#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SRSF4	6429	broad.mit.edu	37	1	29475178	29475178	+	Missense_Mutation	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:29475178G>C	ENST00000373795.4	-	6	1463	c.1229C>G	c.(1228-1230)tCc>tGc	p.S410C	SRSF4_ENST00000466448.1_5'Flank|RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_3'UTR	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	410	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S410C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						CTTTGACACGGAGCGGGATGG	0.582																																							uc001bro.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1228-1230)TCC>TGC		splicing factor, arginine/serine-rich 4							153.0	165.0	161.0					1																	29475178		2203	4300	6503	SO:0001583	missense	6429				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding	g.chr1:29475178G>C	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.1229C>G	1.37:g.29475178G>C	ENSP00000362900:p.Ser410Cys		Somatic				SFRS4_uc010ofy.1_3'UTR	p.S410C	NM_005626	NP_005617	WXS	Illumina HiSeq	Unspecified	Q08170	SRSF4_HUMAN		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)	6	1602	-		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)	410			Arg/Ser-rich (RS domain).		Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	37	c.1229C>G	CCDS333.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.620490	0.28801	.	.	ENSG00000116350	ENST00000373795	T	0.47177	0.85	5.72	5.72	0.89469	.	0.437153	0.21351	N	0.075975	T	0.65048	0.2654	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.65726	-0.6098	10	0.87932	D	0	.	15.3969	0.74801	0.0:0.0:1.0:0.0	.	410	Q08170	SRSF4_HUMAN	C	410	ENSP00000362900:S410C	ENSP00000362900:S410C	S	-	2	0	SRSF4	29347765	1.000000	0.71417	0.785000	0.31869	0.186000	0.23388	8.766000	0.91728	2.691000	0.91804	0.655000	0.94253	TCC		0.582	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626		9	58	0	0	0	0.069234	0	9	58				
TOE1	114034	broad.mit.edu	37	1	45808791	45808791	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:45808791A>C	ENST00000372090.5	+	8	1533	c.950A>C	c.(949-951)cAg>cCg	p.Q317P	TOE1_ENST00000539779.1_Missense_Mutation_p.Q237P|MUTYH_ENST00000531105.1_5'Flank|MUTYH_ENST00000372098.3_5'Flank|TOE1_ENST00000495703.1_3'UTR|MUTYH_ENST00000372115.3_5'Flank|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000529984.1_5'Flank|MUTYH_ENST00000528332.2_5'Flank|MUTYH_ENST00000450313.1_5'Flank|TESK2_ENST00000486676.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	317						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.Q317P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					CAGTGTCCTCAGTCTCACGAT	0.552																																							uc009vxq.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(949-951)CAG>CCG		target of EGR1, member 1 (nuclear)							86.0	88.0	88.0					1																	45808791		2203	4300	6503	SO:0001583	missense	114034					nuclear speck|nucleolus	nucleic acid binding|zinc ion binding	g.chr1:45808791A>C		CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.950A>C	1.37:g.45808791A>C	ENSP00000361162:p.Gln317Pro		Somatic				MUTYH_uc001cno.2_5'Flank|MUTYH_uc001cnk.2_5'Flank|MUTYH_uc010oll.1_5'Flank|MUTYH_uc001cnm.2_5'Flank|MUTYH_uc001cnl.2_5'Flank|MUTYH_uc009vxp.2_5'Flank|MUTYH_uc001cnn.2_5'Flank|TOE1_uc001cnq.3_RNA|TOE1_uc010olm.1_Missense_Mutation_p.Q237P|TOE1_uc001cnr.3_RNA	p.Q317P	NM_025077	NP_079353	WXS	Illumina HiSeq	Unspecified	Q96GM8	TOE1_HUMAN			8	1533	+	Acute lymphoblastic leukemia(166;0.155)		317			C3H1-type.		B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	37	c.950A>C	CCDS521.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.948284	0.34377	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.42131	0.98;0.98	5.99	0.478	0.16789	Zinc finger, CCCH-type (2);Ribonuclease H-like (1);	0.547464	0.19945	N	0.102556	T	0.28797	0.0714	L	0.38175	1.15	0.36584	D	0.873716	P;B	0.43750	0.816;0.355	B;B	0.42138	0.377;0.199	T	0.17806	-1.0357	10	0.39692	T	0.17	-4.9052	5.0951	0.14729	0.5384:0.0:0.3193:0.1422	.	237;317	B4DEM6;Q96GM8	.;TOE1_HUMAN	P	317;237	ENSP00000361162:Q317P;ENSP00000438900:Q237P	ENSP00000361162:Q317P	Q	+	2	0	TOE1	45581378	0.995000	0.38212	0.999000	0.59377	0.997000	0.91878	0.713000	0.25794	0.371000	0.24564	0.533000	0.62120	CAG		0.552	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077		6	99	0	0	0	0.02938	0	6	99				
IFI44L	10964	broad.mit.edu	37	1	79101124	79101124	+	Missense_Mutation	SNP	A	A	T	rs149877350	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:79101124A>T	ENST00000370751.5	+	5	1005	c.826A>T	c.(826-828)Atg>Ttg	p.M276L	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Missense_Mutation_p.M18L	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	276					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)		p.M237L(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AGGACTGTGCATGGATGACAT	0.373																																							uc010oro.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(826-828)ATG>TTG		interferon-induced protein 44-like							149.0	148.0	148.0					1																	79101124		2203	4300	6503	SO:0001583	missense	10964					cytoplasm		g.chr1:79101124A>T	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.826A>T	1.37:g.79101124A>T	ENSP00000359787:p.Met276Leu		Somatic				IFI44L_uc010orp.1_Missense_Mutation_p.M13L|IFI44L_uc010orq.1_Missense_Mutation_p.M13L	p.M276L	NM_006820	NP_006811	WXS	Illumina HiSeq	Unspecified	Q53G44	IF44L_HUMAN			5	1005	+			276					Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	37	c.826A>T	CCDS687.2	.	.	.	.	.	.	.	.	.	.	A	4.230	0.041536	0.08196	.	.	ENSG00000137959	ENST00000370751;ENST00000342282	T;T	0.26810	2.87;1.71	4.54	-7.13	0.01532	.	0.540380	0.18158	N	0.149864	T	0.03220	0.0094	N	0.16478	0.41	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33523	-0.9865	10	0.27082	T	0.32	-0.1241	8.1868	0.31343	0.3942:0.117:0.4888:0.0	.	276	Q53G44	IF44L_HUMAN	L	276;18	ENSP00000359787:M276L;ENSP00000342833:M18L	ENSP00000342833:M18L	M	+	1	0	IFI44L	78873712	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	-0.265000	0.08644	-1.442000	0.01955	-0.487000	0.04747	ATG		0.373	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820		42	621	0	0	0	0.048971	0	42	621				
PRG4	10216	broad.mit.edu	37	1	186277099	186277099	+	Missense_Mutation	SNP	G	G	A	rs143599637	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:186277099G>A	ENST00000445192.2	+	7	2293	c.2248G>A	c.(2248-2250)Gct>Act	p.A750T	PRG4_ENST00000367486.3_Missense_Mutation_p.A707T|PRG4_ENST00000367485.4_Missense_Mutation_p.A657T|PRG4_ENST00000367483.4_Missense_Mutation_p.A709T|PRG4_ENST00000367484.3_Intron	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	750	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.A750T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TGACAAGCCCGCTCCAACTAC	0.607													g|||	4	0.000798722	0.0	0.0	5008	,	,		14728	0.0		0.004	False		,,,				2504	0.0						uc001gru.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2248-2250)GCT>ACT		proteoglycan 4 isoform A		G	THR/ALA,THR/ALA,THR/ALA,THR/ALA	11,4395	16.8+/-37.8	0,11,2192	169.0	189.0	182.0		2248,1846,1969,2125	-3.2	0.0	1	dbSNP_134	182	29,8571	20.4+/-63.3	0,29,4271	yes	missense,missense,missense,missense	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	58,58,58,58	0,40,6463	AA,AG,GG		0.3372,0.2497,0.3076	benign,benign,benign,benign	750/1405,616/1271,657/1312,709/1364	186277099	40,12966	2203	4300	6503	SO:0001583	missense	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186277099G>A	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2248G>A	1.37:g.186277099G>A	ENSP00000399679:p.Ala750Thr		Somatic				PRG4_uc001grt.3_Missense_Mutation_p.A709T|PRG4_uc009wyl.2_Missense_Mutation_p.A657T|PRG4_uc009wym.2_Missense_Mutation_p.A616T|PRG4_uc010poo.1_Intron	p.A750T	NM_005807	NP_005798	WXS	Illumina HiSeq	Unspecified	Q92954	PRG4_HUMAN			7	2299	+			750			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|47; approximate.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	c.2248G>A	CCDS1369.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	G	3.817	-0.038522	0.07497	0.002497	0.003372	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05996	3.36;3.38;3.36;3.41	1.62	-3.23	0.05109	.	.	.	.	.	T	0.01695	0.0054	N	0.11560	0.145	0.09310	N	1	B;B;B;B	0.17465	0.009;0.009;0.007;0.022	B;B;B;B	0.09377	0.002;0.002;0.002;0.004	T	0.46034	-0.9220	8	.	.	.	.	2.4024	0.04405	0.3007:0.0:0.3091:0.3903	.	616;657;750;709	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	T	707;616;709;657;750	ENSP00000356456:A707T;ENSP00000356453:A709T;ENSP00000356455:A657T;ENSP00000399679:A750T	.	A	+	1	0	PRG4	184543722	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.623000	0.02040	-0.789000	0.04498	0.186000	0.17326	GCT		0.607	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		4	15	0	0	0	0.014758	0	4	15				
LAMB3	3914	broad.mit.edu	37	1	209797336	209797336	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:209797336G>C	ENST00000356082.4	-	15	2120	c.1986C>G	c.(1984-1986)ctC>ctG	p.L662L	LAMB3_ENST00000367030.3_Silent_p.L662L|LAMB3_ENST00000391911.1_Silent_p.L662L|MIR4260_ENST00000583107.1_RNA	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	662	Domain II.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.L662L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GCAGGCCCTGGAGAGTTCGCC	0.532																																							uc001hhg.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(1984-1986)CTC>CTG		laminin, beta 3 precursor							48.0	50.0	49.0					1																	209797336		2203	4300	6503	SO:0001819	synonymous_variant	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209797336G>C	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1986C>G	1.37:g.209797336G>C			Somatic				LAMB3_uc009xco.2_Silent_p.L662L|LAMB3_uc001hhh.2_Silent_p.L662L|LAMB3_uc010psl.1_RNA|hsa-mir-4260|MI0015859_5'Flank	p.L662L	NM_001017402	NP_001017402	WXS	Illumina HiSeq	Unspecified	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	14	2376	-			662			Domain II.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Silent	SNP	ENST00000356082.4	37	c.1986C>G	CCDS1487.1																																																																																				0.532	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228		12	34	0	0	0	0.024245	0	12	34				
KCNH1	3756	broad.mit.edu	37	1	211280627	211280627	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:211280627C>T	ENST00000271751.4	-	2	199	c.172G>A	c.(172-174)Gca>Aca	p.A58T	KCNH1_ENST00000367007.4_Missense_Mutation_p.A58T			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	58	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.A58T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ATCACTTCTGCCCTGTGATAG	0.388																																							uc001hib.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(172-174)GCA>ACA		potassium voltage-gated channel, subfamily H,							135.0	137.0	137.0					1																	211280627		2203	4300	6503	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:211280627C>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.172G>A	1.37:g.211280627C>T	ENSP00000271751:p.Ala58Thr		Somatic				KCNH1_uc001hic.2_Missense_Mutation_p.A58T	p.A58T	NM_172362	NP_758872	WXS	Illumina HiSeq	Unspecified	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	2	342	-			58			Cytoplasmic (Potential).|PAS.		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.172G>A	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	34	5.374761	0.95923	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99567	-6.18;-6.18	5.62	5.62	0.85841	PAS (3);PAS fold (1);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	M	0.62154	1.92	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.71656	0.965;0.974	D	0.99811	1.1041	10	0.34782	T	0.22	.	18.6649	0.91486	0.0:1.0:0.0:0.0	.	58;58	Q14CL3;O95259	.;KCNH1_HUMAN	T	58	ENSP00000271751:A58T;ENSP00000355974:A58T	ENSP00000271751:A58T	A	-	1	0	KCNH1	209347250	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.470000	0.80973	2.634000	0.89283	0.655000	0.94253	GCA		0.388	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		51	99	0	0	0	0.048971	0	51	99				
TLR5	7100	broad.mit.edu	37	1	223283837	223283837	+	Missense_Mutation	SNP	T	T	C	rs5744177	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:223283837T>C	ENST00000540964.1	-	4	2998	c.2537A>G	c.(2536-2538)gAc>gGc	p.D846G	TLR5_ENST00000342210.6_Missense_Mutation_p.D846G			O60602	TLR5_HUMAN	toll-like receptor 5	846			Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1). {ECO:0000269|PubMed:14623910}.		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)	p.D846G(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		AATGTTATTGTCTTTCTTCTT	0.378													T|||	20	0.00399361	0.0045	0.0101	5008	,	,		20860	0.0		0.007	False		,,,				2504	0.0						uc001hnv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(2536-2538)GAC>GGC		toll-like receptor 5 precursor		T	GLY/ASP	36,4370	40.0+/-72.8	0,36,2167	103.0	105.0	105.0		2537	-1.0	0.0	1	dbSNP_114	105	87,8513	49.4+/-109.1	1,85,4214	yes	missense	TLR5	NM_003268.5	94	1,121,6381	CC,CT,TT		1.0116,0.8171,0.9457	possibly-damaging	846/859	223283837	123,12883	2203	4300	6503	SO:0001583	missense	7100				cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity	g.chr1:223283837T>C		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.2537A>G	1.37:g.223283837T>C	ENSP00000440643:p.Asp846Gly		Somatic				TLR5_uc001hnw.1_Missense_Mutation_p.D846G	p.D846G	NM_003268	NP_003259	WXS	Illumina HiSeq	Unspecified	O60602	TLR5_HUMAN		GBM - Glioblastoma multiforme(131;0.0851)	4	2983	-			846		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1).	Cytoplasmic (Potential).		B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	37	c.2537A>G	CCDS31033.1	12	0.005494505494505495	4	0.008130081300813009	2	0.0055248618784530384	0	0.0	6	0.0079155672823219	T	14.23	2.474284	0.43942	0.008171	0.010116	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.36157	1.27;1.27;1.27	5.57	-0.994	0.10225	.	0.854610	0.10076	N	0.719097	T	0.16981	0.0408	L	0.46157	1.445	0.09310	N	1	B	0.28439	0.212	B	0.24006	0.05	T	0.22800	-1.0206	10	0.18276	T	0.48	.	3.5557	0.07863	0.0949:0.2493:0.4474:0.2085	rs5744177	846	O60602	TLR5_HUMAN	G	846	ENSP00000440643:D846G;ENSP00000355846:D846G;ENSP00000340089:D846G	ENSP00000340089:D846G	D	-	2	0	TLR5	221350460	0.000000	0.05858	0.000000	0.03702	0.928000	0.56348	-0.058000	0.11750	-0.137000	0.11455	0.477000	0.44152	GAC		0.378	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268		5	94	0	0	0	0.021553	0	5	94				
RYR2	6262	broad.mit.edu	37	1	237777703	237777703	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:237777703C>T	ENST00000366574.2	+	37	5592	c.5275C>T	c.(5275-5277)Cca>Tca	p.P1759S	RYR2_ENST00000542537.1_Missense_Mutation_p.P1743S|RYR2_ENST00000360064.6_Missense_Mutation_p.P1757S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1759	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P1757S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCCCTCAGGCCACGGATGCA	0.512																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(5275-5277)CCA>TCA		cardiac muscle ryanodine receptor							73.0	74.0	74.0					1																	237777703		1999	4161	6160	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237777703C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5275C>T	1.37:g.237777703C>T	ENSP00000355533:p.Pro1759Ser		Somatic					p.P1759S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		37	5395	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1759			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.5275C>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898722	0.91962	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.74106	-0.81;-0.81;-0.81	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000011	T	0.78578	0.4305	M	0.86651	2.83	0.80722	D	1	B	0.31968	0.349	B	0.25614	0.062	T	0.80520	-0.1346	10	0.62326	D	0.03	.	19.2592	0.93961	0.0:1.0:0.0:0.0	.	1759	Q92736	RYR2_HUMAN	S	1759;1757;1743	ENSP00000355533:P1759S;ENSP00000353174:P1757S;ENSP00000443798:P1743S	ENSP00000353174:P1757S	P	+	1	0	RYR2	235844326	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.776000	0.85560	2.563000	0.86464	0.650000	0.86243	CCA		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		33	299	0	0	0	0.086207	0	33	299				
ST8SIA6	338596	broad.mit.edu	37	10	17363049	17363049	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:17363049C>A	ENST00000377602.4	-	8	1099	c.1025G>T	c.(1024-1026)gGa>gTa	p.G342V		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	342					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)	p.G342V(1)		endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						GGGCCAGAATCCATACAGCTT	0.433																																							uc001ipd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1024-1026)GGA>GTA		ST8 alpha-N-acetyl-neuraminide							199.0	189.0	193.0					10																	17363049		2203	4300	6503	SO:0001583	missense	338596				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr10:17363049C>A		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.1025G>T	10.37:g.17363049C>A	ENSP00000366827:p.Gly342Val		Somatic				ST8SIA6_uc010qce.1_RNA	p.G342V	NM_001004470	NP_001004470	WXS	Illumina HiSeq	Unspecified	P61647	SIA8F_HUMAN			8	1025	-			342			Lumenal (Potential).		B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	c.1025G>T	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167931	0.78339	.	.	ENSG00000148488	ENST00000377602	T	0.63580	-0.05	5.48	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.85093	0.5618	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89927	0.4063	10	0.87932	D	0	-8.1289	14.4178	0.67163	0.0:0.9297:0.0:0.0703	.	342	P61647	SIA8F_HUMAN	V	342	ENSP00000366827:G342V	ENSP00000366827:G342V	G	-	2	0	ST8SIA6	17403055	1.000000	0.71417	0.871000	0.34182	0.892000	0.51952	7.651000	0.83577	1.558000	0.49541	0.650000	0.86243	GGA		0.433	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470		131	271	1	0	9.59235e-44	0.048971	1.07688e-43	131	271				
MAP3K8	1326	broad.mit.edu	37	10	30748249	30748249	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:30748249G>C	ENST00000263056.1	+	8	1788	c.1092G>C	c.(1090-1092)ctG>ctC	p.L364L	MAP3K8_ENST00000542547.1_Silent_p.L364L|MAP3K8_ENST00000375321.1_Silent_p.L364L	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	364	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.L364L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				TGAGAGAGCTGATAGAAGCTT	0.527																																							uc001ivi.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|central_nervous_system(1)	4						c.(1090-1092)CTG>CTC		mitogen-activated protein kinase kinase kinase							71.0	75.0	74.0					10																	30748249		2203	4300	6503	SO:0001819	synonymous_variant	1326				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr10:30748249G>C	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.1092G>C	10.37:g.30748249G>C			Somatic				MAP3K8_uc009xlf.1_Silent_p.L364L|MAP3K8_uc001ivj.1_Silent_p.L364L	p.L364L	NM_005204	NP_005195	WXS	Illumina HiSeq	Unspecified	P41279	M3K8_HUMAN			8	1788	+		Prostate(175;0.151)	364			Protein kinase.		A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Silent	SNP	ENST00000263056.1	37	c.1092G>C	CCDS7166.1																																																																																				0.527	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204		7	92	0	0	0	0.038147	0	7	92				
MAP3K8	1326	broad.mit.edu	37	10	30748321	30748321	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:30748321G>C	ENST00000263056.1	+	8	1860	c.1164G>C	c.(1162-1164)ctG>ctC	p.L388L	MAP3K8_ENST00000542547.1_Silent_p.L388L|MAP3K8_ENST00000375321.1_Silent_p.L388L	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	388	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.L388L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				ATGAGGCCCTGAACCCGCCCA	0.567																																							uc001ivi.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|central_nervous_system(1)	4						c.(1162-1164)CTG>CTC		mitogen-activated protein kinase kinase kinase							61.0	64.0	63.0					10																	30748321		2203	4300	6503	SO:0001819	synonymous_variant	1326				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr10:30748321G>C	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.1164G>C	10.37:g.30748321G>C			Somatic				MAP3K8_uc009xlf.1_Silent_p.L388L|MAP3K8_uc001ivj.1_Silent_p.L388L	p.L388L	NM_005204	NP_005195	WXS	Illumina HiSeq	Unspecified	P41279	M3K8_HUMAN			8	1860	+		Prostate(175;0.151)	388			Protein kinase.		A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Silent	SNP	ENST00000263056.1	37	c.1164G>C	CCDS7166.1																																																																																				0.567	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204		7	57	0	0	0	0.038147	0	7	57				
FAM178A	55719	broad.mit.edu	37	10	102690783	102690783	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:102690783C>T	ENST00000238961.4	+	9	2926	c.2384C>T	c.(2383-2385)tCt>tTt	p.S795F	FAM178A_ENST00000370269.3_Missense_Mutation_p.S795F	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	795						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.S795F(1)									TTCCTTACGTCTGCTTATCAC	0.368																																							uc001krt.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2383-2385)TCT>TTT		hypothetical protein LOC55719 isoform 1							191.0	178.0	183.0					10																	102690783		2203	4300	6503	SO:0001583	missense	55719							g.chr10:102690783C>T	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.2384C>T	10.37:g.102690783C>T	ENSP00000238961:p.Ser795Phe		Somatic				FAM178A_uc001krs.2_Missense_Mutation_p.S795F	p.S795F	NM_018121	NP_060591	WXS	Illumina HiSeq	Unspecified	Q8IX21	F178A_HUMAN			9	2926	+			795					A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	ENST00000238961.4	37	c.2384C>T	CCDS7500.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351289	0.41700	.	.	ENSG00000119906	ENST00000238961;ENST00000370269	T;T	0.33216	1.42;1.42	5.56	4.6	0.57074	.	0.478512	0.22265	N	0.062353	T	0.14874	0.0359	N	0.12182	0.205	0.30186	N	0.799968	B;B	0.22003	0.037;0.063	B;B	0.24701	0.055;0.055	T	0.16305	-1.0407	10	0.12766	T	0.61	-1.1814	7.1037	0.25353	0.0:0.7361:0.1746:0.0893	.	795;795	Q8IX21;B1AL17	F178A_HUMAN;.	F	795	ENSP00000238961:S795F;ENSP00000359292:S795F	ENSP00000238961:S795F	S	+	2	0	FAM178A	102680773	0.982000	0.34865	0.999000	0.59377	0.968000	0.65278	1.322000	0.33689	2.617000	0.88574	0.655000	0.94253	TCT		0.368	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3			24	268	0	0	0	0.045705	0	24	268				
COL17A1	1308	broad.mit.edu	37	10	105801076	105801076	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:105801076G>T	ENST00000353479.5	-	38	2922	c.2632C>A	c.(2632-2634)Ccc>Acc	p.P878T	COL17A1_ENST00000369733.3_Missense_Mutation_p.P878T	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	878	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P878T(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCCTCGGGGTCCTGGTGGG	0.647																																							uc001kxr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(2632-2634)CCC>ACC		alpha 1 type XVII collagen							60.0	63.0	62.0					10																	105801076		2203	4300	6503	SO:0001583	missense	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105801076G>T	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2632C>A	10.37:g.105801076G>T	ENSP00000340937:p.Pro878Thr		Somatic					p.P878T	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	38	2801	-		Colorectal(252;0.103)|Breast(234;0.122)	878			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	c.2632C>A	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849607	0.32699	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.92965	-3.14;-2.97	4.68	4.68	0.58851	.	0.170883	0.27563	N	0.018819	D	0.94218	0.8144	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91553	0.5258	10	0.13108	T	0.6	-8.4674	13.1359	0.59409	0.0:0.0:1.0:0.0	.	878	Q9UMD9	COHA1_HUMAN	T	878	ENSP00000340937:P878T;ENSP00000358748:P878T	ENSP00000340937:P878T	P	-	1	0	COL17A1	105791066	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	5.379000	0.66196	2.472000	0.83506	0.383000	0.25322	CCC		0.647	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		6	45	1	0	1.26484e-09	0.038147	1.4067e-09	6	45				
