.0					5																	140741968		1942	4145	6087	SO:0001583	missense	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741968G>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2266G>T	5.37:g.140741968G>T	ENSP00000429018:p.Val756Phe		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.V756F|PCDHGA5_uc011das.1_5'Flank	p.V756F	NM_018923	NP_061746	WXS	Illumina HiSeq	Unspecified	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2266	+			756			Cytoplasmic (Potential).		Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	c.2266G>T	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	13.92	2.379759	0.42207	.	.	ENSG00000253910	ENST00000522605	T	0.50277	0.75	4.96	0.841	0.18918	.	.	.	.	.	T	0.53367	0.1792	M	0.67700	2.07	0.20764	N	0.99985	P;P	0.51791	0.948;0.913	P;P	0.54210	0.745;0.463	T	0.43458	-0.9390	9	0.62326	D	0.03	.	5.5588	0.17131	0.3451:0.1314:0.5235:0.0	.	756;756	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	F	756	ENSP00000429018:V756F	ENSP00000429018:V756F	V	+	1	0	PCDHGB2	140722152	0.020000	0.18652	0.736000	0.30914	0.907000	0.53573	0.098000	0.15189	-0.071000	0.12886	0.461000	0.40582	GTT		0.507	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		80	62	1	0	6.11987e-43	0.01441	1.24351e-42	80	62				
ADAM19	8728	broad.mit.edu	37	5	156964936	156964936	+	Silent	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:156964936G>C	ENST00000517905.1	-	4	359	c.315C>G	c.(313-315)acC>acG	p.T105T	ADAM19_ENST00000394020.1_Silent_p.T107T|ADAM19_ENST00000257527.4_Silent_p.T105T|ADAM19_ENST00000430702.2_5'UTR			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	105					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T105T(1)|p.T106T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATTTCCGTGTGGTGGTTTGAG	0.443																																							uc003lwz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(313-315)ACC>ACG		ADAM metallopeptidase domain 19 preproprotein							211.0	194.0	200.0					5																	156964936		2203	4300	6503	SO:0001819	synonymous_variant	8728				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	g.chr5:156964936G>C	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.315C>G	5.37:g.156964936G>C			Somatic				ADAM19_uc003lww.1_5'UTR|ADAM19_uc011ddr.1_Silent_p.T36T	p.T105T	NM_033274	NP_150377	WXS	Illumina HiSeq	Unspecified	Q9H013	ADA19_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		4	379	-	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	105					Q9BZL5|Q9UHP2	Silent	SNP	ENST00000517905.1	37	c.315C>G																																																																																					0.443	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		14	30	0	0	0	0.004007	0	14	30				
FAF2	23197	broad.mit.edu	37	5	175923528	175923528	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr5:175923528A>G	ENST00000261942.6	+	8	756	c.703A>G	c.(703-705)Atg>Gtg	p.M235V		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	235					lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.M235V(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						ATTCCTGGCCATGATTATGCT	0.463																																							uc003mej.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(703-705)ATG>GTG		UBX domain containing 8							174.0	154.0	161.0					5																	175923528		2203	4300	6503	SO:0001583	missense	23197				response to unfolded protein	endoplasmic reticulum|lipid particle	protein binding	g.chr5:175923528A>G	BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.703A>G	5.37:g.175923528A>G	ENSP00000261942:p.Met235Val		Somatic					p.M235V	NM_014613	NP_055428	WXS	Illumina HiSeq	Unspecified	Q96CS3	FAF2_HUMAN			8	756	+			235					O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	ENST00000261942.6	37	c.703A>G	CCDS34296.1	.	.	.	.	.	.	.	.	.	.	A	14.00	2.405472	0.42715	.	.	ENSG00000113194	ENST00000261942	T	0.37584	1.19	6.03	6.03	0.97812	UAS (1);	0.032612	0.85682	D	0.000000	T	0.17109	0.0411	N	0.05199	-0.095	0.58432	D	0.999997	B	0.19817	0.039	B	0.14578	0.011	T	0.17228	-1.0376	10	0.10636	T	0.68	-24.9747	11.1202	0.48284	0.9235:0.0:0.0765:0.0	.	235	Q96CS3	FAF2_HUMAN	V	235	ENSP00000261942:M235V	ENSP00000261942:M235V	M	+	1	0	FAF2	175856134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.705000	0.74644	2.313000	0.78055	0.454000	0.30748	ATG		0.463	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372194.1	NM_014613		27	35	0	0	0	0.012213	0	27	35				
C6orf89	221477	broad.mit.edu	37	6	36882185	36882185	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr6:36882185G>C	ENST00000480824.2	+	5	823	c.529G>C	c.(529-531)Gag>Cag	p.E177Q	C6orf89_ENST00000510325.2_Missense_Mutation_p.E71Q|C6orf89_ENST00000355190.3_Missense_Mutation_p.E184Q|C6orf89_ENST00000359359.2_Missense_Mutation_p.E71Q|C6orf89_ENST00000373685.1_Missense_Mutation_p.E177Q			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	177					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E184Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						AAGGAAATTTGAGAGGCTCCA	0.527																																							uc003omx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(529-531)GAG>CAG		hypothetical protein LOC221477							73.0	78.0	76.0					6																	36882185		2203	4300	6503	SO:0001583	missense	221477					integral to membrane		g.chr6:36882185G>C	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.529G>C	6.37:g.36882185G>C	ENSP00000475947:p.Glu177Gln		Somatic				C6orf89_uc003omv.2_Missense_Mutation_p.E71Q|C6orf89_uc003omw.2_Missense_Mutation_p.E184Q|C6orf89_uc011dtr.1_Missense_Mutation_p.E71Q|C6orf89_uc003omy.2_Missense_Mutation_p.E11Q	p.E177Q	NM_152734	NP_689947	WXS	Illumina HiSeq	Unspecified	Q6UWU4	CF089_HUMAN			5	813	+			177					B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000480824.2	37	c.529G>C		.	.	.	.	.	.	.	.	.	.	G	13.18	2.160234	0.38119	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685;ENST00000416621;ENST00000540072	.	.	.	5.44	5.44	0.79542	.	0.366803	0.29225	N	0.012775	T	0.33818	0.0876	L	0.38531	1.155	0.37075	D	0.898711	B;B	0.20052	0.041;0.041	B;B	0.17722	0.016;0.019	T	0.16217	-1.0410	9	0.33940	T	0.23	-0.35	14.7713	0.69681	0.0:0.0:1.0:0.0	.	177;184	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	Q	71;71;184;177;184;183	.	ENSP00000347322:E184Q	E	+	1	0	C6orf89	36990163	0.998000	0.40836	0.703000	0.30354	0.925000	0.55904	3.143000	0.50608	2.555000	0.86185	0.655000	0.94253	GAG		0.527	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000040387.2	NM_152734		27	31	0	0	0	0.009535	0	27	31				
LRRC1	55227	broad.mit.edu	37	6	53785527	53785527	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr6:53785527G>C	ENST00000370888.1	+	13	1661	c.1384G>C	c.(1384-1386)Gag>Cag	p.E462Q	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	462						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.E462Q(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCGATTTGTGGAGGATGAGAA	0.443																																							uc003pcd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1384-1386)GAG>CAG		leucine rich repeat containing 1							152.0	154.0	153.0					6																	53785527		2018	4197	6215	SO:0001583	missense	55227					cytoplasm|membrane		g.chr6:53785527G>C	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1384G>C	6.37:g.53785527G>C	ENSP00000359925:p.Glu462Gln		Somatic					p.E462Q	NM_018214	NP_060684	WXS	Illumina HiSeq	Unspecified	Q9BTT6	LRRC1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0745)	13	1661	+	Lung NSC(77;0.0147)		462					Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	c.1384G>C	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351781	0.82132	.	.	ENSG00000137269	ENST00000370888	T	0.77620	-1.11	5.92	5.92	0.95590	.	0.286935	0.33161	N	0.005206	T	0.66386	0.2784	L	0.59436	1.845	0.80722	D	1	P	0.40250	0.709	B	0.35413	0.202	T	0.67616	-0.5625	10	0.30078	T	0.28	.	19.3054	0.94161	0.0:0.0:1.0:0.0	.	462	Q9BTT6	LRRC1_HUMAN	Q	462	ENSP00000359925:E462Q	ENSP00000359925:E462Q	E	+	1	0	LRRC1	53893486	1.000000	0.71417	0.978000	0.43139	0.808000	0.45660	9.248000	0.95456	2.801000	0.96364	0.650000	0.86243	GAG		0.443	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168		13	24	0	0	0	0.013537	0	13	24				
GRIK2	2898	broad.mit.edu	37	6	102516291	102516291	+	Nonsense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr6:102516291A>T	ENST00000421544.1	+	16	3122	c.2632A>T	c.(2632-2634)Aag>Tag	p.K878*	GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369134.4_Nonsense_Mutation_p.K829*|GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000369137.3_Nonsense_Mutation_p.K802*	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	878					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.K878*(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GTTAAAACATAAGCCACAGGC	0.413																																							uc003pqp.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(2632-2634)AAG>TAG		glutamate receptor, ionotropic, kainate 2	L-Glutamic Acid(DB00142)						113.0	103.0	106.0					6																	102516291		2203	4300	6503	SO:0001587	stop_gained	2898				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr6:102516291A>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2632A>T	6.37:g.102516291A>T	ENSP00000397026:p.Lys878*		Somatic				GRIK2_uc003pqo.3_3'UTR|GRIK2_uc010kcw.2_3'UTR	p.K878*	NM_021956	NP_068775	WXS	Illumina HiSeq	Unspecified	Q13002	GRIK2_HUMAN		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	16	2881	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	878			Cytoplasmic (Potential).		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Nonsense_Mutation	SNP	ENST00000421544.1	37	c.2632A>T	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	A	43	10.082176	0.99332	.	.	ENSG00000164418	ENST00000421544;ENST00000369137;ENST00000369134	.	.	.	5.79	5.79	0.91817	.	0.044125	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	16.1296	0.81418	1.0:0.0:0.0:0.0	.	.	.	.	X	878;802;829	.	ENSP00000358130:K829X	K	+	1	0	GRIK2	102622984	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.932000	0.92897	2.216000	0.71823	0.379000	0.24179	AAG		0.413	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			27	16	0	0	0	0.00632	0	27	16				
