#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLCH2	9651	broad.mit.edu	37	1	2435767	2435767	+	Silent	SNP	C	C	T	rs564857617		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:2435767C>T	ENST00000419816.2	+	22	3640	c.3366C>T	c.(3364-3366)tcC>tcT	p.S1122S	PLCH2_ENST00000378488.3_Silent_p.S1086S|PLCH2_ENST00000378486.3_Silent_p.S1122S|PLCH2_ENST00000449969.1_3'UTR			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1122					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CCGTGTACTCCGATGCCACGG	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14033	0.0		0.0	False		,,,				2504	0.0						uc001aji.1		NA																	0				central_nervous_system(3)|ovary(1)|skin(1)	5						c.(3364-3366)TCC>TCT		phospholipase C, eta 2																																				SO:0001819	synonymous_variant	9651				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr1:2435767C>T	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3366C>T	1.37:g.2435767C>T			Somatic				PLCH2_uc010nyz.1_3'UTR|PLCH2_uc009vle.1_Silent_p.S874S|PLCH2_uc001ajj.1_3'UTR|PLCH2_uc001ajk.1_3'UTR|PLCH2_uc001ajl.1_5'UTR	p.S1122S	NM_014638	NP_055453	WXS	Illumina HiSeq	Unspecified	O75038	PLCH2_HUMAN		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)	22	3640	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	1122					A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37	c.3366C>T		.	.	.	.	.	.	.	.	.	.	C	0.205	-1.041284	0.02013	.	.	ENSG00000149527	ENST00000419816	.	.	.	4.62	-9.24	0.00669	.	.	.	.	.	T	0.31263	0.0791	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40001	-0.9586	4	.	.	.	.	0.2216	0.00168	0.3293:0.1654:0.1775:0.3278	.	.	.	.	L	417	.	.	P	+	2	0	PLCH2	2425627	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.281000	0.00260	-1.933000	0.01052	-1.474000	0.01003	CCG		0.662	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638		10	18	0	0	0	0.013537	0	10	18				
EIF3I	8668	broad.mit.edu	37	1	32696570	32696570	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:32696570G>C	ENST00000373586.1	+	10	918	c.846G>C	c.(844-846)aaG>aaC	p.K282N	MTMR9LP_ENST00000441044.1_RNA	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I											breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				GAAGAGTCAAGGGTCACTTTG	0.468																																					Colon(102;1138 2140 2180 17876)	Colon(102;1138 2140 2180 17876)	uc001bur.3		NA																	0				ovary(1)	1						c.(844-846)AAG>AAC		eukaryotic translation initiation factor 3,							115.0	110.0	112.0					1																	32696570		2203	4300	6503	SO:0001583	missense	8668					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr1:32696570G>C	U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.846G>C	1.37:g.32696570G>C	ENSP00000362688:p.Lys282Asn		Somatic				EIF3I_uc009vuc.2_Missense_Mutation_p.K282N|EIF3I_uc001bus.2_Missense_Mutation_p.K234N	p.K282N	NM_003757	NP_003748	WXS	Illumina HiSeq	Unspecified	Q13347	EIF3I_HUMAN			11	1379	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)	282						Missense_Mutation	SNP	ENST00000373586.1	37	c.846G>C	CCDS357.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427719	0.62733	.	.	ENSG00000084623	ENST00000373586	T	0.60920	0.15	4.44	0.357	0.16079	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65037	0.2653	L	0.52266	1.64	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62229	-0.6898	10	0.87932	D	0	-36.1819	8.0544	0.30596	0.4074:0.0:0.5926:0.0	.	282	Q13347	EIF3I_HUMAN	N	282	ENSP00000362688:K282N	ENSP00000362688:K282N	K	+	3	2	EIF3I	32469157	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	1.733000	0.38156	-0.124000	0.11724	-0.339000	0.08088	AAG		0.468	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019282.2	NM_003757		17	36	0	0	0	0.006122	0	17	36				
ST6GALNAC5	81849	broad.mit.edu	37	1	77510125	77510125	+	Silent	SNP	C	C	T	rs369823894		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:77510125C>T	ENST00000477717.1	+	3	733	c.498C>T	c.(496-498)acC>acT	p.T166T		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	166					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						GCCAGGGCACCGTGTTCATCT	0.637																																							uc001dhi.2		NA																	0				pancreas(1)|skin(1)	2						c.(496-498)ACC>ACT		sialyltransferase 7E							72.0	64.0	67.0					1																	77510125		2203	4300	6503	SO:0001819	synonymous_variant	81849				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77510125C>T		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.498C>T	1.37:g.77510125C>T			Somatic				ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	p.T166T	NM_030965	NP_112227	WXS	Illumina HiSeq	Unspecified	Q9BVH7	SIA7E_HUMAN			3	673	+			166			Lumenal (Potential).		B1AK82	Silent	SNP	ENST00000477717.1	37	c.498C>T	CCDS673.1																																																																																				0.637	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965		21	63	0	0	0	0.016522	0	21	63				
NBPF10	100132406	broad.mit.edu	37	1	145296448	145296448	+	Missense_Mutation	SNP	T	T	A	rs4996268		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:145296448T>A	ENST00000342960.5	+	3	405	c.370T>A	c.(370-372)Tat>Aat	p.Y124N	NBPF10_ENST00000369339.3_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	124						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.Y124N(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGCTCATTGTATGAGCATCT	0.562																																							uc001end.3		NA																	2	Substitution - Missense(2)		kidney(2)		0						c.(370-372)TAT>AAT		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145296448T>A	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.370T>A	1.37:g.145296448T>A	ENSP00000345684:p.Tyr124Asn		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.Y124N|NBPF10_uc001emq.1_Intron	p.Y124N	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	3	405	+	all_hematologic(923;0.032)		124					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	c.370T>A	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.880827	0.00061	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.02552	4.25	1.04	-2.09	0.07232	.	.	.	.	.	T	0.00109	0.0003	N	0.00075	-2.25	0.09310	N	1	.	.	.	.	.	.	T	0.35351	-0.9792	7	0.02654	T	1	.	3.206	0.06666	0.3078:0.4616:0.0:0.2307	rs4996268	.	.	.	N	124;49;124	ENSP00000345684:Y124N	ENSP00000345684:Y124N	Y	+	1	0	NBPF10	144007805	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.048000	0.14078	-3.520000	0.00148	-3.904000	0.00016	TAT		0.562	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		8	312	0	0	0	0.004482	0	8	312				
TCHH	7062	broad.mit.edu	37	1	152084627	152084627	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152084627C>G	ENST00000368804.1	-	2	1065	c.1066G>C	c.(1066-1068)Gag>Cag	p.E356Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	356	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.E356Q(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctctcctcctcctgctcgcgc	0.716																																							uc001ezp.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(1066-1068)GAG>CAG		trichohyalin																																				SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152084627C>G	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1066G>C	1.37:g.152084627C>G	ENSP00000357794:p.Glu356Gln		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.E356Q	p.E356Q	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1066	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		356			1-4.|5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.1066G>C	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	N	7.510	0.654399	0.14580	.	.	ENSG00000159450	ENST00000368804	T	0.05319	3.46	3.05	-0.676	0.11361	.	.	.	.	.	T	0.00845	0.0028	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.06405	0.002	T	0.47509	-0.9112	9	0.21540	T	0.41	.	6.5749	0.22560	0.0:0.3165:0.5607:0.1228	.	356	Q07283	TRHY_HUMAN	Q	356	ENSP00000357794:E356Q	ENSP00000357794:E356Q	E	-	1	0	TCHH	150351251	0.000000	0.05858	0.021000	0.16686	0.029000	0.11900	-0.248000	0.08854	0.122000	0.18314	0.441000	0.28932	GAG		0.716	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		3	84	0	0	0	0.014758	0	3	84				
LCE2C	353140	broad.mit.edu	37	1	152648696	152648696	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152648696G>A	ENST00000368783.1	+	2	260	c.205G>A	c.(205-207)Ggt>Agt	p.G69S	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	69	Cys-rich.				keratinization (GO:0031424)					endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTGGGGCTGGTGGCTGCTC	0.667																																							uc001fah.2		NA																	0					0						c.(205-207)GGT>AGT		late cornified envelope 2C							61.0	71.0	67.0					1																	152648696		2203	4300	6503	SO:0001583	missense	353140				keratinization			g.chr1:152648696G>A		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.205G>A	1.37:g.152648696G>A	ENSP00000357772:p.Gly69Ser		Somatic					p.G69S	NM_178429	NP_848516	WXS	Illumina HiSeq	Unspecified	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	260	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		69			Cys-rich.			Missense_Mutation	SNP	ENST00000368783.1	37	c.205G>A	CCDS1019.1	.	.	.	.	.	.	.	.	.	.	G	1.733	-0.493551	0.04322	.	.	ENSG00000187180	ENST00000368783	T	0.04603	3.59	3.0	2.05	0.26809	.	.	.	.	.	T	0.02688	0.0081	M	0.69823	2.125	0.09310	N	1	P	0.44139	0.827	B	0.40864	0.342	T	0.36915	-0.9728	9	0.87932	D	0	.	6.3704	0.21479	0.1462:0.0:0.8538:0.0	.	69	Q5TA81	LCE2C_HUMAN	S	69	ENSP00000357772:G69S	ENSP00000357772:G69S	G	+	1	0	LCE2C	150915320	0.984000	0.35163	0.001000	0.08648	0.002000	0.02628	1.750000	0.38329	0.574000	0.29417	0.563000	0.77884	GGT		0.667	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		8	117	0	0	0	0.004482	0	8	117				
NUF2	83540	broad.mit.edu	37	1	163298697	163298697	+	Splice_Site	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:163298697A>C	ENST00000271452.3	+	5	616	c.337A>C	c.(337-339)Aaa>Caa	p.K113Q	NUF2_ENST00000367900.3_Splice_Site_p.K113Q|NUF2_ENST00000490881.1_3'UTR|NUF2_ENST00000524800.1_Splice_Site_p.K113Q	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	113	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TCTATGTCCAAGTAAGTGAGA	0.323																																							uc001gcq.1		NA																	0				ovary(3)|skin(1)	4						c.(337-339)AAA>CAA		NUF2, NDC80 kinetochore complex component							124.0	118.0	120.0					1																	163298697		2203	4300	6503	SO:0001630	splice_region_variant	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163298697A>C	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.337+1A>C	1.37:g.163298697A>C			Somatic				NUF2_uc001gcp.2_Missense_Mutation_p.K113Q|NUF2_uc001gcr.1_Missense_Mutation_p.K113Q|NUF2_uc009wvc.1_Missense_Mutation_p.K113Q	p.K113Q	NM_145697	NP_663735	WXS	Illumina HiSeq	Unspecified	Q9BZD4	NUF2_HUMAN			5	637	+	all_hematologic(923;0.101)		113			Interaction with the N-terminus of NDC80.		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	c.337A>C	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.231852	0.79688	.	.	ENSG00000143228	ENST00000534289;ENST00000450453;ENST00000524800;ENST00000442820;ENST00000367900;ENST00000271452	T;T;T	0.31510	1.53;1.49;1.49	4.7	4.7	0.59300	.	0.045294	0.85682	D	0.000000	T	0.26195	0.0639	L	0.47716	1.5	.	.	.	D;D;D	0.60160	0.987;0.987;0.987	P;P;P	0.58210	0.835;0.835;0.835	T	0.03981	-1.0987	9	0.18276	T	0.48	-12.6187	12.0909	0.53726	1.0:0.0:0.0:0.0	.	113;113;113	E9PQC4;Q9BZD4;B1AQT4	.;NUF2_HUMAN;.	Q	113	ENSP00000436888:K113Q;ENSP00000356875:K113Q;ENSP00000271452:K113Q	ENSP00000271452:K113Q	K	+	1	0	NUF2	161565321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.727000	0.61993	2.105000	0.64084	0.528000	0.53228	AAA		0.323	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	Missense_Mutation	7	59	0	0	0	0.004482	0	7	59				
NAV1	89796	broad.mit.edu	37	1	201778380	201778380	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:201778380C>T	ENST00000367296.4	+	21	4716	c.4296C>T	c.(4294-4296)atC>atT	p.I1432I	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Silent_p.I1372I|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367302.1_Silent_p.I1385I|NAV1_ENST00000295624.6_Silent_p.I1429I|NAV1_ENST00000367295.1_Silent_p.I1038I|NAV1_ENST00000367297.4_Silent_p.I1424I	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1432					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CGCAGCACATCATCAAAGGGG	0.517																																							uc001gwu.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(4285-4287)ATC>ATT		neuron navigator 1							102.0	99.0	100.0					1																	201778380		2203	4300	6503	SO:0001819	synonymous_variant	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201778380C>T	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4296C>T	1.37:g.201778380C>T			Somatic				NAV1_uc001gwx.2_Silent_p.I1038I	p.I1429I	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			20	4634	+			1432					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	c.4287C>T	CCDS1414.2																																																																																				0.517	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		47	101	0	0	0	0.01441	0	47	101				
TRAF5	7188	broad.mit.edu	37	1	211526711	211526711	+	Nonsense_Mutation	SNP	A	A	T	rs141533849	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:211526711A>T	ENST00000261464.5	+	2	184	c.130A>T	c.(130-132)Aaa>Taa	p.K44*	TRAF5_ENST00000427925.2_Nonsense_Mutation_p.K44*|TRAF5_ENST00000336184.2_Nonsense_Mutation_p.K44*|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000367004.3_Nonsense_Mutation_p.K44*	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	44					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		AGAGCGCTACAAATGTGCCTT	0.567																																							uc001hih.2		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(130-132)AAA>TAA		TNF receptor-associated factor 5							95.0	82.0	87.0					1																	211526711		2203	4300	6503	SO:0001587	stop_gained	7188				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:211526711A>T	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.130A>T	1.37:g.211526711A>T	ENSP00000261464:p.Lys44*		Somatic				TRAF5_uc001hii.2_Nonsense_Mutation_p.K44*|TRAF5_uc010psx.1_Nonsense_Mutation_p.K44*|TRAF5_uc010psy.1_Nonsense_Mutation_p.K44*|TRAF5_uc001hij.2_Nonsense_Mutation_p.K44*	p.K44*	NM_004619	NP_004610	WXS	Illumina HiSeq	Unspecified	O00463	TRAF5_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)	2	190	+			44					B4DIS9|B4E0A2|Q6FHY1	Nonsense_Mutation	SNP	ENST00000261464.5	37	c.130A>T	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.891435	0.91889	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	.	.	.	4.85	3.67	0.42095	.	0.379178	0.29410	N	0.012235	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3421	11.6391	0.51222	0.8508:0.1492:0.0:0.0	.	.	.	.	X	44	.	ENSP00000261464:K44X	K	+	1	0	TRAF5	209593334	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.079000	0.64431	0.754000	0.32968	0.533000	0.62120	AAA		0.567	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619		14	91	0	0	0	0.028581	0	14	91				
C1orf35	79169	broad.mit.edu	37	1	228290021	228290021	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:228290021G>C	ENST00000272139.4	-	5	671	c.437C>G	c.(436-438)tCt>tGt	p.S146C	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	146							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				CGTGAACACAGACAGCCCCAG	0.706																																							uc001hrx.2		NA																	0					0						c.(436-438)TCT>TGT		hypothetical protein LOC79169							23.0	23.0	23.0					1																	228290021		2202	4298	6500	SO:0001583	missense	79169							g.chr1:228290021G>C	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.437C>G	1.37:g.228290021G>C	ENSP00000272139:p.Ser146Cys		Somatic				C1orf35_uc009xew.2_RNA	p.S146C	NM_024319	NP_077295	WXS	Illumina HiSeq	Unspecified	Q9BU76	MMTA2_HUMAN			5	531	-		Prostate(94;0.0488)	146					Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Missense_Mutation	SNP	ENST00000272139.4	37	c.437C>G	CCDS1566.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677801	0.68042	.	.	ENSG00000143793	ENST00000272139	.	.	.	4.1	4.1	0.47936	.	0.203567	0.43747	D	0.000536	T	0.69052	0.3068	M	0.63843	1.955	0.40135	D	0.976767	D	0.71674	0.998	P	0.60173	0.87	T	0.73452	-0.3978	9	0.56958	D	0.05	-6.1284	14.6454	0.68756	0.0:0.0:1.0:0.0	.	146	Q9BU76	MMTA2_HUMAN	C	146	.	ENSP00000272139:S146C	S	-	2	0	C1orf35	226356644	1.000000	0.71417	0.621000	0.29145	0.486000	0.33341	4.294000	0.59043	2.295000	0.77249	0.491000	0.48974	TCT		0.706	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319		5	32	0	0	0	0.02938	0	5	32				
RYR2	6262	broad.mit.edu	37	1	237753108	237753108	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:237753108G>A	ENST00000366574.2	+	30	3931	c.3614G>A	c.(3613-3615)tGt>tAt	p.C1205Y	RYR2_ENST00000542537.1_Missense_Mutation_p.C1189Y|RYR2_ENST00000360064.6_Missense_Mutation_p.C1203Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1205	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATACCTGTGTGTAGCCTTGGA	0.388																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(3613-3615)TGT>TAT		cardiac muscle ryanodine receptor							75.0	71.0	72.0					1																	237753108		1872	4109	5981	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237753108G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3614G>A	1.37:g.237753108G>A	ENSP00000355533:p.Cys1205Tyr		Somatic					p.C1205Y	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		30	3734	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1205			Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.3614G>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	g	18.65	3.670420	0.67814	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.60171	0.21;0.21;0.21	5.49	5.49	0.81192	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.084605	0.49916	D	0.000122	T	0.68769	0.3037	M	0.86651	2.83	0.80722	D	1	B	0.30937	0.301	B	0.34590	0.186	T	0.72814	-0.4179	10	0.87932	D	0	.	19.3668	0.94466	0.0:0.0:1.0:0.0	.	1205	Q92736	RYR2_HUMAN	Y	1205;1203;1189	ENSP00000355533:C1205Y;ENSP00000353174:C1203Y;ENSP00000443798:C1189Y	ENSP00000353174:C1203Y	C	+	2	0	RYR2	235819731	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	7.899000	0.87370	2.564000	0.86499	0.650000	0.86243	TGT		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		5	51	0	0	0	0.021553	0	5	51				
OR2W5	441932	broad.mit.edu	37	1	247655175	247655175	+	RNA	SNP	T	T	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:247655175T>A	ENST00000522351.1	+	0	806							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CACAGTGGTCTCTCTCTTCTA	0.537																																							uc001icz.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(745-747)CTC>CAC		olfactory receptor, family 2, subfamily W,							141.0	124.0	130.0					1																	247655175		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247655175T>A			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655175T>A			Somatic					p.L249H	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	746	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	249					B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.746T>A																																																																																					0.537	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		53	117	0	0	0	0.01441	0	53	117				