PNLIPRP3	119548	broad.mit.edu	37	10	118228714	118228714	+	Silent	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:118228714T>C	ENST00000369230.3	+	9	1091	c.945T>C	c.(943-945)tgT>tgC	p.C315C		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	315					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.C315C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		GCTTCTTTTGTTCCAAAGAAG	0.313																																							uc001lcl.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(943-945)TGT>TGC		pancreatic lipase-related protein 3 precursor							79.0	80.0	79.0					10																	118228714		2203	4299	6502	SO:0001819	synonymous_variant	119548				lipid catabolic process	extracellular region	triglyceride lipase activity	g.chr10:118228714T>C	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.945T>C	10.37:g.118228714T>C			Somatic					p.C315C	NM_001011709	NP_001011709	WXS	Illumina HiSeq	Unspecified	Q17RR3	LIPR3_HUMAN		all cancers(201;0.0131)	9	1046	+			315						Silent	SNP	ENST00000369230.3	37	c.945T>C	CCDS31292.1																																																																																				0.313	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404		24	140	0	0	0	0.045705	0	24	140				
NLRP10	338322	broad.mit.edu	37	11	7981660	7981660	+	Missense_Mutation	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:7981660T>C	ENST00000328600.2	-	2	1660	c.1499A>G	c.(1498-1500)gAg>gGg	p.E500G		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	500					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.E500G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCCTTTACCTCCAGCAGCCT	0.493																																							uc001mfv.1		NA																	1	Substitution - Missense(1)	p.E500D(1)	lung(1)	lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1498-1500)GAG>GGG		NLR family, pyrin domain containing 10							97.0	94.0	95.0					11																	7981660		2201	4296	6497	SO:0001583	missense	338322						ATP binding	g.chr11:7981660T>C	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1499A>G	11.37:g.7981660T>C	ENSP00000327763:p.Glu500Gly		Somatic					p.E500G	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1516	-			500					Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	c.1499A>G	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	T	9.605	1.129797	0.21041	.	.	ENSG00000182261	ENST00000328600	T	0.81163	-1.46	2.99	0.494	0.16884	.	1.027830	0.07783	N	0.953716	T	0.72676	0.3490	L	0.52011	1.625	0.09310	N	0.999992	B	0.14012	0.009	B	0.15484	0.013	T	0.56998	-0.7886	10	0.40728	T	0.16	.	5.1171	0.14840	0.0:0.2946:0.0:0.7054	.	500	Q86W26	NAL10_HUMAN	G	500	ENSP00000327763:E500G	ENSP00000327763:E500G	E	-	2	0	NLRP10	7938236	0.007000	0.16637	0.016000	0.15963	0.036000	0.12997	1.730000	0.38125	-0.016000	0.14127	0.460000	0.39030	GAG		0.493	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		8	147	0	0	0	0.080935	0	8	147				
HSD17B12	51144	broad.mit.edu	37	11	43819909	43819909	+	Missense_Mutation	SNP	A	A	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:43819909A>T	ENST00000278353.4	+	4	442	c.323A>T	c.(322-324)gAc>gTc	p.D108V	HSD17B12_ENST00000529261.1_3'UTR	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	108					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)	p.D108V(1)		endometrium(2)|large_intestine(4)|lung(4)	10						ATTGCTGTTGACTTTGCATCA	0.368																																					Ovarian(58;548 1143 13948 16572 34258)	Ovarian(58;548 1143 13948 16572 34258)	uc001mxq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(322-324)GAC>GTC		hydroxysteroid (17-beta) dehydrogenase 12							98.0	101.0	100.0					11																	43819909		2203	4300	6503	SO:0001583	missense	51144				long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity	g.chr11:43819909A>T	AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.323A>T	11.37:g.43819909A>T	ENSP00000278353:p.Asp108Val		Somatic					p.D108V	NM_016142	NP_057226	WXS	Illumina HiSeq	Unspecified	Q53GQ0	DHB12_HUMAN			4	558	+			108					A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Missense_Mutation	SNP	ENST00000278353.4	37	c.323A>T	CCDS7905.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.832083	0.71258	.	.	ENSG00000149084	ENST00000531185;ENST00000278353	D;T	0.98792	-5.14;-1.2	5.09	5.09	0.68999	NAD(P)-binding domain (1);	0.143221	0.64402	D	0.000011	D	0.99576	0.9847	H	0.99811	4.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97475	1.0043	10	0.87932	D	0	-18.2047	12.4164	0.55496	1.0:0.0:0.0:0.0	.	108	Q53GQ0	DHB12_HUMAN	V	67;108	ENSP00000436582:D67V;ENSP00000278353:D108V	ENSP00000278353:D108V	D	+	2	0	HSD17B12	43776485	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.933000	0.70130	1.913000	0.55393	0.533000	0.62120	GAC		0.368	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389594.1			97	227	0	0	0	0.048971	0	97	227				
OR5L2	26338	broad.mit.edu	37	11	55594807	55594807	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:55594807C>T	ENST00000378397.1	+	1	113	c.113C>T	c.(112-114)aCg>aTg	p.T38M		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T38M(2)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TATGGAGTCACGTTGTTAGCC	0.502										HNSCC(27;0.073)																													uc001nhy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(112-114)ACG>ATG		olfactory receptor, family 5, subfamily L,							299.0	263.0	275.0					11																	55594807		2200	4296	6496	SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55594807C>T	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.113C>T	11.37:g.55594807C>T	ENSP00000367650:p.Thr38Met	HNSCC(27;0.073)	Somatic					p.T38M	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	113	+		all_epithelial(135;0.208)	38			Helical; Name=1; (Potential).		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.113C>T	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	12.24	1.879277	0.33162	.	.	ENSG00000205030	ENST00000378397	T	0.00504	6.94	5.31	5.31	0.75309	.	0.000000	0.50627	D	0.000111	T	0.02380	0.0073	M	0.93763	3.455	0.35740	D	0.81862	D	0.89917	1.0	D	0.64237	0.923	T	0.04268	-1.0964	10	0.87932	D	0	-20.2856	12.525	0.56081	0.0:0.9185:0.0:0.0815	.	38	Q8NGL0	OR5L2_HUMAN	M	38	ENSP00000367650:T38M	ENSP00000367650:T38M	T	+	2	0	OR5L2	55351383	0.864000	0.29904	0.960000	0.40013	0.379000	0.30106	2.479000	0.45197	2.691000	0.91804	0.626000	0.83405	ACG		0.502	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		26	815	0	0	0	0.0918	0	26	815				
AHNAK	79026	broad.mit.edu	37	11	62298621	62298621	+	Missense_Mutation	SNP	G	G	A	rs148272375	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:62298621G>A	ENST00000378024.4	-	5	3542	c.3268C>T	c.(3268-3270)Cca>Tca	p.P1090S	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1090					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P1090S(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTATCTTTGGTGCAGAGATA	0.468																																							uc001ntl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(3268-3270)CCA>TCA		AHNAK nucleoprotein isoform 1		A	SER/PRO,	1,4403	2.1+/-5.4	0,1,2201	136.0	132.0	133.0		3268,	3.5	1.0	11	dbSNP_134	133	1,8597	1.2+/-3.3	0,1,4298	yes	missense,intron	AHNAK	NM_001620.1,NM_024060.2	74,	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,	1090/5891,	62298621	2,13000	2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62298621G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3268C>T	11.37:g.62298621G>A	ENSP00000367263:p.Pro1090Ser		Somatic				AHNAK_uc001ntk.1_Intron	p.P1090S	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	3568	-		Melanoma(852;0.155)	1090					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.3268C>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	g	11.16	1.556591	0.27827	2.27E-4	1.16E-4	ENSG00000124942	ENST00000378024	T	0.05649	3.41	4.46	3.55	0.40652	.	0.063724	0.64402	D	0.000005	T	0.31040	0.0784	M	0.93062	3.375	0.36670	D	0.878421	D	0.76494	0.999	D	0.85130	0.997	T	0.49978	-0.8881	10	0.48119	T	0.1	-0.3775	12.6277	0.56638	0.0823:0.0:0.9177:0.0	.	1090	Q09666	AHNK_HUMAN	S	1090	ENSP00000367263:P1090S	ENSP00000367263:P1090S	P	-	1	0	AHNAK	62055197	0.978000	0.34361	1.000000	0.80357	0.092000	0.18411	1.750000	0.38329	1.020000	0.39573	-0.226000	0.12346	CCA		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		6	145	0	0	0	0.02938	0	6	145				
KIF5A	3798	broad.mit.edu	37	12	57975228	57975228	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:57975228C>A	ENST00000455537.2	+	25	3060	c.2786C>A	c.(2785-2787)gCa>gAa	p.A929E	KIF5A_ENST00000286452.5_Missense_Mutation_p.A840E	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	929	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.A929E(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CACTACCCAGCATCCTCACCC	0.552																																							uc001sor.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2785-2787)GCA>GAA		kinesin family member 5A							87.0	85.0	86.0					12																	57975228		2203	4300	6503	SO:0001583	missense	3798				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity	g.chr12:57975228C>A	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2786C>A	12.37:g.57975228C>A	ENSP00000408979:p.Ala929Glu		Somatic				KIF5A_uc010srr.1_Missense_Mutation_p.A840E	p.A929E	NM_004984	NP_004975	WXS	Illumina HiSeq	Unspecified	Q12840	KIF5A_HUMAN			25	2994	+			929			Globular.		A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	c.2786C>A	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320414	0.41096	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.75367	-0.93;-0.93	4.52	3.62	0.41486	.	0.230019	0.35838	N	0.002941	T	0.64472	0.2601	L	0.43923	1.385	0.36796	D	0.885081	B;B	0.33549	0.417;0.19	B;B	0.30943	0.122;0.093	T	0.71852	-0.4467	10	0.48119	T	0.1	.	12.27	0.54700	0.0:0.9102:0.0:0.0898	.	840;929	B7Z2M7;Q12840	.;KIF5A_HUMAN	E	929;840;23	ENSP00000408979:A929E;ENSP00000286452:A840E	ENSP00000286452:A840E	A	+	2	0	KIF5A	56261495	0.951000	0.32395	0.823000	0.32752	0.553000	0.35397	2.125000	0.42016	2.528000	0.85240	0.561000	0.74099	GCA		0.552	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984		16	60	1	0	4.96729e-08	0.049695	5.423e-08	16	60				
PRKAB1	5564	broad.mit.edu	37	12	120110257	120110257	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:120110257C>A	ENST00000229328.5	+	2	803	c.311C>A	c.(310-312)cCc>cAc	p.P104H	PRKAB1_ENST00000540121.1_5'UTR|PRKAB1_ENST00000541640.1_Missense_Mutation_p.P104H	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	104	Glycogen-binding domain. {ECO:0000250}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)	p.P104H(1)		endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	AGTAAACTTCCCCTCACCAGA	0.463																																							uc009zwu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)CCC>CAC		AMP-activated protein kinase beta 1	Adenosine monophosphate(DB00131)|Metformin(DB00331)						77.0	85.0	82.0					12																	120110257		2203	4300	6503	SO:0001583	missense	5564				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol		g.chr12:120110257C>A	BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.311C>A	12.37:g.120110257C>A	ENSP00000229328:p.Pro104His		Somatic				PRKAB1_uc001txg.2_Missense_Mutation_p.P104H	p.P104H	NM_006253	NP_006244	WXS	Illumina HiSeq	Unspecified	Q9Y478	AAKB1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.166)	3	414	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		104					Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Missense_Mutation	SNP	ENST00000229328.5	37	c.311C>A	CCDS9191.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941361	0.92526	.	.	ENSG00000111725	ENST00000229328;ENST00000541640;ENST00000539596	.	.	.	5.29	5.29	0.74685	.	0.048247	0.85682	D	0.000000	T	0.79936	0.4532	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.81364	-0.0966	9	0.72032	D	0.01	-5.5675	19.137	0.93431	0.0:1.0:0.0:0.0	.	104	Q9Y478	AAKB1_HUMAN	H	104;104;67	.	ENSP00000229328:P104H	P	+	2	0	PRKAB1	118594640	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.320000	0.79064	2.759000	0.94783	0.555000	0.69702	CCC		0.463	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401731.2	NM_006253		4	29	1	0	4.096e-09	0.021553	4.51319e-09	4	29				
C12orf43	64897	broad.mit.edu	37	12	121448918	121448918	+	Missense_Mutation	SNP	T	T	A	rs112728225	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:121448918T>A	ENST00000288757.3	-	2	199	c.177A>T	c.(175-177)caA>caT	p.Q59H	C12orf43_ENST00000445832.3_Missense_Mutation_p.Q29H|C12orf43_ENST00000366211.2_Missense_Mutation_p.Q17H|C12orf43_ENST00000537817.1_Missense_Mutation_p.Q29H|C12orf43_ENST00000536407.2_Missense_Mutation_p.Q59H|C12orf43_ENST00000539736.1_Missense_Mutation_p.Q59H	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	59								p.Q59H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGAGGCTCGGTTGGGAGGTTG	0.463													T|||	4	0.000798722	0.0	0.0014	5008	,	,		15557	0.0		0.003	False		,,,				2504	0.0						uc001tzh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(175-177)CAA>CAT		hypothetical protein LOC64897		T	HIS/GLN	6,4400	11.4+/-27.6	0,6,2197	146.0	130.0	136.0		177	-6.3	0.0	12	dbSNP_132	136	36,8564	24.6+/-71.5	0,36,4264	yes	missense	C12orf43	NM_022895.1	24	0,42,6461	AA,AT,TT		0.4186,0.1362,0.3229	probably-damaging	59/263	121448918	42,12964	2203	4300	6503	SO:0001583	missense	64897							g.chr12:121448918T>A	AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.177A>T	12.37:g.121448918T>A	ENSP00000288757:p.Gln59His		Somatic				C12orf43_uc009zxa.1_Missense_Mutation_p.Q59H|C12orf43_uc010szo.1_Missense_Mutation_p.Q17H|C12orf43_uc010szp.1_Missense_Mutation_p.Q59H|C12orf43_uc001tzi.1_Missense_Mutation_p.Q59H	p.Q59H	NM_022895	NP_075046	WXS	Illumina HiSeq	Unspecified	Q96C57	CL043_HUMAN			2	200	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		59					Q53HF0|Q9H9Z7	Missense_Mutation	SNP	ENST00000288757.3	37	c.177A>T	CCDS9210.1	3|3|3	0.0013736263736263737|0.0013736263736263737|0.0013736263736263737	0|0|0	0.0|0.0|0.0	1|1|1	0.0027624309392265192|0.0027624309392265192|0.0027624309392265192	0|0|0	0.0|0.0|0.0	2|2|2	0.002638522427440633|0.002638522427440633|0.002638522427440633	T|T|T	10.57|10.57|10.57	1.387415|1.387415|1.387415	0.25031|0.25031|0.25031	0.001362|0.001362|0.001362	0.004186|0.004186|0.004186	ENSG00000157895|ENSG00000157895|ENSG00000157895	ENST00000546272|ENST00000445832;ENST00000288757;ENST00000537817;ENST00000366211;ENST00000539736;ENST00000538296;ENST00000535367|ENST00000536407	.|T;T;T;T;T|.	.|0.60672|.	.|0.78;0.8;0.24;0.79;0.17|.	5.59|5.59|5.59	-6.29|-6.29|-6.29	0.02013|0.02013|0.02013	.|.|.	.|0.624203|.	.|0.16858|.	.|N|.	.|0.196636|.	T|T|T	0.41766|0.41766|0.41766	0.1173|0.1173|0.1173	M|M|M	0.74881|0.74881|0.74881	2.28|2.28|2.28	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;D;B;D|.	.|0.71674|.	.|0.051;0.051;0.998;0.051;0.995|.	.|B;B;D;B;P|.	.|0.67382|.	.|0.023;0.023;0.951;0.023;0.834|.	T|T|T	0.49735|0.49735|0.49735	-0.8908|-0.8908|-0.8908	6|10|5	0.87932|0.49607|.	D|T|.	0|0.09|.	-6.9988|-6.9988|-6.9988	4.2077|4.2077|4.2077	0.10497|0.10497|0.10497	0.1128:0.1831:0.1116:0.5925|0.1128:0.1831:0.1116:0.5925|0.1128:0.1831:0.1116:0.5925	.|.|.	.|59;17;29;59;59|.	.|G5EA44;F6TFQ5;F5H7W8;B4DWJ9;Q96C57|.	.|.;.;.;.;CL043_HUMAN|.	I|H|S	12|29;59;29;17;59;29;13|64	.|ENSP00000409788:Q29H;ENSP00000288757:Q59H;ENSP00000442224:Q29H;ENSP00000437803:Q59H;ENSP00000442041:Q29H|.	ENSP00000439393:N41I|ENSP00000288757:Q59H|.	N|Q|T	-|-|-	2|3|1	0|2|0	C12orf43|C12orf43|C12orf43	119933301|119933301|119933301	0.032000|0.032000|0.032000	0.19561|0.19561|0.19561	0.019000|0.019000|0.019000	0.16419|0.16419|0.16419	0.258000|0.258000|0.258000	0.26162|0.26162|0.26162	-0.899000|-0.899000|-0.899000	0.04101|0.04101|0.04101	-0.804000|-0.804000|-0.804000	0.04410|0.04410|0.04410	-1.247000|-1.247000|-1.247000	0.01520|0.01520|0.01520	AAC|CAA|ACC		0.463	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022895		4	89	0	0	0	0.02938	0	4	89				
GPR133	283383	broad.mit.edu	37	12	131471727	131471727	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:131471727C>T	ENST00000261654.5	+	6	1137	c.578C>T	c.(577-579)cCg>cTg	p.P193L	GPR133_ENST00000535015.1_Missense_Mutation_p.P225L|RP11-76C10.5_ENST00000542980.1_lincRNA	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	193					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P193L(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ACCTCTGATCCGAGTGGAAAA	0.512																																							uc001uit.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(3)|skin(2)	10						c.(577-579)CCG>CTG		G protein-coupled receptor 133 precursor							145.0	135.0	138.0					12																	131471727		2203	4300	6503	SO:0001583	missense	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131471727C>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.578C>T	12.37:g.131471727C>T	ENSP00000261654:p.Pro193Leu		Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.P225L	p.P193L	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	6	1137	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		193			Extracellular (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.578C>T	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187915	0.78789	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015	T;T;T	0.74002	-0.8;-0.8;-0.8	4.46	4.46	0.54185	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.339843	0.29113	N	0.013120	T	0.75671	0.3881	M	0.72118	2.19	0.80722	D	1	D;D	0.54601	0.967;0.958	B;B	0.43783	0.431;0.278	T	0.81602	-0.0858	10	0.87932	D	0	.	16.1186	0.81325	0.0:1.0:0.0:0.0	.	225;193	B7ZLF7;Q6QNK2	.;GP133_HUMAN	L	193;133;225	ENSP00000261654:P193L;ENSP00000442501:P133L;ENSP00000444425:P225L	ENSP00000261654:P193L	P	+	2	0	GPR133	130037680	0.847000	0.29606	0.115000	0.21578	0.814000	0.46013	3.997000	0.57016	2.024000	0.59613	0.591000	0.81541	CCG		0.512	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		6	106	0	0	0	0.02938	0	6	106				
CCDC176	80127	broad.mit.edu	37	14	74495917	74495917	+	Missense_Mutation	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:74495917A>G	ENST00000394009.3	+	3	439	c.316A>G	c.(316-318)Aca>Gca	p.T106A	AC005484.5_ENST00000492026.1_RNA|CCDC176_ENST00000489323.1_3'UTR|CCDC176_ENST00000553773.1_5'Flank	NM_025057.2	NP_079333.2	Q8ND07	BBOF1_HUMAN	coiled-coil domain containing 176	106					motile cilium assembly (GO:0044458)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.T106A(1)									ATTAAATGAAACAAAGGAAAA	0.358																																							uc010tup.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(316-318)ACA>GCA		hypothetical protein LOC80127							117.0	106.0	109.0					14																	74495917		1567	3572	5139	SO:0001583	missense	80127							g.chr14:74495917A>G	BI457605	CCDS32119.2	14q24.3	2013-01-04	2012-09-25	2012-09-25	ENSG00000119636	ENSG00000119636			19855	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 45"""	C14orf45			Standard	NM_025057		Approved		uc010tup.2	Q8ND07	OTTHUMG00000152786	ENST00000394009.3:c.316A>G	14.37:g.74495917A>G	ENSP00000377577:p.Thr106Ala		Somatic				C14orf45_uc001xpm.1_5'Flank	p.T106A	NM_025057	NP_079333	WXS	Illumina HiSeq	Unspecified	Q8ND07	CN045_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00351)	3	439	+			106			Potential.		Q0P604|Q9H5P8	Missense_Mutation	SNP	ENST00000394009.3	37	c.316A>G	CCDS32119.2	.	.	.	.	.	.	.	.	.	.	A	1.616	-0.522841	0.04141	.	.	ENSG00000119636	ENST00000394009	T	0.29917	1.55	5.21	3.89	0.44902	.	0.626565	0.15234	U	0.273241	T	0.11367	0.0277	N	0.08118	0	0.80722	D	1	B	0.23990	0.095	B	0.20184	0.028	T	0.18335	-1.0340	10	0.08599	T	0.76	-9.0123	2.7787	0.05355	0.6463:0.0:0.1418:0.2119	.	106	Q8ND07	CN045_HUMAN	A	106	ENSP00000377577:T106A	ENSP00000377577:T106A	T	+	1	0	C14orf45	73565670	1.000000	0.71417	0.994000	0.49952	0.354000	0.29330	1.798000	0.38814	2.098000	0.63641	0.260000	0.18958	ACA		0.358	CCDC176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327863.1	NM_025057		3	17	0	0	0	0.014758	0	3	17				
KCNK13	56659	broad.mit.edu	37	14	90650622	90650622	+	Nonsense_Mutation	SNP	C	C	T	rs565658757	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:90650622C>T	ENST00000282146.4	+	2	943	c.502C>T	c.(502-504)Cga>Tga	p.R168*		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	168					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.R168*(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				GCTCCGGAGACGAGGGGCCCT	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17635	0.0		0.0	False		,,,				2504	0.0						uc001xye.1		NA																	2	Substitution - Nonsense(2)		large_intestine(1)|lung(1)	skin(1)	1						c.(502-504)CGA>TGA		potassium channel, subfamily K, member 13							71.0	73.0	72.0					14																	90650622		2203	4300	6503	SO:0001587	stop_gained	56659					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:90650622C>T	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.502C>T	14.37:g.90650622C>T	ENSP00000282146:p.Arg168*		Somatic					p.R168*	NM_022054	NP_071337	WXS	Illumina HiSeq	Unspecified	Q9HB14	KCNKD_HUMAN			2	944	+		all_cancers(154;0.186)	168			Cytoplasmic (Potential).		B5TJL8|Q96E79	Nonsense_Mutation	SNP	ENST00000282146.4	37	c.502C>T	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691976	0.88735	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.09	1.75	0.24633	.	1.017930	0.07926	N	0.976702	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0045	0.30317	0.5844:0.3051:0.1105:0.0	.	.	.	.	X	168	.	ENSP00000282146:R168X	R	+	1	2	KCNK13	89720375	0.063000	0.20901	0.003000	0.11579	0.159000	0.22180	2.387000	0.44389	0.482000	0.27582	0.655000	0.94253	CGA		0.612	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054		14	67	0	0	0	0.038395	0	14	67				
THBS1	7057	broad.mit.edu	37	15	39881468	39881468	+	Silent	SNP	C	C	T	rs377361457		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:39881468C>T	ENST00000260356.5	+	12	2004	c.1839C>T	c.(1837-1839)ccC>ccT	p.P613P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	613					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.P613P(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ACACGGACCCCGGCTACAACT	0.562																																							uc001zkh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(3)	6						c.(1837-1839)CCC>CCT		thrombospondin 1 precursor	Becaplermin(DB00102)	C		1,4399	2.1+/-5.4	0,1,2199	94.0	100.0	98.0		1839	-5.6	0.9	15		98	0,8594		0,0,4297	no	coding-synonymous	THBS1	NM_003246.2		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		613/1171	39881468	1,12993	2200	4297	6497	SO:0001819	synonymous_variant	7057				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding	g.chr15:39881468C>T		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1839C>T	15.37:g.39881468C>T			Somatic				THBS1_uc010bbi.2_Silent_p.P85P	p.P613P	NM_003246	NP_003237	WXS	Illumina HiSeq	Unspecified	P07996	TSP1_HUMAN		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	12	2018	+		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)	613			EGF-like 2; calcium-binding (Potential).		A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	37	c.1839C>T	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427106	0.25726	2.27E-4	0.0	ENSG00000137801	ENST00000397593	.	.	.	5.63	-5.56	0.02529	.	0.000000	0.35772	N	0.002989	T	0.54951	0.1890	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57195	-0.7853	6	0.87932	D	0	-18.1666	5.7779	0.18289	0.085:0.3312:0.0844:0.4995	.	.	.	.	L	47	.	ENSP00000380721:P47L	P	+	2	0	THBS1	37668760	0.003000	0.15002	0.912000	0.35992	0.994000	0.84299	-1.399000	0.02506	-0.991000	0.03476	-0.142000	0.14014	CCG		0.562	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246		14	68	0	0	0	0.020292	0	14	68				