RTN4IP1	84816	broad.mit.edu	37	6	107019974	107019974	+	Missense_Mutation	SNP	C	C	A	rs372866009		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr6:107019974C>A	ENST00000369063.3	-	9	1553	c.1088G>T	c.(1087-1089)cGg>cTg	p.R363L	RTN4IP1_ENST00000539449.1_3'UTR|RTN4IP1_ENST00000498091.1_5'UTR	NM_032730.4	NP_116119.2	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1	363						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.R363L(1)		breast(1)|kidney(3)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		AATAACTGGCCGGATCTGTAA	0.418																																							uc003prj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1087-1089)CGG>CTG		reticulon 4 interacting protein 1 precursor							92.0	95.0	94.0					6																	107019974		2203	4300	6503	SO:0001583	missense	84816					mitochondrion	oxidoreductase activity|zinc ion binding	g.chr6:107019974C>A	AF336861	CCDS5056.1	6q21	2008-02-05			ENSG00000130347	ENSG00000130347			18647	protein-coding gene	gene with protein product		610502					Standard	NM_032730		Approved	NIMP	uc003prj.3	Q8WWV3	OTTHUMG00000015304	ENST00000369063.3:c.1088G>T	6.37:g.107019974C>A	ENSP00000358059:p.Arg363Leu		Somatic				RTN4IP1_uc010kdd.2_3'UTR|RTN4IP1_uc003prk.2_Missense_Mutation_p.R263L	p.R363L	NM_032730	NP_116119	WXS	Illumina HiSeq	Unspecified	Q8WWV3	RT4I1_HUMAN	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)	9	1565	-	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	363					Q8N9B3|Q8WZ66|Q9BRA4	Missense_Mutation	SNP	ENST00000369063.3	37	c.1088G>T	CCDS5056.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.316049	0.23908	.	.	ENSG00000130347	ENST00000369063	T	0.26067	1.76	6.02	-2.25	0.06888	.	0.687056	0.15173	N	0.276506	T	0.09774	0.0240	L	0.55990	1.75	0.30381	N	0.781965	B	0.11235	0.004	B	0.12837	0.008	T	0.34229	-0.9837	10	0.40728	T	0.16	-0.4612	12.1462	0.54024	0.0:0.3328:0.0:0.6672	.	363	Q8WWV3	RT4I1_HUMAN	L	363	ENSP00000358059:R363L	ENSP00000358059:R363L	R	-	2	0	RTN4IP1	107126667	0.011000	0.17503	0.894000	0.35097	0.910000	0.53928	-0.027000	0.12371	-0.270000	0.09285	-0.355000	0.07637	CGG		0.418	RTN4IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041673.1			40	13	1	0	1.57019e-19	0.007835	2.52023e-19	40	13				
DNAH11	8701	broad.mit.edu	37	7	21628977	21628977	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:21628977T>C	ENST00000409508.3	+	12	2156	c.2125T>C	c.(2125-2127)Ttc>Ctc	p.F709L	DNAH11_ENST00000328843.6_Missense_Mutation_p.F709L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	709	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.F709L(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTTGGTTAAATTCAGTGCCAT	0.323									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(2125-2127)TTC>CTC		dynein, axonemal, heavy chain 11							129.0	125.0	127.0					7																	21628977		1808	4073	5881	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21628977T>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2125T>C	7.37:g.21628977T>C	ENSP00000475939:p.Phe709Leu		Somatic					p.F709L	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			12	2156	+			709			Stem (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.2125T>C		.	.	.	.	.	.	.	.	.	.	T	10.75	1.438078	0.25900	.	.	ENSG00000105877	ENST00000328843	T	0.54866	0.55	5.58	2.05	0.26809	Dynein heavy chain, domain-1 (1);	2.748860	0.01081	N	0.004995	T	0.40670	0.1126	.	.	.	0.26692	N	0.971338	B	0.02656	0.0	B	0.04013	0.001	T	0.24512	-1.0158	9	0.37606	T	0.19	.	6.545	0.22400	0.0:0.38:0.0:0.62	.	709	Q96DT5	DYH11_HUMAN	L	709	ENSP00000330671:F709L	ENSP00000330671:F709L	F	+	1	0	DNAH11	21595502	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	1.652000	0.37313	0.955000	0.37878	-0.256000	0.11100	TTC		0.323	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		21	63	0	0	0	0.004656	0	21	63				
POM121	9883	broad.mit.edu	37	7	72420448	72420448	+	3'UTR	SNP	C	C	G	rs400282	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:72420448C>G	ENST00000395270.1	+	0	5480				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.W47S(3)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CACAGGCATCCATGACATGGG	0.612													.|||	11	0.00219649	0.0015	0.0014	5008	,	,		17883	0.0		0.004	False		,,,				2504	0.0041						uc003twn.2		NA																	3	Substitution - Missense(3)		large_intestine(1)|lung(1)|kidney(1)		0						c.(139-141)TGG>TCG		NOL1/NOP2/Sun domain family, member 5C isoform							40.0	44.0	43.0					7																	72420448		2199	4300	6499	SO:0001624	3_prime_UTR_variant	260294							g.chr7:72420448C>G	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*1439C>G	7.37:g.72420448C>G			Somatic				POM121_uc010lam.1_3'UTR|NSUN5P2_uc003twl.2_RNA|NSUN5P2_uc003twm.2_Missense_Mutation_p.W47S|NSUN5P2_uc003two.2_Missense_Mutation_p.W47S|NSUN5P2_uc003twq.2_Missense_Mutation_p.W47S|NSUN5P2_uc010lan.1_5'UTR|NSUN5P2_uc003twp.2_Missense_Mutation_p.W47S	p.W47S	NM_032158	NP_115534	WXS	Illumina HiSeq	Unspecified					7	852	-								A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000395270.1	37	c.140G>C	CCDS59059.1																																																																																				0.612	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1			4	47	0	0	0	0.001168	0	4	47				
MUC17	140453	broad.mit.edu	37	7	100682994	100682994	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:100682994C>G	ENST00000306151.4	+	3	8361	c.8297C>G	c.(8296-8298)tCt>tGt	p.S2766C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2766	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S2766C(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTGGCCAGTTCTGAGGCTAGC	0.493																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8296-8298)TCT>TGT		mucin 17 precursor							253.0	247.0	249.0					7																	100682994		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100682994C>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8297C>G	7.37:g.100682994C>G	ENSP00000302716:p.Ser2766Cys		Somatic				MUC17_uc010lho.1_RNA	p.S2766C	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	8350	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2766			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|44.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8297C>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	6.200	0.405145	0.11754	.	.	ENSG00000169876	ENST00000306151	T	0.02050	4.48	0.37	0.37	0.16160	.	.	.	.	.	T	0.03564	0.0102	N	0.19112	0.55	0.09310	N	1	D	0.63046	0.992	P	0.60117	0.869	T	0.50566	-0.8813	9	0.41790	T	0.15	.	6.6184	0.22790	0.0:0.9998:0.0:2.0E-4	.	2766	Q685J3	MUC17_HUMAN	C	2766	ENSP00000302716:S2766C	ENSP00000302716:S2766C	S	+	2	0	MUC17	100469714	0.002000	0.14202	0.002000	0.10522	0.008000	0.06430	1.105000	0.31086	0.469000	0.27268	0.134000	0.15878	TCT		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		154	131	0	0	0	0.01441	0	154	131				
VGF	7425	broad.mit.edu	37	7	100807902	100807902	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:100807902G>T	ENST00000249330.2	-	2	462	c.223C>A	c.(223-225)Cag>Aag	p.Q75K	VGF_ENST00000445482.2_Missense_Mutation_p.Q75K	NM_003378.3	NP_003369.2	O15240	VGF_HUMAN	VGF nerve growth factor inducible	75					defense response to bacterium (GO:0042742)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|ovarian follicle development (GO:0001541)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)|response to insulin (GO:0032868)|sexual reproduction (GO:0019953)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)		p.Q75K(1)		cervix(1)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	9	Lung NSC(181;0.168)|all_lung(186;0.215)					TCCACGCCCTGGAAAAGCTCT	0.736																																							uc003uxx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(223-225)CAG>AAG		VGF nerve growth factor inducible precursor							8.0	10.0	9.0					7																	100807902		2147	4240	6387	SO:0001583	missense	7425				response to cAMP	extracellular space|transport vesicle	growth factor activity	g.chr7:100807902G>T	Y12661	CCDS5712.1	7q22	2008-07-18			ENSG00000128564	ENSG00000128564			12684	protein-coding gene	gene with protein product	"""neuro-endocrine specific protein VGF"""	602186				9344675	Standard	NM_003378		Approved		uc003uxx.4	O15240	OTTHUMG00000157109	ENST00000249330.2:c.223C>A	7.37:g.100807902G>T	ENSP00000249330:p.Gln75Lys		Somatic					p.Q75K	NM_003378	NP_003369	WXS	Illumina HiSeq	Unspecified	O15240	VGF_HUMAN			2	441	-	Lung NSC(181;0.168)|all_lung(186;0.215)		75					Q9UDW8	Missense_Mutation	SNP	ENST00000249330.2	37	c.223C>A	CCDS5712.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726220	0.48833	.	.	ENSG00000128564	ENST00000249330;ENST00000448792;ENST00000445482	.	.	.	4.67	4.67	0.58626	.	0.096923	0.41500	D	0.000871	T	0.34890	0.0913	N	0.19112	0.55	0.31923	N	0.61319	B	0.19706	0.038	B	0.23574	0.047	T	0.47249	-0.9132	9	0.87932	D	0	-13.9975	12.9428	0.58354	0.0:0.0:1.0:0.0	.	75	O15240	VGF_HUMAN	K	75	.	ENSP00000249330:Q75K	Q	-	1	0	VGF	100594622	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.417000	0.44653	2.448000	0.82819	0.555000	0.69702	CAG		0.736	VGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347462.1	NM_003378		3	3	1	0	1.23904e-05	0.014758	1.46992e-05	3	3				