Unknown	0	broad.mit.edu	37	10	135491107	135491107	+	IGR	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr10:135491107G>A								AL845259.1 (17928 upstream) : None (None downstream)																							CTCGTGGGTCGCCTTCGCCCA	0.771																																							uc010qvi.1		NA																	0					0						c.(718-720)GCC>ACC		double homeobox, 4-like							14.0	16.0	15.0					10																	135491107		1147	2189	3336	SO:0001628	intergenic_variant	653544					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135491107G>A																													10.37:g.135491107G>A			Somatic					p.A240T	NM_001127389	NP_001120861	WXS	Illumina HiSeq	Unspecified	F5GZ66	F5GZ66_HUMAN			1	829	+			240						Missense_Mutation	SNP		37	c.718G>A																																																																																				0	0.771									3	7	0	0	0	0.00308	0	3	7				
OR5D16	390144	broad.mit.edu	37	11	55606597	55606597	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:55606597C>A	ENST00000378396.1	+	1	370	c.370C>A	c.(370-372)Cac>Aac	p.H124N		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				GGCCTATGACCACTTTGTGGC	0.438																																							uc010rio.1		NA																	0				ovary(4)|skin(1)	5						c.(370-372)CAC>AAC		olfactory receptor, family 5, subfamily D,							132.0	122.0	125.0					11																	55606597		2201	4296	6497	SO:0001583	missense	390144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55606597C>A	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.370C>A	11.37:g.55606597C>A	ENSP00000367649:p.His124Asn		Somatic					p.H124N	NM_001005496	NP_001005496	WXS	Illumina HiSeq	Unspecified	Q8NGK9	OR5DG_HUMAN			1	370	+		all_epithelial(135;0.208)	124			Cytoplasmic (Potential).		Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	c.370C>A	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	11.07	1.531227	0.27387	.	.	ENSG00000205029	ENST00000378396	T	0.37058	1.22	4.15	-5.36	0.02689	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.26048	0.0635	L	0.39898	1.24	0.09310	N	0.999995	B	0.23937	0.094	B	0.34242	0.178	T	0.46762	-0.9168	9	0.87932	D	0	-3.2743	2.1529	0.03804	0.1227:0.4195:0.1116:0.3461	.	124	Q8NGK9	OR5DG_HUMAN	N	124	ENSP00000367649:H124N	ENSP00000367649:H124N	H	+	1	0	OR5D16	55363173	0.001000	0.12720	0.000000	0.03702	0.588000	0.36517	0.092000	0.15066	-1.288000	0.02378	0.530000	0.56133	CAC		0.438	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		27	67	1	0	1.77063e-15	0.027356	2.10263e-15	27	67				
KIAA1377	57562	broad.mit.edu	37	11	101868365	101868365	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:101868365C>A	ENST00000263468.8	+	11	3615	c.3345C>A	c.(3343-3345)gaC>gaA	p.D1115E	KIAA1377_ENST00000537689.1_Missense_Mutation_p.D916E	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	1115										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GCTGCAGAGACAAGAGATAAT	0.428																																							uc001pgm.2		NA																	0				breast(2)|ovary(1)|central_nervous_system(1)	4						c.(3343-3345)GAC>GAA		hypothetical protein LOC57562							172.0	164.0	167.0					11																	101868365		2203	4299	6502	SO:0001583	missense	57562						protein binding	g.chr11:101868365C>A	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.3345C>A	11.37:g.101868365C>A	ENSP00000263468:p.Asp1115Glu		Somatic				KIAA1377_uc001pgn.2_Missense_Mutation_p.D1071E|KIAA1377_uc010run.1_Missense_Mutation_p.D916E	p.D1115E	NM_020802	NP_065853	WXS	Illumina HiSeq	Unspecified	Q9P2H0	K1377_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.038)	11	3615	+	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)	1115					Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	c.3345C>A	CCDS31658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.245|1.245	-0.620125|-0.620125	0.03636|0.03636	.|.	.|.	ENSG00000110318|ENSG00000110318	ENST00000263468;ENST00000537689|ENST00000532077	T;T|.	0.08193|.	3.27;3.12|.	1.47|1.47	-0.535|-0.535	0.11879|0.11879	.|.	2.556810|.	0.02040|.	U|.	0.049235|.	T|T	0.17577|0.17577	0.0422|0.0422	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P|.	0.48016|.	0.904|.	B|.	0.34452|.	0.183|.	T|T	0.26326|0.26326	-1.0106|-1.0106	10|5	0.09338|.	T|.	0.73|.	3.9295|3.9295	4.0185|4.0185	0.09655|0.09655	0.0:0.5612:0.0:0.4388|0.0:0.5612:0.0:0.4388	.|.	1115|.	Q9P2H0|.	K1377_HUMAN|.	E|K	1115;916|79	ENSP00000263468:D1115E;ENSP00000443184:D916E|.	ENSP00000263468:D1115E|.	D|Q	+|+	3|1	2|0	KIAA1377|KIAA1377	101373575|101373575	0.064000|0.064000	0.20934|0.20934	0.047000|0.047000	0.18901|0.18901	0.009000|0.009000	0.06853|0.06853	1.049000|1.049000	0.30392|0.30392	-0.188000|-0.188000	0.10499|0.10499	-0.373000|-0.373000	0.07131|0.07131	GAC|CAA		0.428	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802		17	49	1	0	3.6726e-16	0.021523	4.40712e-16	17	49				
CCDC15	80071	broad.mit.edu	37	11	124873844	124873844	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:124873844G>T	ENST00000344762.5	+	12	2555	c.2296G>T	c.(2296-2298)Gat>Tat	p.D766Y	CCDC15_ENST00000529051.1_Missense_Mutation_p.D766Y	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	766						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		TAAAGAAGAAGATAAGAAAGA	0.358																																							uc001qbm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2296-2298)GAT>TAT		coiled-coil domain containing 15							90.0	85.0	86.0					11																	124873844		1846	4094	5940	SO:0001583	missense	80071					centrosome		g.chr11:124873844G>T	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2296G>T	11.37:g.124873844G>T	ENSP00000341684:p.Asp766Tyr		Somatic					p.D766Y	NM_025004	NP_079280	WXS	Illumina HiSeq	Unspecified	Q0P6D6	CCD15_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)	12	2555	+	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	766					Q9H8U7	Missense_Mutation	SNP	ENST00000344762.5	37	c.2296G>T	CCDS44756.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320971	0.41096	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.33438	1.41;1.42	5.25	3.4	0.38934	.	0.615828	0.15216	N	0.274207	T	0.42381	0.1200	L	0.47716	1.5	0.25172	N	0.990279	D	0.89917	1.0	D	0.68943	0.961	T	0.14448	-1.0472	10	0.32370	T	0.25	-2.3971	7.9564	0.30045	0.1829:0.0:0.8171:0.0	.	766	Q0P6D6	CCD15_HUMAN	Y	766	ENSP00000435403:D766Y;ENSP00000341684:D766Y	ENSP00000341684:D766Y	D	+	1	0	CCDC15	124379054	0.963000	0.33076	0.953000	0.39169	0.536000	0.34869	1.442000	0.35046	0.796000	0.33947	0.655000	0.94253	GAT		0.358	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004		3	10	1	0	2.56e-06	0.009096	2.9184e-06	3	10				
DDX25	29118	broad.mit.edu	37	11	125788530	125788530	+	Missense_Mutation	SNP	G	G	A	rs373696148		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:125788530G>A	ENST00000263576.6	+	10	1201	c.1046G>A	c.(1045-1047)cGa>cAa	p.R349Q	DDX25_ENST00000525943.1_3'UTR|RP11-680F20.9_ENST00000533033.2_RNA	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	349	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TAGACTCGTCGAAACGCTAAG	0.537																																							uc001qcz.3		NA																	0				ovary(1)	1						c.(1045-1047)CGA>CAA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 25		G	GLN/ARG	2,4064		0,2,2031	135.0	134.0	135.0		1046	-0.3	1.0	11		135	0,8354		0,0,4177	no	missense	DDX25	NM_013264.3	43	0,2,6208	AA,AG,GG		0.0,0.0492,0.0161	benign	349/484	125788530	2,12418	2033	4177	6210	SO:0001583	missense	29118				mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding	g.chr11:125788530G>A	AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1046G>A	11.37:g.125788530G>A	ENSP00000263576:p.Arg349Gln		Somatic				DDX25_uc010sbk.1_Missense_Mutation_p.R349Q	p.R349Q	NM_013264	NP_037396	WXS	Illumina HiSeq	Unspecified	Q9UHL0	DDX25_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)	10	1187	+	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	349			Helicase C-terminal.		B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	ENST00000263576.6	37	c.1046G>A	CCDS44766.1	.	.	.	.	.	.	.	.	.	.	g	5.565	0.289044	0.10513	4.92E-4	0.0	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.04917	3.53	5.5	-0.281	0.12882	Helicase, C-terminal (1);	0.317695	0.27000	N	0.021430	T	0.05593	0.0147	L	0.41236	1.265	0.43283	D	0.995252	B;B	0.20550	0.046;0.046	B;B	0.06405	0.002;0.002	T	0.31806	-0.9930	10	0.52906	T	0.07	-18.0143	9.9168	0.41439	0.5526:0.0:0.4474:0.0	.	349;349	B4DHI6;Q9UHL0	.;DDX25_HUMAN	Q	235;349;215	ENSP00000263576:R349Q	ENSP00000263576:R349Q	R	+	2	0	DDX25	125293740	0.015000	0.18098	0.976000	0.42696	0.030000	0.12068	0.093000	0.15086	-0.132000	0.11557	-2.720000	0.00132	CGA		0.537	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264		18	22	0	0	0	0.010504	0	18	22				
CAPRIN2	65981	broad.mit.edu	37	12	30881636	30881636	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:30881636G>A	ENST00000395805.2	-	8	2275	c.1728C>T	c.(1726-1728)agC>agT	p.S576S	CAPRIN2_ENST00000298892.5_Silent_p.S576S|CAPRIN2_ENST00000251071.5_Silent_p.S576S|CAPRIN2_ENST00000417045.1_Silent_p.S576S|CAPRIN2_ENST00000308433.5_Silent_p.S243S|CAPRIN2_ENST00000538387.1_5'UTR	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTGGTATGAGGCTTGCTGTAG	0.428																																							uc001rji.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1726-1728)AGC>AGT		C1q domain containing 1 isoform 1							149.0	137.0	141.0					12																	30881636		2203	4300	6503	SO:0001819	synonymous_variant	65981				negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding	g.chr12:30881636G>A	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.1728C>T	12.37:g.30881636G>A			Somatic				CAPRIN2_uc001rjf.1_Silent_p.S373S|CAPRIN2_uc001rjg.1_Silent_p.S243S|CAPRIN2_uc001rjh.1_Silent_p.S576S|CAPRIN2_uc001rjj.1_Silent_p.S243S|CAPRIN2_uc001rjk.3_Silent_p.S576S|CAPRIN2_uc001rjl.3_Silent_p.S576S|CAPRIN2_uc001rjm.1_Silent_p.S243S|CAPRIN2_uc001rjn.1_Silent_p.S243S	p.S576S	NM_001002259	NP_001002259	WXS	Illumina HiSeq	Unspecified	Q6IMN6	CAPR2_HUMAN			8	2479	-	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		576						Silent	SNP	ENST00000395805.2	37	c.1728C>T	CCDS55816.1																																																																																				0.428	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925		59	44	0	0	0	0.01441	0	59	44				
TMBIM4	51643	broad.mit.edu	37	12	66531832	66531832	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:66531832C>T	ENST00000358230.3	-	7	745	c.625G>A	c.(625-627)Gag>Aag	p.E209K	TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000539652.1_3'UTR|TMBIM4_ENST00000286424.7_Missense_Mutation_p.E256K|TMBIM4_ENST00000544599.1_Missense_Mutation_p.E32K|TMBIM4_ENST00000542724.1_Missense_Mutation_p.E178K|TMBIM4_ENST00000398033.4_3'UTR	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	209					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		AATACGTACTCTTCAGGTGAC	0.413																																							uc001stc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(625-627)GAG>AAG		transmembrane BAX inhibitor motif containing 4							126.0	124.0	125.0					12																	66531832		1951	4151	6102	SO:0001583	missense	51643					integral to membrane	protein binding	g.chr12:66531832C>T	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.625G>A	12.37:g.66531832C>T	ENSP00000350965:p.Glu209Lys		Somatic				LLPH_uc010ssx.1_RNA|TMBIM4_uc001std.2_Missense_Mutation_p.E178K|TMBIM4_uc009zqr.2_Missense_Mutation_p.E256K|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_3'UTR|TMBIM4_uc009zqs.2_3'UTR	p.E209K	NM_016056	NP_057140	WXS	Illumina HiSeq	Unspecified	Q9HC24	TMBI4_HUMAN		GBM - Glioblastoma multiforme(28;0.0745)	7	701	-			209			Helical; (Potential).		Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	c.625G>A	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	C	36	5.633410	0.96682	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539427;ENST00000542724	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	6.03	6.03	0.97812	.	0.050066	0.85682	D	0.000000	T	0.66247	0.2770	M	0.68728	2.09	0.80722	D	1	P;P;D	0.53619	0.521;0.913;0.961	P;P;P	0.59825	0.452;0.823;0.864	T	0.61337	-0.7083	9	.	.	.	-5.0582	20.5568	0.99304	0.0:1.0:0.0:0.0	.	256;178;209	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	K	209;32;256;254;178	ENSP00000350965:E209K;ENSP00000444639:E32K;ENSP00000286424:E256K;ENSP00000441291:E178K	.	E	-	1	0	TMBIM4	64818099	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	6.877000	0.75562	2.861000	0.98227	0.655000	0.94253	GAG		0.413	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056		17	188	0	0	0	0.008871	0	17	188				
LRRC10	376132	broad.mit.edu	37	12	70004144	70004144	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:70004144G>A	ENST00000361484.3	-	1	798	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	159					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)				large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TGGCCTGGCAGCAAACGCAGG	0.622																																							uc001svc.2		NA																	0					0						c.(475-477)CTG>TTG		leucine rich repeat containing 10							46.0	47.0	47.0					12																	70004144		2203	4300	6503	SO:0001819	synonymous_variant	376132					nucleus		g.chr12:70004144G>A	AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.475C>T	12.37:g.70004144G>A			Somatic					p.L159L	NM_201550	NP_963844	WXS	Illumina HiSeq	Unspecified	Q5BKY1	LRC10_HUMAN	Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		1	799	-	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		159			LRR 5.		Q6ZVY4	Silent	SNP	ENST00000361484.3	37	c.475C>T	CCDS31856.1																																																																																				0.622	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403834.1	NM_201550		3	77	0	0	0	0.004672	0	3	77				
NAP1L1	4673	broad.mit.edu	37	12	76447587	76447587	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:76447587A>G	ENST00000261182.8	-	9	1219	c.733T>C	c.(733-735)Ttt>Ctt	p.F245L	NAP1L1_ENST00000548044.1_Missense_Mutation_p.F204L|NAP1L1_ENST00000431879.3_Missense_Mutation_p.F177L|NAP1L1_ENST00000393263.3_Missense_Mutation_p.F245L|NAP1L1_ENST00000552342.1_Missense_Mutation_p.F256L|NAP1L1_ENST00000547773.1_Missense_Mutation_p.F182L|NAP1L1_ENST00000542344.1_Missense_Mutation_p.F203L|NAP1L1_ENST00000544816.1_Missense_Mutation_p.F62L|NAP1L1_ENST00000549596.1_Missense_Mutation_p.F245L|NAP1L1_ENST00000535020.2_Missense_Mutation_p.F245L|NAP1L1_ENST00000547993.1_Missense_Mutation_p.F62L	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	245					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				TCAAAAGAAAAGGGATCAGAA	0.318																																							uc001sxw.2		NA																	0				ovary(1)|skin(1)	2						c.(733-735)TTT>CTT		nucleosome assembly protein 1-like 1							75.0	75.0	75.0					12																	76447587		2203	4300	6503	SO:0001583	missense	4673				DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding	g.chr12:76447587A>G		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.733T>C	12.37:g.76447587A>G	ENSP00000261182:p.Phe245Leu		Somatic				NAP1L1_uc001sxv.2_Missense_Mutation_p.F203L|NAP1L1_uc001sxz.2_Missense_Mutation_p.F176L|NAP1L1_uc001sxx.2_Missense_Mutation_p.F245L|NAP1L1_uc001sxy.2_Missense_Mutation_p.F182L|NAP1L1_uc010sty.1_Missense_Mutation_p.F202L|NAP1L1_uc010stz.1_Missense_Mutation_p.F62L|NAP1L1_uc010sua.1_Missense_Mutation_p.F245L|NAP1L1_uc001syb.2_Missense_Mutation_p.F245L|NAP1L1_uc001sya.2_Missense_Mutation_p.F203L|NAP1L1_uc001syc.2_Missense_Mutation_p.F256L	p.F245L	NM_139207	NP_631946	WXS	Illumina HiSeq	Unspecified	P55209	NP1L1_HUMAN			9	1145	-		Colorectal(145;0.09)	245					B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	c.733T>C	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.818893	0.71028	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044;ENST00000550934;ENST00000551992;ENST00000548273	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75;1.75	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.30135	0.0755	L	0.46819	1.47	0.80722	D	1	B;P;B;B;B;B;B	0.36125	0.1;0.538;0.334;0.03;0.07;0.057;0.035	B;B;B;B;B;B;B	0.40825	0.154;0.341;0.23;0.232;0.168;0.065;0.075	T	0.03394	-1.1041	10	0.44086	T	0.13	.	15.8236	0.78678	1.0:0.0:0.0:0.0	.	245;203;256;245;177;182;245	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	L	245;239;245;177;182;62;203;245;245;62;256;204;218;245;204	ENSP00000261182:F245L;ENSP00000450236:F239L;ENSP00000376947:F245L;ENSP00000409795:F177L;ENSP00000448167:F182L;ENSP00000437507:F62L;ENSP00000444759:F203L;ENSP00000445008:F245L;ENSP00000447793:F245L;ENSP00000448007:F62L;ENSP00000447196:F256L;ENSP00000449649:F204L;ENSP00000448133:F218L;ENSP00000448764:F245L;ENSP00000446787:F204L	ENSP00000261182:F245L	F	-	1	0	NAP1L1	74733854	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.336000	0.96533	2.135000	0.66039	0.524000	0.50904	TTT		0.318	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207		3	101	0	0	0	0.004672	0	3	101				
E2F7	144455	broad.mit.edu	37	12	77436892	77436892	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:77436892C>A	ENST00000322886.7	-	7	1311	c.1076G>T	c.(1075-1077)cGt>cTt	p.R359L	E2F7_ENST00000416496.2_Missense_Mutation_p.R359L	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	359					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GGCTGGTTTACGACCTCGCTC	0.463																																							uc001sym.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(1075-1077)CGT>CTT		E2F transcription factor 7							200.0	173.0	182.0					12																	77436892		2203	4300	6503	SO:0001583	missense	144455				cell cycle	transcription factor complex	DNA binding|identical protein binding	g.chr12:77436892C>A	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1076G>T	12.37:g.77436892C>A	ENSP00000323246:p.Arg359Leu		Somatic					p.R359L	NM_203394	NP_976328	WXS	Illumina HiSeq	Unspecified	Q96AV8	E2F7_HUMAN			7	1312	-			359			Potential.		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	c.1076G>T	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570505	0.96540	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	T;T;T	0.38401	1.36;1.14;1.15	5.95	5.95	0.96441	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71846	-0.4469	10	0.87932	D	0	-16.2249	19.3671	0.94468	0.0:1.0:0.0:0.0	.	359	Q96AV8	E2F7_HUMAN	L	359	ENSP00000323246:R359L;ENSP00000393639:R359L;ENSP00000448245:R359L	ENSP00000323246:R359L	R	-	2	0	E2F7	75961023	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	7.765000	0.85310	2.826000	0.97356	0.563000	0.77884	CGT		0.463	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		27	272	1	0	2.12542e-12	0.030593	2.49791e-12	27	272				