MAP1A	4130	broad.mit.edu	37	15	43818488	43818488	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:43818488C>A	ENST00000300231.5	+	4	5267	c.4817C>A	c.(4816-4818)gCc>gAc	p.A1606D	MAP1A_ENST00000399453.1_Missense_Mutation_p.A1606D|MAP1A_ENST00000382031.1_Missense_Mutation_p.A1844D			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1606					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.A1606D(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AAGGTCAAGGCCATGGAAGAG	0.512																																							uc001zrt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(4816-4818)GCC>GAC		microtubule-associated protein 1A	Estramustine(DB01196)						55.0	60.0	59.0					15																	43818488		1895	4100	5995	SO:0001583	missense	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43818488C>A	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4817C>A	15.37:g.43818488C>A	ENSP00000300231:p.Ala1606Asp		Somatic					p.A1606D	NM_002373	NP_002364	WXS	Illumina HiSeq	Unspecified	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	5284	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	1606					O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	c.4817C>A	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	4.639	0.118698	0.08881	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.64618	-0.11;-0.11;-0.11	4.25	3.3	0.37823	.	.	.	.	.	T	0.48786	0.1519	L	0.29908	0.895	0.09310	N	1	B	0.33238	0.403	B	0.30646	0.118	T	0.29792	-1.0000	9	0.30854	T	0.27	-0.035	12.9342	0.58305	0.0:0.8282:0.1718:0.0	.	1606	P78559	MAP1A_HUMAN	D	1844;1606;1606	ENSP00000371462:A1844D;ENSP00000382380:A1606D;ENSP00000300231:A1606D	ENSP00000300231:A1606D	A	+	2	0	MAP1A	41605780	0.000000	0.05858	0.059000	0.19551	0.338000	0.28826	0.000000	0.12993	1.088000	0.41272	0.563000	0.77884	GCC		0.512	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		6	46	1	0	0.00198382	0.02938	0.00201773	6	46				
MYO5A	4644	broad.mit.edu	37	15	52643464	52643464	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:52643464G>A	ENST00000399231.3	-	28	4079	c.3836C>T	c.(3835-3837)gCc>gTc	p.A1279V	MYO5A_ENST00000358212.6_Missense_Mutation_p.A1279V|MYO5A_ENST00000553916.1_Missense_Mutation_p.A1279V|MYO5A_ENST00000399233.2_Missense_Mutation_p.A1279V|MYO5A_ENST00000356338.6_Missense_Mutation_p.A1279V	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1279					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.A1279V(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GGGTTGGATGGCCTCTTTCTG	0.512																																							uc002aby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3835-3837)GCC>GTC		myosin VA isoform 1							54.0	59.0	58.0					15																	52643464		1981	4167	6148	SO:0001583	missense	4644				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr15:52643464G>A		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3836C>T	15.37:g.52643464G>A	ENSP00000382177:p.Ala1279Val		Somatic				MYO5A_uc002abx.3_Missense_Mutation_p.A1279V|MYO5A_uc010ugd.1_Missense_Mutation_p.A31V|MYO5A_uc002aca.1_Missense_Mutation_p.A31V|MYO5A_uc002acb.1_Missense_Mutation_p.A31V|MYO5A_uc002acc.1_Missense_Mutation_p.A31V	p.A1279V	NM_000259	NP_000250	WXS	Illumina HiSeq	Unspecified	Q9Y4I1	MYO5A_HUMAN		all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)	28	4080	-			1279					A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	c.3836C>T	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474395	0.84640	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916;ENST00000399228	T;T;T;T;T;T	0.18960	3.57;3.57;2.18;3.57;3.6;3.57	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.35537	0.0935	L	0.27053	0.805	0.80722	D	1	B;D;D;B;D	0.89917	0.197;1.0;1.0;0.129;1.0	B;D;D;B;D	0.91635	0.042;0.999;0.999;0.017;0.997	T	0.03008	-1.1083	10	0.31617	T	0.26	.	19.704	0.96066	0.0:0.0:1.0:0.0	.	39;72;72;1279;1279	B5LY56;Q9UES5;O95317;Q9Y4I1;Q9Y4I1-2	.;.;.;MYO5A_HUMAN;.	V	1279;813;1279;1279;1279;909;1279;72	ENSP00000382177:A1279V;ENSP00000382179:A1279V;ENSP00000348693:A1279V;ENSP00000350945:A1279V;ENSP00000451109:A1279V;ENSP00000382174:A72V	ENSP00000348693:A1279V	A	-	2	0	MYO5A	50430756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.726000	0.93360	0.650000	0.86243	GCC		0.512	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259		5	25	0	0	0	0.014758	0	5	25				
UNC45A	55898	broad.mit.edu	37	15	91485697	91485697	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:91485697C>T	ENST00000418476.2	+	7	758	c.718C>T	c.(718-720)Cgg>Tgg	p.R240W	UNC45A_ENST00000394275.2_Missense_Mutation_p.R225W|UNC45A_ENST00000553671.2_Intron	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	240					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R240W(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ACTGGGAACTCGGCGAGTAGT	0.562																																							uc002bqg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(718-720)CGG>TGG		smooth muscle cell associated protein-1 isoform							103.0	104.0	104.0					15																	91485697		2198	4298	6496	SO:0001583	missense	55898				cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding	g.chr15:91485697C>T		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.718C>T	15.37:g.91485697C>T	ENSP00000407487:p.Arg240Trp		Somatic				UNC45A_uc002bqd.2_Missense_Mutation_p.R225W|UNC45A_uc010uqo.1_Missense_Mutation_p.R232W|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.R240W	p.R240W	NM_018671	NP_061141	WXS	Illumina HiSeq	Unspecified	Q9H3U1	UN45A_HUMAN	Lung(145;0.189)		7	1058	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		240					A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	c.718C>T	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074742	0.76415	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.50548	0.74;0.74	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.378699	0.28006	N	0.016963	T	0.48241	0.1489	N	0.22421	0.69	0.38515	D	0.948584	D;D;D;D	0.76494	0.999;0.999;0.998;0.993	P;P;P;P	0.59825	0.82;0.864;0.657;0.638	T	0.53344	-0.8452	10	0.72032	D	0.01	-30.8218	9.8154	0.40849	0.0:0.783:0.1409:0.0761	.	240;232;240;225	B4DZL0;B4DLE6;Q9H3U1;A8K6F7	.;.;UN45A_HUMAN;.	W	225;240	ENSP00000377816:R225W;ENSP00000407487:R240W	ENSP00000377816:R225W	R	+	1	2	UNC45A	89286701	0.999000	0.42202	0.999000	0.59377	0.979000	0.70002	2.963000	0.49184	2.755000	0.94549	0.558000	0.71614	CGG		0.562	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671		4	30	0	0	0	0.021553	0	4	30				
TTC23	64927	broad.mit.edu	37	15	99696405	99696405	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:99696405C>A	ENST00000394132.2	-	12	1908	c.1091G>T	c.(1090-1092)gGa>gTa	p.G364V	TTC23_ENST00000394135.3_Missense_Mutation_p.G364V|TTC23_ENST00000558613.1_Missense_Mutation_p.G364V|AC022819.3_ENST00000563495.1_RNA|TTC23_ENST00000262074.4_Missense_Mutation_p.G364V|TTC23_ENST00000394136.1_Missense_Mutation_p.G364V|TTC23_ENST00000558663.1_Missense_Mutation_p.G364V|TTC23_ENST00000394129.2_Missense_Mutation_p.G364V|TTC23_ENST00000394130.1_Missense_Mutation_p.G364V			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	364								p.G364V(1)		endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			CAGGTCTGCTCCTCCCAGGAG	0.577																																							uc002bur.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1090-1092)GGA>GTA		tetratricopeptide repeat domain 23							102.0	100.0	101.0					15																	99696405		2197	4297	6494	SO:0001583	missense	64927						binding	g.chr15:99696405C>A		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.1091G>T	15.37:g.99696405C>A	ENSP00000377690:p.Gly364Val		Somatic				TTC23_uc002bus.2_Missense_Mutation_p.G364V|TTC23_uc002but.2_Missense_Mutation_p.G364V|TTC23_uc002buu.2_Missense_Mutation_p.G364V|TTC23_uc002buv.2_Missense_Mutation_p.G364V|TTC23_uc002bux.2_Missense_Mutation_p.G364V|TTC23_uc002buw.2_Missense_Mutation_p.G364V|TTC23_uc010boq.2_RNA|TTC23_uc002buy.2_Missense_Mutation_p.G364V|TTC23_uc010bor.2_Missense_Mutation_p.G364V|TTC23_uc002buz.2_Missense_Mutation_p.G364V	p.G364V	NM_022905	NP_075056	WXS	Illumina HiSeq	Unspecified	Q5W5X9	TTC23_HUMAN	all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)		11	1622	-	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		364			TPR 4.		A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	ENST00000394132.2	37	c.1091G>T	CCDS10379.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.621|8.621	0.891339|0.891339	0.17613|0.17613	.|.	.|.	ENSG00000103852|ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129|ENST00000434594	D;D;D;D;T;T|.	0.93659|.	-3.26;-3.26;-3.26;-3.26;0.08;1.29|.	5.58|5.58	-0.505|-0.505	0.11993|0.11993	Tetratricopeptide-like helical (1);|.	1.059420|.	0.07315|.	N|.	0.876597|.	T|T	0.21718|0.21718	0.0523|0.0523	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|.	0.18461|.	0.001;0.028|.	B;B|.	0.22386|.	0.005;0.039|.	T|T	0.24261|0.24261	-1.0165|-1.0165	10|5	0.21014|.	T|.	0.42|.	0.0058|0.0058	1.8513|1.8513	0.03169|0.03169	0.2668:0.4277:0.131:0.1744|0.2668:0.4277:0.131:0.1744	.|.	364;364|.	Q5W5X9-2;Q5W5X9|.	.;TTC23_HUMAN|.	V|S	364|99	ENSP00000377690:G364V;ENSP00000377693:G364V;ENSP00000262074:G364V;ENSP00000377692:G364V;ENSP00000377688:G364V;ENSP00000457901:G364V|.	ENSP00000262074:G364V|.	G|R	-|-	2|3	0|2	TTC23|TTC23	97513928|97513928	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.265000|0.265000	0.26407|0.26407	-0.482000|-0.482000	0.06544|0.06544	0.013000|0.013000	0.14918|0.14918	0.563000|0.563000	0.77884|0.77884	GGA|AGG		0.577	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905		7	43	1	0	0.000157383	0.038147	0.000161454	7	43				
GPR139	124274	broad.mit.edu	37	16	20043736	20043736	+	Missense_Mutation	SNP	A	A	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:20043736A>T	ENST00000570682.1	-	2	683	c.383T>A	c.(382-384)aTc>aAc	p.I128N		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	128					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.I128N(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						GCAGACAGCGATATACCTGTC	0.507																																							uc002dgu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(382-384)ATC>AAC		G protein-coupled receptor 139							168.0	133.0	145.0					16																	20043736		2203	4300	6503	SO:0001583	missense	124274					integral to membrane|plasma membrane		g.chr16:20043736A>T	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.383T>A	16.37:g.20043736A>T	ENSP00000458791:p.Ile128Asn		Somatic				GPR139_uc010vaw.1_Missense_Mutation_p.I35N	p.I128N	NM_001002911	NP_001002911	WXS	Illumina HiSeq	Unspecified	Q6DWJ6	GP139_HUMAN			2	545	-			128			Cytoplasmic (Potential).		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	37	c.383T>A	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	A	13.80	2.345788	0.41599	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60327	0.2260	L	0.52573	1.65	0.80722	D	1	B	0.28400	0.21	B	0.31869	0.137	T	0.61143	-0.7122	9	0.59425	D	0.04	-31.4927	15.1985	0.73116	1.0:0.0:0.0:0.0	.	128	Q6DWJ6	GP139_HUMAN	N	128	.	ENSP00000370779:I128N	I	-	2	0	GPR139	19951237	1.000000	0.71417	0.670000	0.29842	0.839000	0.47603	8.730000	0.91510	2.186000	0.69663	0.533000	0.62120	ATC		0.507	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911		90	407	0	0	0	0.048971	0	90	407				
SPIRE2	84501	broad.mit.edu	37	16	89911744	89911744	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:89911744G>T	ENST00000378247.3	+	2	302	c.259G>T	c.(259-261)Gtc>Ttc	p.V87F	SPIRE2_ENST00000564878.1_3'UTR|SPIRE2_ENST00000393062.2_Missense_Mutation_p.V87F|SPIRE2_ENST00000563972.1_Missense_Mutation_p.V87F	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	87	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.V87F(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TGCAACCATGGTCGTGCCACT	0.468																																							uc002foz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(259-261)GTC>TTC		spire homolog 2							114.0	109.0	111.0					16																	89911744		2198	4300	6498	SO:0001583	missense	84501				transport	cytoplasm|cytoskeleton	actin binding	g.chr16:89911744G>T	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.259G>T	16.37:g.89911744G>T	ENSP00000367494:p.Val87Phe		Somatic				SPIRE2_uc010civ.1_Missense_Mutation_p.V2F|SPIRE2_uc010ciw.1_Missense_Mutation_p.V87F	p.V87F	NM_032451	NP_115827	WXS	Illumina HiSeq	Unspecified	Q8WWL2	SPIR2_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0286)	2	311	+		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)	87			KIND.		A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	ENST00000378247.3	37	c.259G>T	CCDS32516.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962572	0.53400	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.30448	1.53;1.53	5.19	2.22	0.28083	KIND (2);	1.025700	0.07689	N	0.938406	T	0.26810	0.0656	L	0.56769	1.78	0.25501	N	0.987557	P;P	0.44429	0.835;0.815	B;B	0.40066	0.318;0.316	T	0.13282	-1.0515	10	0.09590	T	0.72	-5.4635	6.7967	0.23729	0.2826:0.0:0.7174:0.0	.	87;87	Q8WWL2-2;Q8WWL2	.;SPIR2_HUMAN	F	87	ENSP00000367494:V87F;ENSP00000376782:V87F	ENSP00000367494:V87F	V	+	1	0	SPIRE2	88439245	1.000000	0.71417	0.151000	0.22473	0.737000	0.42083	0.977000	0.29475	0.371000	0.24564	0.467000	0.42956	GTC		0.468	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462		4	28	1	0	3.59834e-05	0.021553	3.7235e-05	4	28				
GSG2	83903	broad.mit.edu	37	17	3628194	3628194	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:3628194G>A	ENST00000325418.4	+	1	984	c.965G>A	c.(964-966)cGc>cAc	p.R322H	ITGAE_ENST00000263087.4_Intron|CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	322					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)	p.R322H(1)									CCCAAGGGCCGCATTGTGCCA	0.582																																							uc002fwp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(964-966)CGC>CAC		haspin							51.0	47.0	48.0					17																	3628194		2203	4300	6503	SO:0001583	missense	83903				cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr17:3628194G>A	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.965G>A	17.37:g.3628194G>A	ENSP00000325290:p.Arg322His		Somatic				ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	p.R322H	NM_031965	NP_114171	WXS	Illumina HiSeq	Unspecified	Q8TF76	HASP_HUMAN			1	998	+			322					Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	c.965G>A	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256542	0.39896	.	.	ENSG00000177602	ENST00000325418	T	0.05925	3.37	4.47	2.3	0.28687	.	0.885835	0.09417	N	0.805042	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	P	0.46277	0.875	B	0.35312	0.2	T	0.42999	-0.9418	10	0.87932	D	0	-33.3863	7.8687	0.29552	0.0:0.1499:0.6312:0.2189	.	322	Q8TF76	HASP_HUMAN	H	322	ENSP00000325290:R322H	ENSP00000325290:R322H	R	+	2	0	GSG2	3574943	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.686000	0.25392	0.455000	0.26910	0.655000	0.94253	CGC		0.582	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965		3	18	0	0	0	0.004672	0	3	18				
USP6	9098	broad.mit.edu	37	17	5041502	5041502	+	Missense_Mutation	SNP	G	G	A	rs201324904		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:5041502G>A	ENST00000574788.1	+	21	3242	c.1012G>A	c.(1012-1014)Gtg>Atg	p.V338M	USP6_ENST00000250066.6_Missense_Mutation_p.V338M|USP6_ENST00000304328.5_5'UTR|USP6_ENST00000332776.4_Missense_Mutation_p.V338M			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	338					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.V338M(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CGATGACACCGTGCTCAAGCA	0.582			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts								G|||	1	0.000199681	0.0	0.0014	5008	,	,		20107	0.0		0.0	False		,,,				2504	0.0						uc002gau.1		NA		Dom	yes		17	17p13	9098	T	ubiquitin specific peptidase 6 (Tre-2 oncogene)			M	COL1A1|CDH11|ZNF9|OMD		aneurysmal bone cysts		2	Substitution - Missense(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						c.(1012-1014)GTG>ATG		ubiquitin specific protease 6							142.0	140.0	141.0					17																	5041502		2203	4300	6503	SO:0001583	missense	9098				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr17:5041502G>A	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1012G>A	17.37:g.5041502G>A	ENSP00000460380:p.Val338Met		Somatic				USP6_uc002gav.1_Missense_Mutation_p.V338M|USP6_uc010ckz.1_Translation_Start_Site|uc002gbd.2_5'Flank	p.V338M	NM_004505	NP_004496	WXS	Illumina HiSeq	Unspecified	P35125	UBP6_HUMAN			21	3242	+			338					Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	c.1012G>A	CCDS11069.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	14.68	2.607374	0.46527	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.24723	1.84;1.84	0.862	0.862	0.19056	Rab-GAP/TBC domain (1);	0.106620	0.64402	D	0.000006	T	0.33265	0.0857	L	0.52364	1.645	0.80722	D	1	D	0.65815	0.995	P	0.60068	0.868	T	0.06734	-1.0810	10	0.87932	D	0	.	5.4	0.16291	0.0:0.0:1.0:0.0	.	338	P35125	UBP6_HUMAN	M	338	ENSP00000328010:V338M;ENSP00000250066:V338M	ENSP00000250066:V338M	V	+	1	0	USP6	4982226	0.003000	0.15002	0.116000	0.21606	0.117000	0.20001	0.353000	0.20130	0.132000	0.18615	0.134000	0.15878	GTG		0.582	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505		7	43	0	0	0	0.058154	0	7	43				
CCDC144A	9720	broad.mit.edu	37	17	16612580	16612580	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:16612580C>T	ENST00000360524.8	+	5	1285	c.1209C>T	c.(1207-1209)tgC>tgT	p.C403C	CCDC144A_ENST00000399273.1_Silent_p.C403C|RN7SL620P_ENST00000580704.1_RNA|CCDC144A_ENST00000340621.5_Silent_p.C402C|CCDC144A_ENST00000443444.2_Silent_p.C403C|CCDC144A_ENST00000456009.1_Intron|RP11-219A15.1_ENST00000448331.3_Silent_p.C403C	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	403								p.C403C(1)									AATTAGACTGCGACAATGATA	0.358																																							uc002gqk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1207-1209)TGC>TGT		coiled-coil domain containing 144A							59.0	54.0	56.0					17																	16612580		1815	4073	5888	SO:0001819	synonymous_variant	9720							g.chr17:16612580C>T	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.1209C>T	17.37:g.16612580C>T			Somatic				CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_5'Flank	p.C403C	NM_014695	NP_055510	WXS	Illumina HiSeq	Unspecified	A2RUR9	C144A_HUMAN			5	1285	+			403					O60311|Q6ZU57	Silent	SNP	ENST00000360524.8	37	c.1209C>T	CCDS45621.1																																																																																				0.358	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			68	50	0	0	0	0.048971	0	68	50				
SPECC1	92521	broad.mit.edu	37	17	20108150	20108150	+	Nonsense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:20108150C>G	ENST00000261503.5	+	4	839	c.788C>G	c.(787-789)tCa>tGa	p.S263*	SPECC1_ENST00000395527.4_Nonsense_Mutation_p.S263*|SPECC1_ENST00000395530.2_Nonsense_Mutation_p.S182*|SPECC1_ENST00000395525.3_Nonsense_Mutation_p.S182*|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395522.2_Nonsense_Mutation_p.S182*|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395529.3_Nonsense_Mutation_p.S263*|SPECC1_ENST00000584527.1_5'Flank	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	263	Ser-rich.				cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.S263*(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TCCCCAAATTCAGAAGGGGCA	0.488																																							uc002gwq.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(787-789)TCA>TGA		spectrin domain with coiled-coils 1 NSP5b3b							80.0	91.0	87.0					17																	20108150		2203	4300	6503	SO:0001587	stop_gained	92521					nucleus		g.chr17:20108150C>G	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.788C>G	17.37:g.20108150C>G	ENSP00000261503:p.Ser263*		Somatic				CYTSB_uc010cqx.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gwr.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gws.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gwv.2_Nonsense_Mutation_p.S182*|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Nonsense_Mutation_p.S39*|CYTSB_uc002gwt.2_Nonsense_Mutation_p.S182*|CYTSB_uc002gwu.2_Nonsense_Mutation_p.S182*	p.S263*	NM_001033553	NP_001028725	WXS	Illumina HiSeq	Unspecified	Q5M775	CYTSB_HUMAN			4	933	+			263			Ser-rich.		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Nonsense_Mutation	SNP	ENST00000261503.5	37	c.788C>G	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	36	5.680767	0.96774	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	.	.	.	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.2163	17.0048	0.86390	0.0:1.0:0.0:0.0	.	.	.	.	X	263;263;263;182;182;182	.	ENSP00000261503:S263X	S	+	2	0	SPECC1	20048742	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	4.581000	0.60949	2.698000	0.92095	0.655000	0.94253	TCA		0.488	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		7	218	0	0	0	0.058154	0	7	218				
KLHL10	317719	broad.mit.edu	37	17	40004382	40004382	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:40004382G>A	ENST00000293303.4	+	5	1803	c.1650G>A	c.(1648-1650)aaG>aaA	p.K550K	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	550					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.K550K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				ATGATGAAAAGACCGATGAGT	0.463																																							uc010cxr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(1648-1650)AAG>AAA		kelch-like 10							140.0	135.0	136.0					17																	40004382		1992	4180	6172	SO:0001819	synonymous_variant	317719					cytoplasm		g.chr17:40004382G>A	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1650G>A	17.37:g.40004382G>A			Somatic				KLHL10_uc010wfw.1_Silent_p.K462K	p.K550K	NM_152467	NP_689680	WXS	Illumina HiSeq	Unspecified	Q6JEL2	KLH10_HUMAN			5	1792	+		Breast(137;0.000162)	550			Kelch 6.		Q6NW28|Q96MC0	Silent	SNP	ENST00000293303.4	37	c.1650G>A	CCDS42340.1																																																																																				0.463	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467		12	117	0	0	0	0.09319	0	12	117				
MYOM1	8736	broad.mit.edu	37	18	3102545	3102545	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr18:3102545C>G	ENST00000356443.4	-	23	3835	c.3502G>C	c.(3502-3504)Gag>Cag	p.E1168Q	MYOM1_ENST00000400569.3_Missense_Mutation_p.E1168Q|MYOM1_ENST00000261606.7_Missense_Mutation_p.E1072Q	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1168	Ig-like C2-type 3.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.E1168Q(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CAGGAGAACTCGGACTTTGGA	0.413																																							uc002klp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(3502-3504)GAG>CAG		myomesin 1 isoform a							195.0	189.0	191.0					18																	3102545		1895	4117	6012	SO:0001583	missense	8736					striated muscle myosin thick filament	structural constituent of muscle	g.chr18:3102545C>G	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3502G>C	18.37:g.3102545C>G	ENSP00000348821:p.Glu1168Gln		Somatic				MYOM1_uc002klq.2_Missense_Mutation_p.E1072Q	p.E1168Q	NM_003803	NP_003794	WXS	Illumina HiSeq	Unspecified	P52179	MYOM1_HUMAN			23	3836	-			1168			Ig-like C2-type 3.		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	c.3502G>C	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	8.911	0.958672	0.18507	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.67865	-0.29;-0.29;-0.29	5.46	-2.5	0.06384	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.260412	0.42682	N	0.000665	T	0.33527	0.0866	N	0.04959	-0.14	0.30447	N	0.775663	B;B	0.06786	0.001;0.001	B;B	0.19148	0.018;0.024	T	0.23797	-1.0178	10	0.12430	T	0.62	.	5.6798	0.17769	0.0:0.214:0.4018:0.3842	.	1072;1168	P52179-2;P52179	.;MYOM1_HUMAN	Q	1168;1168;1072	ENSP00000348821:E1168Q;ENSP00000383413:E1168Q;ENSP00000261606:E1072Q	ENSP00000261606:E1072Q	E	-	1	0	MYOM1	3092545	0.999000	0.42202	0.348000	0.25681	0.848000	0.48234	0.814000	0.27239	-0.219000	0.10003	-0.312000	0.09012	GAG		0.413	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		79	259	0	0	0	0.048971	0	79	259				