ST7	7982	broad.mit.edu	37	7	116870061	116870061	+	3'UTR	SNP	G	G	T	rs568099318	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:116870061G>T	ENST00000393446.2	+	0	2025				ST7_ENST00000393447.4_3'UTR|ST7_ENST00000432298.1_3'UTR|ST7_ENST00000422922.1_3'UTR|ST7_ENST00000323984.3_3'UTR|ST7_ENST00000393444.3_3'UTR|ST7_ENST00000393451.3_3'UTR|ST7_ENST00000393449.1_3'UTR|ST7_ENST00000393443.1_3'UTR			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ATTAAAAGCTGTTTTTGTTGT	0.333																																							uc011knn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1588-1590)GTT>TTT		suppression of tumorigenicity 7 isoform b																																				SO:0001624	3_prime_UTR_variant	7982					integral to membrane	binding	g.chr7:116870061G>T	AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.*150G>T	7.37:g.116870061G>T			Somatic				ST7_uc003vio.2_3'UTR|ST7_uc003viq.2_3'UTR|ST7_uc011knm.1_3'UTR|ST7_uc003vir.2_3'UTR	p.V530F	NM_021908	NP_068708	WXS	Illumina HiSeq	Unspecified	Q9NRC1	ST7_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	14	1593	+	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		Error:Variant_position_missing_in_Q9NRC1_after_alignment					A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000393446.2	37	c.1588G>T		.	.	.	.	.	.	.	.	.	.	G	12.16	1.854130	0.32791	.	.	ENSG00000004866	ENST00000446490;ENST00000490039	T;T	0.21361	2.01;2.01	5.52	5.52	0.82312	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.01858	-1.1259	8	0.87932	D	0	.	15.4153	0.74962	0.0:0.0:0.8603:0.1396	.	530	C9JU30	.	F	528;530	ENSP00000402934:V528F;ENSP00000419516:V530F	ENSP00000402934:V528F	V	+	1	0	ST7	116657297	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.170000	0.58229	2.760000	0.94817	0.655000	0.94253	GTT		0.333	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1	NM_021908		2	3	1	0	0.00909568	0.009096	0.00954547	2	3				
WNT2	7472	broad.mit.edu	37	7	116955207	116955207	+	Missense_Mutation	SNP	C	C	T	rs200665306		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:116955207C>T	ENST00000265441.3	-	3	805	c.506G>A	c.(505-507)cGc>cAc	p.R169H	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	169					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.R169H(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACAAATGCGCGGGCAAATTT	0.478																																							uc003viz.2		NA																	1	Substitution - Missense(1)	p.R169C(1)	lung(1)	breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7						c.(505-507)CGC>CAC		wingless-type MMTV integration site family							141.0	129.0	133.0					7																	116955207		2203	4300	6503	SO:0001583	missense	7472				atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity	g.chr7:116955207C>T	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.506G>A	7.37:g.116955207C>T	ENSP00000265441:p.Arg169His		Somatic				WNT2_uc003vja.2_Missense_Mutation_p.R73H	p.R169H	NM_003391	NP_003382	WXS	Illumina HiSeq	Unspecified	P09544	WNT2_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	3	806	-	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		169					A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	c.506G>A	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895008	0.72639	.	.	ENSG00000105989	ENST00000265441	T	0.78707	-1.2	5.65	5.65	0.86999	.	0.059928	0.64402	D	0.000002	D	0.89322	0.6682	M	0.85859	2.78	0.44937	D	0.997951	D;D	0.63880	0.993;0.993	D;D	0.65140	0.932;0.932	D	0.90118	0.4197	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	169;169	A4D0V1;P09544	.;WNT2_HUMAN	H	169	ENSP00000265441:R169H	ENSP00000265441:R169H	R	-	2	0	WNT2	116742443	1.000000	0.71417	0.979000	0.43373	0.894000	0.52154	4.558000	0.60789	2.824000	0.97209	0.655000	0.94253	CGC		0.478	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391		31	69	0	0	0	0.009535	0	31	69				
PLXNA4	91584	broad.mit.edu	37	7	131912276	131912276	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:131912276C>T	ENST00000359827.3	-	7	2778	c.1816G>A	c.(1816-1818)Gtg>Atg	p.V606M	PLXNA4_ENST00000321063.4_Missense_Mutation_p.V606M			Q9HCM2	PLXA4_HUMAN	plexin A4	606					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.V606M(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGATTGCCCACGACCAGCCCA	0.587																																							uc003vra.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1816-1818)GTG>ATG		plexin A4 isoform 1							74.0	78.0	77.0					7																	131912276		2085	4222	6307	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131912276C>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1816G>A	7.37:g.131912276C>T	ENSP00000352882:p.Val606Met		Somatic					p.V606M	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			7	2045	-			606			Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.1816G>A	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571668	0.45798	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.00912	5.55;5.55	5.73	0.646	0.17789	.	0.454983	0.17463	N	0.173371	T	0.00754	0.0025	N	0.19112	0.55	0.29775	N	0.834456	B	0.16802	0.019	B	0.12156	0.007	T	0.37361	-0.9709	10	0.45353	T	0.12	.	5.8214	0.18530	0.1175:0.5524:0.0:0.3301	.	606	Q9HCM2	PLXA4_HUMAN	M	606	ENSP00000323194:V606M;ENSP00000352882:V606M	ENSP00000323194:V606M	V	-	1	0	PLXNA4	131562816	0.969000	0.33509	0.860000	0.33809	0.974000	0.67602	0.793000	0.26944	0.088000	0.17205	0.655000	0.94253	GTG		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		11	27	0	0	0	0.008291	0	11	27				
MGAM2	93432	broad.mit.edu	37	7	141833894	141833894	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:141833894G>A	ENST00000477922.3	+	7	743	c.689G>A	c.(688-690)cGc>cAc	p.R230H	RP11-1220K2.2_ENST00000550469.2_Missense_Mutation_p.R230H														p.R230H(2)		endometrium(1)|lung(5)	6						CAGCAGTACCGCCACAATATG	0.587																																							uc003vwz.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)		0						c.(688-690)CGC>CAC		RecName: Full=Putative maltase-glucoamylase-like protein LOC93432;																																				SO:0001583	missense	93432							g.chr7:141833894G>A																												ENST00000477922.3:c.689G>A	7.37:g.141833894G>A	ENSP00000420449:p.Arg230His		Somatic					p.R230H	NR_003715		WXS	Illumina HiSeq	Unspecified					7	748	+									Missense_Mutation	SNP	ENST00000477922.3	37	c.689G>A		.	.	.	.	.	.	.	.	.	.	.	14.44	2.535034	0.45073	.	.	ENSG00000257743	ENST00000550469;ENST00000477922	D	0.84944	-1.92	4.76	-0.936	0.10419	Glycoside hydrolase-type carbohydrate-binding (1);	.	.	.	.	T	0.77274	0.4106	.	.	.	.	.	.	B	0.21606	0.058	B	0.24394	0.053	T	0.71217	-0.4658	7	0.56958	D	0.05	.	8.5847	0.33651	0.0824:0.0:0.2349:0.6827	.	230	Q2M2H8	MGAL2_HUMAN	H	230	ENSP00000447431:R230H	ENSP00000380641:R230H	R	+	2	0	RP11-1220K2.2	141480363	0.652000	0.27349	0.974000	0.42286	0.992000	0.81027	1.144000	0.31565	0.002000	0.14630	-0.268000	0.10319	CGC		0.587	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000351325.3			7	12	0	0	0	0.008291	0	7	12				
FAM131B	9715	broad.mit.edu	37	7	143055984	143055984	+	Silent	SNP	C	C	G			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr7:143055984C>G	ENST00000409408.1	-	4	2026	c.318G>C	c.(316-318)gtG>gtC	p.V106V	FAM131B_ENST00000409222.3_Silent_p.V106V|FAM131B_ENST00000409346.1_Silent_p.V106V|FAM131B_ENST00000443739.2_Silent_p.V134V|FAM131B_ENST00000409578.1_Silent_p.V122V			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	106								p.V106V(1)|p.V134V(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TATCCCTGCGCACGGACTCAT	0.592																																							uc003wct.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(316-318)GTG>GTC		hypothetical protein LOC9715 isoform b							100.0	84.0	89.0					7																	143055984		2203	4300	6503	SO:0001819	synonymous_variant	9715							g.chr7:143055984C>G	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.318G>C	7.37:g.143055984C>G			Somatic				FAM131B_uc010loz.2_Silent_p.V74V|FAM131B_uc003wcu.3_Silent_p.V106V|FAM131B_uc010lpa.2_Silent_p.V134V|ZYX_uc011ktd.1_5'Flank	p.V106V	NM_014690	NP_055505	WXS	Illumina HiSeq	Unspecified	Q86XD5	F131B_HUMAN			4	2024	-	Melanoma(164;0.205)		106					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Silent	SNP	ENST00000409408.1	37	c.318G>C	CCDS5882.1																																																																																				0.592	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		15	22	0	0	0	0.003163	0	15	22				