PLEKHG7	440107	broad.mit.edu	37	12	93155572	93155572	+	Missense_Mutation	SNP	T	T	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:93155572T>A	ENST00000344636.3	+	9	929	c.745T>A	c.(745-747)Ttc>Atc	p.F249I		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	249	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						CTTCAATGATTTCCTCTTAGT	0.333																																							uc001tcj.2		NA																	0				ovary(1)	1						c.(745-747)TTC>ATC		pleckstrin homology domain containing, family G							81.0	77.0	78.0					12																	93155572		2196	4295	6491	SO:0001583	missense	440107				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr12:93155572T>A	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.745T>A	12.37:g.93155572T>A	ENSP00000344961:p.Phe249Ile		Somatic					p.F249I	NM_001004330	NP_001004330	WXS	Illumina HiSeq	Unspecified	Q6ZR37	PKHG7_HUMAN			9	975	+			249			PH.		B2RNR7	Missense_Mutation	SNP	ENST00000344636.3	37	c.745T>A	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.491051	0.64074	.	.	ENSG00000187510	ENST00000344636	T	0.62232	0.04	5.48	5.48	0.80851	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.100188	0.64402	D	0.000001	T	0.46367	0.1389	L	0.41710	1.295	0.52501	D	0.999951	P	0.40578	0.722	B	0.33454	0.164	T	0.42275	-0.9461	10	0.16896	T	0.51	-25.3881	10.7317	0.46100	0.0:0.0755:0.0:0.9245	.	249	Q6ZR37	PKHG7_HUMAN	I	249	ENSP00000344961:F249I	ENSP00000344961:F249I	F	+	1	0	PLEKHG7	91679703	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	5.032000	0.64140	2.209000	0.71365	0.391000	0.25812	TTC		0.333	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330		8	9	0	0	0	0.006214	0	8	9				
UBE3B	89910	broad.mit.edu	37	12	109972426	109972426	+	Missense_Mutation	SNP	C	C	T	rs192805046		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:109972426C>T	ENST00000342494.3	+	28	3641	c.3046C>T	c.(3046-3048)Cgg>Tgg	p.R1016W	UBE3B_ENST00000434735.2_Missense_Mutation_p.R1016W	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1016	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CAGCGTCCTCCGGGGCTTCTT	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		17455	0.0		0.001	False		,,,				2504	0.0						uc001top.2		NA																	0				ovary(2)|lung(2)	4						c.(3046-3048)CGG>TGG		ubiquitin protein ligase E3B							45.0	45.0	45.0					12																	109972426		2203	4300	6503	SO:0001583	missense	89910				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity	g.chr12:109972426C>T	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.3046C>T	12.37:g.109972426C>T	ENSP00000340596:p.Arg1016Trp		Somatic				UBE3B_uc001toq.2_Missense_Mutation_p.R1016W|UBE3B_uc001tos.2_Missense_Mutation_p.R443W|UBE3B_uc001tot.2_Missense_Mutation_p.R134W|UBE3B_uc010sxp.1_3'UTR	p.R1016W	NM_130466	NP_569733	WXS	Illumina HiSeq	Unspecified	Q7Z3V4	UBE3B_HUMAN			28	3649	+			1016			HECT.		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	c.3046C>T	CCDS9129.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	21.0	4.082945	0.76642	.	.	ENSG00000151148	ENST00000434735;ENST00000342494	T;T	0.39592	1.07;1.07	5.3	3.23	0.37069	HECT (4);	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81602	-0.0858	10	0.87932	D	0	-22.4063	14.0438	0.64693	0.3145:0.6854:0.0:0.0	.	1016	Q7Z3V4	UBE3B_HUMAN	W	1016	ENSP00000391529:R1016W;ENSP00000340596:R1016W	ENSP00000340596:R1016W	R	+	1	2	UBE3B	108456809	0.681000	0.27614	0.999000	0.59377	0.988000	0.76386	0.920000	0.28705	1.170000	0.42753	0.563000	0.77884	CGG		0.632	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415		6	22	0	0	0	0.02938	0	6	22				
TRPM1	4308	broad.mit.edu	37	15	31362264	31362264	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:31362264G>A	ENST00000256552.6	-	4	396	c.249C>T	c.(247-249)ttC>ttT	p.F83F	TRPM1_ENST00000397795.2_Silent_p.F61F|TRPM1_ENST00000559179.1_Silent_p.F61F|TRPM1_ENST00000542188.1_Silent_p.F100F	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CGCCACCCTGGAATTCAAGAA	0.507																																							uc001zfm.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(181-183)TTC>TTT		transient receptor potential cation channel,							371.0	356.0	361.0					15																	31362264		1933	4133	6066	SO:0001819	synonymous_variant	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31362264G>A	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.249C>T	15.37:g.31362264G>A			Somatic				TRPM1_uc010azy.2_5'Flank|TRPM1_uc001zfl.2_5'Flank|TRPM1_uc001zfn.3_Silent_p.F61F|uc010ubn.1_RNA	p.F61F	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	3	311	-		all_lung(180;1.92e-11)	61			Extracellular (Potential).			Silent	SNP	ENST00000256552.6	37	c.183C>T	CCDS58346.1																																																																																				0.507	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		12	490	0	0	0	0.020292	0	12	490				
IVD	3712	broad.mit.edu	37	15	40703778	40703778	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:40703778A>G	ENST00000249760.2	+	6	918	c.575A>G	c.(574-576)aAc>aGc	p.N192S	IVD_ENST00000479013.2_Missense_Mutation_p.N165S|IVD_ENST00000487418.2_Missense_Mutation_p.N195S	NM_002225.3	NP_002216.2	P26440	IVD_HUMAN	isovaleryl-CoA dehydrogenase	192					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	flavin adenine dinucleotide binding (GO:0050660)|isovaleryl-CoA dehydrogenase activity (GO:0008470)			kidney(1)|lung(5)|ovary(2)|prostate(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	Flavin adenine dinucleotide(DB03147)	CTGAATGGCAACAAGTTCTGG	0.522																																					GBM(31;293 617 7486 32527 34655)	GBM(31;293 617 7486 32527 34655)	uc001zls.3		NA																	0				ovary(1)	1						c.(583-585)AAC>AGC		isovaleryl Coenzyme A dehydrogenase isoform 1							101.0	82.0	89.0					15																	40703778		2203	4300	6503	SO:0001583	missense	3712				leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity	g.chr15:40703778A>G	AF038317	CCDS10057.1, CCDS10057.2, CCDS53930.1	15q14-q15	2010-05-11	2010-05-11		ENSG00000128928	ENSG00000128928	1.3.99.10		6186	protein-coding gene	gene with protein product		607036	"""isovaleryl Coenzyme A dehydrogenase"", ""isovaleryl CoA dehydrogenase"""			2063866	Standard	NM_002225		Approved	ACAD2	uc001zls.3	P26440	OTTHUMG00000129984	ENST00000249760.2:c.575A>G	15.37:g.40703778A>G	ENSP00000249760:p.Asn192Ser		Somatic				IVD_uc001zlq.2_Missense_Mutation_p.N165S	p.N195S	NM_002225	NP_002216	WXS	Illumina HiSeq	Unspecified	P26440	IVD_HUMAN		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	6	918	+		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	192					B2RCV5|B3KVI7|J3KR54|Q53XZ9|Q96AF6	Missense_Mutation	SNP	ENST00000249760.2	37	c.584A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.18|10.18	1.279382|1.279382	0.23307|0.23307	.|.	.|.	ENSG00000128928|ENSG00000128928	ENST00000249760;ENST00000479013;ENST00000487418|ENST00000473112	D;D;D|.	0.94828|.	-3.53;-3.53;-3.53|.	5.23|5.23	2.97|2.97	0.34412|0.34412	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);|.	0.133278|.	0.64402|.	D|.	0.000003|.	T|T	0.17323|0.17323	0.0416|0.0416	N|N	0.00648|0.00648	-1.295|-1.295	0.52501|0.52501	D|D	0.99995|0.99995	B;B|.	0.12013|.	0.001;0.005|.	B;B|.	0.21360|.	0.004;0.034|.	T|T	0.08452|0.08452	-1.0721|-1.0721	10|5	0.10636|.	T|.	0.68|.	.|.	13.3013|13.3013	0.60326|0.60326	0.7172:0.2828:0.0:0.0|0.7172:0.2828:0.0:0.0	.|.	192;165|.	P26440;B3KVI7|.	IVD_HUMAN;.|.	S|A	192;165;195|112	ENSP00000249760:N192S;ENSP00000417990:N165S;ENSP00000418397:N195S|.	ENSP00000249760:N192S|.	N|T	+|+	2|1	0|0	IVD|IVD	38491070|38491070	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	2.701000|2.701000	0.47094|0.47094	0.833000|0.833000	0.34828|0.34828	0.459000|0.459000	0.35465|0.35465	AAC|ACA		0.522	IVD-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				40	21	0	0	0	0.01441	0	40	21				
GATM	2628	broad.mit.edu	37	15	45660357	45660357	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:45660357A>G	ENST00000396659.3	-	4	925	c.586T>C	c.(586-588)Tac>Cac	p.Y196H	GATM_ENST00000558336.1_Missense_Mutation_p.Y196H	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	196					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	ATTGACCTGTACGCTCGGTAC	0.493																																							uc001zvc.2		NA																	0					0						c.(586-588)TAC>CAC		L-arginine:glycine amidinotransferase precursor	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)						121.0	98.0	106.0					15																	45660357		2198	4298	6496	SO:0001583	missense	2628				creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding	g.chr15:45660357A>G	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.586T>C	15.37:g.45660357A>G	ENSP00000379895:p.Tyr196His		Somatic				GATM_uc001zvb.2_Missense_Mutation_p.Y67H|GATM_uc010uev.1_Missense_Mutation_p.Y249H	p.Y196H	NM_001482	NP_001473	WXS	Illumina HiSeq	Unspecified	P50440	GATM_HUMAN		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	4	915	-		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	196					B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	37	c.586T>C	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.459994	0.84317	.	.	ENSG00000171766	ENST00000396659	T	0.46063	0.88	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.68924	0.3054	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.74478	-0.3652	10	0.54805	T	0.06	-13.7581	13.7318	0.62792	1.0:0.0:0.0:0.0	.	196;196	P50440-3;P50440	.;GATM_HUMAN	H	196	ENSP00000379895:Y196H	ENSP00000379895:Y196H	Y	-	1	0	GATM	43447649	1.000000	0.71417	0.973000	0.42090	0.933000	0.57130	8.850000	0.92190	2.131000	0.65755	0.377000	0.23210	TAC		0.493	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482		20	21	0	0	0	0.021523	0	20	21				
WASH3P	374666	broad.mit.edu	37	15	102515282	102515282	+	RNA	SNP	G	G	A	rs201747221	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:102515282G>A	ENST00000557932.1	+	0	1128				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GAGTCCATCCGCCAAGCTGGG	0.652																																							uc002cdi.2		NA																	0					0						c.(505-507)CGC>CAC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515282G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515282G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.R169H|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.R169H|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.R169H	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1926	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.506G>A		.	.	.	.	.	.	.	.	.	.	g	1.498	-0.552720	0.03996	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-17.9607	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	H	377;368	.	.	R	+	2	0	WASH3P	100332805	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	CGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		8	6	0	0	0	0.006214	0	8	6				
ERN2	10595	broad.mit.edu	37	16	23722327	23722327	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:23722327T>C	ENST00000457008.2	-	2	144	c.106A>G	c.(106-108)Agg>Ggg	p.R36G	CTD-2385L22.1_ENST00000563611.1_RNA|ERN2_ENST00000256797.4_Missense_Mutation_p.R84G					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TTCTCTGGCCTGAGAGTATGA	0.582																																							uc002dma.3		NA																	0				large_intestine(2)|lung(2)|ovary(2)	6						c.(250-252)AGG>GGG		endoplasmic reticulum to nucleus signalling 2							97.0	89.0	92.0					16																	23722327		2197	4300	6497	SO:0001583	missense	10595				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity	g.chr16:23722327T>C	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.106A>G	16.37:g.23722327T>C	ENSP00000413812:p.Arg36Gly		Somatic				ERN2_uc010bxp.2_Missense_Mutation_p.R84G|ERN2_uc010bxq.1_5'UTR	p.R84G	NM_033266	NP_150296	WXS	Illumina HiSeq	Unspecified	Q76MJ5	ERN2_HUMAN		GBM - Glioblastoma multiforme(48;0.0156)	2	419	-			36			Lumenal (Potential).			Missense_Mutation	SNP	ENST00000457008.2	37	c.250A>G		.	.	.	.	.	.	.	.	.	.	T	7.367	0.625937	0.14257	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.20463	2.07;2.07	4.82	3.71	0.42584	.	0.665949	0.15764	N	0.245793	T	0.15739	0.0379	L	0.36672	1.1	0.09310	N	1	B;B	0.20261	0.043;0.043	B;B	0.19946	0.027;0.027	T	0.21724	-1.0237	10	0.29301	T	0.29	.	7.6798	0.28507	0.1874:0.0:0.0:0.8126	.	36;36	E7ETG2;A5YM65	.;.	G	84;36	ENSP00000256797:R84G;ENSP00000413812:R36G	ENSP00000256797:R84G	R	-	1	2	ERN2	23629828	.	.	0.061000	0.19648	0.490000	0.33462	.	.	0.853000	0.35312	0.460000	0.39030	AGG		0.582	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1			3	67	0	0	0	0.014758	0	3	67				
CHST4	10164	broad.mit.edu	37	16	71570803	71570803	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:71570803G>T	ENST00000338482.5	+	3	566	c.223G>T	c.(223-225)Gcc>Tcc	p.A75S	CHST4_ENST00000572450.1_Missense_Mutation_p.A75S|CHST4_ENST00000539698.3_Missense_Mutation_p.A75S|RP11-510M2.5_ENST00000568523.1_RNA|ZNF19_ENST00000568446.1_Intron			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	75					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						GATGGAGCCCGCCTGGCACGT	0.587																																							uc002fan.2		NA																	0					0						c.(223-225)GCC>TCC		carbohydrate (N-acetylglucosamine 6-O)							101.0	101.0	101.0					16																	71570803		2198	4300	6498	SO:0001583	missense	10164				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:71570803G>T	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.223G>T	16.37:g.71570803G>T	ENSP00000341206:p.Ala75Ser		Somatic				CHST4_uc002fao.2_Missense_Mutation_p.A75S	p.A75S	NM_005769	NP_005760	WXS	Illumina HiSeq	Unspecified	Q8NCG5	CHST4_HUMAN			2	404	+			75			Lumenal (Potential).		Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	37	c.223G>T	CCDS10902.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715486	0.89112	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.96232	-3.95;-3.95	6.0	6.0	0.97389	Sulfotransferase domain (1);	0.115236	0.56097	D	0.000022	D	0.98115	0.9378	M	0.86178	2.8	0.42989	D	0.994485	D	0.62365	0.991	D	0.68039	0.955	D	0.97919	1.0313	10	0.41790	T	0.15	-21.6361	17.9887	0.89162	0.0:0.0:1.0:0.0	.	75	Q8NCG5	CHST4_HUMAN	S	75	ENSP00000341206:A75S;ENSP00000441204:A75S	ENSP00000341206:A75S	A	+	1	0	CHST4	70128304	1.000000	0.71417	0.986000	0.45419	0.948000	0.59901	6.809000	0.75211	2.848000	0.98002	0.655000	0.94253	GCC		0.587	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769		13	46	1	0	6.31663e-08	0.024245	7.27369e-08	13	46				
OSGIN1	29948	broad.mit.edu	37	16	83998759	83998759	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:83998759C>G	ENST00000343939.2	+	7	1213	c.830C>G	c.(829-831)tCc>tGc	p.S277C	OSGIN1_ENST00000361711.3_Missense_Mutation_p.S194C|OSGIN1_ENST00000393306.1_Missense_Mutation_p.S194C			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	277					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						AACTTTGTGTCCGGTGCTGTA	0.642																																							uc002fha.2		NA																	0					0						c.(829-831)TCC>TGC		oxidative stress induced growth inhibitor 1							105.0	113.0	110.0					16																	83998759		2200	4300	6500	SO:0001583	missense	29948				cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity	g.chr16:83998759C>G	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.830C>G	16.37:g.83998759C>G	ENSP00000343376:p.Ser277Cys		Somatic				OSGIN1_uc002fhb.2_Missense_Mutation_p.S194C|OSGIN1_uc002fhc.2_Missense_Mutation_p.S194C	p.S277C	NM_013370	NP_037502	WXS	Illumina HiSeq	Unspecified	Q9UJX0	OSGI1_HUMAN			7	1213	+			277					Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37	c.830C>G		.	.	.	.	.	.	.	.	.	.	C	7.195	0.592365	0.13812	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.23754	1.89;1.89;1.89	4.8	3.81	0.43845	.	0.148595	0.64402	D	0.000007	T	0.14614	0.0353	N	0.11698	0.16	0.34822	D	0.738815	B	0.15930	0.015	B	0.20184	0.028	T	0.15178	-1.0446	10	0.23891	T	0.37	-0.6738	12.8246	0.57712	0.0:0.7505:0.2495:0.0	.	277	Q9UJX0	OSGI1_HUMAN	C	277;194;194	ENSP00000343376:S277C;ENSP00000355374:S194C;ENSP00000376983:S194C	ENSP00000343376:S277C	S	+	2	0	OSGIN1	82556260	0.994000	0.37717	0.876000	0.34364	0.150000	0.21749	3.064000	0.49986	2.211000	0.71520	0.467000	0.42956	TCC		0.642	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370		20	99	0	0	0	0.014323	0	20	99				
ATP1B2	482	broad.mit.edu	37	17	7558889	7558889	+	Silent	SNP	C	C	T	rs574358752		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:7558889C>T	ENST00000250111.4	+	6	1061	c.654C>T	c.(652-654)ccC>ccT	p.P218P		NM_001678.3	NP_001669.3	P14415	AT1B2_HUMAN	ATPase, Na+/K+ transporting, beta 2 polypeptide	218	immunoglobulin-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.0?(2)|p.?(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|pancreas(1)	10		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)		TCATGTTCCCCGCCAACGGCA	0.587																																							uc002gif.1		NA																	3	Whole gene deletion(2)|Unknown(1)	p.0?(2)|p.?(1)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|bone(1)	central_nervous_system(1)|pancreas(1)	2						c.(652-654)CCC>CCT		Na+/K+ -ATPase beta 2 subunit							143.0	113.0	123.0					17																	7558889		2203	4300	6503	SO:0001819	synonymous_variant	482				ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	g.chr17:7558889C>T	U45945	CCDS32550.1	17p13.1	2012-10-22			ENSG00000129244	ENSG00000129244	3.6.3.9	"""ATPases / P-type"""	805	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-2"", ""sodium pump subunit beta-2"", ""sodium-potassium ATPase subunit beta 2 (non-catalytic)"""	182331				1699290	Standard	NM_001678		Approved	AMOG	uc002gif.1	P14415		ENST00000250111.4:c.654C>T	17.37:g.7558889C>T			Somatic					p.P218P	NM_001678	NP_001669	WXS	Illumina HiSeq	Unspecified	P14415	AT1B2_HUMAN		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)	6	1237	+		all_cancers(10;0.000178)|Prostate(122;0.081)	218			Extracellular (Potential).		A0AV17|A8K278|D3DTQ2|O60444	Silent	SNP	ENST00000250111.4	37	c.654C>T	CCDS32550.1																																																																																				0.587	ATP1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440234.1	NM_001678		5	57	0	0	0	0.021553	0	5	57				
TP53	7157	broad.mit.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:7577130A>C	ENST00000269305.4	-	8	997	c.808T>G	c.(808-810)Ttt>Gtt	p.F270V	TP53_ENST00000445888.2_Missense_Mutation_p.F270V|TP53_ENST00000455263.2_Missense_Mutation_p.F270V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.F270V|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.F270V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270L(15)|p.0?(8)|p.F270V(7)|p.F270I(5)|p.S269_F270>I(2)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCACCTCAAAGCTGTTCCGT	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		51	Substitution - Missense(27)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	p.F270L(22)|p.F270C(15)|p.F270V(8)|p.0?(7)|p.F270S(7)|p.F270Y(5)|p.F270I(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)	stomach(8)|large_intestine(7)|breast(5)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|urinary_tract(2)|soft_tissue(1)|biliary_tract(1)|testis(1)|eye(1)|ovary(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(808-810)TTT>GTT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							58.0	51.0	53.0					17																	7577130		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577130A>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.808T>G	17.37:g.7577130A>C	ENSP00000269305:p.Phe270Val	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.F270V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.F138V|TP53_uc010cng.1_Missense_Mutation_p.F138V|TP53_uc002gii.1_Missense_Mutation_p.F138V|TP53_uc010cnh.1_Missense_Mutation_p.F270V|TP53_uc010cni.1_Missense_Mutation_p.F270V|TP53_uc002gij.2_Missense_Mutation_p.F270V	p.F270V	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1002	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	270		F -> L (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).|F -> C (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.808T>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279586	0.80692	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73;-6.73	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99420	0.9795	L	0.28556	0.865	0.58432	D	0.999999	D;B;D;D	0.89917	0.999;0.043;1.0;0.998	D;B;D;D	0.85130	0.997;0.196;0.997;0.996	D	0.98038	1.0380	10	0.87932	D	0	-25.5181	12.9367	0.58319	1.0:0.0:0.0:0.0	.	270;270;270;270	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	270;270;270;270;270;259;138	ENSP00000352610:F270V;ENSP00000269305:F270V;ENSP00000398846:F270V;ENSP00000391127:F270V;ENSP00000391478:F270V;ENSP00000425104:F138V	ENSP00000269305:F270V	F	-	1	0	TP53	7517855	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.060000	0.93907	2.154000	0.67381	0.379000	0.24179	TTT		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		5	5	0	0	0	0.014758	0	5	5				