ZNF812	729648	broad.mit.edu	37	19	9801053	9801053	+	Missense_Mutation	SNP	G	G	C	rs576821063	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:9801053G>C	ENST00000457674.2	-	5	1644	c.1126C>G	c.(1126-1128)Cgt>Ggt	p.R376G	ZNF812_ENST00000536819.1_5'UTR	NM_001199814.1	NP_001186743.1	P0C7V5	ZN812_HUMAN	zinc finger protein 812	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R376G(1)		ovary(1)	1						TGTTTACTACGATAGGAAGAA	0.393																																							uc010xkx.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(814-816)CGT>GGT		RecName: Full=Zinc finger protein 562;																																				SO:0001583	missense	0							g.chr19:9801053G>C		CCDS54215.1	19p13.2	2014-04-02			ENSG00000224689	ENSG00000224689		"""Zinc fingers, C2H2-type"", ""-"""	33242	protein-coding gene	gene with protein product							Standard	NM_001199814		Approved		uc021uop.1	P0C7V5	OTTHUMG00000167867	ENST00000457674.2:c.1126C>G	19.37:g.9801053G>C	ENSP00000395629:p.Arg376Gly		Somatic					p.R272G			WXS	Illumina HiSeq	Unspecified					3	1437	-									Missense_Mutation	SNP	ENST00000457674.2	37	c.814C>G	CCDS54215.1	.	.	.	.	.	.	.	.	.	.	g	7.030	0.560517	0.13498	.	.	ENSG00000224689	ENST00000457674	T	0.07444	3.19	1.42	1.42	0.22433	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09642	0.0237	L	0.41236	1.265	0.09310	N	1	P	0.42871	0.792	B	0.44044	0.439	T	0.22730	-1.0208	9	0.87932	D	0	.	8.745	0.34580	0.0:0.0:1.0:0.0	.	376	P0C7V5	ZN812_HUMAN	G	376	ENSP00000395629:R376G	ENSP00000395629:R376G	R	-	1	0	ZNF812	9662053	0.035000	0.19736	0.001000	0.08648	0.030000	0.12068	0.082000	0.14847	1.070000	0.40811	0.195000	0.17529	CGT		0.393	ZNF812-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396726.1			8	130	0	0	0	0.058154	0	8	130				
ELOF1	84337	broad.mit.edu	37	19	11665121	11665121	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:11665121C>T	ENST00000252445.3	-	2	105	c.42G>A	c.(40-42)aaG>aaA	p.K14K	ELOF1_ENST00000586683.1_Silent_p.K14K|ELOF1_ENST00000591912.1_Silent_p.K14K|ELOF1_ENST00000587806.1_Silent_p.K35K|ELOF1_ENST00000589171.1_Silent_p.K14K|ELOF1_ENST00000590700.1_Silent_p.K14K|ELOF1_ENST00000591674.1_Silent_p.K21K|ELOF1_ENST00000586120.1_Silent_p.K14K	NM_032377.3	NP_115753.1	P60002	ELOF1_HUMAN	elongation factor 1 homolog (S. cerevisiae)	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.K14K(1)		endometrium(3)|lung(2)	5						CTGTCATCTTCTTCTTGGGAG	0.552																																							uc002mse.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(40-42)AAG>AAA		elongation factor 1 homolog (ELF1, S.							276.0	213.0	234.0					19																	11665121		2203	4300	6503	SO:0001819	synonymous_variant	84337				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr19:11665121C>T	AK001171	CCDS12264.1	19p13.2	2008-02-05	2006-02-13			ENSG00000130165			28691	protein-coding gene	gene with protein product			"""elongation factor 1 homolog (ELF1, S. cerevisiae)"""			12477932	Standard	NM_032377		Approved	MGC4549, ELF1	uc002mse.1	P60002		ENST00000252445.3:c.42G>A	19.37:g.11665121C>T			Somatic				ELOF1_uc002msd.1_Silent_p.K35K	p.K14K	NM_032377	NP_115753	WXS	Illumina HiSeq	Unspecified	P60002	ELOF1_HUMAN			2	106	-			14					Q8R1J7|Q96II4	Silent	SNP	ENST00000252445.3	37	c.42G>A	CCDS12264.1																																																																																				0.552	ELOF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458868.1	NM_032377		15	61	0	0	0	0.043863	0	15	61				
LYL1	4066	broad.mit.edu	37	19	13211508	13211508	+	Silent	SNP	C	C	T	rs142687463	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:13211508C>T	ENST00000264824.4	-	3	750	c.390G>A	c.(388-390)aaG>aaA	p.K130K		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	130					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K130K(1)		cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			TTGGTCTCCGCTTCAACCGGC	0.562			T	TRB@	T-ALL								C|||	8	0.00159744	0.0	0.0029	5008	,	,		15553	0.0		0.001	False		,,,				2504	0.0051						uc002mwi.2		NA		Dom	yes		19	19p13.2-p13.1	4066	T	lymphoblastic leukemia derived sequence 1			L	TRB@		T-ALL		1	Substitution - coding silent(1)		lung(1)		0						c.(388-390)AAG>AAA		lymphoblastic leukemia derived sequence 1		C		8,4398	15.5+/-35.6	0,8,2195	218.0	206.0	210.0		390	2.0	1.0	19	dbSNP_134	210	44,8556	29.0+/-79.6	0,44,4256	no	coding-synonymous	LYL1	NM_005583.4		0,52,6451	TT,TC,CC		0.5116,0.1816,0.3998		130/281	13211508	52,12954	2203	4300	6503	SO:0001819	synonymous_variant	4066				B cell differentiation|blood vessel maturation|definitive hemopoiesis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr19:13211508C>T		CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.390G>A	19.37:g.13211508C>T			Somatic					p.K130K	NM_005583	NP_005574	WXS	Illumina HiSeq	Unspecified	P12980	LYL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)		3	751	-			130					O76102	Silent	SNP	ENST00000264824.4	37	c.390G>A	CCDS12292.1																																																																																				0.562	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452827.1	NM_005583		7	59	0	0	0	0.047766	0	7	59				
ANKRD27	84079	broad.mit.edu	37	19	33140660	33140660	+	Silent	SNP	G	G	T	rs367630751		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:33140660G>T	ENST00000306065.4	-	3	299	c.141C>A	c.(139-141)atC>atA	p.I47I	ANKRD27_ENST00000587352.1_Silent_p.I47I	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	47					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.I47I(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AAGTAGACTGGATGCTGCTCG	0.448																																							uc002ntn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(139-141)ATC>ATA		ankyrin repeat domain 27 (VPS9 domain)							154.0	158.0	157.0					19																	33140660		2203	4300	6503	SO:0001819	synonymous_variant	84079				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr19:33140660G>T	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.141C>A	19.37:g.33140660G>T			Somatic				ANKRD27_uc002nto.1_Silent_p.I47I	p.I47I	NM_032139	NP_115515	WXS	Illumina HiSeq	Unspecified	Q96NW4	ANR27_HUMAN			3	297	-	Esophageal squamous(110;0.137)		47					Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	ENST00000306065.4	37	c.141C>A	CCDS32986.1																																																																																				0.448	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139		9	113	1	0	7.48243e-07	0.058154	8.09463e-07	9	113				
TEX101	83639	broad.mit.edu	37	19	43922153	43922153	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:43922153C>A	ENST00000598265.1	+	5	681	c.515C>A	c.(514-516)aCt>aAt	p.T172N	TEX101_ENST00000253435.7_Missense_Mutation_p.T190N|TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000602198.1_Missense_Mutation_p.T190N	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	172	UPAR/Ly6.					acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.T190N(1)		large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				CTTGAGATCACTGGAGGTAAA	0.483																																							uc010xwo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(514-516)ACT>AAT		testis expressed 101 isoform 2							149.0	128.0	135.0					19																	43922153		2203	4300	6503	SO:0001583	missense	83639					anchored to membrane|plasma membrane		g.chr19:43922153C>A	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.515C>A	19.37:g.43922153C>A	ENSP00000472769:p.Thr172Asn		Somatic				TEX101_uc002owk.2_Missense_Mutation_p.T190N	p.T172N	NM_001130011	NP_001123483	WXS	Illumina HiSeq	Unspecified	Q9BY14	TX101_HUMAN			5	710	+		Prostate(69;0.0199)	172					Q7L5R2|Q9BPY7	Missense_Mutation	SNP	ENST00000598265.1	37	c.515C>A	CCDS59393.1	.	.	.	.	.	.	.	.	.	.	C	8.956	0.969276	0.18659	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.69926	-0.44	3.88	-0.71	0.11234	CD59 antigen (1);	0.887861	0.09615	N	0.778311	T	0.64627	0.2615	L	0.50333	1.59	0.09310	N	0.999995	D;D	0.55385	0.971;0.964	P;P	0.54270	0.747;0.631	T	0.53578	-0.8419	10	0.31617	T	0.26	-0.7179	3.7931	0.08728	0.0:0.5022:0.1831:0.3147	.	172;190	Q9BY14;Q9BY14-2	TX101_HUMAN;.	N	190;185	ENSP00000253435:T190N	ENSP00000253435:T190N	T	+	2	0	TEX101	48613993	0.011000	0.17503	0.108000	0.21378	0.605000	0.37080	-0.483000	0.06536	-0.016000	0.14127	-0.251000	0.11542	ACT		0.483	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451		15	182	1	0	8.34094e-07	0.049695	8.86224e-07	15	182				
ERCC2	2068	broad.mit.edu	37	19	45860756	45860756	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:45860756G>T	ENST00000391945.4	-	14	1430	c.1353C>A	c.(1351-1353)ttC>ttA	p.F451L	ERCC2_ENST00000391944.3_Missense_Mutation_p.F373L	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	451	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.F451L(1)		large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		TGACAGACTGGAAACGCTCAA	0.642			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc002pbj.2		NA	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	Mis|N|F|S	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""			E		skin basal cell|skin squamous cell|melanoma			1	Substitution - Missense(1)		lung(1)	lung(2)|pancreas(1)	3						c.(1351-1353)TTC>TTA	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							72.0	68.0	69.0					19																	45860756		2203	4300	6503	SO:0001583	missense	2068	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding	g.chr19:45860756G>T		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1353C>A	19.37:g.45860756G>T	ENSP00000375809:p.Phe451Leu		Somatic				ERCC2_uc002pbh.2_Missense_Mutation_p.F14L|ERCC2_uc002pbi.2_Missense_Mutation_p.F144L|ERCC2_uc010ejz.2_Missense_Mutation_p.F373L|ERCC2_uc002pbk.2_Missense_Mutation_p.F427L	p.F451L	NM_000400	NP_000391	WXS	Illumina HiSeq	Unspecified	P18074	ERCC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0226)	14	1400	-		Ovarian(192;0.0728)|all_neural(266;0.112)	451			Mediates interaction with MMS19.		Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	c.1353C>A	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.128104	0.56721	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	T;T	0.70516	-0.49;-0.49	5.64	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.87269	2.87	0.80722	D	1	B;B;B	0.28971	0.229;0.036;0.053	B;B;B	0.30105	0.104;0.111;0.035	T	0.76553	-0.2917	10	0.87932	D	0	-38.8702	10.3385	0.43864	0.1032:0.0:0.8968:0.0	.	373;451;144	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	L	401;427;451;373	ENSP00000375809:F451L;ENSP00000375808:F373L	ENSP00000375805:F401L	F	-	3	2	ERCC2	50552596	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.005000	0.40864	2.655000	0.90218	0.655000	0.94253	TTC		0.642	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400		13	22	1	0	3.52763e-06	0.0333	3.71494e-06	13	22				
ZNF671	79891	broad.mit.edu	37	19	58232868	58232868	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:58232868C>T	ENST00000317398.6	-	4	681	c.586G>A	c.(586-588)Gca>Aca	p.A196T	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Missense_Mutation_p.A98T|AC003006.7_ENST00000599221.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A196T(1)		kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTTCCACATGCCCCACACAAG	0.488																																							uc002qpz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(586-588)GCA>ACA		zinc finger protein 671							159.0	150.0	153.0					19																	58232868		2203	4300	6503	SO:0001583	missense	79891				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58232868C>T		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.586G>A	19.37:g.58232868C>T	ENSP00000321848:p.Ala196Thr		Somatic				ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Missense_Mutation_p.A119T|ZNF671_uc010yhf.1_Missense_Mutation_p.A98T	p.A196T	NM_024833	NP_079109	WXS	Illumina HiSeq	Unspecified	Q8TAW3	ZN671_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	685	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	196			C2H2-type 1; degenerate.		A6NF07|Q9H5E9	Missense_Mutation	SNP	ENST00000317398.6	37	c.586G>A	CCDS12961.1	.	.	.	.	.	.	.	.	.	.	C	6.448	0.450867	0.12223	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.27720	1.65;1.65	1.47	0.392	0.16288	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15955	0.0384	N	0.17872	0.535	0.09310	N	1	B	0.24618	0.107	B	0.16722	0.016	T	0.20739	-1.0266	9	0.40728	T	0.16	.	3.809	0.08789	0.0:0.7541:0.0:0.2459	.	196	Q8TAW3	ZN671_HUMAN	T	196;98	ENSP00000321848:A196T;ENSP00000338670:A98T	ENSP00000321848:A196T	A	-	1	0	ZNF671	62924680	0.000000	0.05858	0.001000	0.08648	0.174000	0.22865	-1.447000	0.02396	0.185000	0.20105	0.467000	0.42956	GCA		0.488	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	NM_024833		6	69	0	0	0	0.021553	0	6	69				
SLC8A1	6546	broad.mit.edu	37	2	40366566	40366566	+	Missense_Mutation	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:40366566G>C	ENST00000403092.1	-	10	2553	c.2520C>G	c.(2518-2520)ttC>ttG	p.F840L	SLC8A1_ENST00000405269.1_Missense_Mutation_p.F804L|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000542024.1_Missense_Mutation_p.F804L|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000406785.2_Missense_Mutation_p.F804L|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.F804L|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.F832L|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.F835L|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.F835L|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.F840L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.F804L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	840					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.F840L(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAAGTGCGACGAACACGACTG	0.463																																							uc002rrx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2518-2520)TTC>TTG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						69.0	59.0	63.0					2																	40366566		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40366566G>C		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2520C>G	2.37:g.40366566G>C	ENSP00000384763:p.Phe840Leu		Somatic				uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.F835L|SLC8A1_uc002rrz.2_Missense_Mutation_p.F827L|SLC8A1_uc002rsa.2_Missense_Mutation_p.F804L|SLC8A1_uc002rsd.3_Missense_Mutation_p.F804L	p.F840L	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			9	2544	-			840			Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.2520C>G	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140398	0.56936	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.06	-1.25	0.09405	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	L	0.41906	1.305	0.58432	D	0.999999	P;P;D;P	0.59357	0.677;0.813;0.985;0.876	P;P;P;P	0.60068	0.798;0.465;0.868;0.672	T	0.49476	-0.8936	10	0.42905	T	0.14	.	10.0541	0.42235	0.6562:0.0:0.3438:0.0	.	804;827;835;840	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	L	804;840;835;840;835;804;804;840;832;827;804;804	ENSP00000383886:F804L;ENSP00000440727:F835L;ENSP00000384763:F840L;ENSP00000385678:F835L;ENSP00000385188:F804L;ENSP00000385535:F804L;ENSP00000332931:F840L;ENSP00000384908:F832L;ENSP00000385811:F804L;ENSP00000443515:F804L	ENSP00000332931:F840L	F	-	3	2	SLC8A1	40220070	0.999000	0.42202	0.996000	0.52242	0.823000	0.46562	0.784000	0.26816	-0.137000	0.11455	-0.217000	0.12591	TTC		0.463	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		41	72	0	0	0	0.045515	0	41	72				
PKP4	8502	broad.mit.edu	37	2	159499085	159499085	+	Nonsense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:159499085C>T	ENST00000389759.3	+	11	1895	c.1783C>T	c.(1783-1785)Cga>Tga	p.R595*	PKP4_ENST00000389757.3_Nonsense_Mutation_p.R595*	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	595					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.R595*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						TGGTGCCCTTCGAAACCTCGT	0.418										HNSCC(62;0.18)																													uc002tzv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|skin(2)	7						c.(1783-1785)CGA>TGA		plakophilin 4 isoform a							130.0	131.0	131.0					2																	159499085		2203	4300	6503	SO:0001587	stop_gained	8502				cell adhesion	desmosome	protein binding	g.chr2:159499085C>T	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1783C>T	2.37:g.159499085C>T	ENSP00000374409:p.Arg595*	HNSCC(62;0.18)	Somatic				PKP4_uc002tzt.1_Nonsense_Mutation_p.R447*|PKP4_uc002tzu.2_Nonsense_Mutation_p.R595*|PKP4_uc002tzw.2_Nonsense_Mutation_p.R595*|PKP4_uc002tzx.2_Nonsense_Mutation_p.R252*|PKP4_uc002tzy.1_Nonsense_Mutation_p.R253*|PKP4_uc002tzz.1_Nonsense_Mutation_p.R593*|PKP4_uc002uaa.2_Nonsense_Mutation_p.R447*	p.R595*	NM_003628	NP_003619	WXS	Illumina HiSeq	Unspecified	Q99569	PKP4_HUMAN			11	2043	+			595			ARM 3.		Q86W91	Nonsense_Mutation	SNP	ENST00000389759.3	37	c.1783C>T	CCDS33305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	9.016165|9.016165	0.99037|0.99037	.|.	.|.	ENSG00000144283|ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759|ENST00000389756	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.70640	.|0.3247	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77498	.|-0.2565	.|4	0.02654|0.87932	T|D	1|0	-8.4116|-8.4116	14.0902|14.0902	0.64984|0.64984	0.2501:0.7499:0.0:0.0|0.2501:0.7499:0.0:0.0	.|.	.|.	.|.	.|.	X|L	446;595;595|82	.|.	ENSP00000374407:R595X|ENSP00000374406:S82L	R|S	+|+	1|2	2|0	PKP4|PKP4	159207331|159207331	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.598000|1.598000	0.36740|0.36740	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.418	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1			10	302	0	0	0	0.080935	0	10	302				
XRCC5	7520	broad.mit.edu	37	2	216983788	216983788	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:216983788C>T	ENST00000392133.3	+	7	852	c.391C>T	c.(391-393)Cat>Tat	p.H131Y	XRCC5_ENST00000392132.2_Missense_Mutation_p.H131Y			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	131					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.H131Y(1)		endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TGAGAAGAGGCATATTGAAAT	0.343								Non-homologous end-joining																															uc002vfy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(391-393)CAT>TAT	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II							70.0	74.0	73.0					2																	216983788		2203	4300	6503	SO:0001583	missense	7520				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding	g.chr2:216983788C>T	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.391C>T	2.37:g.216983788C>T	ENSP00000375978:p.His131Tyr		Somatic				XRCC5_uc002vfz.2_Missense_Mutation_p.H17Y	p.H131Y	NM_021141	NP_066964	WXS	Illumina HiSeq	Unspecified	P13010	XRCC5_HUMAN		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)	5	531	+		Renal(323;0.0328)	131					A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	37	c.391C>T	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450060	0.84101	.	.	ENSG00000079246	ENST00000392133;ENST00000392132;ENST00000417391	T;T	0.30714	1.52;1.52	5.38	5.38	0.77491	Ku70/Ku80, N-terminal alpha/beta (1);von Willebrand factor, type A (1);	0.052835	0.85682	D	0.000000	T	0.54565	0.1866	M	0.73962	2.25	0.50467	D	0.999877	D	0.65815	0.995	P	0.61592	0.891	T	0.54655	-0.8261	10	0.54805	T	0.06	.	18.3102	0.90197	0.0:1.0:0.0:0.0	.	131	P13010	XRCC5_HUMAN	Y	131;131;118	ENSP00000375978:H131Y;ENSP00000375977:H131Y	ENSP00000375977:H131Y	H	+	1	0	XRCC5	216692033	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	5.360000	0.66086	2.793000	0.96121	0.655000	0.94253	CAT		0.343	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141		13	149	0	0	0	0.024245	0	13	149				
FAM110A	83541	broad.mit.edu	37	20	826325	826325	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:826325C>T	ENST00000304189.2	+	3	1259	c.878C>T	c.(877-879)gCt>gTt	p.A293V	FAM110A_ENST00000541082.1_Missense_Mutation_p.A293V|FAM110A_ENST00000381939.1_Missense_Mutation_p.A293V|FAM110A_ENST00000246100.3_Missense_Mutation_p.A293V|FAM110A_ENST00000381941.3_Missense_Mutation_p.A293V			Q9BQ89	F110A_HUMAN	family with sequence similarity 110, member A	293						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.A293V(1)		breast(1)|lung(2)	3						AGCCCAGCAGCTGAAGGCTAG	0.627																																							uc002wef.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(877-879)GCT>GTT		hypothetical protein LOC83541							39.0	46.0	44.0					20																	826325		2203	4300	6503	SO:0001583	missense	83541					microtubule organizing center|spindle pole	protein binding	g.chr20:826325C>T	BC012800	CCDS13008.1	20p13	2007-06-21	2007-03-21	2007-03-21	ENSG00000125898	ENSG00000125898			16188	protein-coding gene	gene with protein product		611393	"""chromosome 20 open reading frame 55"""	C20orf55		17499476	Standard	NM_001042353		Approved	bA371L19.3	uc002wef.1	Q9BQ89	OTTHUMG00000031649	ENST00000304189.2:c.878C>T	20.37:g.826325C>T	ENSP00000354163:p.Ala293Val		Somatic				FAM110A_uc002weg.1_Missense_Mutation_p.A293V|FAM110A_uc002weh.1_Missense_Mutation_p.A293V|FAM110A_uc010fzz.2_RNA	p.A293V	NM_001042353	NP_001035812	WXS	Illumina HiSeq	Unspecified	Q9BQ89	F110A_HUMAN			2	1214	+			293					D3DVW2|Q5R1M7	Missense_Mutation	SNP	ENST00000304189.2	37	c.878C>T	CCDS13008.1	.	.	.	.	.	.	.	.	.	.	.	10.92	1.487284	0.26686	.	.	ENSG00000125898	ENST00000381941;ENST00000304189;ENST00000381939;ENST00000246100;ENST00000541082	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.81	1.65	0.23941	.	0.605070	0.14805	N	0.297402	T	0.07458	0.0188	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38067	-0.9678	10	0.07482	T	0.82	-9.4883	7.3249	0.26549	0.0:0.6666:0.0:0.3334	.	293	Q9BQ89	F110A_HUMAN	V	293	ENSP00000371367:A293V;ENSP00000354163:A293V;ENSP00000371365:A293V;ENSP00000246100:A293V;ENSP00000445228:A293V	ENSP00000246100:A293V	A	+	2	0	FAM110A	774325	0.002000	0.14202	0.001000	0.08648	0.047000	0.14425	1.399000	0.34566	0.503000	0.28060	0.484000	0.47621	GCT		0.627	FAM110A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077489.1	NM_031424		6	18	0	0	0	0.047766	0	6	18				
PROKR2	128674	broad.mit.edu	37	20	5294752	5294752	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:5294752G>A	ENST00000217270.3	-	1	263	c.264C>T	c.(262-264)acC>acT	p.T88T	PROKR2_ENST00000546004.1_Silent_p.T88T	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	88					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.T88T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						TGAGCAGATTGGTGAGGTTGC	0.557										HNSCC(71;0.22)																													uc010zqw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(262-264)ACC>ACT		prokineticin receptor 2							190.0	148.0	162.0					20																	5294752		2203	4300	6503	SO:0001819	synonymous_variant	128674					integral to membrane|plasma membrane	neuropeptide Y receptor activity	g.chr20:5294752G>A	AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.264C>T	20.37:g.5294752G>A		HNSCC(71;0.22)	Somatic				PROKR2_uc010zqx.1_Silent_p.T88T|PROKR2_uc010zqy.1_Silent_p.T88T|uc002wly.1_5'Flank	p.T88T	NM_144773	NP_658986	WXS	Illumina HiSeq	Unspecified	Q8NFJ6	PKR2_HUMAN			1	264	-			88			Cytoplasmic (Potential).		A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Silent	SNP	ENST00000217270.3	37	c.264C>T	CCDS13089.1																																																																																				0.557	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		5	73	0	0	0	0.021553	0	5	73				