DLGAP2	9228	broad.mit.edu	37	8	1496873	1496873	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:1496873C>A	ENST00000421627.2	+	2	148	c.14C>A	c.(13-15)tCc>tAc	p.S5Y		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	84					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.S27Y(1)|p.S49Y(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AAGGGCCTTTCCGGAAGTCGG	0.687																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(13-15)TCC>TAC		discs large-associated protein 2							9.0	10.0	9.0					8																	1496873		1705	3474	5179	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1496873C>A	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.14C>A	8.37:g.1496873C>A	ENSP00000400258:p.Ser5Tyr		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.S5Y	p.S5Y	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	111	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	84					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.14C>A	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.94|15.94	2.981167|2.981167	0.53827|0.53827	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.14893	.|2.47	4.83|4.83	4.83|4.83	0.62350|0.62350	.|.	.|0.352132	.|0.34046	.|N	.|0.004314	T|T	0.32852|0.32852	0.0843|0.0843	L|L	0.57536|0.57536	1.79|1.79	0.26719|0.26719	N|N	0.970819|0.970819	.|P;P	.|0.46706	.|0.883;0.814	.|P;P	.|0.53360	.|0.724;0.534	T|T	0.08472|0.08472	-1.0720|-1.0720	5|10	.|0.62326	.|D	.|0.03	-4.9699|-4.9699	17.8949|17.8949	0.88885|0.88885	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|84;84	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	T|Y	22|50;5	.|ENSP00000400258:S5Y	.|ENSP00000348366:S50Y	P|S	+|+	1|2	0|0	DLGAP2|DLGAP2	1484280|1484280	0.820000|0.820000	0.29190|0.29190	0.003000|0.003000	0.11579|0.11579	0.089000|0.089000	0.18198|0.18198	5.656000|5.656000	0.67988|0.67988	2.210000|2.210000	0.71456|0.71456	0.462000|0.462000	0.41574|0.41574	CCG|TCC		0.687	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		6	9	1	0	2.0095e-06	0.001984	2.4923e-06	6	9				
DLGAP2	9228	broad.mit.edu	37	8	1497432	1497432	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:1497432C>A	ENST00000421627.2	+	2	707	c.573C>A	c.(571-573)caC>caA	p.H191Q		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	270					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.H213Q(1)|p.H235Q(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ACGCCCACCACGCCAAGCACA	0.667																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(571-573)CAC>CAA		discs large-associated protein 2							19.0	27.0	24.0					8																	1497432		2191	4289	6480	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497432C>A	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.573C>A	8.37:g.1497432C>A	ENSP00000400258:p.His191Gln		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.H191Q	p.H191Q	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	670	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	270					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.573C>A	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.819|1.819	-0.472843|-0.472843	0.04445|0.04445	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.16597|.	2.33|.	5.57|5.57	-2.7|-2.7	0.06004|0.06004	.|.	0.142348|.	0.64402|.	D|.	0.000006|.	T|T	0.38506|0.38506	0.1043|0.1043	L|L	0.42529|0.42529	1.33|1.33	0.09310|0.09310	N|N	1|1	P;P|.	0.40250|.	0.709;0.586|.	P;B|.	0.44772|.	0.46;0.271|.	T|T	0.42207|0.42207	-0.9465|-0.9465	10|5	0.05959|.	T|.	0.93|.	-4.2151|-4.2151	12.4159|12.4159	0.55494|0.55494	0.0:0.405:0.0:0.595|0.0:0.405:0.0:0.595	.|.	270;270|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	Q|K	236;191|208	ENSP00000400258:H191Q|.	ENSP00000348366:H236Q|.	H|T	+|+	3|2	2|0	DLGAP2|DLGAP2	1484839|1484839	0.053000|0.053000	0.20554|0.20554	0.000000|0.000000	0.03702|0.03702	0.532000|0.532000	0.34746|0.34746	-0.007000|-0.007000	0.12810|0.12810	-0.493000|-0.493000	0.06678|0.06678	-0.136000|-0.136000	0.14681|0.14681	CAC|ACG		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		10	8	1	0	0.00829132	0.008291	0.00879801	10	8				
DLGAP2	9228	broad.mit.edu	37	8	1497586	1497586	+	Missense_Mutation	SNP	G	G	T	rs145069342	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:1497586G>T	ENST00000421627.2	+	2	861	c.727G>T	c.(727-729)Gtg>Ttg	p.V243L		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	322					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.V287L(1)|p.V265L(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCTGGGCCCCGTGGCCCACTG	0.677																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(727-729)GTG>TTG		discs large-associated protein 2							55.0	66.0	62.0					8																	1497586		2119	4245	6364	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497586G>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.727G>T	8.37:g.1497586G>T	ENSP00000400258:p.Val243Leu		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.V243L	p.V243L	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	824	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	322					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.727G>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	0.085	-1.176542	0.01646	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.11169	2.8	5.3	-10.6	0.00265	.	0.781500	0.11809	N	0.527306	T	0.02848	0.0085	N	0.12182	0.205	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.32025	-0.9922	10	0.07644	T	0.81	0.003	2.7454	0.05265	0.555:0.1013:0.1977:0.1459	.	322;322	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	L	288;243	ENSP00000400258:V243L	ENSP00000348366:V288L	V	+	1	0	DLGAP2	1484993	0.185000	0.23213	0.000000	0.03702	0.012000	0.07955	0.586000	0.23894	-3.760000	0.00110	-0.841000	0.03054	GTG		0.677	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		47	67	1	0	4.6707e-30	0.01441	9.01115e-30	47	67				
CSMD1	64478	broad.mit.edu	37	8	3087578	3087578	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:3087578G>T	ENST00000520002.1	-	28	4887	c.4332C>A	c.(4330-4332)gaC>gaA	p.D1444E	CSMD1_ENST00000602557.1_Missense_Mutation_p.D1444E|CSMD1_ENST00000537824.1_Missense_Mutation_p.D1443E|CSMD1_ENST00000542608.1_Missense_Mutation_p.D1443E|CSMD1_ENST00000400186.3_Missense_Mutation_p.D1444E|CSMD1_ENST00000539096.1_Missense_Mutation_p.D1443E|CSMD1_ENST00000602723.1_Missense_Mutation_p.D1444E|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1444	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.D1172E(1)|p.D1443E(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATGTAGGAGGGTCTGGTTGCC	0.438																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(4330-4332)GAC>GAA		CUB and Sushi multiple domains 1 precursor							101.0	97.0	98.0					8																	3087578		1917	4130	6047	SO:0001583	missense	64478					integral to membrane		g.chr8:3087578G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4332C>A	8.37:g.3087578G>T	ENSP00000430733:p.Asp1444Glu		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.D836E|CSMD1_uc003wqe.2_Missense_Mutation_p.D600E	p.D1444E	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	27	4722	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1444			Extracellular (Potential).|Sushi 8.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.4332C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.46|13.46	2.243892|2.243892	0.39697|0.39697	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02;-0.02|.	6.16|6.16	-1.01|-1.01	0.10169|0.10169	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.50411|0.50411	0.1614|0.1614	L|L	0.33710|0.33710	1.025|1.025	0.46167|0.46167	D|D	0.998904|0.998904	D;P;P|.	0.64830|.	0.994;0.948;0.744|.	D;P;P|.	0.66979|.	0.948;0.719;0.57|.	T|T	0.37979|0.37979	-0.9682|-0.9682	10|5	0.09338|.	T|.	0.73|.	.|.	12.7385|12.7385	0.57238|0.57238	0.6162:0.0:0.3838:0.0|0.6162:0.0:0.3838:0.0	.|.	1444;1444;1444|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	E|T	1444;1444;1306;1443;1443;1443|924	ENSP00000383047:D1444E;ENSP00000430733:D1444E;ENSP00000441462:D1443E;ENSP00000446243:D1443E;ENSP00000441675:D1443E|.	ENSP00000320445:D1306E|.	D|P	-|-	3|1	2|0	CSMD1|CSMD1	3074985|3074985	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.371000|0.371000	0.29859|0.29859	0.731000|0.731000	0.26058|0.26058	-0.233000|-0.233000	0.09797|0.09797	-0.143000|-0.143000	0.13931|0.13931	GAC|CCC		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		6	43	1	0	3.59834e-05	0.001168	4.16535e-05	6	43				
NRG1	3084	broad.mit.edu	37	8	32453386	32453386	+	Silent	SNP	G	G	T	rs147561043	byFrequency	TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:32453386G>T	ENST00000405005.3	+	2	141	c.141G>T	c.(139-141)tcG>tcT	p.S47S	NRG1_ENST00000287842.3_Silent_p.S47S|NRG1_ENST00000287845.5_Silent_p.S47S|NRG1_ENST00000356819.4_Silent_p.S47S|NRG1_ENST00000520407.1_Silent_p.S262S|NRG1_ENST00000521670.1_Silent_p.S47S|NRG1_ENST00000523079.1_Silent_p.S47S|NRG1_ENST00000338921.4_Silent_p.S47S|NRG1_ENST00000341377.5_Silent_p.S47S|NRG1_ENST00000519301.1_Silent_p.S26S			Q02297	NRG1_HUMAN	neuregulin 1	47	Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.S47S(2)|p.S262S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCCAGGAATCGGCTGCAGGTT	0.413																																							uc003xiv.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(139-141)TCG>TCT		neuregulin 1 isoform HRG-alpha							98.0	109.0	105.0					8																	32453386		2203	4300	6503	SO:0001819	synonymous_variant	3084				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr8:32453386G>T	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.141G>T	8.37:g.32453386G>T			Somatic				NRG1_uc003xip.2_Silent_p.S262S|NRG1_uc003xir.2_Silent_p.S47S|NRG1_uc010lvl.2_Silent_p.S47S|NRG1_uc010lvm.2_Silent_p.S47S|NRG1_uc010lvn.2_Silent_p.S47S|NRG1_uc003xis.2_Silent_p.S47S|NRG1_uc011lbf.1_Silent_p.S47S|NRG1_uc010lvo.2_Silent_p.S47S|NRG1_uc003xiu.2_Silent_p.S47S|NRG1_uc003xiw.2_Silent_p.S47S|NRG1_uc003xit.2_Silent_p.S47S|NRG1_uc010lvr.2_5'UTR|NRG1_uc010lvs.2_5'UTR|NRG1_uc010lvp.2_Silent_p.S13S|NRG1_uc010lvq.2_Silent_p.S13S	p.S47S	NM_013964	NP_039258	WXS	Illumina HiSeq	Unspecified	Q02297	NRG1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)	2	658	+		Breast(100;0.203)	47			Extracellular (Potential).|Ig-like C2-type.		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	37	c.141G>T	CCDS6085.1																																																																																				0.413	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			57	34	1	0	9.59835e-30	0.01441	1.81513e-29	57	34				