RASL10B	91608	broad.mit.edu	37	17	34062322	34062322	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:34062322G>A	ENST00000268864.3	+	2	496	c.119G>A	c.(118-120)cGc>cAc	p.R40H		NM_033315.3	NP_201572.1	Q96S79	RSLAB_HUMAN	RAS-like, family 10, member B	40	Small GTPase-like.				GTP catabolic process (GO:0006184)|positive regulation of peptide hormone secretion (GO:0090277)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|endometrium(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACCGCCCGCCGCCTTTACCTG	0.632																																							uc002hju.2		NA																	0				lung(2)|breast(2)	4						c.(118-120)CGC>CAC		RAS-like, family 10, member B precursor							91.0	66.0	75.0					17																	34062322		2203	4300	6503	SO:0001583	missense	91608				small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr17:34062322G>A	BC041133	CCDS11297.1	17q21.1	2014-05-09			ENSG00000141150	ENSG00000270885			30295	protein-coding gene	gene with protein product		612128				12477932	Standard	NM_033315		Approved	VTS58635, RRP17	uc002hju.3	Q96S79	OTTHUMG00000188385	ENST00000268864.3:c.119G>A	17.37:g.34062322G>A	ENSP00000268864:p.Arg40His		Somatic					p.R40H	NM_033315	NP_201572	WXS	Illumina HiSeq	Unspecified	Q96S79	RSLAB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	485	+			40			Small GTPase-like.|Effector region (By similarity).		B3KV31	Missense_Mutation	SNP	ENST00000268864.3	37	c.119G>A	CCDS11297.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288046	0.40494	.	.	ENSG00000141150	ENST00000268864	T	0.79845	-1.31	3.98	3.98	0.46160	.	0.000000	0.47455	D	0.000221	T	0.70107	0.3186	L	0.29908	0.895	0.46167	D	0.998902	B	0.25609	0.13	B	0.20577	0.03	T	0.67309	-0.5703	10	0.30078	T	0.28	.	15.2246	0.73342	0.0:0.0:1.0:0.0	.	40	Q96S79	RSLAB_HUMAN	H	40	ENSP00000268864:R40H	ENSP00000268864:R40H	R	+	2	0	RASL10B	31086435	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.777000	0.62361	2.060000	0.61445	0.462000	0.41574	CGC		0.632	RASL10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256498.2	NM_033315		22	33	0	0	0	0.01892	0	22	33				
FASN	2194	broad.mit.edu	37	17	80041455	80041455	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:80041455A>G	ENST00000306749.2	-	31	5497	c.5279T>C	c.(5278-5280)tTg>tCg	p.L1760S	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1760	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTGCGTAGCCAAGCACCTCAC	0.622																																					Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	0				central_nervous_system(1)	1						c.(5278-5280)TTG>TCG		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)						39.0	38.0	39.0					17																	80041455		2194	4294	6488	SO:0001583	missense	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80041455A>G	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5279T>C	17.37:g.80041455A>G	ENSP00000304592:p.Leu1760Ser		Somatic				FASN_uc002kdv.1_5'Flank	p.L1760S	NM_004104	NP_004095	WXS	Illumina HiSeq	Unspecified	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		31	5396	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		1760			Enoyl reductase (By similarity).		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	c.5279T>C	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.670271	0.67814	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.07688	3.17	4.57	4.57	0.56435	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000001	T	0.49490	0.1560	H	0.99609	4.655	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.73344	-0.4012	10	0.87932	D	0	-22.2681	13.9275	0.63972	1.0:0.0:0.0:0.0	.	1760	P49327	FAS_HUMAN	S	1760;725	ENSP00000304592:L1760S	ENSP00000304592:L1760S	L	-	2	0	FASN	77634744	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	6.014000	0.70784	1.686000	0.51046	0.459000	0.35465	TTG		0.622	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		9	11	0	0	0	0.004482	0	9	11				
GATA6	2627	broad.mit.edu	37	18	19751577	19751577	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr18:19751577G>A	ENST00000269216.3	+	2	749	c.472G>A	c.(472-474)Ggt>Agt	p.G158S	GATA6-AS1_ENST00000583490.1_lincRNA|GATA6_ENST00000581694.1_Missense_Mutation_p.G158S	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	158					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G158S(1)		NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			CTCCAGCCAGGGTCCGGCCGC	0.751																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	uc002ktt.1		NA																	1	Substitution - Missense(1)	p.G158S(1)	central_nervous_system(1)	central_nervous_system(3)	3						c.(472-474)GGT>AGT		GATA binding protein 6							8.0	12.0	11.0					18																	19751577		2072	4138	6210	SO:0001583	missense	2627				blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr18:19751577G>A	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.472G>A	18.37:g.19751577G>A	ENSP00000269216:p.Gly158Ser		Somatic				GATA6_uc002ktu.1_Missense_Mutation_p.G158S	p.G158S	NM_005257	NP_005248	WXS	Illumina HiSeq	Unspecified	Q92908	GATA6_HUMAN	STAD - Stomach adenocarcinoma(5;0.106)		2	737	+	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		158					B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	c.472G>A	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	g	19.22	3.784768	0.70222	.	.	ENSG00000141448	ENST00000269216	D	0.98649	-5.05	3.05	3.05	0.35203	GATA-type transcription activator, N-terminal (1);	7739.210000	0.00698	N	0.000772	D	0.97037	0.9032	L	0.39020	1.185	0.33321	D	0.567368	P	0.36909	0.573	B	0.33521	0.165	D	0.91382	0.5128	10	0.46703	T	0.11	-16.1647	13.8302	0.63375	0.0:0.0:1.0:0.0	.	158	Q92908	GATA6_HUMAN	S	158	ENSP00000269216:G158S	ENSP00000269216:G158S	G	+	1	0	GATA6	18005575	1.000000	0.71417	0.957000	0.39632	0.696000	0.40369	5.409000	0.66374	1.541000	0.49316	0.450000	0.29827	GGT		0.751	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257		6	11	0	0	0	0.021553	0	6	11				
MISP	126353	broad.mit.edu	37	19	758028	758028	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:758028G>A	ENST00000215582.6	+	2	1185	c.1082G>A	c.(1081-1083)cGt>cAt	p.R361H		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	361					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GAGACACAGCGTGAGGAAGAC	0.701																																							uc002lpo.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1081-1083)CGT>CAT		hypothetical protein LOC126353							14.0	17.0	16.0					19																	758028		2192	4291	6483	SO:0001583	missense	126353							g.chr19:758028G>A	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1082G>A	19.37:g.758028G>A	ENSP00000215582:p.Arg361His		Somatic					p.R361H	NM_173481	NP_775752	WXS	Illumina HiSeq	Unspecified	Q8IVT2	CS021_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	1165	+		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)	361						Missense_Mutation	SNP	ENST00000215582.6	37	c.1082G>A	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847938	0.71603	.	.	ENSG00000099812	ENST00000215582	T	0.80909	-1.43	4.38	4.38	0.52667	.	0.335647	0.26776	N	0.022548	D	0.86418	0.5928	L	0.52364	1.645	0.47949	D	0.999558	D	0.89917	1.0	D	0.85130	0.997	D	0.87874	0.2673	10	0.87932	D	0	-16.5499	14.4311	0.67251	0.0:0.0:1.0:0.0	.	361	Q8IVT2	CS021_HUMAN	H	361	ENSP00000215582:R361H	ENSP00000215582:R361H	R	+	2	0	C19orf21	709028	0.999000	0.42202	0.865000	0.33974	0.257000	0.26127	7.348000	0.79366	2.154000	0.67381	0.491000	0.48974	CGT		0.701	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481		5	10	0	0	0	0.014758	0	5	10				
CLEC4M	10332	broad.mit.edu	37	19	7831630	7831630	+	Missense_Mutation	SNP	C	C	A	rs199821532		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:7831630C>A	ENST00000327325.5	+	5	991	c.873C>A	c.(871-873)gaC>gaA	p.D291E	CLEC4M_ENST00000357361.2_Missense_Mutation_p.D291E|CLEC4M_ENST00000334806.5_Missense_Mutation_p.D240E|CLEC4M_ENST00000359059.5_Missense_Mutation_p.D224E|CLEC4M_ENST00000596707.1_Missense_Mutation_p.D224E|CLEC4M_ENST00000248228.4_Missense_Mutation_p.D269E|CLEC4M_ENST00000394122.2_Missense_Mutation_p.D279E|CLEC4M_ENST00000597522.1_Missense_Mutation_p.D199E|CLEC4M_ENST00000596363.1_Missense_Mutation_p.D263E|CLEC4M_ENST00000595496.1_Missense_Mutation_p.D155E	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	291	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.		D -> N (in dbSNP:rs2277998). {ECO:0000269|Ref.5}.		antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						ACTGGCACGACTCCGTCACCG	0.597																																							uc002mih.2		NA																	0				pancreas(1)	1						c.(802-804)GAC>GAA		C-type lectin domain family 4, member M isoform							99.0	90.0	93.0					19																	7831630		2203	4300	6503	SO:0001583	missense	10332				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding	g.chr19:7831630C>A	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.873C>A	19.37:g.7831630C>A	ENSP00000316228:p.Asp291Glu		Somatic				CLEC4M_uc010xjv.1_3'UTR|CLEC4M_uc002mhy.2_3'UTR|CLEC4M_uc010xjw.1_Missense_Mutation_p.D224E|CLEC4M_uc010dvt.2_Missense_Mutation_p.D245E|CLEC4M_uc010dvs.2_Missense_Mutation_p.D267E|CLEC4M_uc010xjx.1_Missense_Mutation_p.D240E|CLEC4M_uc002mhz.2_Missense_Mutation_p.D199E|CLEC4M_uc002mic.2_Missense_Mutation_p.D263E|CLEC4M_uc002mia.2_Missense_Mutation_p.D155E	p.D268E	NM_001144910	NP_001138382	WXS	Illumina HiSeq	Unspecified	Q9H2X3	CLC4M_HUMAN			6	922	+			291			Extracellular (Probable).|C-type lectin.		A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	37	c.804C>A	CCDS12187.1	.	.	.	.	.	.	.	.	.	.	C	2.520	-0.310928	0.05458	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059;ENST00000357361;ENST00000358690	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	2.57	-5.14	0.02875	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.10337	0.0253	L	0.33137	0.985	0.09310	N	1	B;B;B;B;B;B;B;B	0.34241	0.032;0.148;0.444;0.115;0.034;0.011;0.019;0.022	B;B;B;B;B;B;B;B	0.33392	0.025;0.026;0.081;0.163;0.011;0.041;0.01;0.037	T	0.17961	-1.0352	9	0.52906	T	0.07	.	5.4688	0.16658	0.0:0.2539:0.1569:0.5892	.	240;224;291;279;268;263;155;199	B4E2Z5;Q9H2X3-5;Q9H2X3;E7ENS9;Q9H2X3-8;Q9H2X3-9;Q9H2X3-7;Q9H2X3-4	.;.;CLC4M_HUMAN;.;.;.;.;.	E	291;279;269;240;224;291;235	ENSP00000316228:D291E;ENSP00000377680:D279E;ENSP00000248228:D269E;ENSP00000335228:D240E;ENSP00000351954:D224E;ENSP00000349924:D291E	ENSP00000248228:D269E	D	+	3	2	CLEC4M	7737630	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.707000	0.01893	-1.440000	0.01960	-0.265000	0.10407	GAC		0.597	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257		23	73	1	0	6.07407e-21	0.034045	7.36643e-21	23	73				
ZNF492	57615	broad.mit.edu	37	19	22847796	22847796	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:22847796T>C	ENST00000456783.2	+	4	1569	c.1325T>C	c.(1324-1326)aTt>aCt	p.I442T	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CATAAGGTAATTCATACTGGA	0.368																																							uc002nqw.3		NA																	0					0						c.(1324-1326)ATT>ACT		zinc finger protein 492							29.0	40.0	37.0					19																	22847796		2020	4207	6227	SO:0001583	missense	57615				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22847796T>C	AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1325T>C	19.37:g.22847796T>C	ENSP00000413660:p.Ile442Thr		Somatic					p.I442T	NM_020855	NP_065906	WXS	Illumina HiSeq	Unspecified	Q9P255	ZN492_HUMAN			4	1569	+		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)	442			C2H2-type 11.		Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	c.1325T>C	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	7.327	0.618071	0.14129	.	.	ENSG00000229676	ENST00000456783	T	0.16073	2.37	1.12	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16300	0.0392	N	0.16016	0.355	0.09310	N	1	P	0.49559	0.925	P	0.59012	0.85	T	0.12218	-1.0556	9	0.54805	T	0.06	.	2.9486	0.05854	0.0:0.3031:0.0:0.6969	.	442	Q9P255	ZN492_HUMAN	T	442	ENSP00000413660:I442T	ENSP00000413660:I442T	I	+	2	0	ZNF492	22639636	0.000000	0.05858	0.016000	0.15963	0.016000	0.09150	0.222000	0.17699	0.231000	0.21079	0.228000	0.17796	ATT		0.368	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855		3	98	0	0	0	0.014758	0	3	98				
ZNF536	9745	broad.mit.edu	37	19	31039823	31039823	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:31039823C>G	ENST00000355537.3	+	4	3444	c.3297C>G	c.(3295-3297)caC>caG	p.H1099Q		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1099					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGACCGGCCACGTGGACCCTG	0.542																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3295-3297)CAC>CAG		zinc finger protein 536							84.0	96.0	92.0					19																	31039823		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31039823C>G		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3297C>G	19.37:g.31039823C>G	ENSP00000347730:p.His1099Gln		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.H1099Q	p.H1099Q	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3435	+	Esophageal squamous(110;0.0834)		1099					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3297C>G	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	3.449	-0.112444	0.06881	.	.	ENSG00000198597	ENST00000355537	T	0.09073	3.02	5.63	-0.868	0.10652	.	0.214875	0.48286	D	0.000194	T	0.05502	0.0145	L	0.32530	0.975	0.31130	N	0.707816	P;P	0.43169	0.8;0.8	B;B	0.36989	0.238;0.157	T	0.21930	-1.0231	10	0.62326	D	0.03	-20.8909	8.2572	0.31763	0.0:0.6133:0.1121:0.2746	.	1099;1099	A7E228;O15090	.;ZN536_HUMAN	Q	1099	ENSP00000347730:H1099Q	ENSP00000347730:H1099Q	H	+	3	2	ZNF536	35731663	0.000000	0.05858	0.808000	0.32385	0.167000	0.22549	-0.254000	0.08781	0.054000	0.16065	-0.126000	0.14955	CAC		0.542	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		26	12	0	0	0	0.009535	0	26	12				
PRODH2	58510	broad.mit.edu	37	19	36303099	36303099	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:36303099G>A	ENST00000301175.3	-	4	692	c.675C>T	c.(673-675)ccC>ccT	p.P225P		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	225					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCCAGGCTGGGGGGCTCCA	0.672																																							uc002obx.1		NA																	0				ovary(2)	2						c.(673-675)CCC>CCT		kidney and liver proline oxidase 1							45.0	51.0	49.0					19																	36303099		2203	4298	6501	SO:0001819	synonymous_variant	58510				glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity	g.chr19:36303099G>A	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.675C>T	19.37:g.36303099G>A			Somatic					p.P225P	NM_021232	NP_067055	WXS	Illumina HiSeq	Unspecified	Q9UF12	PROD2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		4	693	-	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		225						Silent	SNP	ENST00000301175.3	37	c.675C>T	CCDS12478.1																																																																																				0.672	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232		3	81	0	0	0	0.009096	0	3	81				
XPO1	7514	broad.mit.edu	37	2	61726958	61726958	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:61726958G>A	ENST00000401558.2	-	7	1207	c.480C>T	c.(478-480)agC>agT	p.S160S	XPO1_ENST00000404992.2_Silent_p.S160S|XPO1_ENST00000406957.1_Silent_p.S160S	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	160	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGAGACTTTCGCTGGTCCTAC	0.358			Mis		CLL																																		uc002sbj.2		NA	-'	Dom	yes		2	2p15	7514		"""exportin 1 (CRM1 homolog, yeast)"""			L					0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4						c.(478-480)AGC>AGT		exportin 1							88.0	90.0	89.0					2																	61726958		2203	4300	6503	SO:0001819	synonymous_variant	7514				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding	g.chr2:61726958G>A	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.480C>T	2.37:g.61726958G>A			Somatic				XPO1_uc010fcl.2_Silent_p.S156S|XPO1_uc010ypn.1_Silent_p.S156S|XPO1_uc002sbk.2_5'UTR	p.S160S	NM_003400	NP_003391	WXS	Illumina HiSeq	Unspecified	O14980	XPO1_HUMAN	LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)		7	1208	-			160			Necessary for HTLV-1 Rex-mediated mRNA export.		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Silent	SNP	ENST00000401558.2	37	c.480C>T	CCDS33205.1																																																																																				0.358	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400		18	52	0	0	0	0.010504	0	18	52				
RGPD3	653489	broad.mit.edu	37	2	107040265	107040265	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:107040265C>T	ENST00000409886.3	-	20	4245	c.4158G>A	c.(4156-4158)caG>caA	p.Q1386Q	RGPD3_ENST00000304514.7_Silent_p.Q1386Q	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1386	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TATCATAATTCTGTAAAATCT	0.343																																							uc010ywi.1		NA																	0				ovary(1)	1						c.(4156-4158)CAG>CAA		RANBP2-like and GRIP domain containing 3							97.0	76.0	82.0					2																	107040265		692	1591	2283	SO:0001819	synonymous_variant	653489				intracellular transport		binding	g.chr2:107040265C>T		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.4158G>A	2.37:g.107040265C>T			Somatic					p.Q1386Q	NM_001144013	NP_001137485	WXS	Illumina HiSeq	Unspecified	A6NKT7	RGPD3_HUMAN			20	4215	-			1386			RanBD1 2.		B8ZZM4	Silent	SNP	ENST00000409886.3	37	c.4158G>A	CCDS46379.1																																																																																				0.343	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		23	193	0	0	0	0.030593	0	23	193				