SRSF6	6431	broad.mit.edu	37	20	42089474	42089474	+	Missense_Mutation	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:42089474A>G	ENST00000244020.3	+	6	912	c.806A>G	c.(805-807)tAt>tGt	p.Y269C		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	269	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)	p.Y269C(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						AAGGATGAGTATGAGAAATCT	0.453																																							uc010zwg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(805-807)TAT>TGT		arginine/serine-rich splicing factor 6							55.0	56.0	56.0					20																	42089474		2203	4300	6503	SO:0001583	missense	6431				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr20:42089474A>G	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.806A>G	20.37:g.42089474A>G	ENSP00000244020:p.Tyr269Cys		Somatic				SFRS6_uc002xki.2_Missense_Mutation_p.Y140C|SFRS6_uc002xkk.2_Intron	p.Y269C	NM_006275	NP_006266	WXS	Illumina HiSeq	Unspecified	Q13247	SRSF6_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		6	976	+		Myeloproliferative disorder(115;0.00452)	269			Arg/Ser-rich (RS domain).		B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	37	c.806A>G	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	A	7.519	0.656340	0.14580	.	.	ENSG00000124193	ENST00000244020	T	0.11169	2.8	5.83	4.75	0.60458	.	0.350840	0.26784	N	0.022505	T	0.09774	0.0240	L	0.36672	1.1	0.20873	N	0.999833	B	0.28512	0.214	B	0.26693	0.072	T	0.17961	-1.0352	10	0.48119	T	0.1	.	11.4682	0.50252	0.7846:0.2154:0.0:0.0	.	269	Q13247	SRSF6_HUMAN	C	269	ENSP00000244020:Y269C	ENSP00000244020:Y269C	Y	+	2	0	SRSF6	41522888	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.101000	0.50283	2.217000	0.71921	0.477000	0.44152	TAT		0.453	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275		4	52	0	0	0	0.009096	0	4	52				
CABLES2	81928	broad.mit.edu	37	20	60966358	60966358	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:60966358C>G	ENST00000279101.5	-	9	1251	c.1243G>C	c.(1243-1245)Gct>Cct	p.A415P		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	415					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)	p.A415P(1)		endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ATCTTGGCAGCCAGCAGCACG	0.627																																							uc002ycv.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1243-1245)GCT>CCT		Cdk5 and Abl enzyme substrate 2							64.0	65.0	64.0					20																	60966358		2203	4300	6503	SO:0001583	missense	81928				cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity	g.chr20:60966358C>G	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1243G>C	20.37:g.60966358C>G	ENSP00000279101:p.Ala415Pro		Somatic					p.A415P	NM_031215	NP_112492	WXS	Illumina HiSeq	Unspecified	Q9BTV7	CABL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		9	1250	-	Breast(26;2.05e-08)		415					Q5JWL0|Q9BYK0	Missense_Mutation	SNP	ENST00000279101.5	37	c.1243G>C	CCDS33503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.593730|5.593730	0.96602|0.96602	.|.	.|.	ENSG00000149679|ENSG00000149679	ENST00000370560;ENST00000279101|ENST00000453274	T|.	0.56941|.	0.43|.	5.56|5.56	5.56|5.56	0.83823|0.83823	Cyclin, N-terminal (1);Cyclin-like (3);|.	0.048488|.	0.85682|.	D|.	0.000000|.	D|D	0.84701|0.84701	0.5530|0.5530	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.86502|0.86502	0.1804|0.1804	10|5	0.87932|.	D|.	0|.	-24.9729|-24.9729	19.5097|19.5097	0.95137|0.95137	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	415|.	Q9BTV7|.	CABL2_HUMAN|.	P|C	203;415|208	ENSP00000279101:A415P|.	ENSP00000279101:A415P|.	A|W	-|-	1|3	0|0	CABLES2|CABLES2	60399753|60399753	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.963000|0.963000	0.63663|0.63663	7.639000|7.639000	0.83342|0.83342	2.622000|2.622000	0.88805|0.88805	0.561000|0.561000	0.74099|0.74099	GCT|TGG		0.627	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265		5	17	0	0	0	0.014758	0	5	17				
LARGE	9215	broad.mit.edu	37	22	33777944	33777944	+	Silent	SNP	G	G	A	rs144216539	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr22:33777944G>A	ENST00000354992.2	-	10	1663	c.1092C>T	c.(1090-1092)acC>acT	p.T364T	LARGE_ENST00000337431.2_Silent_p.T364T|LARGE_ENST00000402320.1_Silent_p.T364T|LARGE_ENST00000452586.2_Silent_p.T163T|LARGE_ENST00000397394.2_Silent_p.T364T|LARGE_ENST00000437602.2_Silent_p.T364T	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	364					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.T364T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				GCTCGGAGCGGGTGTGGTCTG	0.552													G|||	2	0.000399361	0.0	0.0	5008	,	,		20776	0.0		0.002	False		,,,				2504	0.0				Colon(70;397 1175 4573 19089 45288)	Colon(70;397 1175 4573 19089 45288)	uc003and.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1090-1092)ACC>ACT		like-glycosyltransferase		G	,	1,4405	2.1+/-5.4	0,1,2202	141.0	135.0	137.0		1092,1092	3.9	1.0	22	dbSNP_134	137	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous,coding-synonymous	LARGE	NM_004737.4,NM_133642.3	,	0,8,6495	AA,AG,GG		0.0814,0.0227,0.0615	,	364/757,364/757	33777944	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	9215				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity	g.chr22:33777944G>A	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1092C>T	22.37:g.33777944G>A			Somatic				LARGE_uc011amd.1_Silent_p.T163T|LARGE_uc003ane.3_Silent_p.T364T|LARGE_uc010gwp.2_Silent_p.T364T|LARGE_uc011ame.1_Silent_p.T296T|LARGE_uc011amf.1_Silent_p.T364T|LARGE_uc010gwq.1_RNA	p.T364T	NM_004737	NP_004728	WXS	Illumina HiSeq	Unspecified	O95461	LARGE_HUMAN			10	1671	-		Lung NSC(1;0.219)	364			Lumenal (Potential).		B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	ENST00000354992.2	37	c.1092C>T	CCDS13912.1																																																																																				0.552	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642		5	98	0	0	0	0.02938	0	5	98				
IQSEC1	9922	broad.mit.edu	37	3	12977661	12977661	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:12977661C>T	ENST00000273221.4	-	3	1113	c.897G>A	c.(895-897)tcG>tcA	p.S299S	IQSEC1_ENST00000473088.1_5'Flank	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	299					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.S299S(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATCACTGTACGAGGCCGTCA	0.687																																							uc003bxt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(895-897)TCG>TCA		IQ motif and Sec7 domain 1 isoform b							67.0	70.0	69.0					3																	12977661		2203	4300	6503	SO:0001819	synonymous_variant	9922				regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity	g.chr3:12977661C>T	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.897G>A	3.37:g.12977661C>T			Somatic				IQSEC1_uc003bxu.3_Silent_p.S177S|IQSEC1_uc011auw.1_Silent_p.S285S	p.S299S	NM_014869	NP_055684	WXS	Illumina HiSeq	Unspecified	Q6DN90	IQEC1_HUMAN			3	906	-			299					O94863|Q96D85	Silent	SNP	ENST00000273221.4	37	c.897G>A	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	C	3.901	-0.022021	0.07634	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.86	-9.71	0.00518	.	.	.	.	.	T	0.41351	0.1155	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45934	-0.9227	4	.	.	.	.	4.2404	0.10645	0.1813:0.1464:0.4943:0.178	.	.	.	.	I	300	.	.	V	-	1	0	IQSEC1	12952661	0.000000	0.05858	0.424000	0.26647	0.548000	0.35241	-3.791000	0.00365	-2.256000	0.00695	-0.140000	0.14226	GTA		0.687	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869		4	14	0	0	0	0.02938	0	4	14				
ZNF860	344787	broad.mit.edu	37	3	32031055	32031055	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:32031055C>T	ENST00000360311.4	+	2	1033	c.484C>T	c.(484-486)Cat>Tat	p.H162Y		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H162Y(2)		endometrium(3)|lung(4)|ovary(1)	8						CTTTCATTCGCATCTTCCTGA	0.413																																							uc011axg.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(484-486)CAT>TAT		zinc finger protein 860							61.0	45.0	50.0					3																	32031055		692	1591	2283	SO:0001583	missense	344787				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:32031055C>T	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.484C>T	3.37:g.32031055C>T	ENSP00000373274:p.His162Tyr		Somatic					p.H162Y	NM_001137674	NP_001131146	WXS	Illumina HiSeq	Unspecified	A6NHJ4	ZN860_HUMAN			2	1033	+			162					B4DFA4	Missense_Mutation	SNP	ENST00000360311.4	37	c.484C>T	CCDS46784.1	.	.	.	.	.	.	.	.	.	.	C	9.039	0.989182	0.18966	.	.	ENSG00000197385	ENST00000360311	T	0.04917	3.53	0.345	0.345	0.16011	.	.	.	.	.	T	0.11623	0.0283	L	0.46567	1.45	0.09310	N	1	P	0.39094	0.659	P	0.55391	0.775	T	0.32134	-0.9918	8	.	.	.	.	3.2711	0.06882	0.4632:0.5366:1.0E-4:1.0E-4	.	162	A6NHJ4	ZN860_HUMAN	Y	162	ENSP00000373274:H162Y	.	H	+	1	0	ZNF860	32006059	0.002000	0.14202	0.011000	0.14972	0.011000	0.07611	0.241000	0.18065	0.392000	0.25172	0.393000	0.25936	CAT		0.413	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1			10	172	0	0	0	0.09319	0	10	172				
ZNF860	344787	broad.mit.edu	37	3	32031135	32031135	+	Silent	SNP	A	A	G	rs6419811	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:32031135A>G	ENST00000360311.4	+	2	1113	c.564A>G	c.(562-564)tcA>tcG	p.S188S		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						ATGCTTCCTCAGTTCTAACGT	0.358													G|||	2356	0.470447	0.7988	0.3602	5008	,	,		20726	0.4524		0.1968	False		,,,				2504	0.4049						uc011axg.1		NA																	0				ovary(1)	1						c.(562-564)TCA>TCG		zinc finger protein 860		G		938,446		325,288,79	58.0	44.0	48.0		564	0.3	0.0	3	dbSNP_116	48	608,2574		58,492,1041	no	coding-synonymous	ZNF860	NM_001137674.2		383,780,1120	GG,GA,AA		19.1075,32.2254,33.859		188/633	32031135	1546,3020	692	1591	2283	SO:0001819	synonymous_variant	344787				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:32031135A>G	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.564A>G	3.37:g.32031135A>G			Somatic					p.S188S	NM_001137674	NP_001131146	WXS	Illumina HiSeq	Unspecified	A6NHJ4	ZN860_HUMAN			2	1113	+			188					B4DFA4	Silent	SNP	ENST00000360311.4	37	c.564A>G	CCDS46784.1																																																																																				0.358	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1			4	78	0	0	0	0.014758	0	4	78				
MAP4	4134	broad.mit.edu	37	3	47958078	47958078	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:47958078G>C	ENST00000360240.6	-	7	1757	c.1239C>G	c.(1237-1239)ctC>ctG	p.L413L	MAP4_ENST00000383737.4_Intron|MAP4_ENST00000426837.2_Silent_p.L430L|MAP4_ENST00000395734.3_Silent_p.L413L	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	413	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.L413L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	CTATTTCTGAGAGTAATACCA	0.463																																							uc003csb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1237-1239)CTC>CTG		microtubule-associated protein 4 isoform 1							137.0	128.0	131.0					3																	47958078		2203	4300	6503	SO:0001819	synonymous_variant	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47958078G>C		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1239C>G	3.37:g.47958078G>C			Somatic				MAP4_uc003csc.3_Silent_p.L413L|MAP4_uc011bbf.1_Silent_p.L390L|MAP4_uc003csf.3_Silent_p.L430L	p.L413L	NM_002375	NP_002366	WXS	Illumina HiSeq	Unspecified	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	1765	-			413			17 X 14 AA tandem repeats.|9.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	c.1239C>G	CCDS33750.1																																																																																				0.463	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		6	198	0	0	0	0.038147	0	6	198				
TWF2	11344	broad.mit.edu	37	3	52269072	52269072	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:52269072G>A	ENST00000305533.5	-	2	319	c.76C>T	c.(76-78)Cgg>Tgg	p.R26W	TLR9_ENST00000597542.1_5'UTR|TWF2_ENST00000499914.2_Missense_Mutation_p.R26W	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	26	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)	p.R26W(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTGATGAGCCGCACAGAGCCA	0.582																																							uc003ddd.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(1)|ovary(1)|lung(1)	3						c.(76-78)CGG>TGG		twinfilin-like protein							118.0	102.0	108.0					3																	52269072		2203	4300	6503	SO:0001583	missense	11344					cytoskeleton|perinuclear region of cytoplasm	actin binding|ATP binding	g.chr3:52269072G>A	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.76C>T	3.37:g.52269072G>A	ENSP00000303908:p.Arg26Trp		Somatic				TWF2_uc010hmc.2_Missense_Mutation_p.R26W	p.R26W	NM_007284	NP_009215	WXS	Illumina HiSeq	Unspecified	Q6IBS0	TWF2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	227	-			26			ADF-H 1.		Q9Y3F5	Missense_Mutation	SNP	ENST00000305533.5	37	c.76C>T	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169887	0.78452	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.30981	1.51;1.51	4.43	3.46	0.39613	Actin-binding, cofilin/tropomyosin type (2);	.	.	.	.	T	0.64907	0.2641	H	0.94345	3.525	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76244	-0.3030	9	0.87932	D	0	.	13.8886	0.63724	0.0:0.0:0.837:0.163	.	26;26	D6RG15;Q6IBS0	.;TWF2_HUMAN	W	26	ENSP00000303908:R26W;ENSP00000426464:R26W	ENSP00000303908:R26W	R	-	1	2	TWF2	52244112	1.000000	0.71417	0.982000	0.44146	0.973000	0.67179	5.214000	0.65236	2.302000	0.77476	0.561000	0.74099	CGG		0.582	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2			3	21	0	0	0	0.004672	0	3	21				
BOC	91653	broad.mit.edu	37	3	112998717	112998717	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:112998717G>A	ENST00000495514.1	+	13	2771	c.2067G>A	c.(2065-2067)gaG>gaA	p.E689E	BOC_ENST00000273395.4_Silent_p.E690E|BOC_ENST00000355385.3_Silent_p.E689E			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	689	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.E689E(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGCTGGGGGAGAGCGAGCCCA	0.602																																							uc003dzx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(2065-2067)GAG>GAA		brother of CDO precursor							70.0	77.0	75.0					3																	112998717		2203	4300	6503	SO:0001819	synonymous_variant	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112998717G>A	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2067G>A	3.37:g.112998717G>A			Somatic				BOC_uc003dzy.2_Silent_p.E689E|BOC_uc003dzz.2_Silent_p.E690E|BOC_uc003eab.2_Silent_p.E390E|BOC_uc003eac.2_Silent_p.E4E	p.E689E	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		13	2688	+			689			Fibronectin type-III 2.|Extracellular (Potential).		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	c.2067G>A	CCDS2971.1																																																																																				0.602	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		4	34	0	0	0	0.021553	0	4	34				
PLA1A	51365	broad.mit.edu	37	3	119328403	119328403	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:119328403G>A	ENST00000273371.4	+	4	614	c.542G>A	c.(541-543)gGc>gAc	p.G181D	PLA1A_ENST00000495992.1_Missense_Mutation_p.G165D|PLA1A_ENST00000488919.1_Missense_Mutation_p.G8D|PLA1A_ENST00000494440.1_Missense_Mutation_p.G165D	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	181					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)	p.G181D(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTCTTCGGAGGCCAGCTGGGA	0.537																																							uc003ecu.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(541-543)GGC>GAC		phospholipase A1 member A precursor							106.0	103.0	104.0					3																	119328403		2203	4300	6503	SO:0001583	missense	51365				lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity	g.chr3:119328403G>A	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.542G>A	3.37:g.119328403G>A	ENSP00000273371:p.Gly181Asp		Somatic				PLA1A_uc003ecv.2_Missense_Mutation_p.G165D|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.G8D	p.G181D	NM_015900	NP_056984	WXS	Illumina HiSeq	Unspecified	Q53H76	PLA1A_HUMAN			4	581	+			181					B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	37	c.542G>A	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871414	0.91587	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440;ENST00000475963	D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76	5.31	5.31	0.75309	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95887	0.8661	M	0.86343	2.81	0.51767	D	0.999937	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96281	0.9206	10	0.72032	D	0.01	-21.5059	17.1049	0.86659	0.0:0.0:1.0:0.0	.	165;181	Q53H76-3;Q53H76	.;PLA1A_HUMAN	D	181;8;165;165;47	ENSP00000273371:G181D;ENSP00000420625:G8D;ENSP00000417326:G165D;ENSP00000418793:G165D;ENSP00000417295:G47D	ENSP00000273371:G181D	G	+	2	0	PLA1A	120811093	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.485000	0.90448	2.629000	0.89072	0.561000	0.74099	GGC		0.537	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2			46	179	0	0	0	0.048971	0	46	179				
JMY	133746	broad.mit.edu	37	5	78602256	78602256	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:78602256A>C	ENST00000396137.4	+	7	2402	c.1940A>C	c.(1939-1941)gAa>gCa	p.E647A	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	647					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.E293A(1)|p.E647A(1)		endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ATTGAAGATGAATATAGAACC	0.303																																							uc003kfx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1939-1941)GAA>GCA		junction-mediating and regulatory protein							135.0	125.0	128.0					5																	78602256		1836	4088	5924	SO:0001583	missense	133746				'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity	g.chr5:78602256A>C	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.1940A>C	5.37:g.78602256A>C	ENSP00000379441:p.Glu647Ala		Somatic				JMY_uc003kfw.1_Missense_Mutation_p.E293A	p.E647A	NM_152405	NP_689618	WXS	Illumina HiSeq	Unspecified	Q8N9B5	JMY_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)	7	2460	+		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)	647					A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	c.1940A>C	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	A	11.64	1.700323	0.30142	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.07327	3.2	5.19	5.19	0.71726	.	0.836948	0.10944	N	0.616929	T	0.10294	0.0252	M	0.62723	1.935	0.28660	N	0.906192	B	0.34329	0.449	B	0.32864	0.154	T	0.15780	-1.0425	10	0.15066	T	0.55	.	9.8291	0.40930	0.9228:0.0:0.0772:0.0	.	647	Q8N9B5	JMY_HUMAN	A	647	ENSP00000379441:E647A	ENSP00000282259:E647A	E	+	2	0	JMY	78638012	1.000000	0.71417	0.776000	0.31678	0.971000	0.66376	5.193000	0.65120	2.089000	0.63090	0.533000	0.62120	GAA		0.303	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405		22	453	0	0	0	0.050027	0	22	453				
PCDHB8	56128	broad.mit.edu	37	5	140558166	140558166	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:140558166G>A	ENST00000239444.2	+	1	796	c.551G>A	c.(550-552)cGc>cAc	p.R184H	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R184H(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCCTCACCCGCAAACGCAGT	0.483																																							uc011dai.1		NA																	1	Substitution - Missense(1)		kidney(1)	skin(4)	4						c.(550-552)CGC>CAC		protocadherin beta 8 precursor							38.0	59.0	52.0					5																	140558166		2200	4297	6497	SO:0001583	missense	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140558166G>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.551G>A	5.37:g.140558166G>A	ENSP00000239444:p.Arg184His		Somatic				PCDHB16_uc003liv.2_5'Flank	p.R184H	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	737	+			184			Cadherin 2.|Extracellular (Potential).		B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	c.551G>A	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	g	7.040	0.562271	0.13498	.	.	ENSG00000120322	ENST00000239444	T	0.20598	2.06	4.25	3.38	0.38709	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.15478	0.0373	L	0.39514	1.22	0.09310	N	1	B	0.24258	0.1	B	0.24269	0.052	T	0.25882	-1.0119	9	0.30854	T	0.27	.	4.629	0.12491	0.1865:0.0:0.6385:0.175	.	184	Q9UN66	PCDB8_HUMAN	H	184	ENSP00000239444:R184H	ENSP00000239444:R184H	R	+	2	0	PCDHB8	140538350	0.000000	0.05858	0.120000	0.21714	0.898000	0.52572	0.457000	0.21875	0.778000	0.33520	-0.225000	0.12378	CGC		0.483	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		9	25	0	0	0	0.080935	0	9	25				
GEMIN5	25929	broad.mit.edu	37	5	154270922	154270922	+	Silent	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:154270922A>G	ENST00000285873.7	-	26	4216	c.4141T>C	c.(4141-4143)Ttg>Ctg	p.L1381L		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1381					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.L1381L(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATTTCTGCCAAGGTCTCTTGG	0.453																																							uc003lvx.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(4141-4143)TTG>CTG		gemin 5							130.0	126.0	128.0					5																	154270922		2203	4300	6503	SO:0001819	synonymous_variant	25929				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding	g.chr5:154270922A>G	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.4141T>C	5.37:g.154270922A>G			Somatic				GEMIN5_uc011ddk.1_Silent_p.L1380L	p.L1381L	NM_015465	NP_056280	WXS	Illumina HiSeq	Unspecified	Q8TEQ6	GEMI5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		26	4224	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	1381			Potential.		Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	37	c.4141T>C	CCDS4330.1																																																																																				0.453	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1			17	134	0	0	0	0.049695	0	17	134				
PRSS16	10279	broad.mit.edu	37	6	27215709	27215709	+	Missense_Mutation	SNP	G	G	C	rs114674760	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:27215709G>C	ENST00000230582.3	+	2	134	c.119G>C	c.(118-120)aGc>aCc	p.S40T	PRSS16_ENST00000421826.2_Missense_Mutation_p.S40T	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	40					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.S40T(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TTTCAGGAGAGCTCTGCCCAG	0.642																																					NSCLC(178;1118 2105 17078 23587 44429)	NSCLC(178;1118 2105 17078 23587 44429)	uc003nja.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(118-120)AGC>ACC		protease, serine, 16 precursor							51.0	52.0	52.0					6																	27215709		2203	4300	6503	SO:0001583	missense	10279				protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity	g.chr6:27215709G>C	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.119G>C	6.37:g.27215709G>C	ENSP00000230582:p.Ser40Thr		Somatic				PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.S40T|PRSS16_uc010jqq.1_5'Flank|PRSS16_uc010jqr.1_5'Flank|PRSS16_uc003njc.1_5'Flank	p.S40T	NM_005865	NP_005856	WXS	Illumina HiSeq	Unspecified	Q9NQE7	TSSP_HUMAN			2	131	+			40					O75416	Missense_Mutation	SNP	ENST00000230582.3	37	c.119G>C	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	g	11.84	1.757906	0.31137	.	.	ENSG00000112812	ENST00000421826;ENST00000230582;ENST00000343467;ENST00000348953	T;T	0.52754	0.65;2.51	2.77	1.89	0.25635	.	1.108760	0.06755	N	0.780711	T	0.09113	0.0225	N	0.19112	0.55	0.09310	N	1	B;P	0.37466	0.231;0.596	B;B	0.26864	0.074;0.05	T	0.10636	-1.0621	10	0.13853	T	0.58	-3.3002	5.6374	0.17544	0.1554:0.0:0.8446:0.0	.	40;40	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	T	40	ENSP00000404349:S40T;ENSP00000230582:S40T	ENSP00000230582:S40T	S	+	2	0	PRSS16	27323688	0.008000	0.16893	0.005000	0.12908	0.422000	0.31414	1.245000	0.32790	0.750000	0.32877	0.563000	0.77884	AGC		0.642	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2			7	105	0	0	0	0.058154	0	7	105				
CYP21A1P	1590	broad.mit.edu	37	6	31975129	31975129	+	5'Flank	SNP	T	T	C	rs554092943	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:31975129T>C	ENST00000594256.1	-	0	0				CYP21A1P_ENST00000342991.6_RNA																							AAGAGGGCTCTGGACAGCTCC	0.607													T|||	512	0.102236	0.2307	0.0994	5008	,	,		16076	0.0149		0.0815	False		,,,				2504	0.0419					Melanoma(174;1669 1998 3915 34700 46447)	uc010jtp.2		NA																	0					0						c.(820-822)TCT>TCC		SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;																																				SO:0001631	upstream_gene_variant	1589				glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding	g.chr6:31975129T>C																													6.37:g.31975129T>C	Exception_encountered		Somatic				CYP21A2_uc011dpb.1_Silent_p.S244S	p.S274S			WXS	Illumina HiSeq	Unspecified	P08686	CP21A_HUMAN			8	940	+			273						Silent	SNP	ENST00000594256.1	37	c.822T>C																																																																																					0.607	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding				3	12	0	0	0	0.004672	0	3	12				