POTEA	340441	broad.mit.edu	37	8	43159892	43159892	+	RNA	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:43159892C>A	ENST00000522175.2	+	0	748				RNU6-104P_ENST00000459597.1_RNA			Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.S295Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCAAACAACTCTTCTGGAAAT	0.338																																							uc003xpz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(883-885)TCT>TAT		POTE ankyrin domain family, member A isoform 2							82.0	83.0	83.0					8																	43159892		2026	4215	6241			340441							g.chr8:43159892C>A	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43159892C>A			Somatic				POTEA_uc003xqa.1_Missense_Mutation_p.S249Y	p.S295Y	NM_001005365	NP_001005365	WXS	Illumina HiSeq	Unspecified	Q6S8J7	POTEA_HUMAN			6	927	+			295					A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	ENST00000522175.2	37	c.884C>A																																																																																					0.338	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920		40	35	1	0	1.15183e-24	0.009718	2.03704e-24	40	35				
CHD7	55636	broad.mit.edu	37	8	61777733	61777734	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:61777733_61777734GG>TT	ENST00000423902.2	+	38	8714_8715	c.8235_8236GG>TT	c.(8233-8238)ctGGtg>ctTTtg	p.V2746L	CHD7_ENST00000524602.1_Missense_Mutation_p.V697L	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2746					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.V2746L(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACCCTTTGCTGGTGAACAGCCT	0.604																																							uc003xue.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(8233-8238)CTGGTG>CTTTTG		chromodomain helicase DNA binding protein 7																																				SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61777733_61777734GG>TT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		Exception_encountered	8.37:g.61777733_61777734delinsTT	ENSP00000392028:p.Val2746Leu		Somatic					p.V2746L	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		38	8712_8713	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	2746					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	DNP	ENST00000423902.2	37	c.8235_8236GG>TT	CCDS47865.1																																																																																				0.604	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		4	6	0	0	0	0.004672	0	4	6				
LRRCC1	85444	broad.mit.edu	37	8	86042158	86042158	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:86042158G>A	ENST00000360375.3	+	11	1780	c.1631G>A	c.(1630-1632)aGa>aAa	p.R544K	LRRCC1_ENST00000414626.2_Missense_Mutation_p.R524K	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	544					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R544K(1)|p.R524K(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						ACTCAGATAAGACTGATCCAA	0.373																																							uc003ycw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1630-1632)AGA>AAA		sodium channel associated protein 2 isoform a							91.0	95.0	94.0					8																	86042158		1824	4080	5904	SO:0001583	missense	85444				cell division|mitosis	centriole|nucleus		g.chr8:86042158G>A	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1631G>A	8.37:g.86042158G>A	ENSP00000353538:p.Arg544Lys		Somatic				LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.R245K|LRRCC1_uc003ycx.2_Missense_Mutation_p.R451K|LRRCC1_uc003ycy.2_Missense_Mutation_p.R524K	p.R544K	NM_033402	NP_208325	WXS	Illumina HiSeq	Unspecified	Q9C099	LRCC1_HUMAN			11	1785	+			544			Potential.		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	c.1631G>A	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	G	2.475	-0.320915	0.05386	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.25749	1.78;1.78	5.27	3.1	0.35709	.	0.000000	0.35555	N	0.003125	T	0.07234	0.0183	N	0.03016	-0.435	0.33502	D	0.590096	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.29792	-1.0000	10	0.02654	T	1	-18.1074	4.4632	0.11676	0.4448:0.0:0.5552:0.0	.	451;524;451;544	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	K	544;524	ENSP00000353538:R544K;ENSP00000394695:R524K	ENSP00000353538:R544K	R	+	2	0	LRRCC1	86229410	1.000000	0.71417	0.956000	0.39512	0.462000	0.32619	3.601000	0.54059	1.372000	0.46190	-0.137000	0.14449	AGA		0.373	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402		4	99	0	0	0	0.009096	0	4	99				
PKHD1L1	93035	broad.mit.edu	37	8	110454418	110454418	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:110454418A>T	ENST00000378402.5	+	35	4491	c.4387A>T	c.(4387-4389)Aca>Tca	p.T1463S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1463	IPT/TIG 7.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T1465S(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACAAAAATCTACATCAGGTAT	0.328										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(4387-4389)ACA>TCA		fibrocystin L precursor							113.0	113.0	113.0					8																	110454418		1832	4093	5925	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110454418A>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4387A>T	8.37:g.110454418A>T	ENSP00000367655:p.Thr1463Ser	HNSCC(38;0.096)	Somatic					p.T1463S	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		35	4491	+			1463			Extracellular (Potential).|IPT/TIG 7.		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.4387A>T	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.818937	0.32145	.	.	ENSG00000205038	ENST00000378402	D	0.84873	-1.91	5.58	-2.64	0.06114	Cupredoxin (1);	0.523934	0.19205	N	0.120085	T	0.59676	0.2211	N	0.08118	0	0.18873	N	0.999982	B	0.11235	0.004	B	0.10450	0.005	T	0.47812	-0.9088	10	0.18710	T	0.47	.	1.2883	0.02055	0.3881:0.2526:0.233:0.1263	.	1463	Q86WI1	PKHL1_HUMAN	S	1463	ENSP00000367655:T1463S	ENSP00000367655:T1463S	T	+	1	0	PKHD1L1	110523594	0.988000	0.35896	0.979000	0.43373	0.935000	0.57460	0.121000	0.15667	-0.306000	0.08818	0.482000	0.46254	ACA		0.328	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		34	7	0	0	0	0.015359	0	34	7				
KIAA0196	9897	broad.mit.edu	37	8	126085512	126085512	+	Silent	SNP	G	G	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr8:126085512G>A	ENST00000318410.7	-	9	1382	c.1033C>T	c.(1033-1035)Cta>Tta	p.L345L	KIAA0196_ENST00000517845.1_Silent_p.L197L	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	345					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.L345L(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CCTTCTTTTAGAAATTGCTGC	0.398																																							uc003yrt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1033-1035)CTA>TTA		strumpellin							119.0	101.0	107.0					8																	126085512		2203	4300	6503	SO:0001819	synonymous_variant	9897				cell death	WASH complex		g.chr8:126085512G>A		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1033C>T	8.37:g.126085512G>A			Somatic				KIAA0196_uc011lir.1_Silent_p.L197L	p.L345L	NM_014846	NP_055661	WXS	Illumina HiSeq	Unspecified	Q12768	STRUM_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		9	1362	-	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		345					A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	c.1033C>T	CCDS6355.1																																																																																				0.398	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		13	56	0	0	0	0.003163	0	13	56				
FBXO10	26267	broad.mit.edu	37	9	37537272	37537272	+	Silent	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr9:37537272C>T	ENST00000432825.2	-	3	1302	c.1254G>A	c.(1252-1254)aaG>aaA	p.K418K	FBXO10_ENST00000543968.1_5'Flank|RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000541829.1_Intron	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	418					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.K418K(1)		breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		CCATGGCCTCCTTATCCTTCT	0.627																																							uc004aab.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(5)	5						c.(1252-1254)AAG>AAA		F-box protein 10							29.0	32.0	31.0					9																	37537272		2002	4180	6182	SO:0001819	synonymous_variant	26267					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr9:37537272C>T	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.1254G>A	9.37:g.37537272C>T			Somatic				FBXO10_uc004aac.2_Silent_p.K434K|FBXO10_uc004aad.2_Intron	p.K418K	NM_012166	NP_036298	WXS	Illumina HiSeq	Unspecified	Q9UK96	FBX10_HUMAN		GBM - Glioblastoma multiforme(29;0.0107)	3	1303	-			418					Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	c.1254G>A	CCDS47966.1																																																																																				0.627	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3			13	20	0	0	0	0.013537	0	13	20				