MTX2	10651	broad.mit.edu	37	2	177191598	177191598	+	Missense_Mutation	SNP	T	T	A	rs182527218	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:177191598T>A	ENST00000249442.6	+	5	465	c.254T>A	c.(253-255)cTt>cAt	p.L85H	MTX2_ENST00000392529.2_Missense_Mutation_p.L75H|MTX2_ENST00000443241.1_Missense_Mutation_p.L29H	NM_006554.4	NP_006545.1	O75431	MTX2_HUMAN	metaxin 2	85					cellular protein metabolic process (GO:0044267)|mitochondrial transport (GO:0006839)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			GTATCAGAACTTGGTCCAATA	0.284																																							uc002ukx.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(253-255)CTT>CAT		metaxin 2							70.0	75.0	74.0					2																	177191598		2201	4282	6483	SO:0001583	missense	10651				protein targeting to mitochondrion	mitochondrial outer membrane		g.chr2:177191598T>A	AF053551	CCDS2272.1	2q31.1	2012-02-07			ENSG00000128654	ENSG00000128654			7506	protein-coding gene	gene with protein product		608555				10381257, 17624330	Standard	NM_006554		Approved		uc002ukx.3	O75431	OTTHUMG00000132514	ENST00000249442.6:c.254T>A	2.37:g.177191598T>A	ENSP00000249442:p.Leu85His		Somatic				MTX2_uc002ukw.2_Missense_Mutation_p.L75H	p.L85H	NM_006554	NP_006545	WXS	Illumina HiSeq	Unspecified	O75431	MTX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)		5	489	+			85					A8JZZ4|Q53S50|Q53SQ2|Q5M7Z6|Q8IZ68	Missense_Mutation	SNP	ENST00000249442.6	37	c.254T>A	CCDS2272.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372394	0.82573	.	.	ENSG00000128654	ENST00000249442;ENST00000392529;ENST00000443241;ENST00000452865	T;T;T;T	0.44881	2.52;2.52;0.91;2.52	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.55481	1.735	0.58432	D	0.999998	D;D	0.69078	0.986;0.997	D;D	0.64595	0.927;0.925	T	0.49523	-0.8931	10	0.15499	T	0.54	-23.1553	15.4877	0.75578	0.0:0.0:0.0:1.0	.	85;75	O75431;Q8IZ68	MTX2_HUMAN;.	H	85;75;29;85	ENSP00000249442:L85H;ENSP00000376314:L75H;ENSP00000414176:L29H;ENSP00000398757:L85H	ENSP00000249442:L85H	L	+	2	0	MTX2	176899844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.486000	0.81215	2.061000	0.61500	0.455000	0.32223	CTT		0.284	MTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255695.4	NM_006554		3	51	0	0	0	0.009096	0	3	51				
TTN	7273	broad.mit.edu	37	2	179484783	179484783	+	Missense_Mutation	SNP	A	A	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:179484783A>T	ENST00000591111.1	-	199	41662	c.41438T>A	c.(41437-41439)cTg>cAg	p.L13813Q	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L6581Q|TTN_ENST00000589042.1_Missense_Mutation_p.L15454Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L6514Q|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L12886Q|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000460472.2_Missense_Mutation_p.L6389Q|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13813	Ig-like 94.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCATCATCCAGCCTGCAATC	0.368																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(38656-38658)CTG>CAG		titin isoform N2-A							131.0	121.0	124.0					2																	179484783		1855	4117	5972	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179484783A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41438T>A	2.37:g.179484783A>T	ENSP00000465570:p.Leu13813Gln		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.L6581Q|TTN_uc010zfi.1_Missense_Mutation_p.L6514Q|TTN_uc010zfj.1_Missense_Mutation_p.L6389Q	p.L12886Q	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		198	38881	-			13813					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.38657T>A		.	.	.	.	.	.	.	.	.	.	A	12.95	2.090097	0.36855	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.73	5.73	0.89815	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78266	0.4256	L	0.35249	1.045	0.31520	N	0.662549	D;D;D;D	0.54397	0.966;0.966;0.966;0.966	P;P;P;P	0.58331	0.837;0.837;0.837;0.837	T	0.79904	-0.1606	9	0.87932	D	0	.	8.6677	0.34132	0.8579:0.0:0.1421:0.0	.	6389;6514;6581;13813	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	12886;6389;6581;6514;6389	ENSP00000343764:L12886Q;ENSP00000434586:L6389Q;ENSP00000340554:L6581Q;ENSP00000352154:L6514Q	ENSP00000340554:L6581Q	L	-	2	0	TTN	179193028	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.085000	0.64468	2.324000	0.78689	0.533000	0.62120	CTG		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	32	0	0	0	0.010729	0	10	32				
CYP27A1	1593	broad.mit.edu	37	2	219677417	219677417	+	Silent	SNP	C	C	T	rs143600636		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:219677417C>T	ENST00000258415.4	+	4	1216	c.789C>T	c.(787-789)ccC>ccT	p.P263P		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	263					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.P263P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	GGACTCGCCCCGTGCTGCCTT	0.567													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21379	0.0		0.0	False		,,,				2504	0.0						uc002viz.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(787-789)CCC>CCT		cytochrome P450, family 27, subfamily A,	Cholecalciferol(DB00169)	C		1,4405	2.1+/-5.4	0,1,2202	267.0	258.0	261.0		789	-1.0	0.1	2	dbSNP_134	261	5,8595	3.7+/-12.6	0,5,4295	no	coding-synonymous	CYP27A1	NM_000784.3		0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461		263/532	219677417	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	1593				bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding	g.chr2:219677417C>T	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.789C>T	2.37:g.219677417C>T			Somatic					p.P263P	NM_000784	NP_000775	WXS	Illumina HiSeq	Unspecified	Q02318	CP27A_HUMAN		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	4	1223	+		Renal(207;0.0474)	263					A8K303|Q6LDB4|Q86YQ6	Silent	SNP	ENST00000258415.4	37	c.789C>T	CCDS2423.1																																																																																				0.567	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4			43	308	0	0	0	0.01441	0	43	308				
AGAP1	116987	broad.mit.edu	37	2	236626271	236626271	+	Missense_Mutation	SNP	A	A	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:236626271A>T	ENST00000304032.8	+	3	873	c.293A>T	c.(292-294)cAg>cTg	p.Q98L	AGAP1_ENST00000409538.1_Missense_Mutation_p.Q363L|AGAP1_ENST00000409457.1_Missense_Mutation_p.Q98L|AGAP1_ENST00000336665.5_Missense_Mutation_p.Q98L	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	98	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						ACATATGTCCAGGAGGAGTCT	0.453																																							uc002vvs.2		NA																	0				ovary(2)|skin(1)	3						c.(292-294)CAG>CTG		centaurin, gamma 2 isoform 1							80.0	74.0	76.0					2																	236626271		2203	4300	6503	SO:0001583	missense	116987				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding	g.chr2:236626271A>T	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.293A>T	2.37:g.236626271A>T	ENSP00000307634:p.Gln98Leu		Somatic				AGAP1_uc002vvt.2_Missense_Mutation_p.Q98L	p.Q98L	NM_001037131	NP_001032208	WXS	Illumina HiSeq	Unspecified	Q9UPQ3	AGAP1_HUMAN			3	888	+			98			Small GTPase-like.		B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	c.293A>T	CCDS33408.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.296204	0.60086	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000402604;ENST00000409538	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.2	5.2	0.72013	Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	T	0.78817	0.4343	M	0.66378	2.025	0.80722	D	1	P;D	0.55385	0.942;0.971	B;D	0.63957	0.35;0.92	T	0.80181	-0.1489	10	0.52906	T	0.07	.	15.4022	0.74849	1.0:0.0:0.0:0.0	.	98;98	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	L	98;98;98;45;363	ENSP00000387174:Q98L;ENSP00000307634:Q98L;ENSP00000338378:Q98L;ENSP00000385492:Q45L;ENSP00000386897:Q363L	ENSP00000307634:Q98L	Q	+	2	0	AGAP1	236291010	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	9.167000	0.94773	2.099000	0.63709	0.533000	0.62120	CAG		0.453	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914		22	35	0	0	0	0.021523	0	22	35				
TMPRSS3	64699	broad.mit.edu	37	21	43803247	43803247	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr21:43803247G>A	ENST00000291532.3	-	8	1632	c.677C>T	c.(676-678)tCg>tTg	p.S226L	TMPRSS3_ENST00000398397.3_Missense_Mutation_p.S226L|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.S226L|TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.S310L|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.S224L	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						GGGCCACTGCGAGAGCAAGGA	0.597																																							uc002zbb.2		NA																	0				ovary(2)|breast(1)	3						c.(676-678)TCG>TTG		transmembrane protease, serine 3 isoform 1							104.0	84.0	91.0					21																	43803247		2203	4300	6503	SO:0001583	missense	64699				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity	g.chr21:43803247G>A	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.677C>T	21.37:g.43803247G>A	ENSP00000291532:p.Ser226Leu		Somatic				TMPRSS3_uc002zay.2_5'UTR|TMPRSS3_uc002zaz.2_Missense_Mutation_p.S99L|TMPRSS3_uc002zba.2_Missense_Mutation_p.S99L|TMPRSS3_uc002zbc.2_Missense_Mutation_p.S226L|TMPRSS3_uc002zbd.2_Missense_Mutation_p.S226L	p.S226L	NM_024022	NP_076927	WXS	Illumina HiSeq	Unspecified	P57727	TMPS3_HUMAN			8	878	-			226			Peptidase S1.|Extracellular (Potential).		D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	c.677C>T	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	G	9.869	1.198519	0.22037	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	T;D;D;T;D	0.81996	0.14;-1.56;-1.56;0.14;-1.56	5.38	1.62	0.23740	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.845761	0.10453	N	0.672809	T	0.61148	0.2324	N	0.11064	0.09	0.09310	N	1	B;B;B	0.12630	0.006;0.0;0.002	B;B;B	0.08055	0.003;0.001;0.003	T	0.45279	-0.9272	9	.	.	.	.	1.2875	0.02053	0.2114:0.3574:0.2331:0.1982	.	226;226;226	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	L	226;226;224;310;226	ENSP00000291532:S226L;ENSP00000411013:S226L;ENSP00000381442:S224L;ENSP00000369762:S310L;ENSP00000381434:S226L	.	S	-	2	0	TMPRSS3	42676316	0.000000	0.05858	0.000000	0.03702	0.227000	0.25037	0.905000	0.28504	0.473000	0.27368	0.591000	0.81541	TCG		0.597	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1			7	26	0	0	0	0.006214	0	7	26				
CBS	875	broad.mit.edu	37	21	44479397	44479397	+	Missense_Mutation	SNP	C	C	T	rs375513996		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr21:44479397C>T	ENST00000398165.3	-	13	1421	c.1162G>A	c.(1162-1164)Gac>Aac	p.D388N	CBS_ENST00000359624.3_Missense_Mutation_p.D388N|CBS_ENST00000352178.5_Missense_Mutation_p.D388N|CBS_ENST00000398168.1_Missense_Mutation_p.D388N|CBS_ENST00000544202.1_Missense_Mutation_p.D300N|CBS_ENST00000398158.1_Missense_Mutation_p.D388N	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	388					cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	ATCCACCTGTCGCTCAGGAAC	0.687																																							uc002zcu.2		NA																	0					0						c.(1162-1164)GAC>AAC		cystathionine-beta-synthase	L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	C	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	63.0	63.0	63.0		1162,1162,1162	4.7	0.8	21		63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	CBS	NM_000071.2,NM_001178008.1,NM_001178009.1	23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	388/552,388/552,388/552	44479397	1,13005	2203	4300	6503	SO:0001583	missense	875				cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding	g.chr21:44479397C>T	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.1162G>A	21.37:g.44479397C>T	ENSP00000381231:p.Asp388Asn		Somatic				CBS_uc002zcs.1_Missense_Mutation_p.D283N|CBS_uc002zct.2_Missense_Mutation_p.D388N|CBS_uc002zcw.3_Missense_Mutation_p.D388N|CBS_uc002zcv.2_Missense_Mutation_p.D388N|CBS_uc002zcx.2_Missense_Mutation_p.D7N	p.D388N	NM_000071	NP_000062	WXS	Illumina HiSeq	Unspecified	P35520	CBS_HUMAN			13	1407	-			388					B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	ENST00000398165.3	37	c.1162G>A	CCDS13693.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202432	0.58234	0.0	1.16E-4	ENSG00000160200	ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202	D;D;D;D;D;D	0.99239	-5.61;-5.61;-5.61;-5.61;-5.61;-5.61	4.74	4.74	0.60224	Pyridoxal phosphate-dependent enzyme, beta subunit (1);	0.057170	0.64402	D	0.000002	D	0.98804	0.9597	M	0.90252	3.1	0.80722	D	1	B;B;B	0.27951	0.195;0.173;0.173	B;B;B	0.26693	0.072;0.036;0.036	D	0.99926	1.1289	10	0.72032	D	0.01	-37.5686	15.5464	0.76104	0.0:1.0:0.0:0.0	.	388;388;345	P35520-2;P35520;B7Z2D6	.;CBS_HUMAN;.	N	388;388;388;388;388;345;300	ENSP00000381225:D388N;ENSP00000381231:D388N;ENSP00000352643:D388N;ENSP00000344460:D388N;ENSP00000381234:D388N;ENSP00000439332:D300N	ENSP00000344460:D388N	D	-	1	0	CBS	43352466	1.000000	0.71417	0.775000	0.31657	0.344000	0.29017	5.603000	0.67619	2.197000	0.70478	0.563000	0.77884	GAC		0.687	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071		17	29	0	0	0	0.010504	0	17	29				
TRIOBP	11078	broad.mit.edu	37	22	38150920	38150920	+	Nonsense_Mutation	SNP	C	C	T	rs142929031		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr22:38150920C>T	ENST00000406386.3	+	13	5671	c.5416C>T	c.(5416-5418)Cag>Tag	p.Q1806*	TRIOBP_ENST00000407319.2_Nonsense_Mutation_p.Q93*|TRIOBP_ENST00000403663.2_Nonsense_Mutation_p.Q93*	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1806	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CTCTACTTCGCAGTGGAAGAA	0.527																																							uc003atr.2		NA																	0				central_nervous_system(1)	1						c.(5416-5418)CAG>TAG		TRIO and F-actin binding protein isoform 6							166.0	126.0	139.0					22																	38150920		2203	4300	6503	SO:0001587	stop_gained	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38150920C>T	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5416C>T	22.37:g.38150920C>T	ENSP00000384312:p.Gln1806*		Somatic				TRIOBP_uc003atu.2_Nonsense_Mutation_p.Q1634*|TRIOBP_uc003atv.2_Nonsense_Mutation_p.Q93*|TRIOBP_uc003atw.2_Nonsense_Mutation_p.Q93*|TRIOBP_uc003atx.1_5'Flank|TRIOBP_uc010gxh.2_5'Flank	p.Q1806*	NM_001039141	NP_001034230	WXS	Illumina HiSeq	Unspecified	Q9H2D6	TARA_HUMAN			13	5687	+	Melanoma(58;0.0574)		1806			PH.		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Nonsense_Mutation	SNP	ENST00000406386.3	37	c.5416C>T	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829658	0.71258	.	.	ENSG00000100106	ENST00000406386;ENST00000407319;ENST00000403663;ENST00000418339;ENST00000452519;ENST00000417857	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.2712	0.90069	0.0:1.0:0.0:0.0	.	.	.	.	X	1806;93;93;52;22;22	.	ENSP00000386026:Q93X	Q	+	1	0	TRIOBP	36480866	0.985000	0.35326	0.931000	0.37212	0.477000	0.33069	2.644000	0.46613	2.294000	0.77228	0.655000	0.94253	CAG		0.527	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			5	21	0	0	0	0.02938	0	5	21				
ATP2B2	491	broad.mit.edu	37	3	10491052	10491052	+	Missense_Mutation	SNP	C	C	T	rs149328739		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:10491052C>T	ENST00000352432.4	-	1	245	c.176G>A	c.(175-177)cGc>cAc	p.R59H	ATP2B2_ENST00000383800.4_Missense_Mutation_p.R59H|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R59H|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R59H|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R59H			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	59					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GGTTTTGAGGCGCCGGCAGAT	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		16792	0.0		0.0	False		,,,				2504	0.001				Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0		p.R59C(1)		ovary(3)|skin(2)|central_nervous_system(1)	6						c.(175-177)CGC>CAC		plasma membrane calcium ATPase 2 isoform 1		C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	67.0	69.0		176,176	4.9	1.0	3	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ATP2B2	NM_001001331.2,NM_001683.3	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	59/1244,59/1199	10491052	2,13004	2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10491052C>T	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.176G>A	3.37:g.10491052C>T	ENSP00000324172:p.Arg59His		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.R59H|ATP2B2_uc003bvw.2_Missense_Mutation_p.R59H|ATP2B2_uc010hdp.2_Missense_Mutation_p.R59H	p.R59H	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			2	615	-			59			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.176G>A	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.744985	0.69418	2.27E-4	1.16E-4	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000342354	T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32	4.9	4.9	0.64082	ATPase, P-type cation-transporter, N-terminal (2);	0.071490	0.56097	D	0.000023	T	0.80088	0.4559	M	0.67953	2.075	0.80722	D	1	B;B;B	0.27286	0.002;0.03;0.174	B;B;B	0.29524	0.003;0.021;0.103	T	0.79685	-0.1700	10	0.54805	T	0.06	-24.0908	15.5665	0.76298	0.0:1.0:0.0:0.0	.	59;71;59	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	H	59;59;59;59;59;25;59	ENSP00000324172:R59H;ENSP00000373311:R59H;ENSP00000380267:R59H;ENSP00000353414:R59H;ENSP00000344677:R59H	ENSP00000342954:R59H	R	-	2	0	ATP2B2	10466052	0.948000	0.32251	1.000000	0.80357	0.987000	0.75469	1.600000	0.36762	2.275000	0.75901	0.462000	0.41574	CGC		0.562	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		4	37	0	0	0	0.009096	0	4	37				
EAF1	85403	broad.mit.edu	37	3	15473685	15473685	+	Missense_Mutation	SNP	A	A	G	rs17857248		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:15473685A>G	ENST00000396842.2	+	3	715	c.290A>G	c.(289-291)tAt>tGt	p.Y97C	EAF1_ENST00000432764.2_Intron|RNU6-1024P_ENST00000384199.1_RNA	NM_033083.6	NP_149074.3	Q96JC9	EAF1_HUMAN	ELL associated factor 1	97				Y -> F (in Ref. 4; AAH41329). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ELL-EAF complex (GO:0032783)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	7						ACTGGTGAATATGTGCTGGAA	0.418																																							uc003bzu.2		NA																	0				central_nervous_system(1)	1						c.(289-291)TAT>TGT		ELL associated factor 1							145.0	133.0	137.0					3																	15473685		2203	4300	6503	SO:0001583	missense	85403				regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cajal body|nuclear speck	protein binding	g.chr3:15473685A>G	AF272973	CCDS2626.1	3p25.1	2011-06-10			ENSG00000144597	ENSG00000144597			20907	protein-coding gene	gene with protein product		608315				11418481	Standard	NM_033083		Approved		uc003bzu.3	Q96JC9	OTTHUMG00000162544	ENST00000396842.2:c.290A>G	3.37:g.15473685A>G	ENSP00000380054:p.Tyr97Cys		Somatic				EAF1_uc011avq.1_Intron	p.Y97C	NM_033083	NP_149074	WXS	Illumina HiSeq	Unspecified	Q96JC9	EAF1_HUMAN			3	513	+			97	Y -> F (in Ref. 2; AAH41329).				B4E3F5|Q8IW10	Missense_Mutation	SNP	ENST00000396842.2	37	c.290A>G	CCDS2626.1	.	.	.	.	.	.	.	.	.	.	A	9.435	1.086537	0.20390	.	.	ENSG00000144597	ENST00000396842	.	.	.	6.17	5.02	0.67125	Transcription elognation factor  Eaf, N-terminal (1);	0.098563	0.64402	D	0.000001	T	0.35856	0.0946	N	0.04880	-0.145	0.80722	D	1	B	0.14805	0.011	B	0.17433	0.018	T	0.11227	-1.0596	9	0.30078	T	0.28	-6.2872	12.0091	0.53276	0.9326:0.0:0.0674:0.0	.	97	Q96JC9	EAF1_HUMAN	C	97	.	ENSP00000380054:Y97C	Y	+	2	0	EAF1	15448689	1.000000	0.71417	0.534000	0.28014	0.776000	0.43924	5.521000	0.67086	1.161000	0.42604	-0.250000	0.11733	TAT		0.418	EAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252100.4	NM_033083		60	80	0	0	0	0.01441	0	60	80				