UHRF1BP1	54887	broad.mit.edu	37	6	34826855	34826855	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:34826855C>T	ENST00000192788.5	+	14	2893	c.2722C>T	c.(2722-2724)Cta>Tta	p.L908L	UHRF1BP1_ENST00000452449.2_Silent_p.L908L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	908							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.L908L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						AGATTCAGAGCTATCTCCTTC	0.527																																							uc003oju.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(2722-2724)CTA>TTA		ICBP90 binding protein 1							45.0	45.0	45.0					6																	34826855		2024	4207	6231	SO:0001819	synonymous_variant	54887							g.chr6:34826855C>T	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.2722C>T	6.37:g.34826855C>T			Somatic				UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	p.L908L	NM_017754	NP_060224	WXS	Illumina HiSeq	Unspecified	Q6BDS2	URFB1_HUMAN			14	2956	+			908					Q9NXE0	Silent	SNP	ENST00000192788.5	37	c.2722C>T	CCDS43455.1																																																																																				0.527	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		4	72	0	0	0	0.009096	0	4	72				
THEMIS	387357	broad.mit.edu	37	6	128134143	128134143	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:128134143C>G	ENST00000368248.2	-	4	1791	c.1643G>C	c.(1642-1644)aGc>aCc	p.S548T	THEMIS_ENST00000543064.1_Missense_Mutation_p.S548T|THEMIS_ENST00000368250.1_Missense_Mutation_p.S469T|THEMIS_ENST00000537166.1_Missense_Mutation_p.S513T	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	548					negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S548T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TGAGGCTGAGCTTTCATATCT	0.463																																							uc003qbi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1642-1644)AGC>ACC		thymocyte selection pathway associated isoform							108.0	109.0	108.0					6																	128134143		2203	4300	6503	SO:0001583	missense	387357				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus		g.chr6:128134143C>G	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1643G>C	6.37:g.128134143C>G	ENSP00000357231:p.Ser548Thr		Somatic				THEMIS_uc010kfa.2_Missense_Mutation_p.S451T|THEMIS_uc011ebt.1_Missense_Mutation_p.S548T|THEMIS_uc010kfb.2_Missense_Mutation_p.S513T	p.S548T	NM_001010923	NP_001010923	WXS	Illumina HiSeq	Unspecified	Q8N1K5	THMS1_HUMAN			5	1962	-			548					A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	c.1643G>C	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	C	8.511	0.866498	0.17250	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.17854	2.25;2.27;2.26;2.26	5.9	2.6	0.31112	.	0.398638	0.30329	N	0.009864	T	0.03348	0.0097	L	0.40543	1.245	0.28950	N	0.890448	B;P	0.35433	0.372;0.501	B;B	0.30855	0.121;0.039	T	0.40384	-0.9566	10	0.13470	T	0.59	-3.0987	6.9672	0.24629	0.0:0.5611:0.0:0.4389	.	548;548	F5H1J9;Q8N1K5	.;THMS1_HUMAN	T	469;548;548;513	ENSP00000357233:S469T;ENSP00000439594:S548T;ENSP00000357231:S548T;ENSP00000439863:S513T	ENSP00000357231:S548T	S	-	2	0	THEMIS	128175836	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	0.534000	0.23098	0.744000	0.32741	0.563000	0.77884	AGC		0.463	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923		42	143	0	0	0	0.104719	0	42	143				
SAMD3	154075	broad.mit.edu	37	6	130465801	130465801	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:130465801A>C	ENST00000368134.2	-	14	2035	c.1427T>G	c.(1426-1428)tTt>tGt	p.F476C	SAMD3_ENST00000457563.2_Missense_Mutation_p.F500C|SAMD3_ENST00000439090.2_Missense_Mutation_p.F476C|RP11-73O6.3_ENST00000609978.1_RNA|SAMD3_ENST00000437477.2_Missense_Mutation_p.F476C|RP11-73O6.3_ENST00000415964.1_RNA	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	476								p.F476C(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CTCAATCCTAAATACATGAAA	0.418																																							uc003qbv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1426-1428)TTT>TGT		sterile alpha motif domain containing 3 isoform							93.0	87.0	89.0					6																	130465801		2203	4300	6503	SO:0001583	missense	154075							g.chr6:130465801A>C	AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.1427T>G	6.37:g.130465801A>C	ENSP00000357116:p.Phe476Cys		Somatic				SAMD3_uc003qbx.2_Missense_Mutation_p.F476C|SAMD3_uc003qbw.2_Missense_Mutation_p.F476C	p.F476C	NM_001017373	NP_001017373	WXS	Illumina HiSeq	Unspecified	Q8N6K7	SAMD3_HUMAN		GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)	13	1753	-			476					B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	c.1427T>G	CCDS34539.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.950788	0.34471	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477	T;T;T;T	0.58506	0.37;0.33;0.37;0.37	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000008	T	0.63426	0.2510	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.69639	-0.5091	10	0.87932	D	0	.	10.6111	0.45423	0.8572:0.0:0.0:0.1428	.	476	Q8N6K7	SAMD3_HUMAN	C	476;500;476;476	ENSP00000357116:F476C;ENSP00000402092:F500C;ENSP00000403565:F476C;ENSP00000391163:F476C	ENSP00000357116:F476C	F	-	2	0	SAMD3	130507494	1.000000	0.71417	0.807000	0.32361	0.024000	0.10985	4.361000	0.59461	2.118000	0.64928	0.460000	0.39030	TTT		0.418	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552		10	346	0	0	0	0.020292	0	10	346				
FUCA2	2519	broad.mit.edu	37	6	143823616	143823616	+	Missense_Mutation	SNP	C	C	T	rs543674576	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:143823616C>T	ENST00000002165.6	-	4	894	c.839G>A	c.(838-840)cGt>cAt	p.R280H	RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000610068.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|FUCA2_ENST00000367585.1_Intron|RP1-20N2.6_ENST00000591892.1_RNA|FUCA2_ENST00000438118.2_Intron|RP1-20N2.6_ENST00000590703.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	280					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)	p.R280H(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		TGGGTTATAACGATCACTGCA	0.468													C|||	2	0.000399361	0.0	0.0	5008	,	,		17682	0.0		0.0	False		,,,				2504	0.002						uc003qjm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(838-840)CGT>CAT		fucosidase, alpha-L- 2, plasma precursor							143.0	126.0	132.0					6																	143823616		2203	4300	6503	SO:0001583	missense	2519				fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding	g.chr6:143823616C>T	BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.839G>A	6.37:g.143823616C>T	ENSP00000002165:p.Arg280His		Somatic				FUCA2_uc003qjn.2_Missense_Mutation_p.R34H	p.R280H	NM_032020	NP_114409	WXS	Illumina HiSeq	Unspecified	Q9BTY2	FUCO2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)	4	931	-			280					E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	ENST00000002165.6	37	c.839G>A	CCDS5200.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399849	0.62177	.	.	ENSG00000001036	ENST00000002165	T	0.59364	0.27	5.8	4.94	0.65067	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51466	0.1676	L	0.55103	1.725	0.80722	D	1	P	0.45827	0.867	P	0.49561	0.615	T	0.55192	-0.8179	10	0.46703	T	0.11	-16.4326	15.0768	0.72082	0.0:0.9319:0.0:0.0681	.	280	Q9BTY2	FUCO2_HUMAN	H	280	ENSP00000002165:R280H	ENSP00000002165:R280H	R	-	2	0	FUCA2	143865309	1.000000	0.71417	0.019000	0.16419	0.909000	0.53808	7.487000	0.81328	1.458000	0.47871	0.655000	0.94253	CGT		0.468	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2	NM_032020		14	322	0	0	0	0.024245	0	14	322				
PMS2	5395	broad.mit.edu	37	7	6045634	6045634	+	Missense_Mutation	SNP	T	T	C	rs63750123	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:6045634T>C	ENST00000265849.7	-	2	157	c.52A>G	c.(52-54)Att>Gtt	p.I18V	PMS2_ENST00000382321.4_Missense_Mutation_p.I18V|PMS2_ENST00000469652.1_5'UTR|PMS2_ENST00000406569.3_Missense_Mutation_p.I18V|Y_RNA_ENST00000365120.1_RNA|PMS2_ENST00000441476.2_5'Flank	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	18					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.I18V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TTCCGATCAATAGGTTTGATG	0.418			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome				t|||	16	0.00319489	0.0	0.0043	5008	,	,		17454	0.0		0.0109	False		,,,				2504	0.002						uc003spl.2		NA	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	Mis|N|F	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)			E		colorectal|endometrial|ovarian|medulloblastoma|glioma			1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(52-54)ATT>GTT	Direct_reversal_of_damage|MMR	PMS2 postmeiotic segregation increased 2 isoform		T	VAL/ILE	9,2707		0,9,1349	184.0	227.0	211.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	52	5.7	1.0	7	dbSNP_130	211	52,4550		0,52,2249	no	missense	PMS2	NM_000535.5	29	0,61,3598	CC,CT,TT		1.1299,0.3314,0.8336	probably-damaging	18/863	6045634	61,7257	1358	2301	3659	SO:0001583	missense	5395	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding	g.chr7:6045634T>C		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.52A>G	7.37:g.6045634T>C	ENSP00000265849:p.Ile18Val		Somatic				PMS2_uc003spj.2_5'Flank|PMS2_uc003spk.2_5'UTR|PMS2_uc011jwl.1_Intron|PMS2_uc010ktg.2_5'UTR|PMS2_uc010kte.2_Missense_Mutation_p.I18V|PMS2_uc010ktf.1_Missense_Mutation_p.I18V	p.I18V	NM_000535	NP_000526	WXS	Illumina HiSeq	Unspecified	P54278	PMS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)	2	139	-		Ovarian(82;0.0694)	18					B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	c.52A>G	CCDS5343.1	9	0.004120879120879121	0	0.0	1	0.0027624309392265192	0	0.0	8	0.010554089709762533	T	26.9	4.784101	0.90282	0.003314	0.011299	ENSG00000122512	ENST00000265849;ENST00000382321;ENST00000406569	D;D;D	0.88818	-2.22;-2.4;-2.43	5.67	5.67	0.87782	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92870	0.7732	M	0.82716	2.605	0.80722	D	1	D;D;D	0.76494	0.999;0.981;0.998	D;D;D	0.80764	0.988;0.976;0.994	D	0.93526	0.6865	10	0.72032	D	0.01	.	15.9013	0.79380	0.0:0.0:0.0:1.0	rs63750123	18;18;18	P54278-3;P54278-2;P54278	.;.;PMS2_HUMAN	V	18	ENSP00000265849:I18V;ENSP00000371758:I18V;ENSP00000384308:I18V	ENSP00000265849:I18V	I	-	1	0	PMS2	6012160	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	4.791000	0.62460	2.151000	0.67156	0.477000	0.44152	ATT		0.418	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535		7	170	0	0	0	0.038147	0	7	170				
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:55259515T>G	ENST00000275493.2	+	21	2750	c.2573T>G	c.(2572-2574)cTg>cGg	p.L858R	EGFR_ENST00000454757.2_Missense_Mutation_p.L805R|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.L813R|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	858	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> M (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.|L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity; more sensitive to gefitinib than wild-type; dbSNP:rs121434568). {ECO:0000269|PubMed:15118125, ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L858R(1489)|p.L858Q(1)|p.L858K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATTTTGGGCTGGCCAAACTG	0.537	L858R(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	L858R(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1491	Substitution - Missense(1491)	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)	lung(1475)|upper_aerodigestive_tract(5)|thyroid(4)|large_intestine(2)|peritoneum(1)|stomach(1)|thymus(1)|breast(1)|ovary(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2572-2574)CTG>CGG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	98.0	101.0					7																	55259515		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259515T>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2573T>G	7.37:g.55259515T>G	ENSP00000275493:p.Leu858Arg	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	p.L858R	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2819	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		858		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2573T>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601026	0.87055	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.91351	-2.83;-2.83;-2.83	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.137592	0.50627	D	0.000117	D	0.96340	0.8806	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.956;0.999	D	0.97213	0.9872	10	0.87932	D	0	.	14.8112	0.69996	0.0:0.0:0.0:1.0	.	813;858	Q504U8;P00533	.;EGFR_HUMAN	R	813;728;858;805	ENSP00000415559:L813R;ENSP00000275493:L858R;ENSP00000395243:L805R	ENSP00000275493:L858R	L	+	2	0	EGFR	55227009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.890000	0.87313	2.176000	0.68965	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		109	312	0	0	0	0.048971	0	109	312				
FLNC	2318	broad.mit.edu	37	7	128480629	128480629	+	Missense_Mutation	SNP	G	G	A	rs34932223	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:128480629G>A	ENST00000325888.8	+	10	1838	c.1577G>A	c.(1576-1578)cGg>cAg	p.R526Q	FLNC_ENST00000346177.6_Missense_Mutation_p.R526Q	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	526					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.R526Q(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGAAGGTGCGGGAGGCTGGG	0.612													G|||	15	0.00299521	0.0008	0.0	5008	,	,		19979	0.0		0.003	False		,,,				2504	0.0112						uc003vnz.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(1576-1578)CGG>CAG		gamma filamin isoform a		G	GLN/ARG,GLN/ARG	5,4285		0,5,2140	135.0	156.0	149.0		1577,1577	4.4	0.9	7	dbSNP_126	149	13,8463		0,13,4225	yes	missense,missense	FLNC	NM_001127487.1,NM_001458.4	43,43	0,18,6365	AA,AG,GG		0.1534,0.1166,0.141	benign,benign	526/2693,526/2726	128480629	18,12748	2145	4238	6383	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128480629G>A	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1577G>A	7.37:g.128480629G>A	ENSP00000327145:p.Arg526Gln		Somatic				FLNC_uc003voa.3_Missense_Mutation_p.R526Q	p.R526Q	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			10	1786	+			526			Filamin 3.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.1577G>A	CCDS43644.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	12.69	2.014052	0.35511	0.001166	0.001534	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84370	-1.84;-1.84	5.29	4.41	0.53225	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.620373	0.15861	N	0.241004	T	0.75766	0.3894	N	0.25094	0.71	0.09310	N	1	B;B	0.18310	0.013;0.027	B;B	0.16289	0.009;0.015	T	0.66073	-0.6014	10	0.51188	T	0.08	.	10.7025	0.45934	0.1663:0.0:0.8337:0.0	rs34932223	526;526	Q14315-2;Q14315	.;FLNC_HUMAN	Q	526	ENSP00000327145:R526Q;ENSP00000344002:R526Q	ENSP00000327145:R526Q	R	+	2	0	FLNC	128267865	0.000000	0.05858	0.877000	0.34402	0.467000	0.32768	0.216000	0.17585	1.232000	0.43678	-0.339000	0.08088	CGG		0.612	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			5	35	0	0	0	0.021553	0	5	35				
PPP2CB	5516	broad.mit.edu	37	8	30655229	30655229	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:30655229G>A	ENST00000221138.4	-	3	804	c.354C>T	c.(352-354)caC>caT	p.H118H	PPP2CB_ENST00000520500.1_5'Flank|PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	118					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.H118H(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	GTCGGCTTTCGTGATTTCCTC	0.363																																							uc003xik.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(352-354)CAC>CAT		protein phosphatase 2, catalytic subunit, beta	Vitamin E(DB00163)						85.0	75.0	79.0					8																	30655229		2203	4300	6503	SO:0001819	synonymous_variant	5516				protein dephosphorylation	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex|spindle pole	metal ion binding	g.chr8:30655229G>A		CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.354C>T	8.37:g.30655229G>A			Somatic					p.H118H	NM_004156	NP_004147	WXS	Illumina HiSeq	Unspecified	P62714	PP2AB_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	4	589	-			118				Proton donor (By similarity).	D3DSV4|P11082|Q6FHK5	Silent	SNP	ENST00000221138.4	37	c.354C>T	CCDS6079.1																																																																																				0.363	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2	NM_001009552		3	43	0	0	0	0.014758	0	3	43				
POTEA	340441	broad.mit.edu	37	8	43197329	43197329	+	RNA	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:43197329G>A	ENST00000522175.2	+	0	1082							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTATCTTACAGGTCAAAAGCC	0.318																																							uc003xpz.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e11-1		POTE ankyrin domain family, member A isoform 2							100.0	96.0	97.0					8																	43197329		1831	4078	5909			340441							g.chr8:43197329G>A	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43197329G>A			Somatic				POTEA_uc003xqa.1_Splice_Site_p.V361_splice	p.V407_splice	NM_001005365	NP_001005365	WXS	Illumina HiSeq	Unspecified	Q6S8J7	POTEA_HUMAN			11	1262	+								A6ND17|A6ND71|Q6S8J6	Splice_Site	SNP	ENST00000522175.2	37	c.1219_splice																																																																																					0.318	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920		66	193	0	0	0	0.048971	0	66	193				
PXDNL	137902	broad.mit.edu	37	8	52359654	52359654	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:52359654C>G	ENST00000356297.4	-	12	1535	c.1435G>C	c.(1435-1437)Gca>Cca	p.A479P	PXDNL_ENST00000543296.1_Missense_Mutation_p.A479P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	479	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.A479P(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCGTGCTGTGCTGCACGGTCA	0.463																																							uc003xqu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1435-1437)GCA>CCA		peroxidasin homolog-like precursor							143.0	139.0	140.0					8																	52359654		2026	4190	6216	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52359654C>G		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1435G>C	8.37:g.52359654C>G	ENSP00000348645:p.Ala479Pro		Somatic					p.A479P	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			12	1536	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	479			Ig-like C2-type 3.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1435G>C	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101491	0.37048	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68025	-0.3;-0.3	4.02	4.02	0.46733	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67896	0.2942	L	0.33339	1.005	0.09310	N	0.999998	D	0.54601	0.967	P	0.56865	0.808	T	0.58081	-0.7699	9	0.46703	T	0.11	.	11.6306	0.51173	0.0:1.0:0.0:0.0	.	479	A1KZ92	PXDNL_HUMAN	P	479	ENSP00000348645:A479P;ENSP00000444865:A479P	ENSP00000348645:A479P	A	-	1	0	PXDNL	52522207	0.972000	0.33761	0.003000	0.11579	0.183000	0.23260	4.397000	0.59690	1.775000	0.52247	0.467000	0.42956	GCA		0.463	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		46	429	0	0	0	0.048971	0	46	429				
OTUD6B	51633	broad.mit.edu	37	8	92090700	92090700	+	Silent	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:92090700T>C	ENST00000285420.4	+	4	621	c.522T>C	c.(520-522)gcT>gcC	p.A174A	OTUD6B_ENST00000404789.3_Silent_p.A43A	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	144	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.						cysteine-type peptidase activity (GO:0008234)	p.A174A(1)|p.A144A(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TATTGGCAGCTAGACAGTTAG	0.398																																							uc003yeu.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)	3						c.(520-522)GCT>GCC		OTU domain containing 6B							63.0	59.0	60.0					8																	92090700		2202	4298	6500	SO:0001819	synonymous_variant	51633							g.chr8:92090700T>C		CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.522T>C	8.37:g.92090700T>C			Somatic				OTUD6B_uc011lgh.1_Silent_p.A43A	p.A174A	NM_016023	NP_057107	WXS	Illumina HiSeq	Unspecified	Q8N6M0	OTU6B_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0187)		4	621	+			144					A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Silent	SNP	ENST00000285420.4	37	c.522T>C	CCDS6253.2																																																																																				0.398	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000319968.1	NM_016023		3	30	0	0	0	0.009096	0	3	30				
SLC52A2	79581	broad.mit.edu	37	8	145583657	145583657	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:145583657C>T	ENST00000532887.1	+	3	1088	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C	SLC52A2_ENST00000527078.1_Missense_Mutation_p.R169C|SLC52A2_ENST00000402965.1_Missense_Mutation_p.R169C|SLC52A2_ENST00000526891.1_3'UTR|FBXL6_ENST00000455319.2_5'Flank|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000540505.1_Missense_Mutation_p.R81C|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.R169C|SLC52A2_ENST00000329994.2_Missense_Mutation_p.R169C|SLC52A2_ENST00000526752.1_Intron			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	169					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)	p.R169C(1)								Gamma Hydroxybutyric Acid(DB01440)	GGGTGTGGGCCGCCTCGAGTG	0.662																																							uc003zcc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(505-507)CGC>TGC		G protein-coupled receptor 172A precursor							68.0	75.0	72.0					8																	145583657		2203	4300	6503	SO:0001583	missense	79581					integral to plasma membrane	receptor activity|riboflavin transporter activity	g.chr8:145583657C>T	AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.505C>T	8.37:g.145583657C>T	ENSP00000436768:p.Arg169Cys		Somatic				FBXL6_uc003zbz.2_5'Flank|FBXL6_uc003zca.2_5'Flank|FBXL6_uc003zcb.2_5'Flank|FBXL6_uc010mfx.2_5'Flank|GPR172A_uc003zcd.1_Missense_Mutation_p.R169C|GPR172A_uc003zce.1_Missense_Mutation_p.R169C|GPR172A_uc010mfy.1_Missense_Mutation_p.R169C|GPR172A_uc003zcf.1_Missense_Mutation_p.R169C|GPR172A_uc011llc.1_Missense_Mutation_p.R81C	p.R169C	NM_024531	NP_078807	WXS	Illumina HiSeq	Unspecified	Q9HAB3	RFT3_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)		3	662	+	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		169					A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	ENST00000532887.1	37	c.505C>T	CCDS6423.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457875	0.43634	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000534725;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	3.82	3.82	0.43975	.	0.393713	0.26812	N	0.022371	T	0.74359	0.3706	M	0.63428	1.95	0.43740	D	0.996232	D	0.62365	0.991	P	0.47528	0.549	T	0.76189	-0.3050	9	.	.	.	.	13.2392	0.59987	0.0:1.0:0.0:0.0	.	169	Q9HAB3	RFT3_HUMAN	C	169;169;169;169;169;169;81	ENSP00000435820:R169C;ENSP00000434728:R169C;ENSP00000385961:R169C;ENSP00000431965:R169C;ENSP00000436768:R169C;ENSP00000333638:R169C;ENSP00000440400:R81C	.	R	+	1	0	GPR172A	145554465	0.919000	0.31177	0.995000	0.50966	0.539000	0.34962	2.177000	0.42509	1.966000	0.57179	0.462000	0.41574	CGC		0.662	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382405.1	NM_024531		3	5	0	0	0	0.004672	0	3	5				