TMEM2	23670	broad.mit.edu	37	9	74340552	74340552	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr9:74340552G>T	ENST00000377044.4	-	11	2662	c.2123C>A	c.(2122-2124)cCa>cAa	p.P708Q	TMEM2_ENST00000377066.5_Missense_Mutation_p.P645Q	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	708					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P708Q(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AGTGAGTTCTGGTTTTGCCAA	0.378																																							uc011lsa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2122-2124)CCA>CAA		transmembrane protein 2 isoform a							105.0	110.0	108.0					9																	74340552		2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74340552G>T		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.2123C>A	9.37:g.74340552G>T	ENSP00000366243:p.Pro708Gln		Somatic				TMEM2_uc010mos.2_Missense_Mutation_p.P645Q|TMEM2_uc011lsb.1_RNA	p.P708Q	NM_013390	NP_037522	WXS	Illumina HiSeq	Unspecified	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	11	2663	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	708					A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.2123C>A	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953297	0.53293	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.52526	0.66;0.66	5.23	5.23	0.72850	Pectin lyase fold/virulence factor (1);	0.235612	0.42821	D	0.000644	T	0.45256	0.1333	L	0.35487	1.065	0.80722	D	1	B;B	0.24258	0.031;0.1	B;B	0.32022	0.041;0.139	T	0.41787	-0.9489	10	0.59425	D	0.04	.	19.1483	0.93477	0.0:0.0:1.0:0.0	.	708;645	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	Q	708;645	ENSP00000366243:P708Q;ENSP00000366266:P645Q	ENSP00000366243:P708Q	P	-	2	0	TMEM2	73530372	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.986000	0.93492	2.603000	0.88011	0.491000	0.48974	CCA		0.378	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		24	47	1	0	7.87624e-14	0.016522	1.16617e-13	24	47				
SPATA31C1	441452	broad.mit.edu	37	9	90535445	90535445	+	RNA	SNP	C	C	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr9:90535445C>A	ENST00000602681.1	+	0	1349							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTAGAACGCCCCTCACCCGAG	0.627																																							uc010mqi.2		NA																	0					0						c.(622-624)CCC>CAC		family with sequence similarity 75, member C1							82.0	73.0	76.0					9																	90535445		692	1591	2283			441452							g.chr9:90535445C>A	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535445C>A			Somatic				FAM75C1_uc004apq.3_Missense_Mutation_p.P191H	p.P208H	NM_001145124	NP_001138596	WXS	Illumina HiSeq	Unspecified					4	652	+									Missense_Mutation	SNP	ENST00000602681.1	37	c.623C>A																																																																																					0.627	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		53	102	1	0	4.88482e-21	0.01441	8.11306e-21	53	102				
LHX3	8022	broad.mit.edu	37	9	139091689	139091689	+	Missense_Mutation	SNP	T	T	C	rs137854504		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr9:139091689T>C	ENST00000371748.5	-	3	385	c.289A>G	c.(289-291)Atc>Gtc	p.I97V	LHX3_ENST00000371746.3_Missense_Mutation_p.I102V	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	97	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.I102V(1)		large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		GTGGGCGGGATGCCCAGCTGG	0.721																																							uc004cha.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(289-291)ATC>GTC		LIM homeobox protein 3 isoform a							14.0	13.0	13.0					9																	139091689		2190	4288	6478	SO:0001583	missense	8022				inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:139091689T>C	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.289A>G	9.37:g.139091689T>C	ENSP00000360813:p.Ile97Val		Somatic				LHX3_uc004cgz.2_Missense_Mutation_p.I102V	p.I97V	NM_178138	NP_835258	WXS	Illumina HiSeq	Unspecified	Q9UBR4	LHX3_HUMAN		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)	3	386	-		Myeloproliferative disorder(178;0.0511)	97			LIM zinc-binding 2.		Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Missense_Mutation	SNP	ENST00000371748.5	37	c.289A>G	CCDS6994.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.921309	0.92249	.	.	ENSG00000107187	ENST00000371748;ENST00000371746;ENST00000325195	D;D	0.90133	-2.62;-2.62	4.19	4.19	0.49359	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.93090	0.7800	L	0.58510	1.815	0.80722	D	1	P;B	0.35944	0.529;0.176	P;P	0.54815	0.761;0.573	D	0.93428	0.6783	10	0.66056	D	0.02	.	12.5814	0.56393	0.0:0.0:0.0:1.0	.	97;102	Q9UBR4;F1T0D9	LHX3_HUMAN;.	V	97;102;100	ENSP00000360813:I97V;ENSP00000360811:I102V	ENSP00000319224:I100V	I	-	1	0	LHX3	138231510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.501000	0.81600	1.763000	0.52060	0.459000	0.35465	ATC		0.721	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3			7	3	0	0	0	0.001984	0	7	3				
FAM47A	158724	broad.mit.edu	37	X	34150162	34150162	+	Silent	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrX:34150162G>T	ENST00000346193.3	-	1	285	c.234C>A	c.(232-234)ctC>ctA	p.L78L		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	78								p.L78L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ATATTTTGGGGAGTAAAAACT	0.542																																							uc004ddg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(232-234)CTC>CTA		hypothetical protein LOC158724							86.0	84.0	84.0					X																	34150162		2202	4300	6502	SO:0001819	synonymous_variant	158724							g.chrX:34150162G>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.234C>A	X.37:g.34150162G>T			Somatic					p.L78L	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	267	-			78					A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	c.234C>A	CCDS43926.1																																																																																				0.542	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		20	45	1	0	2.94398e-08	0.007413	3.85137e-08	20	45				
NXF2B	728343	broad.mit.edu	37	X	101623732	101623732	+	Silent	SNP	C	C	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrX:101623732C>T	ENST00000372750.1	-	12	1429	c.630G>A	c.(628-630)aaG>aaA	p.K210K	NXF2B_ENST00000412230.2_Silent_p.K210K|NXF2B_ENST00000372749.1_Silent_p.K210K|NXF2B_ENST00000489531.1_5'Flank|NXF2B_ENST00000372752.1_Silent_p.K122K|NXF2B_ENST00000457521.2_Silent_p.K210K			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	210					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.K210K(1)		breast(1)|kidney(1)|lung(4)|ovary(1)	7						TTTGGCCTGGCTTCAACTTAT	0.483																																							uc004ejb.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(628-630)AAG>AAA		nuclear RNA export factor 2B							148.0	133.0	138.0					X																	101623732		2203	4297	6500	SO:0001819	synonymous_variant	728343				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|RNA binding	g.chrX:101623732C>T		CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.630G>A	X.37:g.101623732C>T			Somatic				NXF2B_uc004eiz.3_Silent_p.K122K|NXF2B_uc004eja.3_Silent_p.K210K|NXF2_uc004eiy.3_Silent_p.K210K	p.K210K	NM_001099686	NP_001093156	WXS	Illumina HiSeq	Unspecified	Q9GZY0	NXF2_HUMAN			19	2502	-			210					Q9BXU4|Q9NSS1|Q9NX66	Silent	SNP	ENST00000372750.1	37	c.630G>A	CCDS43979.1																																																																																				0.483	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058979.1			18	33	0	0	0	0.019004	0	18	33				
GPR112	139378	broad.mit.edu	37	X	135428901	135428901	+	Silent	SNP	T	T	C			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrX:135428901T>C	ENST00000394143.1	+	6	3327	c.3036T>C	c.(3034-3036)acT>acC	p.T1012T	GPR112_ENST00000370652.1_Silent_p.T1012T|GPR112_ENST00000412101.1_Silent_p.T807T|GPR112_ENST00000394141.1_Silent_p.T807T|GPR112_ENST00000287534.4_Silent_p.T949T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1012					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T1012T(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGCCTGTTACTCATATGTTCT	0.507																																							uc004ezu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(3034-3036)ACT>ACC		G-protein coupled receptor 112							187.0	161.0	170.0					X																	135428901		2203	4300	6503	SO:0001819	synonymous_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135428901T>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3036T>C	X.37:g.135428901T>C			Somatic				GPR112_uc010nsb.1_Silent_p.T807T|GPR112_uc010nsc.1_Silent_p.T779T	p.T1012T	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	3327	+	Acute lymphoblastic leukemia(192;0.000127)		1012			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	c.3036T>C	CCDS35409.1																																																																																				0.507	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			103	19	0	0	0	0.01441	0	103	19				