RAD54L2	23132	broad.mit.edu	37	3	51671500	51671500	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:51671500C>T	ENST00000409535.2	+	10	1788	c.1663C>T	c.(1663-1665)Ctg>Ttg	p.L555L	RAD54L2_ENST00000296477.3_Silent_p.L249L	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	555						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GCACAGTCTTCTGGAGGGCTT	0.542																																							uc011bdt.1		NA																	0				ovary(3)	3						c.(1663-1665)CTG>TTG		RAD54-like 2							42.0	33.0	36.0					3																	51671500		2203	4300	6503	SO:0001819	synonymous_variant	23132					nucleus	ATP binding|DNA binding|helicase activity	g.chr3:51671500C>T	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.1663C>T	3.37:g.51671500C>T			Somatic				RAD54L2_uc003dbh.2_Silent_p.L146L|RAD54L2_uc011bdu.1_Silent_p.L249L|RAD54L2_uc003dbj.2_5'UTR	p.L555L	NM_015106	NP_055921	WXS	Illumina HiSeq	Unspecified	Q9Y4B4	ARIP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)	10	1788	+			555			LXXLL motif 1.		Q8TB57|Q9BV54	Silent	SNP	ENST00000409535.2	37	c.1663C>T	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	C	7.807	0.714810	0.15306	.	.	ENSG00000164080	ENST00000432863	.	.	.	5.36	3.54	0.40534	.	.	.	.	.	T	0.60444	0.2269	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57911	-0.7729	4	.	.	.	-8.0613	10.6682	0.45743	0.0:0.8438:0.0:0.1562	.	.	.	.	F	383	.	.	S	+	2	0	RAD54L2	51646540	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	1.352000	0.34033	1.252000	0.44001	0.561000	0.74099	TCT		0.542	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106		13	16	0	0	0	0.024245	0	13	16				
FAM19A1	407738	broad.mit.edu	37	3	68055862	68055862	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:68055862C>A	ENST00000478136.1	+	2	583	c.93C>A	c.(91-93)ttC>ttA	p.F31L	FAM19A1_ENST00000496687.1_Missense_Mutation_p.F31L	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1	31						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)		p.F31F(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		AGCACACTTTCCAGCAGCATC	0.498																																							uc003dnd.2		NA																	2	Substitution - coding silent(2)		endometrium(2)	ovary(1)	1						c.(91-93)TTC>TTA		family with sequence similarity 19 (chemokine							187.0	182.0	184.0					3																	68055862		2098	4225	6323	SO:0001583	missense	407738					endoplasmic reticulum|extracellular region		g.chr3:68055862C>A	AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.93C>A	3.37:g.68055862C>A	ENSP00000418575:p.Phe31Leu		Somatic				FAM19A1_uc003dne.2_Missense_Mutation_p.F31L|FAM19A1_uc003dng.2_Missense_Mutation_p.F31L|FAM19A1_uc003dnf.1_RNA	p.F31L	NM_213609	NP_998774	WXS	Illumina HiSeq	Unspecified	Q7Z5A9	F19A1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)	2	309	+		Lung NSC(201;0.0117)	31					A8K0V3|Q8TCL8	Missense_Mutation	SNP	ENST00000478136.1	37	c.93C>A	CCDS54606.1	.	.	.	.	.	.	.	.	.	.	.	10.95	1.496654	0.26861	.	.	ENSG00000183662	ENST00000478136;ENST00000496687	.	.	.	6.17	4.4	0.53042	.	0.253457	0.32578	N	0.005906	T	0.37489	0.1005	N	0.14661	0.345	0.38630	D	0.951341	B	0.11235	0.004	B	0.08055	0.003	T	0.18903	-1.0322	9	0.10902	T	0.67	.	13.3342	0.60507	0.0:0.8724:0.0:0.1276	.	31	Q7Z5A9	F19A1_HUMAN	L	31	.	ENSP00000418575:F31L	F	+	3	2	FAM19A1	68138552	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.626000	0.37039	0.943000	0.37553	-0.150000	0.13652	TTC		0.498	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352004.1	NM_213609		52	100	1	0	3.36121e-32	0.01441	4.16497e-32	52	100				
SEC22A	26984	broad.mit.edu	37	3	122964752	122964752	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:122964752A>G	ENST00000309934.4	+	4	1444	c.548A>G	c.(547-549)cAg>cGg	p.Q183R	SEC22A_ENST00000492595.1_Missense_Mutation_p.Q183R|SEC22A_ENST00000481965.2_Intron	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	183					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		CCAGCTCACCAGCGACTGGAA	0.373																																							uc003ege.2		NA																	0				ovary(1)	1						c.(547-549)CAG>CGG		SEC22 vesicle trafficking protein homolog A							181.0	187.0	185.0					3																	122964752		2203	4300	6503	SO:0001583	missense	26984				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity	g.chr3:122964752A>G	AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.548A>G	3.37:g.122964752A>G	ENSP00000310521:p.Gln183Arg		Somatic				SEC22A_uc003egf.2_Missense_Mutation_p.Q183R	p.Q183R	NM_012430	NP_036562	WXS	Illumina HiSeq	Unspecified	Q96IW7	SC22A_HUMAN		GBM - Glioblastoma multiforme(114;0.0548)	5	627	+			183			Cytoplasmic (Potential).		B2RE26|Q9Y682	Missense_Mutation	SNP	ENST00000309934.4	37	c.548A>G	CCDS3021.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.491643	0.26774	.	.	ENSG00000121542	ENST00000492595;ENST00000473494;ENST00000487572;ENST00000309934	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.03	3.86	0.44501	.	0.171254	0.52532	D	0.000062	T	0.12774	0.0310	L	0.36672	1.1	0.45139	D	0.998156	B	0.19331	0.035	B	0.11329	0.006	T	0.09100	-1.0690	10	0.23302	T	0.38	-11.8788	10.011	0.41986	0.8494:0.0:0.0:0.1506	.	183	Q96IW7	SC22A_HUMAN	R	183	ENSP00000417972:Q183R;ENSP00000420343:Q183R;ENSP00000420015:Q183R;ENSP00000310521:Q183R	ENSP00000310521:Q183R	Q	+	2	0	SEC22A	124447442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.059000	0.64306	1.021000	0.39600	0.533000	0.62120	CAG		0.373	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355770.2	NM_012430		68	126	0	0	0	0.01441	0	68	126				
ARMC8	25852	broad.mit.edu	37	3	137942330	137942330	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:137942330C>T	ENST00000469044.1	+	4	565	c.294C>T	c.(292-294)gtC>gtT	p.V98V	ARMC8_ENST00000461822.1_Silent_p.V98V|ARMC8_ENST00000485396.1_Silent_p.V56V|ARMC8_ENST00000489213.1_Silent_p.V56V|ARMC8_ENST00000481646.1_Silent_p.V84V|ARMC8_ENST00000393058.3_Silent_p.V88V|ARMC8_ENST00000538260.1_Silent_p.V98V|ARMC8_ENST00000491704.1_Silent_p.V56V|ARMC8_ENST00000358441.2_Silent_p.V84V|ARMC8_ENST00000471453.1_Silent_p.V84V|ARMC8_ENST00000470821.1_Silent_p.V98V	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	98										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						AAAACAATGTCAAGTCTCTAC	0.418																																							uc003esa.1		NA																	0					0						c.(250-252)GTC>GTT		armadillo repeat containing 8 isoform 2							131.0	121.0	124.0					3																	137942330		2203	4300	6503	SO:0001819	synonymous_variant	25852						binding	g.chr3:137942330C>T		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.294C>T	3.37:g.137942330C>T			Somatic				ARMC8_uc003erw.2_Silent_p.V84V|ARMC8_uc003erx.2_Silent_p.V84V|ARMC8_uc003ery.2_Silent_p.V56V|ARMC8_uc003erz.2_Silent_p.V56V|ARMC8_uc011bmf.1_Silent_p.V98V|ARMC8_uc011bmg.1_Silent_p.V98V|ARMC8_uc011bmh.1_Silent_p.V56V|ARMC8_uc003esb.1_Silent_p.V56V	p.V84V	NM_015396	NP_056211	WXS	Illumina HiSeq	Unspecified	Q8IUR7	ARMC8_HUMAN			5	619	+			98			ARM 2.		A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	ENST00000469044.1	37	c.252C>T																																																																																					0.418	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396		17	99	0	0	0	0.006122	0	17	99				
XRN1	54464	broad.mit.edu	37	3	142116274	142116274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:142116274G>A	ENST00000264951.4	-	20	2353	c.2236C>T	c.(2236-2238)Cag>Tag	p.Q746*	XRN1_ENST00000392981.2_Nonsense_Mutation_p.Q746*	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	746					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TAAAGCTTCTGTGTTCCTGGA	0.353																																							uc003eus.2		NA																	0				ovary(3)	3						c.(2236-2238)CAG>TAG		5'-3' exoribonuclease 1 isoform a							90.0	85.0	87.0					3																	142116274		2203	4300	6503	SO:0001587	stop_gained	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142116274G>A	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2236C>T	3.37:g.142116274G>A	ENSP00000264951:p.Gln746*		Somatic				XRN1_uc010huu.2_Nonsense_Mutation_p.Q212*|XRN1_uc003eut.2_Nonsense_Mutation_p.Q746*|XRN1_uc003euu.2_Nonsense_Mutation_p.Q746*|XRN1_uc003euv.1_Nonsense_Mutation_p.Q607*	p.Q746*	NM_019001	NP_061874	WXS	Illumina HiSeq	Unspecified	Q8IZH2	XRN1_HUMAN			20	2303	-			746					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Nonsense_Mutation	SNP	ENST00000264951.4	37	c.2236C>T	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	34	5.338992	0.95783	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-9.0907	19.2197	0.93791	0.0:0.0:1.0:0.0	.	.	.	.	X	746	.	ENSP00000264951:Q746X	Q	-	1	0	XRN1	143598964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.077000	0.89505	2.556000	0.86216	0.591000	0.81541	CAG		0.353	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		6	30	0	0	0	0.00308	0	6	30				
TRIM59	286827	broad.mit.edu	37	3	160155919	160155919	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:160155919G>A	ENST00000309784.4	-	3	1238	c.1053C>T	c.(1051-1053)caC>caT	p.H351H	RP11-432B6.3_ENST00000483754.1_Intron|TRIM59_ENST00000543469.1_Intron	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	351					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGGTTATGATGTGTTGGTTGA	0.284																																							uc003fdm.2		NA																	0					0						c.(1051-1053)CAC>CAT		tripartite motif-containing 59							60.0	62.0	61.0					3																	160155919		2201	4298	6499	SO:0001819	synonymous_variant	286827					integral to membrane|intracellular	zinc ion binding	g.chr3:160155919G>A	AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.1053C>T	3.37:g.160155919G>A			Somatic				IFT80_uc003fda.2_Intron	p.H351H	NM_173084	NP_775107	WXS	Illumina HiSeq	Unspecified	Q8IWR1	TRI59_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		3	1248	-			351					A8K5G9|D3DNL9	Silent	SNP	ENST00000309784.4	37	c.1053C>T	CCDS3190.1																																																																																				0.284	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1	NM_173084		16	26	0	0	0	0.006122	0	16	26				
USP13	8975	broad.mit.edu	37	3	179478937	179478937	+	Silent	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:179478937C>G	ENST00000263966.3	+	17	2457	c.1986C>G	c.(1984-1986)gcC>gcG	p.A662A	USP13_ENST00000496897.1_Silent_p.A597A	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	662	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.A662A(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TGCAGCTGGCCGAGATGGGTT	0.498																																							uc003fkh.2		NA																	1	Substitution - coding silent(1)	p.A662A(1)	ovary(1)	ovary(1)	1						c.(1984-1986)GCC>GCG		ubiquitin thiolesterase 13							140.0	131.0	134.0					3																	179478937		2203	4300	6503	SO:0001819	synonymous_variant	8975				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:179478937C>G	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1986C>G	3.37:g.179478937C>G			Somatic					p.A662A	NM_003940	NP_003931	WXS	Illumina HiSeq	Unspecified	Q92995	UBP13_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)		17	2067	+	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		662			UBA 1.		A8K2S3|B4DYF3|D3DNS2|Q96B25	Silent	SNP	ENST00000263966.3	37	c.1986C>G	CCDS3235.1																																																																																				0.498	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1			11	147	0	0	0	0.020292	0	11	147				
ECE2	9718	broad.mit.edu	37	3	184009886	184009886	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:184009886G>A	ENST00000402825.3	+	19	2512	c.2512G>A	c.(2512-2514)Gag>Aag	p.E838K	ECE2_ENST00000404464.3_Missense_Mutation_p.E720K|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.E691K|ECE2_ENST00000357474.5_Missense_Mutation_p.E766K	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	838	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAGCTCTCACGAGGGGCTGGT	0.667																																							uc003fni.3		NA																	0				ovary(2)|skin(2)	4						c.(2512-2514)GAG>AAG		endothelin converting enzyme 2 isoform A							37.0	39.0	39.0					3																	184009886		2203	4300	6503	SO:0001583	missense	9718				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity	g.chr3:184009886G>A	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2512G>A	3.37:g.184009886G>A	ENSP00000384223:p.Glu838Lys		Somatic				ECE2_uc003fnl.3_Missense_Mutation_p.E766K|ECE2_uc003fnm.3_Missense_Mutation_p.E720K|ECE2_uc003fnk.3_Missense_Mutation_p.E691K	p.E838K	NM_014693	NP_055508	WXS	Illumina HiSeq	Unspecified	O60344	ECE2_HUMAN	Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		19	2550	+	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		838			Lumenal (Potential).|Endothelin-converting enzyme 2 region.		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	c.2512G>A	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319069	0.81469	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474	D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6	5.38	5.38	0.77491	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90724	0.7089	L	0.41356	1.27	0.80722	D	1	P;D;D;D	0.89917	0.783;1.0;0.985;0.999	B;D;P;P	0.87578	0.1;0.998;0.752;0.849	D	0.86507	0.1807	10	0.08599	T	0.76	-27.7151	16.6245	0.84952	0.0:0.0:1.0:0.0	.	720;766;691;838	O60344-2;O60344-5;O60344-3;O60344	.;.;.;ECE2_HUMAN	K	838;691;720;766	ENSP00000384223:E838K;ENSP00000352052:E691K;ENSP00000385846:E720K;ENSP00000350066:E766K	ENSP00000350066:E766K	E	+	1	0	ECE2	185492580	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.793000	0.99091	2.515000	0.84797	0.491000	0.48974	GAG		0.667	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693		12	56	0	0	0	0.013537	0	12	56				
MB21D2	151963	broad.mit.edu	37	3	192516439	192516440	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:192516439_192516440GC>AT	ENST00000392452.2	-	2	1531_1532	c.1211_1212GC>AT	c.(1210-1212)cGC>cAT	p.R404H		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	404							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						CCGGGTCTGAGCGCACAGAGGA	0.574																																							uc011bsp.1		NA																	0					0						c.(1210-1212)CGC>CAT		hypothetical protein LOC151963																																				SO:0001583	missense	151963							g.chr3:192516439_192516440GC>AT	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.1211_1212delinsAT	3.37:g.192516439_192516440delinsAT	ENSP00000376246:p.Arg404His		Somatic					p.R404H	NM_178496	NP_848591	WXS	Illumina HiSeq	Unspecified	Q8IYB1	M21D2_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)	2	1532_1533	-	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		404					Q86VD8	Missense_Mutation	DNP	ENST00000392452.2	37	c.1211_1212GC>AT	CCDS3302.2																																																																																				0.574	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496		5	38	0	0	0	0.004672	0	5	38				
ATP13A4	84239	broad.mit.edu	37	3	193182868	193182868	+	Missense_Mutation	SNP	G	G	A	rs148750067		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:193182868G>A	ENST00000342695.4	-	12	1644	c.1322C>T	c.(1321-1323)gCg>gTg	p.A441V	ATP13A4_ENST00000392443.3_Missense_Mutation_p.A422V|ATP13A4_ENST00000295548.3_Missense_Mutation_p.A441V	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	441						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CGGAGGAACCGCAATTGTGAT	0.507																																							uc003ftd.2		NA																	0				ovary(2)	2						c.(1321-1323)GCG>GTG		ATPase type 13A4		G	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	100.0	93.0	95.0		1322	6.1	0.7	3	dbSNP_134	95	0,8600		0,0,4300	yes	missense	ATP13A4	NM_032279.2	64	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	441/1197	193182868	2,13004	2203	4300	6503	SO:0001583	missense	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193182868G>A	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1322C>T	3.37:g.193182868G>A	ENSP00000339182:p.Ala441Val		Somatic				ATP13A4_uc003fte.1_Missense_Mutation_p.A441V|ATP13A4_uc011bsr.1_5'UTR|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Missense_Mutation_p.A147V	p.A441V	NM_032279	NP_115655	WXS	Illumina HiSeq	Unspecified	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	12	1430	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		441			Helical; (Potential).		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	c.1322C>T	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593280	0.66219	4.54E-4	0.0	ENSG00000127249	ENST00000392443;ENST00000342695;ENST00000295548	T;D;D	0.92149	-0.85;-2.98;-2.98	6.05	6.05	0.98169	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000001	D	0.88862	0.6552	L	0.28014	0.82	0.49389	D	0.999788	D;D;D	0.58970	0.957;0.984;0.966	P;P;P	0.49561	0.481;0.481;0.615	D	0.84903	0.0843	10	0.02654	T	1	-3.8281	19.5894	0.95501	0.0:0.0:1.0:0.0	.	441;441;441	Q4VNC1-3;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	V	422;441;441	ENSP00000376238:A422V;ENSP00000339182:A441V;ENSP00000295548:A441V	ENSP00000295548:A441V	A	-	2	0	ATP13A4	194665562	1.000000	0.71417	0.744000	0.31058	0.613000	0.37349	6.640000	0.74319	2.878000	0.98634	0.650000	0.86243	GCG		0.507	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		28	28	0	0	0	0.015359	0	28	28				
ARAP2	116984	broad.mit.edu	37	4	36149176	36149176	+	Nonsense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:36149176C>A	ENST00000303965.4	-	18	3682	c.3193G>T	c.(3193-3195)Gag>Tag	p.E1065*		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1065	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTACTTAGCTCTTGCAGTCTT	0.388																																							uc003gsq.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3193-3195)GAG>TAG		ArfGAP with RhoGAP domain, ankyrin repeat and PH							78.0	80.0	79.0					4																	36149176		2203	4299	6502	SO:0001587	stop_gained	116984				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding	g.chr4:36149176C>A	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3193G>T	4.37:g.36149176C>A	ENSP00000302895:p.Glu1065*		Somatic					p.E1065*	NM_015230	NP_056045	WXS	Illumina HiSeq	Unspecified	Q8WZ64	ARAP2_HUMAN			18	3531	-			1065			PH 4.		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Nonsense_Mutation	SNP	ENST00000303965.4	37	c.3193G>T	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	45	12.025733	0.99628	.	.	ENSG00000047365	ENST00000303965	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.5309	0.95228	0.0:1.0:0.0:0.0	.	.	.	.	X	1065	.	ENSP00000302895:E1065X	E	-	1	0	ARAP2	35825571	1.000000	0.71417	0.999000	0.59377	0.873000	0.50193	6.467000	0.73547	2.636000	0.89361	0.650000	0.86243	GAG		0.388	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230		12	27	1	0	3.27435e-08	0.020292	3.80894e-08	12	27				
UGT2B28	54490	broad.mit.edu	37	4	70152481	70152481	+	Silent	SNP	A	A	G	rs141618560	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:70152481A>G	ENST00000335568.5	+	3	884	c.882A>G	c.(880-882)gaA>gaG	p.E294E	UGT2B28_ENST00000511240.1_Silent_p.E294E	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	294					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.E294E(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AAATGGAGGAATTTGTACAGA	0.393													a|||	49	0.00978435	0.0159	0.0043	5008	,	,		10804	0.004		0.005	False		,,,				2504	0.0164						uc003hej.2		NA																	1	Substitution - coding silent(1)		kidney(1)	skin(1)	1						c.(880-882)GAA>GAG		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)	G	,	12,4124		0,12,2056	125.0	143.0	138.0		882,882	-1.6	0.9	4	dbSNP_134	138	9,8499		0,9,4245	no	coding-synonymous,coding-synonymous	UGT2B28	NM_001207004.1,NM_053039.1	,	0,21,6301	GG,GA,AA		0.1058,0.2901,0.1661	,	294/336,294/530	70152481	21,12623	2068	4254	6322	SO:0001819	synonymous_variant	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70152481A>G	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.882A>G	4.37:g.70152481A>G			Somatic				UGT2B28_uc010ihr.2_Silent_p.E294E	p.E294E	NM_053039	NP_444267	WXS	Illumina HiSeq	Unspecified	Q9BY64	UDB28_HUMAN			3	884	+			294					B5BUM0|Q9BY62|Q9BY63	Silent	SNP	ENST00000335568.5	37	c.882A>G	CCDS3528.1																																																																																				0.393	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039		4	103	0	0	0	0.021553	0	4	103				