SPATA31A6	389730	broad.mit.edu	37	9	43625382	43625382	+	Missense_Mutation	SNP	G	G	A	rs143826416	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:43625382G>A	ENST00000332857.6	-	4	3333	c.3305C>T	c.(3304-3306)cCt>cTt	p.P1102L	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1102					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTTGTGAATAGGGGGAAACAT	0.483													G|||	2248	0.448882	0.3132	0.4625	5008	,	,		13804	0.6458		0.5	False		,,,				2504	0.3671						uc011lrb.1		NA																	0					0						c.(3304-3306)CCT>CTT		hypothetical protein LOC389730							1.0	2.0	2.0					9																	43625382		372	1032	1404	SO:0001583	missense	389730					integral to membrane		g.chr9:43625382G>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3305C>T	9.37:g.43625382G>A	ENSP00000329825:p.Pro1102Leu		Somatic					p.P1102L	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			4	3334	-			1102						Missense_Mutation	SNP	ENST00000332857.6	37	c.3305C>T	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762340	0.31228	.	.	ENSG00000185775	ENST00000332857	T	0.04970	3.52	2.44	0.396	0.16309	.	1.512980	0.04100	N	0.312673	T	0.12860	0.0312	M	0.71206	2.165	0.80722	P	0.0	B	0.33044	0.395	B	0.42495	0.389	T	0.36648	-0.9739	9	0.56958	D	0.05	.	2.8448	0.05540	0.1624:0.0:0.5643:0.2733	.	1102	Q5VVP1	F75A6_HUMAN	L	1102	ENSP00000329825:P1102L	ENSP00000329825:P1102L	P	-	2	0	FAM75A6	43565378	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.063000	0.14410	0.111000	0.17947	0.383000	0.25322	CCT		0.483	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		4	34	0	0	0	0.047766	0	4	34				
SPATA31A6	389730	broad.mit.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	G	A	rs11261835	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:43627428G>A	ENST00000332857.6	-	4	1287	c.1259C>T	c.(1258-1260)cCc>cTc	p.P420L	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	420					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P420L(1)									GTGCAGAGAGGGGAGGCCCCA	0.498													G|||	2290	0.457268	0.3593	0.4424	5008	,	,		13778	0.6508		0.4891	False		,,,				2504	0.3681						uc011lrb.1		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(1258-1260)CCC>CTC		hypothetical protein LOC389730							4.0	6.0	5.0					9																	43627428		577	1492	2069	SO:0001583	missense	389730					integral to membrane		g.chr9:43627428G>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1259C>T	9.37:g.43627428G>A	ENSP00000329825:p.Pro420Leu		Somatic					p.P420L	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			4	1288	-			420						Missense_Mutation	SNP	ENST00000332857.6	37	c.1259C>T	CCDS47973.1	1071	0.49038461538461536	187	0.3800813008130081	164	0.4530386740331492	357	0.6241258741258742	363	0.4788918205804749	G	16.62	3.174501	0.57692	.	.	ENSG00000185775	ENST00000332857	T	0.64618	-0.11	2.56	2.56	0.30785	.	0.000000	0.52532	D	0.000070	T	0.00012	0.0000	M	0.62154	1.92	0.26385	P	0.9766778	D	0.89917	1.0	D	0.97110	1.0	T	0.49986	-0.8880	9	0.87932	D	0	-6.7679	8.8215	0.35030	0.0:0.0:1.0:0.0	rs11261835	420	Q5VVP1	F75A6_HUMAN	L	420	ENSP00000329825:P420L	ENSP00000329825:P420L	P	-	2	0	FAM75A6	43567424	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.801000	0.47908	1.746000	0.51805	0.449000	0.29647	CCC		0.498	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		7	39	0	0	0	0.105934	0	7	39				
BRINP1	1620	broad.mit.edu	37	9	121930416	121930416	+	Missense_Mutation	SNP	C	C	T	rs141766717	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:121930416C>T	ENST00000265922.3	-	8	1693	c.1232G>A	c.(1231-1233)cGg>cAg	p.R411Q	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	411					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.R411Q(1)									CACGCAGCTCCGCTGGCTCTC	0.597													C|||	5	0.000998403	0.0015	0.0	5008	,	,		19155	0.002		0.0	False		,,,				2504	0.001						uc004bkc.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(1231-1233)CGG>CAG		deleted in bladder cancer 1 precursor		C	GLN/ARG	6,4400	11.4+/-27.6	0,6,2197	20.0	18.0	19.0		1232	5.7	1.0	9	dbSNP_134	19	9,8591	7.1+/-27.0	0,9,4291	yes	missense	DBC1	NM_014618.2	43	0,15,6488	TT,TC,CC		0.1047,0.1362,0.1153	probably-damaging	411/762	121930416	15,12991	2203	4300	6503	SO:0001583	missense	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:121930416C>T	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1232G>A	9.37:g.121930416C>T	ENSP00000265922:p.Arg411Gln		Somatic					p.R411Q	NM_014618	NP_055433	WXS	Illumina HiSeq	Unspecified	O60477	DBC1_HUMAN			8	1688	-			411					Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	c.1232G>A	CCDS6822.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	24.4	4.525548	0.85600	0.001362	0.001047	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.62364	0.03	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.62588	0.2440	L	0.41824	1.3	0.80722	D	1	D	0.63880	0.993	P	0.47134	0.539	T	0.63296	-0.6669	10	0.46703	T	0.11	-21.7784	19.8211	0.96595	0.0:1.0:0.0:0.0	.	411	O60477	DBC1_HUMAN	Q	411	ENSP00000265922:R411Q	ENSP00000265922:R411Q	R	-	2	0	DBC1	120970237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.890000	0.63178	2.687000	0.91594	0.655000	0.94253	CGG		0.597	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		9	11	0	0	0	0.069234	0	9	11				
TOR1A	1861	broad.mit.edu	37	9	132585013	132585013	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:132585013C>T	ENST00000351698.4	-	2	339	c.291G>A	c.(289-291)acG>acA	p.T97T	TOR1A_ENST00000473084.1_5'UTR	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	97	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)	p.T97T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				GCAGGGAGAGCGTGAGAGGTT	0.473																																							uc004byl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(289-291)ACG>ACA		torsin A precursor							214.0	195.0	202.0					9																	132585013		2203	4300	6503	SO:0001819	synonymous_variant	1861				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding	g.chr9:132585013C>T	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.291G>A	9.37:g.132585013C>T			Somatic				TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Silent_p.T97T	p.T97T	NM_000113	NP_000104	WXS	Illumina HiSeq	Unspecified	O14656	TOR1A_HUMAN			2	368	-		Ovarian(14;0.00556)	97					B2RB58|Q53Y64|Q96CA0	Silent	SNP	ENST00000351698.4	37	c.291G>A	CCDS6930.1																																																																																				0.473	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113		6	77	0	0	0	0.021553	0	6	77				
NOTCH1	4851	broad.mit.edu	37	9	139397707	139397707	+	Silent	SNP	G	G	A	rs10521	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:139397707G>A	ENST00000277541.6	-	27	5169	c.5094C>T	c.(5092-5094)gaC>gaT	p.D1698D		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1698					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D1699D(11)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ATGCGGCCACGTCGGTGGCAC	0.632			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			G|||	2772	0.553514	0.5552	0.5115	5008	,	,		17626	0.9018		0.4046	False		,,,				2504	0.3753						uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		11	Substitution - coding silent(11)	p.D1699D(11)	haematopoietic_and_lymphoid_tissue(11)	haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(5092-5094)GAC>GAT		notch1 preproprotein		G		2208,2062		587,1034,514	57.0	67.0	64.0		5094	-4.9	0.8	9	dbSNP_52	64	3010,5508		545,1920,1794	no	coding-synonymous	NOTCH1	NM_017617.3		1132,2954,2308	AA,AG,GG		35.3369,48.2904,40.8039		1698/2556	139397707	5218,7570	2135	4259	6394	SO:0001819	synonymous_variant	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139397707G>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5094C>T	9.37:g.139397707G>A		HNSCC(8;0.001)	Somatic				NOTCH1_uc004cia.1_Silent_p.D928D	p.D1698D	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	27	5094	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	1698			Extracellular (Potential).		Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	c.5094C>T	CCDS43905.1																																																																																				0.632	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		2	3	0	0	0	0.004672	0	2	3				
REPS2	9185	broad.mit.edu	37	X	17073016	17073016	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:17073016G>A	ENST00000357277.3	+	8	1228	c.1057G>A	c.(1057-1059)Ggc>Agc	p.G353S	REPS2_ENST00000380064.4_Missense_Mutation_p.G213S|REPS2_ENST00000303843.7_Missense_Mutation_p.G352S	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	353	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.G353S(1)|p.G214S(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TCGGAAGAACGGCTACCCATT	0.512																																							uc004cxv.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|central_nervous_system(1)	3						c.(1057-1059)GGC>AGC		RALBP1 associated Eps domain containing 2							152.0	116.0	128.0					X																	17073016		2203	4300	6503	SO:0001583	missense	9185				epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding	g.chrX:17073016G>A	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1057G>A	X.37:g.17073016G>A	ENSP00000349824:p.Gly353Ser		Somatic				REPS2_uc004cxw.1_Missense_Mutation_p.G352S|REPS2_uc011miw.1_Missense_Mutation_p.G212S	p.G353S	NM_004726	NP_004717	WXS	Illumina HiSeq	Unspecified	Q8NFH8	REPS2_HUMAN			8	1228	+	Hepatocellular(33;0.183)		353			EH 2.		A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	c.1057G>A	CCDS14180.2	.	.	.	.	.	.	.	.	.	.	G	31	5.074724	0.94000	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.39056	1.1;1.1;1.1	5.13	5.13	0.70059	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.64402	D	0.000006	T	0.67325	0.2881	M	0.79926	2.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.72843	-0.4170	10	0.87932	D	0	-9.8761	16.6137	0.84901	0.0:0.0:1.0:0.0	.	213;352;353	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	S	353;353;352;213	ENSP00000349824:G353S;ENSP00000306033:G352S;ENSP00000369404:G213S	ENSP00000306033:G352S	G	+	1	0	REPS2	16982937	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.565000	0.90730	2.267000	0.75376	0.600000	0.82982	GGC		0.512	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726		8	156	0	0	0	0.047766	0	8	156				
ERCC6L	54821	broad.mit.edu	37	X	71427306	71427306	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:71427306C>T	ENST00000334463.3	-	2	1446	c.1311G>A	c.(1309-1311)gaG>gaA	p.E437E	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Silent_p.E314E	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	437					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.E437E(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AATCTTCCCCCTCATTTCCAT	0.423																																							uc004eaq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1309-1311)GAG>GAA		excision repair protein ERCC6-like							114.0	105.0	108.0					X																	71427306		2203	4300	6503	SO:0001819	synonymous_variant	54821				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	g.chrX:71427306C>T	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1311G>A	X.37:g.71427306C>T			Somatic				PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.E314E	p.E437E	NM_017669	NP_060139	WXS	Illumina HiSeq	Unspecified	Q2NKX8	ERC6L_HUMAN			2	1408	-	Renal(35;0.156)		437					Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	c.1311G>A	CCDS35329.1																																																																																				0.423	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		31	611	0	0	0	0.104719	0	31	611				
HTATSF1	27336	broad.mit.edu	37	X	135592250	135592250	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:135592250G>A	ENST00000218364.4	+	8	1108	c.934G>A	c.(934-936)Gat>Aat	p.D312N	HTATSF1_ENST00000535601.1_Missense_Mutation_p.D312N	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	312	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D312N(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GAGGCACCCAGATGGTGTGGC	0.398																																							uc004ezw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(934-936)GAT>AAT		HIV-1 Tat specific factor 1							108.0	104.0	105.0					X																	135592250		2203	4300	6503	SO:0001583	missense	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135592250G>A	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.934G>A	X.37:g.135592250G>A	ENSP00000218364:p.Asp312Asn		Somatic				HTATSF1_uc004ezx.2_Missense_Mutation_p.D312N	p.D312N	NM_001163280	NP_001156752	WXS	Illumina HiSeq	Unspecified	O43719	HTSF1_HUMAN			9	1356	+	Acute lymphoblastic leukemia(192;0.000127)		312			RRM 2.		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	c.934G>A	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358294	0.82243	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.05717	3.4;3.4	5.11	5.11	0.69529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.18173	0.0436	L	0.58583	1.82	0.80722	D	1	P	0.38440	0.631	P	0.50791	0.65	T	0.00379	-1.1777	10	0.87932	D	0	-22.4005	17.7192	0.88345	0.0:0.0:1.0:0.0	.	312	O43719	HTSF1_HUMAN	N	312	ENSP00000442699:D312N;ENSP00000218364:D312N	ENSP00000218364:D312N	D	+	1	0	HTATSF1	135419916	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.396000	0.97270	2.114000	0.64651	0.538000	0.68166	GAT		0.398	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		36	400	0	0	0	0.09836	0	36	400				
CSMD2	114784	broad.mit.edu	37	1	34401515	34401515	+	Frame_Shift_Del	DEL	G	G	-	rs150564422		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:34401515delG	ENST00000373381.4	-	4	734	c.558delC	c.(556-558)cccfs	p.P186fs		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	146	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGATGCCATTGGGCAGCCTCC	0.612																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(436-438)CCCfs		CUB and Sushi multiple domains 2							102.0	95.0	97.0					1																	34401515		2203	4300	6503	SO:0001589	frameshift_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34401515delG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.558delC	1.37:g.34401515delG	ENSP00000362479:p.Pro186fs		Somatic				CSMD2_uc001bxm.1_Frame_Shift_Del_p.P186fs	p.P146fs	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			4	467	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	146			Sushi 1.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Frame_Shift_Del	DEL	ENST00000373381.4	37	c.438delC																																																																																					0.612	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		8	2109	NA	NA	NA	NA	NA	8	2109	---	---	---	---
SPRR3	6707	broad.mit.edu	37	1	152975806	152975829	+	In_Frame_Del	DEL	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	rs1970328|rs561001430|rs72704847|rs527966074|rs200495953	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	-	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	ENST00000295367.4	+	2	352_375	c.310_333delCCAGGCTACACCAAGGTCCCTGAA	c.(310-333)ccaggctacaccaaggtccctgaadel	p.PGYTKVPE104del	SPRR3_ENST00000542696.1_In_Frame_Del_p.PGYTKVPE96del|SPRR3_ENST00000331860.3_In_Frame_Del_p.PGYTKVPE104del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	104	14 X 8 AA approximate tandem repeats.		Missing.		epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.Y106C(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTCCCTGAGCCAGGCTACACCAAGGTCCCTGAACCAGGCAGCA	0.567														567	0.113219	0.1082	0.062	5008	,	,		23905	0.1528		0.1133	False		,,,				2504	0.1155						uc001fax.3		NA																	1	Substitution - Missense(1)		kidney(1)	skin(1)	1						c.(310-333)CCAGGCTACACCAAGGTCCCTGAAdel		small proline-rich protein 3			,	1170,3096		431,308,1394					,	3.4	0.4		dbSNP_130	84	2304,5950		748,808,2571	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1179,1116,3965	A1A1,A1R,RR		27.9137,27.4262,27.7476	,	,		3474,9046				SO:0001651	inframe_deletion	6707				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity	g.chr1:152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.310_333delCCAGGCTACACCAAGGTCCCTGAA	1.37:g.152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	ENSP00000295367:p.Pro104_Glu111del		Somatic				SPRR3_uc001faz.3_In_Frame_Del_p.PGYTKVPE104del|SPRR3_uc001fay.2_In_Frame_Del_p.PGYTKVPE96del	p.PGYTKVPE104del	NM_005416	NP_005407	WXS	Illumina HiSeq	Unspecified	Q9UBC9	SPRR3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	460_483	+	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		104_111			9.|14 X 8 AA approximate tandem repeats.		A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	c.310_333delCCAGGCTACACCAAGGTCCCTGAA	CCDS1033.1																																																																																				0.567	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416		53	303	NA	NA	NA	NA	NA	53	303	---	---	---	---
HAX1	10456	broad.mit.edu	37	1	154246356	154246357	+	Frame_Shift_Ins	INS	-	-	G	rs200778148		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:154246356_154246357insG	ENST00000328703.7	+	3	636_637	c.423_424insG	c.(424-426)gggfs	p.G142fs	HAX1_ENST00000532105.1_Frame_Shift_Ins_p.G14fs|HAX1_ENST00000457918.2_Frame_Shift_Ins_p.G94fs|HAX1_ENST00000483970.2_Frame_Shift_Ins_p.G150fs	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	142	Involved in HCLS1 binding.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCAGGATCTTTGGGGGGGTCTT	0.554									Kostmann syndrome																														uc001fes.2		NA																	0					0						c.(421-426)TTTGGGfs		HCLS1 associated protein X-1 isoform a																																				SO:0001589	frameshift_variant	10456	Kostmann_syndrome	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis		actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding	g.chr1:154246356_154246357insG	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.430dupG	1.37:g.154246363_154246363dupG	ENSP00000329002:p.Gly142fs		Somatic				HAX1_uc001fet.2_Frame_Shift_Ins_p.F93fs|HAX1_uc010peo.1_Frame_Shift_Ins_p.F149fs|HAX1_uc009wou.2_Frame_Shift_Ins_p.F66fs|HAX1_uc009wov.2_Frame_Shift_Ins_p.F115fs	p.F141fs	NM_006118	NP_006109	WXS	Illumina HiSeq	Unspecified	O00165	HAX1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		3	584_585	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		141_142			Involved in HCLS1 binding.		A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Frame_Shift_Ins	INS	ENST00000328703.7	37	c.423_424insG	CCDS1064.1																																																																																				0.554	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087650.1	NM_006118		8	230	NA	NA	NA	NA	NA	8	230	---	---	---	---
ROBO4	54538	broad.mit.edu	37	11	124765393	124765394	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:124765393_124765394insC	ENST00000306534.3	-	6	1480_1481	c.995_996insG	c.(994-996)ggcfs	p.G332fs	ROBO4_ENST00000533054.1_Frame_Shift_Ins_p.G187fs|ROBO4_ENST00000526899.1_5'Flank	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	332	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TGCTGTCAGGGCCTCGAGCCCG	0.609																																							uc001qbg.2		NA																	0				ovary(1)|skin(1)	2						c.(994-996)GGCfs		roundabout homolog 4, magic roundabout																																				SO:0001589	frameshift_variant	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124765393_124765394insC	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.996dupG	11.37:g.124765395_124765395dupC	ENSP00000304945:p.Gly332fs		Somatic				ROBO4_uc010sas.1_Frame_Shift_Ins_p.G187fs|ROBO4_uc001qbh.2_Frame_Shift_Ins_p.G222fs|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	p.G332fs	NM_019055	NP_061928	WXS	Illumina HiSeq	Unspecified	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	6	1135_1136	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	332			Fibronectin type-III 1.		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Frame_Shift_Ins	INS	ENST00000306534.3	37	c.995_996insG	CCDS8455.1																																																																																				0.609	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		7	166	NA	NA	NA	NA	NA	7	166	---	---	---	---
ACRV1	56	broad.mit.edu	37	11	125550635	125550645	+	Frame_Shift_Del	DEL	CCAAGCAGATA	CCAAGCAGATA	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CCAAGCAGATA	CCAAGCAGATA	-	-	CCAAGCAGATA	CCAAGCAGATA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:125550635_125550645delCCAAGCAGATA	ENST00000533904.1	-	1	373_383	c.31_41delTATCTGCTTGG	c.(31-42)tatctgcttggafs	p.YLLG11fs	ACRV1_ENST00000348856.3_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000345274.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000445562.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000353070.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000315608.3_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000453509.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000527795.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000425431.1_Frame_Shift_Del_p.YLLG11fs|ACRV1_ENST00000530048.1_Frame_Shift_Del_p.YLLG11fs			P26436	ASPX_HUMAN	acrosomal vesicle protein 1	11					multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				kidney(1)|large_intestine(3)|lung(2)	6	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TCTGGCAGATCCAAGCAGATAAAGACTCATT	0.469																																							uc001qcs.2		NA																	0					0						c.(31-42)TATCTGCTTGGAfs		acrosomal vesicle protein 1 isoform a precursor																																				SO:0001589	frameshift_variant	56				multicellular organismal development	acrosomal vesicle		g.chr11:125550635_125550645delCCAAGCAGATA	AK223335	CCDS8460.1, CCDS8461.1, CCDS44759.1, CCDS44761.1	11q24.2	2012-05-16			ENSG00000134940	ENSG00000134940			127	protein-coding gene	gene with protein product	"""sperm protein 10"""	102525				1693291, 8288254	Standard	NM_001612		Approved	SPACA2, SP-10, D11S4365	uc001qcs.3	P26436	OTTHUMG00000165854	ENST00000533904.1:c.31_41delTATCTGCTTGG	11.37:g.125550635_125550645delCCAAGCAGATA	ENSP00000432816:p.Tyr11fs		Somatic				ACRV1_uc001qck.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcl.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcm.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcn.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qco.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcp.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcq.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcr.2_Frame_Shift_Del_p.Y11fs	p.Y11fs	NM_001612	NP_001603	WXS	Illumina HiSeq	Unspecified	P26436	ASPX_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)	1	298_308	-	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	11_14					Q53FF4	Frame_Shift_Del	DEL	ENST00000533904.1	37	c.31_41delTATCTGCTTGG	CCDS8460.1																																																																																				0.469	ACRV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386722.1	NM_001612		93	539	NA	NA	NA	NA	NA	93	539	---	---	---	---
FOXM1	2305	broad.mit.edu	37	12	2977901	2977910	+	Frame_Shift_Del	DEL	GGTCTCGAAG	GGTCTCGAAG	-	rs148573089		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	GGTCTCGAAG	GGTCTCGAAG	-	-	GGTCTCGAAG	GGTCTCGAAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:2977901_2977910delGGTCTCGAAG	ENST00000359843.3	-	4	733_742	c.665_674delCTTCGAGACC	c.(664-675)ccttcgagaccafs	p.PSRP222fs	FOXM1_ENST00000537018.1_5'UTR|FOXM1_ENST00000361953.3_Frame_Shift_Del_p.PSRP222fs|FOXM1_ENST00000342628.2_Frame_Shift_Del_p.PSRP222fs	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	222					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGACGCTGATGGTCTCGAAGGCTCCTCAAC	0.505																																							uc001qlf.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(664-675)CCTTCGAGACCAfs		forkhead box M1 isoform 2																																				SO:0001589	frameshift_variant	2305				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	g.chr12:2977901_2977910delGGTCTCGAAG	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.665_674delCTTCGAGACC	12.37:g.2977901_2977910delGGTCTCGAAG	ENSP00000352901:p.Pro222fs		Somatic				FOXM1_uc001qle.2_Frame_Shift_Del_p.P222fs|FOXM1_uc001qlg.2_Frame_Shift_Del_p.P222fs|FOXM1_uc009zea.2_Frame_Shift_Del_p.P221fs|FOXM1_uc009zeb.2_Frame_Shift_Del_p.P221fs	p.P222fs	NM_021953	NP_068772	WXS	Illumina HiSeq	Unspecified	Q08050	FOXM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000622)		4	930_939	-			222_225					O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Frame_Shift_Del	DEL	ENST00000359843.3	37	c.665_674delCTTCGAGACC	CCDS8515.1																																																																																				0.505	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953		8	155	NA	NA	NA	NA	NA	8	155	---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72165808	72165809	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:72165808_72165809insG	ENST00000555818.1	+	11	3833_3834	c.3485_3486insG	c.(3484-3489)gtggggfs	p.VG1162fs	SIPA1L1_ENST00000381232.3_Frame_Shift_Ins_p.VG1162fs|SIPA1L1_ENST00000537413.1_Frame_Shift_Ins_p.VG637fs|SIPA1L1_ENST00000358550.2_Frame_Shift_Ins_p.VG1162fs	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1162					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTGGTTCTGTGGGGGGCACTT	0.495																																							uc001xms.2		NA																	0				ovary(3)|breast(1)	4						c.(3484-3486)GTGfs		signal-induced proliferation-associated 1 like																																				SO:0001589	frameshift_variant	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72165808_72165809insG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3491dupG	14.37:g.72165814_72165814dupG	ENSP00000450832:p.Val1162fs		Somatic				SIPA1L1_uc001xmt.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc001xmu.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc001xmv.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc010ttm.1_Frame_Shift_Ins_p.V637fs	p.V1162fs	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	11	3833_3834	+			1162					J3KP19|O95321|Q9UDU4|Q9UNU4	Frame_Shift_Ins	INS	ENST00000555818.1	37	c.3485_3486insG	CCDS9807.1																																																																																				0.495	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		8	486	NA	NA	NA	NA	NA	8	486	---	---	---	---