MAMLD1	10046	broad.mit.edu	37	X	149638350	149638350	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrX:149638350G>T	ENST00000370401.2	+	4	815	c.505G>T	c.(505-507)Gtg>Ttg	p.V169L	MAMLD1_ENST00000432680.2_Missense_Mutation_p.V144L|MAMLD1_ENST00000426613.2_Missense_Mutation_p.V144L|MAMLD1_ENST00000468306.1_3'UTR|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.V169L			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	169					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V96L(1)|p.V144L(1)|p.V169L(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					AATCAACAGCGTGCCGGCTGT	0.478																																							uc004fee.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(505-507)GTG>TTG		mastermind-like domain containing 1							64.0	62.0	63.0					X																	149638350		2203	4300	6503	SO:0001583	missense	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638350G>T	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.505G>T	X.37:g.149638350G>T	ENSP00000359428:p.Val169Leu		Somatic				MAMLD1_uc011mxt.1_Missense_Mutation_p.V131L|MAMLD1_uc011mxu.1_Missense_Mutation_p.V144L|MAMLD1_uc011mxv.1_Missense_Mutation_p.V144L|MAMLD1_uc011mxw.1_Missense_Mutation_p.V96L	p.V169L	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	581	+	Acute lymphoblastic leukemia(192;6.56e-05)		169					B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	c.505G>T	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.881705	0.00532	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.60920	0.5;0.15;0.5;0.51	5.36	-10.7	0.00240	.	1.563870	0.03344	N	0.195271	T	0.30916	0.0780	N	0.13098	0.295	0.09310	N	1	B;B;B;B	0.21520	0.008;0.033;0.0;0.057	B;B;B;B	0.18561	0.006;0.022;0.002;0.022	T	0.09751	-1.0660	10	0.16420	T	0.52	0.5407	6.6423	0.22917	0.6297:0.1798:0.0807:0.1098	.	131;144;144;169	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	L	131;169;144;169;144	ENSP00000359428:V169L;ENSP00000414517:V144L;ENSP00000262858:V169L;ENSP00000397438:V144L	ENSP00000262858:V169L	V	+	1	0	MAMLD1	149389008	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.262000	0.01175	-3.170000	0.00225	-1.158000	0.01797	GTG		0.478	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		42	5	1	0	1.07121e-22	0.006999	1.82679e-22	42	5				
MAGEA6	4105	broad.mit.edu	37	X	151869776	151869776	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrX:151869776G>T	ENST00000329342.5	+	3	691	c.466G>T	c.(466-468)Gat>Tat	p.D156Y		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	156	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.D156Y(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CAAAGCTTCCGATTCCTTGCA	0.552																																							uc004ffq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(466-468)GAT>TAT		melanoma antigen family A, 6							148.0	129.0	136.0					X																	151869776		2202	4299	6501	SO:0001583	missense	4105						protein binding	g.chrX:151869776G>T		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.466G>T	X.37:g.151869776G>T	ENSP00000329199:p.Asp156Tyr		Somatic				MAGEA6_uc004ffr.1_Missense_Mutation_p.D156Y|MAGEA2_uc010nto.2_Intron	p.D156Y	NM_005363	NP_005354	WXS	Illumina HiSeq	Unspecified	P43360	MAGA6_HUMAN			3	660	+	Acute lymphoblastic leukemia(192;6.56e-05)		156			MAGE.		A8IF93|Q6NW44	Missense_Mutation	SNP	ENST00000329342.5	37	c.466G>T	CCDS14708.1	.	.	.	.	.	.	.	.	.	.	g	5.129	0.209349	0.09757	.	.	ENSG00000197172	ENST00000329342;ENST00000412733;ENST00000457643	T;T;T	0.04917	3.53;3.53;3.53	0.605	0.605	0.17553	.	.	.	.	.	T	0.04407	0.0121	N	0.17474	0.49	0.09310	N	1	B	0.19073	0.033	B	0.23150	0.044	T	0.40194	-0.9576	8	0.87932	D	0	.	.	.	.	.	156	P43360	MAGA6_HUMAN	Y	156	ENSP00000329199:D156Y;ENSP00000403303:D156Y;ENSP00000401806:D156Y	ENSP00000329199:D156Y	D	+	1	0	MAGEA6	151620432	0.000000	0.05858	0.003000	0.11579	0.036000	0.12997	0.009000	0.13219	0.573000	0.29400	0.181000	0.17075	GAT		0.552	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363		61	9	1	0	1.27862e-28	0.01441	2.34823e-28	61	9				
AMELY	266	broad.mit.edu	37	Y	6736166	6736166	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chrY:6736166A>T	ENST00000383036.1	-	5	526	c.527T>A	c.(526-528)aTg>aAg	p.M176K	AMELY_ENST00000383037.4_Missense_Mutation_p.M176K|AMELY_ENST00000215479.5_Missense_Mutation_p.M162K			Q99218	AMELY_HUMAN	amelogenin, Y-linked	176					biomineral tissue development (GO:0031214)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	structural constituent of tooth enamel (GO:0030345)	p.M162K(1)		NS(1)|lung(5)	6						CAGGGGGAACATTGGAGGCAG	0.627																																							uc004fra.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)ATG>AAG		amelogenin, Y-linked precursor							15.0	18.0	17.0					Y																	6736166		579	1906	2485	SO:0001583	missense	266				biomineral tissue development	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chrY:6736166A>T	M86933	CCDS14778.1	Yp11.2	2004-12-07	2003-09-12		ENSG00000099721	ENSG00000099721			462	protein-coding gene	gene with protein product		410000	"""amelogenin (Y chromosome)"""	AMGL		2004775	Standard	NM_001143		Approved		uc004fqz.3	Q99218	OTTHUMG00000035297	ENST00000383036.1:c.527T>A	Y.37:g.6736166A>T	ENSP00000372505:p.Met176Lys		Somatic				AMELY_uc004fqz.2_Missense_Mutation_p.M162K	p.M176K	NM_001143	NP_001134	WXS	Illumina HiSeq	Unspecified	Q99218	AMELY_HUMAN			5	539	-			176					Q6RWT1	Missense_Mutation	SNP	ENST00000383036.1	37	c.527T>A	CCDS14778.1	.	.	.	.	.	.	.	.	.	.	.	1.999	-0.429989	0.04701	.	.	ENSG00000099721	ENST00000383036;ENST00000383037	D;D	0.89875	-2.58;-2.58	1.35	1.35	0.21983	.	0.280066	0.34025	N	0.004333	T	0.80248	0.4588	M	0.80616	2.505	0.25119	N	0.990656	B;B	0.21452	0.056;0.046	B;B	0.16289	0.015;0.009	T	0.74538	-0.3632	7	.	.	.	3.8939	.	.	.	.	176;162	Q99218;Q99218-1	AMELY_HUMAN;.	K	176	ENSP00000372505:M176K;ENSP00000372506:M176K	.	M	-	2	0	AMELY	6796166	0.993000	0.37304	0.985000	0.45067	0.091000	0.18340	3.197000	0.51028	0.879000	0.35944	0.155000	0.16302	ATG		0.627	AMELY-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000100214.1	NM_001143		2	2	0	0	0	0.004672	0	2	2				
SCUBE2	57758	broad.mit.edu	37	11	9096031	9096031	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr11:9096031delC	ENST00000309263.3	-	4	586	c.514delG	c.(514-516)gaafs	p.E173fs	SCUBE2_ENST00000457346.2_Frame_Shift_Del_p.E173fs|SCUBE2_ENST00000450649.2_Frame_Shift_Del_p.E173fs|SCUBE2_ENST00000520467.1_Frame_Shift_Del_p.E173fs			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	173						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		GAGGTACCTTCCGAGCGGTGA	0.582																																							uc001mhh.1		NA																	0				ovary(1)|skin(1)	2						c.(514-516)GAAfs		CEGP1 protein precursor							122.0	103.0	110.0					11																	9096031		2201	4296	6497	SO:0001589	frameshift_variant	57758					extracellular region	calcium ion binding	g.chr11:9096031delC	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.514delG	11.37:g.9096031delC	ENSP00000310658:p.Glu173fs		Somatic				SCUBE2_uc001mhi.1_Frame_Shift_Del_p.E172fs|SCUBE2_uc001mhj.1_Frame_Shift_Del_p.E172fs	p.E172fs	NM_020974	NP_066025	WXS	Illumina HiSeq	Unspecified	Q9NQ36	SCUB2_HUMAN		all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)	4	594	-			172					Q2NKQ8|Q6ZWI1	Frame_Shift_Del	DEL	ENST00000309263.3	37	c.514delG																																																																																					0.582	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974		7	91	NA	NA	NA	NA	NA	7	91	---	---	---	---
KCNK10	54207	broad.mit.edu	37	14	88652098	88652098	+	Frame_Shift_Del	DEL	G	G	-	rs371190844		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr14:88652098delG	ENST00000340700.5	-	7	1849	c.1398delC	c.(1396-1398)cccfs	p.P466fs	KCNK10_ENST00000312350.5_Frame_Shift_Del_p.P471fs|KCNK10_ENST00000319231.5_Frame_Shift_Del_p.P471fs	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	466					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GAACGTCCTCGGGCAAGGTCT	0.502																																							uc001xwo.2		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(1396-1398)CCCfs		potassium channel, subfamily K, member 10							154.0	148.0	150.0					14																	88652098		2203	4300	6503	SO:0001589	frameshift_variant	54207				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:88652098delG	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1398delC	14.37:g.88652098delG	ENSP00000343104:p.Pro466fs		Somatic				KCNK10_uc001xwm.2_Frame_Shift_Del_p.P471fs|KCNK10_uc001xwn.2_Frame_Shift_Del_p.P471fs	p.P466fs	NM_021161	NP_066984	WXS	Illumina HiSeq	Unspecified	P57789	KCNKA_HUMAN			7	1855	-			466			Cytoplasmic (Potential).		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Frame_Shift_Del	DEL	ENST00000340700.5	37	c.1398delC	CCDS9880.1																																																																																				0.502	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161		67	121	NA	NA	NA	NA	NA	67	121	---	---	---	---