GC	2638	broad.mit.edu	37	4	72634047	72634047	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:72634047C>T	ENST00000273951.8	-	3	575	c.232G>A	c.(232-234)Ggg>Agg	p.G78R	GC_ENST00000513476.1_Missense_Mutation_p.G78R|GC_ENST00000504199.1_Missense_Mutation_p.G97R|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	78	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	GGGTCAGCCCCTTCCGCACAG	0.527																																							uc003hge.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(232-234)GGG>AGG		vitamin D-binding protein precursor	Cholecalciferol(DB00169)						55.0	48.0	50.0					4																	72634047		2203	4300	6503	SO:0001583	missense	2638				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity	g.chr4:72634047C>T	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.232G>A	4.37:g.72634047C>T	ENSP00000273951:p.Gly78Arg		Somatic				GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Missense_Mutation_p.G78R|GC_uc010iif.2_Missense_Mutation_p.G97R	p.G78R	NM_000583	NP_000574	WXS	Illumina HiSeq	Unspecified	P02774	VTDB_HUMAN	Lung(101;0.148)		3	385	-		all_hematologic(202;0.107)	78			Albumin 1.		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	ENST00000273951.8	37	c.232G>A	CCDS3550.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258186	0.39896	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476;ENST00000506245	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	5.92	3.87	0.44632	.	0.363223	0.28273	N	0.015945	T	0.79764	0.4502	L	0.60455	1.87	0.09310	N	1	D;D	0.59767	0.986;0.984	P;P	0.58391	0.771;0.838	T	0.71735	-0.4503	10	0.66056	D	0.02	.	11.8103	0.52179	0.126:0.8002:0.0:0.0738	.	97;78	D6RAK8;D6RF35	.;.	R	78;97;78;78	ENSP00000273951:G78R;ENSP00000421725:G97R;ENSP00000426683:G78R;ENSP00000426718:G78R	ENSP00000273951:G78R	G	-	1	0	GC	72852911	0.071000	0.21146	0.101000	0.21167	0.125000	0.20455	3.968000	0.56809	1.493000	0.48517	-0.518000	0.04402	GGG		0.527	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2			4	33	0	0	0	0.009096	0	4	33				
ADCY2	108	broad.mit.edu	37	5	7757636	7757636	+	Nonsense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:7757636G>A	ENST00000338316.4	+	16	2120	c.2031G>A	c.(2029-2031)tgG>tgA	p.W677*	ADCY2_ENST00000537121.1_Nonsense_Mutation_p.W497*	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	677					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACCGCCCCTGGCCACGGATCT	0.507																																							uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(2029-2031)TGG>TGA		adenylate cyclase 2							93.0	91.0	92.0					5																	7757636		2203	4300	6503	SO:0001587	stop_gained	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7757636G>A	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2031G>A	5.37:g.7757636G>A	ENSP00000342952:p.Trp677*		Somatic				ADCY2_uc011cmo.1_Nonsense_Mutation_p.W497*	p.W677*	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			16	2098	+			677					B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Nonsense_Mutation	SNP	ENST00000338316.4	37	c.2031G>A	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	38	6.641104	0.97726	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	.	.	.	5.49	5.49	0.81192	.	0.134645	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	16.3023	0.82830	0.0:0.0:1.0:0.0	.	.	.	.	X	677;510;497	.	ENSP00000342952:W677X	W	+	3	0	ADCY2	7810636	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	7.737000	0.84957	2.569000	0.86673	0.655000	0.94253	TGG		0.507	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		22	63	0	0	0	0.014323	0	22	63				
SEMA5A	9037	broad.mit.edu	37	5	9063108	9063108	+	Silent	SNP	G	G	A	rs372052109		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:9063108G>A	ENST00000382496.5	-	18	3074	c.2409C>T	c.(2407-2409)ggC>ggT	p.G803G		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	803	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GGTTCCGAATGCCCCTGCTGC	0.582																																							uc003jek.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2407-2409)GGC>GGT		semaphorin 5A precursor							91.0	73.0	79.0					5																	9063108		2203	4300	6503	SO:0001819	synonymous_variant	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9063108G>A	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2409C>T	5.37:g.9063108G>A			Somatic					p.G803G	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			18	3121	-			803			TSP type-1 5.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	c.2409C>T	CCDS3875.1																																																																																				0.582	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			10	57	0	0	0	0.016723	0	10	57				
PCDHB2	56133	broad.mit.edu	37	5	140475890	140475890	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:140475890G>T	ENST00000194155.4	+	1	1664	c.1516G>T	c.(1516-1518)Gtc>Ttc	p.V506F		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	506	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCTCCCTGGTCTCCATCAA	0.701																																							uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(1516-1518)GTC>TTC		protocadherin beta 2 precursor							74.0	79.0	77.0					5																	140475890		2203	4300	6503	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475890G>T	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1516G>T	5.37:g.140475890G>T	ENSP00000194155:p.Val506Phe		Somatic				PCDHB2_uc003lim.1_Missense_Mutation_p.V167F	p.V506F	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1654	+			506			Extracellular (Potential).|Cadherin 5.		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.1516G>T	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622870	0.46840	.	.	ENSG00000112852	ENST00000194155	T	0.21191	2.02	4.5	2.63	0.31362	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.23210	0.0561	N	0.11756	0.17	0.20975	N	0.999811	D	0.71674	0.998	D	0.70227	0.968	T	0.07158	-1.0787	9	0.87932	D	0	.	5.5038	0.16842	0.2388:0.0:0.6134:0.1479	.	506	Q9Y5E7	PCDB2_HUMAN	F	506	ENSP00000194155:V506F	ENSP00000194155:V506F	V	+	1	0	PCDHB2	140456074	0.000000	0.05858	0.711000	0.30485	0.965000	0.64279	-1.359000	0.02602	0.990000	0.38787	0.556000	0.70494	GTC		0.701	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		25	184	1	0	1.56442e-22	0.012213	1.91767e-22	25	184				
PCDHB10	56126	broad.mit.edu	37	5	140572437	140572437	+	Silent	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:140572437G>T	ENST00000239446.4	+	1	496	c.312G>T	c.(310-312)ctG>ctT	p.L104L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	104	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGTATGCTGTATTTCCAAA	0.443																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(310-312)CTG>CTT		protocadherin beta 10 precursor							42.0	42.0	42.0					5																	140572437		2140	4254	6394	SO:0001819	synonymous_variant	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140572437G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.312G>T	5.37:g.140572437G>T			Somatic					p.L104L	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	486	+			104			Extracellular (Potential).|Cadherin 1.		Q96T99	Silent	SNP	ENST00000239446.4	37	c.312G>T	CCDS4252.1																																																																																				0.443	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		7	25	1	0	5.01169e-05	0.0333	5.60131e-05	7	25				
NMUR2	56923	broad.mit.edu	37	5	151784061	151784061	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:151784061G>A	ENST00000255262.3	-	1	779	c.614C>T	c.(613-615)aCg>aTg	p.T205M	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	205					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.T205M(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CTTGATGACCGTACAGGTGGC	0.542																																							uc003luv.2		NA																	2	Substitution - Missense(2)	p.T205M(1)	ovary(1)|kidney(1)	ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8						c.(613-615)ACG>ATG		neuromedin U receptor 2							173.0	166.0	169.0					5																	151784061		2203	4300	6503	SO:0001583	missense	56923				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	g.chr5:151784061G>A	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.614C>T	5.37:g.151784061G>A	ENSP00000255262:p.Thr205Met		Somatic					p.T205M	NM_020167	NP_064552	WXS	Illumina HiSeq	Unspecified	Q9GZQ4	NMUR2_HUMAN	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)		1	780	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	205			Extracellular (Potential).		Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	c.614C>T	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	G	4.452	0.083741	0.08533	.	.	ENSG00000132911	ENST00000255262	T	0.38077	1.16	5.44	3.61	0.41365	GPCR, rhodopsin-like superfamily (1);	0.370788	0.28198	N	0.016226	T	0.28134	0.0694	L	0.45698	1.435	0.09310	N	1	P	0.40398	0.716	B	0.35655	0.207	T	0.10337	-1.0634	10	0.45353	T	0.12	0.2937	9.1507	0.36962	0.0759:0.0:0.767:0.1571	.	205	Q9GZQ4	NMUR2_HUMAN	M	205	ENSP00000255262:T205M	ENSP00000255262:T205M	T	-	2	0	NMUR2	151764254	0.998000	0.40836	0.001000	0.08648	0.057000	0.15508	4.073000	0.57570	0.622000	0.30249	-0.237000	0.12165	ACG		0.542	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		7	258	0	0	0	0.004482	0	7	258				
GEMIN5	25929	broad.mit.edu	37	5	154306962	154306962	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:154306962T>C	ENST00000285873.7	-	7	1138	c.1063A>G	c.(1063-1065)Aca>Gca	p.T355A		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	355					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCATTGATGTAGAAAGTAAT	0.393																																							uc003lvx.3		NA																	0				skin(2)|ovary(1)	3						c.(1063-1065)ACA>GCA		gemin 5							109.0	98.0	102.0					5																	154306962		2203	4300	6503	SO:0001583	missense	25929				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding	g.chr5:154306962T>C	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1063A>G	5.37:g.154306962T>C	ENSP00000285873:p.Thr355Ala		Somatic				GEMIN5_uc011ddk.1_Missense_Mutation_p.T354A	p.T355A	NM_015465	NP_056280	WXS	Illumina HiSeq	Unspecified	Q8TEQ6	GEMI5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		7	1146	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	355			WD 6.		Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	c.1063A>G	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075913	0.55646	.	.	ENSG00000082516	ENST00000285873	T	0.03951	3.75	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.187911	0.48767	D	0.000177	T	0.03959	0.0111	N	0.20685	0.6	0.45318	D	0.998312	B;B	0.32862	0.387;0.387	B;B	0.27796	0.083;0.083	T	0.56774	-0.7923	10	0.20046	T	0.44	-6.5613	15.9132	0.79488	0.0:0.0:0.0:1.0	.	354;355	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	A	355	ENSP00000285873:T355A	ENSP00000285873:T355A	T	-	1	0	GEMIN5	154287155	1.000000	0.71417	0.966000	0.40874	0.720000	0.41350	6.239000	0.72356	2.154000	0.67381	0.482000	0.46254	ACA		0.393	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1			11	43	0	0	0	0.024245	0	11	43				
ZKSCAN3	80317	broad.mit.edu	37	6	28333829	28333829	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:28333829G>T	ENST00000377255.3	+	7	1681	c.1384G>T	c.(1384-1386)Gcc>Tcc	p.A462S	ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.A462S|ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.A314S	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	462				QGEAWKSRMESQLENVETPMS -> TGRGWKVGWKASWKML KLPCP (in Ref. 6; AAB16813). {ECO:0000305}.	autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						GCAGGGAGAGGCCTGGAAAAG	0.438																																							uc003nle.3		NA																	0				skin(2)	2						c.(1384-1386)GCC>TCC		zinc finger with KRAB and SCAN domains 3							82.0	85.0	84.0					6																	28333829		2203	4300	6503	SO:0001583	missense	80317				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:28333829G>T	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.1384G>T	6.37:g.28333829G>T	ENSP00000366465:p.Ala462Ser		Somatic				ZKSCAN3_uc010jrc.2_Missense_Mutation_p.A462S|ZKSCAN3_uc003nlf.3_Missense_Mutation_p.A314S|uc010jrd.2_5'Flank	p.A462S	NM_024493	NP_077819	WXS	Illumina HiSeq	Unspecified	Q9BRR0	ZKSC3_HUMAN			6	1600	+			462	QGEAWKSRMESQLENVETPMS -> TGRGWKVGWKASWKML KLPCP (in Ref. 5; AAB16813).				B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	37	c.1384G>T	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	G	0.729	-0.780574	0.02929	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.05081	3.53;3.5;3.53	2.96	0.74	0.18330	.	.	.	.	.	T	0.01029	0.0034	N	0.16233	0.39	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.48198	-0.9056	9	0.21540	T	0.41	.	5.26	0.15567	0.5171:0.0:0.4829:0.0	.	462	Q9BRR0	ZKSC3_HUMAN	S	462;314;462	ENSP00000252211:A462S;ENSP00000341883:A314S;ENSP00000366465:A462S	ENSP00000252211:A462S	A	+	1	0	ZKSCAN3	28441808	0.000000	0.05858	0.002000	0.10522	0.040000	0.13550	0.312000	0.19397	0.280000	0.22209	0.655000	0.94253	GCC		0.438	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493		12	22	1	0	0.000219431	0.020292	0.000242866	12	22				
MDC1	9656	broad.mit.edu	37	6	30673003	30673003	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:30673003G>A	ENST00000376406.3	-	10	4604	c.3957C>T	c.(3955-3957)gtC>gtT	p.V1319V	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.V1055V	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1319	Interaction with the PRKDC complex.|Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CAGGGGTCTTGACAGAGGACA	0.592								Other conserved DNA damage response genes																															uc003nrg.3		NA																	0				breast(2)|ovary(1)|kidney(1)	4						c.(3955-3957)GTC>GTT	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							141.0	153.0	149.0					6																	30673003		2203	4300	6503	SO:0001819	synonymous_variant	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30673003G>A	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3957C>T	6.37:g.30673003G>A			Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.V926V	p.V1319V	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			10	4397	-			1319	Missing (in Ref. 2; CAH18685).		Pro-rich.|Interaction with the PRKDC complex.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	c.3957C>T	CCDS34384.1																																																																																				0.592	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		5	229	0	0	0	0.014758	0	5	229				
MDC1	9656	broad.mit.edu	37	6	30673738	30673738	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:30673738G>C	ENST00000376406.3	-	10	3869	c.3222C>G	c.(3220-3222)atC>atG	p.I1074M	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.I810M	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1074	Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CGGTTGGCTTGATAGAAGGTA	0.537								Other conserved DNA damage response genes																															uc003nrg.3		NA																	0				breast(2)|ovary(1)|kidney(1)	4						c.(3220-3222)ATC>ATG	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							134.0	146.0	142.0					6																	30673738		2203	4300	6503	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30673738G>C	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3222C>G	6.37:g.30673738G>C	ENSP00000365588:p.Ile1074Met		Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.I681M	p.I1074M	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			10	3662	-			1074	Missing (in Ref. 2; CAH18685).		Pro-rich.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.3222C>G	CCDS34384.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.91|11.91	1.778157|1.778157	0.31502|0.31502	.|.	.|.	ENSG00000137337|ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104|ENST00000417033	T;T|.	0.03004|.	4.24;4.08|.	4.84|4.84	-2.09|-2.09	0.07232|0.07232	.|.	3.155510|.	0.01423|.	N|.	0.014454|.	T|T	0.04952|0.04952	0.0133|0.0133	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P;P|.	0.48294|.	0.908;0.704|.	P;B|.	0.46299|.	0.511;0.069|.	T|T	0.36138|0.36138	-0.9760|-0.9760	10|5	0.44086|.	T|.	0.13|.	4.4641|4.4641	1.0733|1.0733	0.01626|0.01626	0.4687:0.1148:0.2035:0.213|0.4687:0.1148:0.2035:0.213	.|.	810;1074|.	Q14676-2;Q14676|.	.;MDC1_HUMAN|.	M|E	1074;810;1074;681|135	ENSP00000365588:I1074M;ENSP00000365587:I810M|.	ENSP00000365587:I810M|.	I|Q	-|-	3|1	3|0	MDC1|MDC1	30781717|30781717	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.005000|0.005000	0.04900|0.04900	-0.187000|-0.187000	0.09656|0.09656	-0.240000|-0.240000	0.09696|0.09696	-0.282000|-0.282000	0.10007|0.10007	ATC|CAA		0.537	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		4	156	0	0	0	0.014758	0	4	156				
ZNF318	24149	broad.mit.edu	37	6	43306956	43306956	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:43306956C>T	ENST00000361428.2	-	10	4857	c.4780G>A	c.(4780-4782)Ggt>Agt	p.G1594S	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1594					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCCAATGGACCACCACTTAGC	0.493																																							uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(4780-4782)GGT>AGT		zinc finger protein 318							85.0	91.0	89.0					6																	43306956		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43306956C>T	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4780G>A	6.37:g.43306956C>T	ENSP00000354964:p.Gly1594Ser		Somatic				ZNF318_uc003ouw.2_Intron	p.G1594S	NM_014345	NP_055160	WXS	Illumina HiSeq	Unspecified	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		10	4858	-			1594					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.4780G>A	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	1.781	-0.481906	0.04383	.	.	ENSG00000171467	ENST00000361428	T	0.08546	3.08	5.82	3.7	0.42460	.	0.785958	0.11716	N	0.536436	T	0.01061	0.0035	N	0.11201	0.11	0.09310	N	0.999998	B	0.22146	0.065	B	0.22753	0.041	T	0.46952	-0.9154	10	0.08599	T	0.76	-0.4207	5.513	0.16890	0.2037:0.6073:0.0:0.189	.	1594	Q5VUA4	ZN318_HUMAN	S	1594	ENSP00000354964:G1594S	ENSP00000354964:G1594S	G	-	1	0	ZNF318	43414934	0.002000	0.14202	0.144000	0.22314	0.744000	0.42396	0.404000	0.20999	1.439000	0.47511	0.563000	0.77884	GGT		0.493	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		3	64	0	0	0	0.009096	0	3	64				