NOMO1	23420	broad.mit.edu	37	16	14980694	14980695	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:14980694_14980695insC	ENST00000287667.7	+	28	3470_3471	c.3299_3300insC	c.(3298-3303)ttccccfs	p.FP1100fs		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1100						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						TTCTTCCATTTCCCCCCACTGC	0.475																																							uc002dcv.2		NA																	0				ovary(1)	1						c.(3298-3300)TTCfs		nodal modulator 1 precursor																																				SO:0001589	frameshift_variant	23420					integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding	g.chr16:14980694_14980695insC	X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3305dupC	16.37:g.14980700_14980700dupC	ENSP00000287667:p.Phe1100fs		Somatic					p.F1100fs	NM_014287	NP_055102	WXS	Illumina HiSeq	Unspecified	Q15155	NOMO1_HUMAN			28	3365_3366	+			1100			Extracellular (Potential).		P78421|Q8IW21|Q96DG0	Frame_Shift_Ins	INS	ENST00000287667.7	37	c.3299_3300insC	CCDS10556.1																																																																																				0.475	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1			7	721	NA	NA	NA	NA	NA	7	721	---	---	---	---
GPATCH8	23131	broad.mit.edu	37	17	42476034	42476035	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:42476034_42476035insG	ENST00000591680.1	-	8	3440_3441	c.3410_3411insC	c.(3409-3411)ccafs	p.P1137fs	GPATCH8_ENST00000434000.1_Frame_Shift_Ins_p.P1059fs	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1137							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TGCCAAGAGATGGGGGGAGCTT	0.554																																							uc002igw.1		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(3409-3411)CCAfs		G patch domain containing 8																																				SO:0001589	frameshift_variant	23131					intracellular	nucleic acid binding|zinc ion binding	g.chr17:42476034_42476035insG	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3411dupC	17.37:g.42476040_42476040dupG	ENSP00000467556:p.Pro1137fs		Somatic				GPATCH8_uc002igv.1_Frame_Shift_Ins_p.P1059fs|GPATCH8_uc010wiz.1_Frame_Shift_Ins_p.P1059fs	p.P1137fs	NM_001002909	NP_001002909	WXS	Illumina HiSeq	Unspecified	Q9UKJ3	GPTC8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.206)	8	3474_3475	-		Prostate(33;0.0181)	1137					B9EGP9|O60300|Q8TB99	Frame_Shift_Ins	INS	ENST00000591680.1	37	c.3410_3411insC	CCDS32666.1																																																																																				0.554	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909		9	634	NA	NA	NA	NA	NA	9	634	---	---	---	---
U2AF2	11338	broad.mit.edu	37	19	56171936	56171937	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:56171936_56171937insC	ENST00000308924.4	+	4	325_326	c.285_286insC	c.(286-288)cccfs	p.P96fs	U2AF2_ENST00000590551.1_5'Flank|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA|U2AF2_ENST00000450554.2_Frame_Shift_Ins_p.P96fs			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	96					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GGGACGTGCCACCCCCAGGCTT	0.634																																							uc002qlu.2		NA																	0				ovary(1)	1						c.(283-288)CCACCCfs		U2 (RNU2) small nuclear RNA auxiliary factor 2																																				SO:0001589	frameshift_variant	11338				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding	g.chr19:56171936_56171937insC	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.290dupC	19.37:g.56171941_56171941dupC	ENSP00000307863:p.Pro96fs		Somatic				U2AF2_uc002qlt.2_Frame_Shift_Ins_p.P95fs	p.P95fs	NM_007279	NP_009210	WXS	Illumina HiSeq	Unspecified	P26368	U2AF2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)	4	1340_1341	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	95_96	P->G: Decreases affinity for UAF1 by 2 orders of magnitude.				Q96HC5	Frame_Shift_Ins	INS	ENST00000308924.4	37	c.285_286insC	CCDS12933.1																																																																																				0.634	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279		7	117	NA	NA	NA	NA	NA	7	117	---	---	---	---
ASXL2	55252	broad.mit.edu	37	2	25966872	25966873	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:25966872_25966873insG	ENST00000435504.4	-	13	2626_2627	c.2333_2334insC	c.(2332-2334)ccafs	p.P778fs	ASXL2_ENST00000272341.4_Frame_Shift_Ins_p.P518fs|ASXL2_ENST00000336112.4_Frame_Shift_Ins_p.P750fs|ASXL2_ENST00000404843.1_Frame_Shift_Ins_p.P518fs			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	778					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGAGGCACTGGGGGGGTTTG	0.554																																							uc002rgs.2		NA																	0				pancreas(1)	1						c.(2332-2334)CCAfs		additional sex combs like 2																																				SO:0001589	frameshift_variant	55252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding	g.chr2:25966872_25966873insG			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2334dupC	2.37:g.25966879_25966879dupG	ENSP00000391447:p.Pro778fs		Somatic				ASXL2_uc002rgt.1_Frame_Shift_Ins_p.P518fs	p.P778fs	NM_018263	NP_060733	WXS	Illumina HiSeq	Unspecified	Q76L83	ASXL2_HUMAN			12	2554_2555	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		778					Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Frame_Shift_Ins	INS	ENST00000435504.4	37	c.2333_2334insC																																																																																					0.554	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263		7	135	NA	NA	NA	NA	NA	7	135	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179535845	179535845	+	Frame_Shift_Del	DEL	A	A	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:179535845delA	ENST00000591111.1	-	152	34382	c.34158delT	c.(34156-34158)gttfs	p.V11387fs	TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.V10460fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Frame_Shift_Del_p.V11761fs|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11378	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCGAGGAACAACTTTAGTGG	0.353																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(31375-31377)GTTfs		titin isoform N2-A							113.0	102.0	105.0					2																	179535845		1799	4061	5860	SO:0001589	frameshift_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179535845delA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34158delT	2.37:g.179535845delA	ENSP00000465570:p.Val11387fs		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.V7120fs|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_5'UTR	p.V10459fs	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		151	31601	-			11386					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37	c.31377delT																																																																																					0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		48	87	NA	NA	NA	NA	NA	48	87	---	---	---	---
NYAP2	57624	broad.mit.edu	37	2	226447378	226447379	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:226447378_226447379insC	ENST00000272907.6	+	4	1658_1659	c.1245_1246insC	c.(1246-1248)cccfs	p.P416fs	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	416	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CGTCGCCCCCACCCCCGTCTAC	0.678																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1243-1248)CCACCCfs		hypothetical protein LOC57624																																				SO:0001589	frameshift_variant	57624							g.chr2:226447378_226447379insC	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1250dupC	2.37:g.226447383_226447383dupC	ENSP00000272907:p.Pro416fs		Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Frame_Shift_Ins_p.P185fs	p.P415fs	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	1420_1421	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	415_416			Pro-rich.		A2RRN4|Q96NL2	Frame_Shift_Ins	INS	ENST00000272907.6	37	c.1245_1246insC	CCDS46529.1																																																																																				0.678	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40834329	40834330	+	Frame_Shift_Ins	INS	-	-	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr21:40834329_40834330insT	ENST00000333634.4	+	2	341_342	c.263_264insT	c.(262-267)ggttttfs	p.GF88fs	SH3BGR_ENST00000380637.3_5'UTR|SH3BGR_ENST00000380631.1_5'UTR|SH3BGR_ENST00000458295.1_5'UTR|SH3BGR_ENST00000380634.1_5'UTR	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	88					positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		GAAGTAGTGGGTTTTTTGGAAG	0.342																																							uc002yya.2		NA																	0					0						c.(262-264)GGTfs		SH3-binding domain and glutamic acid-rich																																				SO:0001589	frameshift_variant	6450				protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity	g.chr21:40834329_40834330insT		CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.269dupT	21.37:g.40834335_40834335dupT	ENSP00000332513:p.Gly88fs		Somatic				SH3BGR_uc002yxz.2_5'UTR	p.G88fs	NM_007341	NP_031367	WXS	Illumina HiSeq	Unspecified	P55822	SH3BG_HUMAN		STAD - Stomach adenocarcinoma(101;0.00151)	2	317_318	+		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)	88					A6ND59|D3DSI2|Q9BRB8	Frame_Shift_Ins	INS	ENST00000333634.4	37	c.263_264insT	CCDS13666.1																																																																																				0.342	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157377.6	NM_007341		7	191	NA	NA	NA	NA	NA	7	191	---	---	---	---
SERPIND1	3053	broad.mit.edu	37	22	21138419	21138420	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr22:21138419_21138420insG	ENST00000215727.5	+	3	1332_1333	c.1049_1050insG	c.(1048-1053)gtggggfs	p.VG350fs	PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000466162.1_Intron|SERPIND1_ENST00000406799.1_Frame_Shift_Ins_p.VG350fs	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	350					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	CTGGAATACGTGGGGGGCATCA	0.54											OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002ztb.1		NA																	0					0						c.(1048-1050)GTGfs		heparin cofactor II precursor	Ardeparin(DB00407)																																			SO:0001589	frameshift_variant	3053				blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity	g.chr22:21138419_21138420insG	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1055dupG	22.37:g.21138425_21138425dupG	ENSP00000215727:p.Val350fs		Somatic	OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	746	PI4KA_uc002zsz.3_Intron|SERPIND1_uc002ztc.2_Frame_Shift_Ins_p.V378fs	p.V350fs	NM_000185	NP_000176	WXS	Illumina HiSeq	Unspecified	P05546	HEP2_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		3	1116_1117	+	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	350					B2RAI1|D3DX34|Q6IBZ5	Frame_Shift_Ins	INS	ENST00000215727.5	37	c.1049_1050insG	CCDS13783.1																																																																																				0.540	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185		8	401	NA	NA	NA	NA	NA	8	401	---	---	---	---
UBA7	7318	broad.mit.edu	37	3	49846857	49846860	+	Frame_Shift_Del	DEL	TGTT	TGTT	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	TGTT	TGTT	-	-	TGTT	TGTT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:49846857_49846860delTGTT	ENST00000333486.3	-	17	2284_2287	c.2126_2129delAACA	c.(2125-2130)aaacagfs	p.KQ709fs		NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	709					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTGGGGACACTGTTTGGGACCTGA	0.564																																							uc003cxr.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2125-2130)AAACAGfs		ubiquitin-like modifier activating enzyme 7				3,4263		0,3,2130						0.8	0.8			115	10,8244		1,8,4118	no	frameshift	UBA7	NM_003335.2		1,11,6248	A1A1,A1R,RR		0.1212,0.0703,0.1038				13,12507				SO:0001589	frameshift_variant	7318				ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity	g.chr3:49846857_49846860delTGTT	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.2126_2129delAACA	3.37:g.49846857_49846860delTGTT	ENSP00000333266:p.Lys709fs		Somatic					p.K709fs	NM_003335	NP_003326	WXS	Illumina HiSeq	Unspecified	P41226	UBA7_HUMAN		BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	17	2297_2300	-			709_710					Q9BRB2	Frame_Shift_Del	DEL	ENST00000333486.3	37	c.2126_2129delAACA	CCDS2805.1																																																																																				0.564	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335		7	45	NA	NA	NA	NA	NA	7	45	---	---	---	---
PFN2	5217	broad.mit.edu	37	3	149684345	149684346	+	Frame_Shift_Ins	INS	-	-	GACA			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:149684345_149684346insGACA	ENST00000239940.7	-	3	605_606	c.353_354insTGTC	c.(352-354)gggfs	p.-119fs	PFN2_ENST00000498307.1_Frame_Shift_Ins_p.-70fs|PFN2_ENST00000423691.2_Intron|PFN2_ENST00000452853.2_Intron|PFN2_ENST00000489155.1_Frame_Shift_Ins_p.-70fs|PFN2_ENST00000494827.1_Intron|PFN2_ENST00000490975.1_Frame_Shift_Ins_p.-104fs|PFN2_ENST00000497148.1_Frame_Shift_Ins_p.-70fs|PFN2_ENST00000475518.1_Frame_Shift_Ins_p.-70fs|PFN2_ENST00000481275.1_Frame_Shift_Ins_p.-70fs|PFN2_ENST00000481767.1_Intron			P35080	PROF2_HUMAN	profilin 2						actin cytoskeleton organization (GO:0030036)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|regulation of synaptic vesicle exocytosis (GO:2000300)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|terminal bouton (GO:0043195)	actin monomer binding (GO:0003785)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTCCATGGACCCCTTCTTTTCC	0.396																																							uc003ext.1		NA																	0					0						c.(352-354)GGGfs		profilin 2 isoform a																																				SO:0001589	frameshift_variant	5217				actin cytoskeleton organization|regulation of actin polymerization or depolymerization	actin cytoskeleton|cytoplasm	actin binding|phosphatidylinositol-4,5-bisphosphate binding	g.chr3:149684345_149684346insGACA	L10678	CCDS3148.1, CCDS46934.1	3q25.1	2006-10-16			ENSG00000070087	ENSG00000070087			8882	protein-coding gene	gene with protein product		176590				8975700, 8365484	Standard	NM_002628		Approved		uc003ext.1	P35080	OTTHUMG00000159683	ENST00000239940.7:c.353_354insTGTC	3.37:g.149684345_149684346insGACA	ENSP00000239940:p.Val119fs		Somatic				PFN2_uc003exs.1_Intron|PFN2_uc003exu.1_Intron|PFN2_uc011bnu.1_Intron	p.G118fs	NM_053024	NP_444252	WXS	Illumina HiSeq	Unspecified	P35080	PROF2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		3	451_452	-			118					B2R4C8|D3DNI4|Q4VBQ4|Q8WVF9|Q9HBK2	Frame_Shift_Ins	INS	ENST00000239940.7	37	c.353_354insTGTC	CCDS3148.1																																																																																				0.396	PFN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356873.2	NM_002628		18	206	NA	NA	NA	NA	NA	18	206	---	---	---	---
APBB2	323	broad.mit.edu	37	4	41015705	41015706	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr4:41015705_41015706insG	ENST00000295974.8	-	6	1358_1359	c.729_730insC	c.(727-732)accgacfs	p.D244fs	APBB2_ENST00000513140.1_Frame_Shift_Ins_p.D244fs|APBB2_ENST00000506352.1_Frame_Shift_Ins_p.D244fs|APBB2_ENST00000508593.1_Frame_Shift_Ins_p.D244fs	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	244					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						AGTGCACAGTCGGTTTTGGCCC	0.579																																					Ovarian(3;20 75 16686 49997)	Ovarian(3;20 75 16686 49997)	uc003gvl.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(727-732)ACCGACfs		amyloid beta A4 precursor protein-binding,																																				SO:0001589	frameshift_variant	323				cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding	g.chr4:41015705_41015706insG	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.730dupC	4.37:g.41015707_41015707dupG	ENSP00000295974:p.Asp244fs		Somatic				APBB2_uc003gvm.2_Frame_Shift_Ins_p.T243fs|APBB2_uc003gvn.2_Frame_Shift_Ins_p.T243fs|APBB2_uc011byt.1_Frame_Shift_Ins_p.T226fs	p.T243fs	NM_173075	NP_775098	WXS	Illumina HiSeq	Unspecified	Q92870	APBB2_HUMAN			6	1359_1360	-			243_244					B4DSL4|E9PG87|Q8IUI6	Frame_Shift_Ins	INS	ENST00000295974.8	37	c.729_730insC	CCDS54761.1																																																																																				0.579	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075		9	1229	NA	NA	NA	NA	NA	9	1229	---	---	---	---
FYB	2533	broad.mit.edu	37	5	39203039	39203040	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:39203039_39203040insC	ENST00000351578.6	-	2	213_214	c.23_24insG	c.(22-24)ggcfs	p.G8fs	FYB_ENST00000512982.1_Frame_Shift_Ins_p.G8fs|FYB_ENST00000540520.1_Frame_Shift_Ins_p.G18fs|FYB_ENST00000505428.1_Frame_Shift_Ins_p.G8fs|FYB_ENST00000515010.1_Frame_Shift_Ins_p.G8fs	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	8					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTGTCGGGTTGCCCCCCGTGTT	0.446																																							uc003jls.2		NA																	0				ovary(2)	2						c.(22-24)GGCfs		FYN binding protein (FYB-120/130) isoform 2																																				SO:0001589	frameshift_variant	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39203039_39203040insC	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.24dupG	5.37:g.39203045_39203045dupC	ENSP00000316460:p.Gly8fs		Somatic				FYB_uc003jlt.2_Frame_Shift_Ins_p.G8fs|FYB_uc003jlu.2_Frame_Shift_Ins_p.G8fs|FYB_uc011cpl.1_Frame_Shift_Ins_p.G18fs	p.G8fs	NM_199335	NP_955367	WXS	Illumina HiSeq	Unspecified	O15117	FYB_HUMAN	Epithelial(62;0.235)		1	90_91	-	all_lung(31;0.000343)		8					A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Frame_Shift_Ins	INS	ENST00000351578.6	37	c.23_24insG	CCDS47200.1																																																																																				0.446	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		7	326	NA	NA	NA	NA	NA	7	326	---	---	---	---
NCR3	259197	broad.mit.edu	37	6	31557857	31557858	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:31557857_31557858delCA	ENST00000340027.5	-	2	352_353	c.89_90delTG	c.(88-90)ctgfs	p.L30fs	NCR3_ENST00000376071.4_Frame_Shift_Del_p.L30fs|NCR3_ENST00000491161.1_5'UTR|NCR3_ENST00000376073.4_Frame_Shift_Del_p.L30fs|NCR3_ENST00000376072.3_Frame_Shift_Del_p.L30fs	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	30	Ig-like.				cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)				cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						AGGATCCTTCCAGGGTACGAAT	0.579																																							uc003nuv.2		NA																	0				ovary(1)|skin(1)	2						c.(88-90)CTGfs		natural cytotoxicity triggering receptor 3																																				SO:0001589	frameshift_variant	259197				cell recognition|immune response|inflammatory response|positive regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane	receptor activity	g.chr6:31557857_31557858delCA	AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.89_90delTG	6.37:g.31557857_31557858delCA	ENSP00000342156:p.Leu30fs		Somatic				NCR3_uc003nuw.2_Frame_Shift_Del_p.L30fs|NCR3_uc003nux.1_Frame_Shift_Del_p.L30fs	p.L30fs	NM_147130	NP_667341	WXS	Illumina HiSeq	Unspecified	O14931	NCTR3_HUMAN			2	353_354	-			30			Ig-like.|Extracellular (Potential).		B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Frame_Shift_Del	DEL	ENST00000340027.5	37	c.89_90delTG	CCDS34397.1																																																																																				0.579	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2			50	246	NA	NA	NA	NA	NA	50	246	---	---	---	---
ALDH8A1	64577	broad.mit.edu	37	6	135253995	135253996	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:135253995_135253996insC	ENST00000265605.2	-	5	835_836	c.767_768insG	c.(766-768)ggcfs	p.G256fs	ALDH8A1_ENST00000367847.2_Frame_Shift_Ins_p.G206fs|ALDH8A1_ENST00000367845.2_Frame_Shift_Ins_p.G256fs	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	256					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.G256D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CAGGATTCTTGCCCCCCAGCTC	0.619																																							uc003qew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(766-768)GGCfs		aldehyde dehydrogenase 8A1 isoform 1																																				SO:0001589	frameshift_variant	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135253995_135253996insC	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.768dupG	6.37:g.135254001_135254001dupC	ENSP00000265605:p.Gly256fs		Somatic				ALDH8A1_uc003qex.2_Frame_Shift_Ins_p.G256fs|ALDH8A1_uc010kgh.2_Frame_Shift_Ins_p.G88fs|ALDH8A1_uc011ecx.1_Frame_Shift_Ins_p.G206fs	p.G256fs	NM_022568	NP_072090	WXS	Illumina HiSeq	Unspecified	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	5	820_821	-	Colorectal(23;0.221)		256					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Frame_Shift_Ins	INS	ENST00000265605.2	37	c.767_768insG	CCDS5171.1																																																																																				0.619	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			7	247	NA	NA	NA	NA	NA	7	247	---	---	---	---
NOX3	50508	broad.mit.edu	37	6	155750039	155750040	+	Frame_Shift_Ins	INS	-	-	G	rs79326507	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:155750039_155750040insG	ENST00000159060.2	-	9	1135_1136	c.1033_1034insC	c.(1033-1035)cagfs	p.Q345fs		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	345	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AAAGTCCTCCTGGGGGGCAGAG	0.614																																							uc003qqm.2		NA																	0				ovary(1)	1						c.(1033-1035)CAGfs		NADPH oxidase 3																																				SO:0001589	frameshift_variant	50508						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding	g.chr6:155750039_155750040insG	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1034dupC	6.37:g.155750045_155750045dupG	ENSP00000159060:p.Gln345fs		Somatic					p.Q345fs	NM_015718	NP_056533	WXS	Illumina HiSeq	Unspecified	Q9HBY0	NOX3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)	9	1136_1137	-		Breast(66;0.0183)	345			Extracellular (Potential).|FAD-binding FR-type.		Q9HBJ9	Frame_Shift_Ins	INS	ENST00000159060.2	37	c.1033_1034insC	CCDS5250.1																																																																																				0.614	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1			7	286	NA	NA	NA	NA	NA	7	286	---	---	---	---