PITPNM3	83394	broad.mit.edu	37	17	6358848	6358848	+	Frame_Shift_Del	DEL	G	G	-	rs570165186		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr17:6358848delG	ENST00000262483.8	-	20	2822	c.2735delC	c.(2734-2736)gcgfs	p.A912fs	PITPNM3_ENST00000421306.3_Frame_Shift_Del_p.A876fs|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	912					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTCTGGCTGCGCGTGCAGCCC	0.692																																							uc002gdd.3		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(2734-2736)GCGfs		PITPNM family member 3 isoform 1							22.0	27.0	25.0					17																	6358848		2194	4298	6492	SO:0001589	frameshift_variant	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6358848delG	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2735delC	17.37:g.6358848delG	ENSP00000262483:p.Ala912fs		Somatic				PITPNM3_uc010cln.2_Frame_Shift_Del_p.A876fs|PITPNM3_uc010clm.2_Frame_Shift_Del_p.A395fs|PITPNM3_uc002gdc.3_Frame_Shift_Del_p.A503fs	p.A912fs	NM_031220	NP_112497	WXS	Illumina HiSeq	Unspecified	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	20	2886	-			912					A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Frame_Shift_Del	DEL	ENST00000262483.8	37	c.2735delC	CCDS11076.1																																																																																				0.692	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		13	23	NA	NA	NA	NA	NA	13	23	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1221313	1221314	+	Frame_Shift_Ins	INS	-	-	C	rs121913321|rs373021819		TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:1221313_1221314insC	ENST00000326873.7	+	6	2009_2010	c.836_837insC	c.(835-840)ggccccfs	p.GP279fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.P281fs*6(2)|p.?(2)|p.G279F(1)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGACTGTGGCCCCCCGCTCT	0.604		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		26	Whole gene deletion(20)|Deletion - Frameshift(3)|Unknown(2)|Substitution - Missense(1)	p.0?(19)|p.P281fs*6(2)|p.?(2)|p.G279F(1)|p.Y246fs*3(1)	cervix(14)|lung(7)|large_intestine(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(835-837)GGCfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221313_1221314insC	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.842dupC	19.37:g.1221319_1221319dupC	ENSP00000324856:p.Gly279fs	TSP Lung(3;<1E-08)	Somatic					p.G279fs	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1951_1952	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	279			Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Ins	INS	ENST00000326873.7	37	c.836_837insC	CCDS45896.1																																																																																				0.604	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		6	5	NA	NA	NA	NA	NA	6	5	---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13418663	13418663	+	Frame_Shift_Del	DEL	T	T	-			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:13418663delT	ENST00000360228.5	-	15	1918	c.1919delA	c.(1918-1920)aatfs	p.N640fs	CACNA1A_ENST00000573710.2_Frame_Shift_Del_p.N641fs	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	641					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCATCGAAATTAAACCTGCA	0.547																																							uc010dze.2		NA																	0				large_intestine(2)	2						c.(1921-1923)AATfs		calcium channel, alpha 1A subunit isoform 3	Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)						105.0	100.0	102.0					19																	13418663		1926	4138	6064	SO:0001589	frameshift_variant	773				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	g.chr19:13418663delT	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1919delA	19.37:g.13418663delT	ENSP00000353362:p.Asn640fs		Somatic				CACNA1A_uc010dzc.2_Frame_Shift_Del_p.N166fs|CACNA1A_uc002mwy.3_Frame_Shift_Del_p.N640fs|CACNA1A_uc010xne.1_Frame_Shift_Del_p.N166fs	p.N641fs	NM_001127221	NP_001120693	WXS	Illumina HiSeq	Unspecified	O00555	CAC1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		15	2158	-			641			Extracellular (Potential).|II.		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Frame_Shift_Del	DEL	ENST00000360228.5	37	c.1922delA	CCDS45998.1																																																																																				0.547	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068		55	14	NA	NA	NA	NA	NA	55	14	---	---	---	---
ZNF671	79891	broad.mit.edu	37	19	58232780	58232780	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr19:58232780delC	ENST00000317398.6	-	4	769	c.674delG	c.(673-675)ggcfs	p.G225fs	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Frame_Shift_Del_p.G127fs	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGAGTCTCTGCCCTCCTTCCT	0.507																																							uc002qpz.3		NA																	0				ovary(1)	1						c.(673-675)GGCfs		zinc finger protein 671							107.0	102.0	104.0					19																	58232780		2203	4300	6503	SO:0001589	frameshift_variant	79891				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58232780delC		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.674delG	19.37:g.58232780delC	ENSP00000321848:p.Gly225fs		Somatic				ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Frame_Shift_Del_p.G148fs|ZNF671_uc010yhf.1_Frame_Shift_Del_p.G127fs	p.G225fs	NM_024833	NP_079109	WXS	Illumina HiSeq	Unspecified	Q8TAW3	ZN671_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	773	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	225					A6NF07|Q9H5E9	Frame_Shift_Del	DEL	ENST00000317398.6	37	c.674delG	CCDS12961.1																																																																																				0.507	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	NM_024833		9	74	NA	NA	NA	NA	NA	9	74	---	---	---	---
DEFB115	245929	broad.mit.edu	37	20	29847303	29847304	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr20:29847303_29847304insA	ENST00000400552.1	+	2	135_136	c.135_136insA	c.(136-138)aggfs	p.R46fs		NM_001037730.1	NP_001032819.1	Q30KQ5	DB115_HUMAN	defensin, beta 115	46					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|lung(3)|ovary(1)|skin(1)	6			Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)			CTGGCAGATGCAGGAAATCATG	0.317																																							uc002wvp.1		NA																	0				ovary(1)	1						c.(133-138)TGCAGGfs		beta-defensin 115 precursor																																				SO:0001589	frameshift_variant	245929				defense response to bacterium	extracellular region		g.chr20:29847303_29847304insA	DQ012019	CCDS42859.1	20q11.1	2008-07-17			ENSG00000215547	ENSG00000215547		"""Defensins, beta"""	18096	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037730		Approved	DEFB-15	uc002wvp.1	Q30KQ5	OTTHUMG00000159284	ENST00000400552.1:c.136dupA	20.37:g.29847304_29847304dupA	ENSP00000383398:p.Arg46fs		Somatic					p.C45fs	NM_001037730	NP_001032819	WXS	Illumina HiSeq	Unspecified	Q30KQ5	DB115_HUMAN	Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)		2	135_136	+			45_46						Frame_Shift_Ins	INS	ENST00000400552.1	37	c.135_136insA	CCDS42859.1																																																																																				0.317	DEFB115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354402.1	NM_001037730		21	30	NA	NA	NA	NA	NA	21	30	---	---	---	---
RBPJ	3516	broad.mit.edu	37	4	26417145	26417146	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:26417145_26417146insA	ENST00000361572.6	+	4	437_438	c.243_244insA	c.(244-246)aaafs	p.K82fs	RBPJ_ENST00000511401.1_3'UTR|RBPJ_ENST00000348160.4_Frame_Shift_Ins_p.K69fs|RBPJ_ENST00000342295.1_Frame_Shift_Ins_p.K82fs|RBPJ_ENST00000504907.1_Frame_Shift_Ins_p.K68fs|RBPJ_ENST00000342320.4_Frame_Shift_Ins_p.K68fs|RBPJ_ENST00000507561.1_Frame_Shift_Ins_p.K47fs|RBPJ_ENST00000345843.3_Frame_Shift_Ins_p.K67fs|RBPJ_ENST00000355476.3_Frame_Shift_Ins_p.K68fs			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	82					angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				GTGGATGGAAGAAAAAAAAAGA	0.371																																							uc003grx.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(241-246)AAGAAAfs		recombining binding protein suppressor of																																				SO:0001589	frameshift_variant	3516				DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity	g.chr4:26417145_26417146insA	L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.252dupA	4.37:g.26417154_26417154dupA	ENSP00000354528:p.Lys82fs		Somatic				RBPJ_uc003gry.1_Frame_Shift_Ins_p.K66fs|RBPJ_uc003grz.1_Frame_Shift_Ins_p.K81fs|RBPJ_uc011bxt.1_Frame_Shift_Ins_p.K81fs|RBPJ_uc003gsa.1_Frame_Shift_Ins_p.K67fs|RBPJ_uc003gsb.1_Frame_Shift_Ins_p.K68fs|RBPJ_uc003gsc.1_Frame_Shift_Ins_p.K67fs	p.K81fs	NM_005349	NP_005340	WXS	Illumina HiSeq	Unspecified	Q06330	SUH_HUMAN			5	479_480	+		Breast(46;0.0503)	81_82					B4DY22|Q5XKH9|Q6P1N3	Frame_Shift_Ins	INS	ENST00000361572.6	37	c.243_244insA	CCDS3437.1																																																																																				0.371	RBPJ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215046.2	NM_015874		7	290	NA	NA	NA	NA	NA	7	290	---	---	---	---
TRAPPC11	60684	broad.mit.edu	37	4	184605873	184605874	+	Frame_Shift_Ins	INS	-	-	TATC			TCGA-64-5774-01A-01D-1625-08	TCGA-64-5774-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	df5957d5-20d3-483e-990b-d6369fb990b8	4fb568ce-a4be-46c5-862b-5c681936f30b	g.chr4:184605873_184605874insTATC	ENST00000334690.6	+	15	1648_1649	c.1446_1447insTATC	c.(1447-1449)tatfs	p.-483fs	TRAPPC11_ENST00000357207.4_Frame_Shift_Ins_p.-483fs|TRAPPC11_ENST00000512476.1_Frame_Shift_Ins_p.-89fs	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11						vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											TGATGTGTGATTATCGGAGTGA	0.406																																							uc003ivx.2		NA																	0					0						c.(1444-1449)GATTATfs		hypothetical protein LOC60684 isoform a																																				SO:0001589	frameshift_variant	60684							g.chr4:184605873_184605874insTATC		CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.1447_1450dupTATC	4.37:g.184605874_184605877dupTATC	ENSP00000335371:p.Tyr483fs		Somatic				C4orf41_uc003ivw.2_Frame_Shift_Ins_p.D482fs|C4orf41_uc010isc.2_Intron|C4orf41_uc003ivy.2_Frame_Shift_Ins_p.D88fs	p.D482fs	NM_021942	NP_068761	WXS	Illumina HiSeq	Unspecified	Q7Z392	CD041_HUMAN		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)	15	1622_1623	+		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)	482_483					A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Frame_Shift_Ins	INS	ENST00000334690.6	37	c.1446_1447insTATC	CCDS34112.1																																																																																				0.406	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942		15	101	NA	NA	NA	NA	NA	15	101	---	---	---	---