SLC35B2	347734	broad.mit.edu	37	6	44222572	44222572	+	Silent	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:44222572G>T	ENST00000393812.3	-	4	1313	c.1170C>A	c.(1168-1170)gtC>gtA	p.V390V	SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000538577.1_Silent_p.V297V|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000537814.1_Silent_p.V257V	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	390					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCACCACAGTGACAGTGTGGC	0.602																																							uc003oxd.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1168-1170)GTC>GTA		solute carrier family 35, member B2							68.0	68.0	68.0					6																	44222572		2203	4300	6503	SO:0001819	synonymous_variant	347734				positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity	g.chr6:44222572G>T	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.1170C>A	6.37:g.44222572G>T			Somatic				SLC35B2_uc011dvt.1_Silent_p.V293V|SLC35B2_uc011dvu.1_Silent_p.V257V	p.V390V	NM_178148	NP_835361	WXS	Illumina HiSeq	Unspecified	Q8TB61	S35B2_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		4	1306	-	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		390			Helical; (Potential).		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Silent	SNP	ENST00000393812.3	37	c.1170C>A	CCDS34462.1																																																																																				0.602	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2			8	52	1	0	0.00621372	0.006214	0.00662022	8	52				
CDC5L	988	broad.mit.edu	37	6	44390472	44390472	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:44390472C>T	ENST00000371477.3	+	10	1629	c.1330C>T	c.(1330-1332)Ctt>Ttt	p.L444F		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	444	Interaction with PPP1R8.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TAGAACTCCTCTTCGAGACAA	0.448																																							uc003oxl.2		NA																	0				lung(3)|ovary(1)|kidney(1)|skin(1)	6						c.(1330-1332)CTT>TTT		CDC5-like							117.0	120.0	119.0					6																	44390472		2203	4300	6503	SO:0001583	missense	988				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|cytoplasm|nuclear speck|nucleolus	DNA binding|RNA binding	g.chr6:44390472C>T	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1330C>T	6.37:g.44390472C>T	ENSP00000360532:p.Leu444Phe		Somatic					p.L444F	NM_001253	NP_001244	WXS	Illumina HiSeq	Unspecified	Q99459	CDC5L_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		10	1589	+	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		444			Interaction with PPP1R8.		Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	37	c.1330C>T	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400746	0.62177	.	.	ENSG00000096401	ENST00000371477	T	0.47177	0.85	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	N	0.26130	0.795	0.80722	D	1	B	0.21225	0.053	B	0.29663	0.105	T	0.06881	-1.0802	10	0.27082	T	0.32	-10.9261	20.1542	0.98100	0.0:1.0:0.0:0.0	.	444	Q99459	CDC5L_HUMAN	F	444	ENSP00000360532:L444F	ENSP00000360532:L444F	L	+	1	0	CDC5L	44498450	0.932000	0.31603	1.000000	0.80357	0.985000	0.73830	1.994000	0.40757	2.767000	0.95098	0.563000	0.77884	CTT		0.448	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1			4	150	0	0	0	0.021553	0	4	150				
RFX6	222546	broad.mit.edu	37	6	117199104	117199104	+	Silent	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:117199104C>A	ENST00000332958.2	+	2	385	c.369C>A	c.(367-369)ctC>ctA	p.L123L		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	123					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AGACACAGCTCACGCTGCAGT	0.478																																							uc003pxm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(367-369)CTC>CTA		regulatory factor X, 6							65.0	59.0	61.0					6																	117199104		2203	4300	6503	SO:0001819	synonymous_variant	222546				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding	g.chr6:117199104C>A	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.369C>A	6.37:g.117199104C>A			Somatic					p.L123L	NM_173560	NP_775831	WXS	Illumina HiSeq	Unspecified	Q8HWS3	RFX6_HUMAN			2	432	+			123					Q5T6B3	Silent	SNP	ENST00000332958.2	37	c.369C>A	CCDS5113.1																																																																																				0.478	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		6	19	1	0	0.00198382	0.02938	0.00215386	6	19				
OCM	654231	broad.mit.edu	37	7	5922210	5922210	+	Missense_Mutation	SNP	T	T	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:5922210T>G	ENST00000242104.5	+	2	240	c.148T>G	c.(148-150)Ttc>Gtc	p.F50V	OCM_ENST00000416608.1_Missense_Mutation_p.F50V	NM_001097622.1	NP_001091091.1	P0CE72	ONCO_HUMAN	oncomodulin	50	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(2)	6		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		TGTTTTCCGGTTCATAGACAA	0.507																																							uc003spe.3		NA																	0					0						c.(148-150)TTC>GTC		oncomodulin							142.0	126.0	131.0					7																	5922210		2203	4300	6503	SO:0001583	missense	654231						calcium ion binding	g.chr7:5922210T>G	BC069468	CCDS43548.1	7p22.1	2013-01-10						"""EF-hand domain containing"""	8105	protein-coding gene	gene with protein product	"""oncomodulin 1"""	164795				1559707, 8354278	Standard	NM_001097622		Approved	OCM1	uc003spe.4	P0CE72		ENST00000242104.5:c.148T>G	7.37:g.5922210T>G	ENSP00000242104:p.Phe50Val		Somatic					p.F50V	NM_001097622	NP_001091091	WXS	Illumina HiSeq	Unspecified	P0CE72	ONCO_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)	2	240	+		Ovarian(82;0.0694)	50			EF-hand 1.		B9EJH7|P32930|Q6ISI5|Q75MW0	Missense_Mutation	SNP	ENST00000242104.5	37	c.148T>G	CCDS43548.1	.	.	.	.	.	.	.	.	.	.	T	7.401	0.632756	0.14322	.	.	ENSG00000122543	ENST00000416608;ENST00000242104	T;T	0.70282	-0.47;-0.47	3.61	2.39	0.29439	EF-hand-like domain (1);	0.118259	0.56097	N	0.000029	T	0.31327	0.0793	N	0.00633	-1.31	0.30778	N	0.742298	B	0.02656	0.0	B	0.06405	0.002	T	0.21211	-1.0252	10	0.16896	T	0.51	-14.0609	5.0926	0.14715	0.1724:0.0:0.3544:0.4731	.	50	P0CE72	ONCO_HUMAN	V	50	ENSP00000401365:F50V;ENSP00000242104:F50V	ENSP00000242104:F50V	F	+	1	0	OCM	5888736	0.998000	0.40836	0.999000	0.59377	0.993000	0.82548	0.523000	0.22925	0.384000	0.24942	0.405000	0.27470	TTC		0.507	OCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340372.1	NM_001097622		11	206	0	0	0	0.008291	0	11	206				
THSD7A	221981	broad.mit.edu	37	7	11486888	11486888	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:11486888A>G	ENST00000423059.4	-	12	3020	c.2769T>C	c.(2767-2769)ggT>ggC	p.G923G	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	923	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCCTAACTGCACCACAGTCTC	0.502										HNSCC(18;0.044)																													uc003ssf.3		NA																	0				ovary(3)	3						c.(2767-2769)GGT>GGC		thrombospondin, type I, domain containing 7A							81.0	76.0	77.0					7																	11486888		1944	4157	6101	SO:0001819	synonymous_variant	221981					integral to membrane		g.chr7:11486888A>G		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2769T>C	7.37:g.11486888A>G		HNSCC(18;0.044)	Somatic					p.G923G	NM_015204	NP_056019	WXS	Illumina HiSeq	Unspecified	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	12	3021	-			923			TSP type-1 9.|Extracellular (Potential).			Silent	SNP	ENST00000423059.4	37	c.2769T>C	CCDS47543.1																																																																																				0.502	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		16	50	0	0	0	0.008871	0	16	50				
DNAH11	8701	broad.mit.edu	37	7	21730401	21730401	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:21730401A>G	ENST00000409508.3	+	35	5974	c.5943A>G	c.(5941-5943)gaA>gaG	p.E1981E	DNAH11_ENST00000328843.6_Silent_p.E1988E	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1988	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTCTTGGGGAAGCTATCACAC	0.363									Kartagener syndrome																														uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(5962-5964)GAA>GAG		dynein, axonemal, heavy chain 11							168.0	161.0	163.0					7																	21730401		1830	4091	5921	SO:0001819	synonymous_variant	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21730401A>G	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5943A>G	7.37:g.21730401A>G			Somatic					p.E1988E	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			36	5995	+			1988			AAA 1 (By similarity).		Q9UJ82	Silent	SNP	ENST00000409508.3	37	c.5964A>G																																																																																					0.363	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		46	265	0	0	0	0.01441	0	46	265				
NOD1	10392	broad.mit.edu	37	7	30494771	30494771	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:30494771C>T	ENST00000222823.4	-	5	883	c.358G>A	c.(358-360)Gtg>Atg	p.V120M	NOD1_ENST00000423334.2_Missense_Mutation_p.V120M	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	120					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GTGTTGACCACGACTTTGCTC	0.617																																							uc003tav.2		NA																	0				ovary(1)|skin(1)	2						c.(358-360)GTG>ATG		nucleotide-binding oligomerization domain							72.0	69.0	70.0					7																	30494771		2203	4300	6503	SO:0001583	missense	10392				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity	g.chr7:30494771C>T	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.358G>A	7.37:g.30494771C>T	ENSP00000222823:p.Val120Met		Somatic				NOD1_uc010kvs.2_Missense_Mutation_p.V120M	p.V120M	NM_006092	NP_006083	WXS	Illumina HiSeq	Unspecified	Q9Y239	NOD1_HUMAN			5	881	-			120					B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	c.358G>A	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275254	0.40194	.	.	ENSG00000106100	ENST00000222823;ENST00000423334	T	0.74002	-0.8	5.08	1.84	0.25277	.	0.128846	0.51477	D	0.000084	T	0.62938	0.2469	N	0.08118	0	0.46981	D	0.999277	D;D	0.76494	0.999;0.999	P;P	0.58454	0.721;0.839	T	0.62798	-0.6778	10	0.66056	D	0.02	.	4.6091	0.12392	0.1648:0.6127:0.0:0.2225	.	120;120	B4DTU3;Q9Y239	.;NOD1_HUMAN	M	120	ENSP00000222823:V120M	ENSP00000222823:V120M	V	-	1	0	NOD1	30461296	0.996000	0.38824	0.025000	0.17156	0.131000	0.20780	3.406000	0.52637	0.349000	0.23975	0.462000	0.41574	GTG		0.617	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2			5	163	0	0	0	0.021553	0	5	163				
PGAM2	5224	broad.mit.edu	37	7	44102401	44102401	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:44102401C>T	ENST00000297283.3	-	3	781	c.724G>A	c.(724-726)Gcc>Acc	p.A242T	AC017116.11_ENST00000445938.1_RNA	NM_000290.3	NP_000281.2	P15259	PGAM2_HUMAN	phosphoglycerate mutase 2 (muscle)	242					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to mercury ion (GO:0046689)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|striated muscle contraction (GO:0006941)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase activity (GO:0046538)|bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|cofactor binding (GO:0048037)|phosphoglycerate mutase activity (GO:0004619)			large_intestine(2)|lung(4)|ovary(1)|stomach(1)	8						GCCTCCATGGCCTTCCGCACC	0.622																																							uc003tjs.2		NA																	0					0						c.(724-726)GCC>ACC		phosphoglycerate mutase 2							120.0	86.0	97.0					7																	44102401		2203	4300	6503	SO:0001583	missense	5224				gluconeogenesis|glycolysis|striated muscle contraction	cytosol	2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity	g.chr7:44102401C>T		CCDS34624.1	7p13-p12	2008-11-17			ENSG00000164708	ENSG00000164708	5.4.2.1, 3.1.3.13, 5.4.2.4		8889	protein-coding gene	gene with protein product		612931					Standard	NM_000290		Approved	PGAM-M	uc003tjs.3	P15259	OTTHUMG00000155355	ENST00000297283.3:c.724G>A	7.37:g.44102401C>T	ENSP00000297283:p.Ala242Thr		Somatic					p.A242T	NM_000290	NP_000281	WXS	Illumina HiSeq	Unspecified	P15259	PGAM2_HUMAN			3	759	-			242						Missense_Mutation	SNP	ENST00000297283.3	37	c.724G>A	CCDS34624.1	.	.	.	.	.	.	.	.	.	.	C	31	5.088438	0.94100	.	.	ENSG00000164708	ENST00000297283	T	0.80304	-1.36	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.90556	0.7040	M	0.91140	3.18	0.80722	D	1	D	0.76494	0.999	P	0.60609	0.877	D	0.92615	0.6103	10	0.72032	D	0.01	-34.0448	16.1772	0.81858	0.0:1.0:0.0:0.0	.	242	P15259	PGAM2_HUMAN	T	242	ENSP00000297283:A242T	ENSP00000297283:A242T	A	-	1	0	PGAM2	44068926	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.682000	0.84083	2.497000	0.84241	0.456000	0.33151	GCC		0.622	PGAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339614.1			18	63	0	0	0	0.012319	0	18	63				
SEMA3A	10371	broad.mit.edu	37	7	83591024	83591024	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:83591024A>G	ENST00000265362.4	-	17	2293	c.1979T>C	c.(1978-1980)cTt>cCt	p.L660P	SEMA3A_ENST00000436949.1_Missense_Mutation_p.L660P	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	660	Ig-like C2-type.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TACCTTAAGAAGAGTTTGTAT	0.428																																							uc003uhz.2		NA																	0				ovary(2)|breast(1)|kidney(1)	4						c.(1978-1980)CTT>CCT		semaphorin 3A precursor							137.0	124.0	129.0					7																	83591024		2203	4299	6502	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83591024A>G	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1979T>C	7.37:g.83591024A>G	ENSP00000265362:p.Leu660Pro		Somatic					p.L660P	NM_006080	NP_006071	WXS	Illumina HiSeq	Unspecified	Q14563	SEM3A_HUMAN			17	2294	-			660			Ig-like C2-type.			Missense_Mutation	SNP	ENST00000265362.4	37	c.1979T>C	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.895920	0.72639	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.01613	4.73;4.73	6.17	6.17	0.99709	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.12092	0.0294	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.00066	-1.2144	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	660	Q14563	SEM3A_HUMAN	P	660	ENSP00000265362:L660P;ENSP00000415260:L660P	ENSP00000265362:L660P	L	-	2	0	SEMA3A	83428960	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.281000	0.95811	2.371000	0.80710	0.533000	0.62120	CTT		0.428	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		46	12	0	0	0	0.01441	0	46	12				
PDAP1	11333	broad.mit.edu	37	7	99002494	99002494	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:99002494C>T	ENST00000350498.3	-	2	376	c.96G>A	c.(94-96)caG>caA	p.Q32Q		NM_014891.6	NP_055706.1	Q13442	HAP28_HUMAN	PDGFA associated protein 1	32					cell proliferation (GO:0008283)|signal transduction (GO:0007165)		poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CCCTGGCCTTCTGCTTCTCAG	0.607																																							uc003uqe.2		NA																	0					0						c.(94-96)CAG>CAA		PDGFA associated protein 1	Becaplermin(DB00102)						78.0	67.0	71.0					7																	99002494		2203	4300	6503	SO:0001819	synonymous_variant	11333				cell proliferation|signal transduction			g.chr7:99002494C>T	U41745	CCDS5662.1	7q	2008-07-18			ENSG00000106244	ENSG00000106244			14634	protein-coding gene	gene with protein product	"""PDGF associated protein"""	607075				8780057	Standard	NM_014891		Approved	PAP1, PAP, HASPP28	uc003uqe.3	Q13442	OTTHUMG00000154629	ENST00000350498.3:c.96G>A	7.37:g.99002494C>T			Somatic					p.Q32Q	NM_014891	NP_055706	WXS	Illumina HiSeq	Unspecified	Q13442	HAP28_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		2	217	-	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		32					D6W5S5|Q92906	Silent	SNP	ENST00000350498.3	37	c.96G>A	CCDS5662.1																																																																																				0.607	PDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336388.2	NM_014891		8	33	0	0	0	0.008291	0	8	33				
KMT2C	58508	broad.mit.edu	37	7	151932943	151932943	+	Missense_Mutation	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:151932943A>C	ENST00000262189.6	-	16	2946	c.2728T>G	c.(2728-2730)Tca>Gca	p.S910A	KMT2C_ENST00000355193.2_Missense_Mutation_p.S910A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	910					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCAGCTTTGACCTGCCTCGG	0.483																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2728-2730)TCA>GCA		myeloid/lymphoid or mixed-lineage leukemia 3							61.0	56.0	58.0					7																	151932943		2202	4291	6493	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151932943A>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2728T>G	7.37:g.151932943A>C	ENSP00000262189:p.Ser910Ala		Somatic				MLL3_uc003wkz.2_5'UTR	p.S910A	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	16	2947	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	910					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2728T>G	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.21|14.21	2.467453|2.467453	0.43839|0.43839	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000418673	D;D|.	0.82619|.	-1.62;-1.63|.	5.0|5.0	5.0|5.0	0.66597|0.66597	AT hook, DNA-binding motif (1);|.	0.000000|.	0.39146|.	N|.	0.001456|.	T|T	0.38799|0.38799	0.1054|0.1054	N|N	0.11064|0.11064	0.09|0.09	0.80722|0.80722	D|D	1|1	D|.	0.58268|.	0.982|.	D|.	0.67548|.	0.952|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|5	0.05436|.	T|.	0.98|.	.|.	13.5664|13.5664	0.61822|0.61822	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	910|.	Q8NEZ4|.	MLL3_HUMAN|.	A|G	910|65	ENSP00000262189:S910A;ENSP00000347325:S910A|.	ENSP00000262189:S910A|.	S|V	-|-	1|2	0|0	MLL3|MLL3	151563876|151563876	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.977000|0.977000	0.68977|0.68977	5.367000|5.367000	0.66127|0.66127	2.008000|2.008000	0.58898|0.58898	0.477000|0.477000	0.44152|0.44152	TCA|GTC		0.483	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			5	137	0	0	0	0.02938	0	5	137				
CSMD1	64478	broad.mit.edu	37	8	3245155	3245155	+	Silent	SNP	G	G	A	rs370427726		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:3245155G>A	ENST00000520002.1	-	19	3201	c.2646C>T	c.(2644-2646)aaC>aaT	p.N882N	CSMD1_ENST00000537824.1_Silent_p.N881N|CSMD1_ENST00000602723.1_Silent_p.N882N|CSMD1_ENST00000400186.3_Silent_p.N882N|CSMD1_ENST00000539096.1_Silent_p.N881N|CSMD1_ENST00000602557.1_Silent_p.N882N|CSMD1_ENST00000542608.1_Silent_p.N881N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	882	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCGATGGCCGTTCACAGGGA	0.562																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(2644-2646)AAC>AAT		CUB and Sushi multiple domains 1 precursor		G		0,4230		0,0,2115	36.0	43.0	41.0		2643	-9.7	0.1	8		41	1,8445		0,1,4222	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6337	AA,AG,GG		0.0118,0.0,0.0079		881/3565	3245155	1,12675	2115	4223	6338	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:3245155G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2646C>T	8.37:g.3245155G>A			Somatic				CSMD1_uc011kwj.1_Silent_p.N274N|CSMD1_uc003wqe.2_Silent_p.N38N	p.N882N	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	18	3036	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	882			Extracellular (Potential).|Sushi 5.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.2646C>T		.	.	.	.	.	.	.	.	.	.	G	7.732	0.699443	0.15106	0.0	1.18E-4	ENSG00000183117	ENST00000335551	.	.	.	5.11	-9.68	0.00528	.	.	.	.	.	T	0.58864	0.2152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69412	-0.5152	4	.	.	.	.	14.5795	0.68278	0.5168:0.0:0.4832:0.0	.	.	.	.	W	362	.	.	R	-	1	2	CSMD1	3232562	0.997000	0.39634	0.064000	0.19789	0.657000	0.38888	0.675000	0.25232	-2.273000	0.00681	-0.781000	0.03364	CGG		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		6	2	0	0	0	0.02938	0	6	2				
VDAC3	7419	broad.mit.edu	37	8	42262390	42262390	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:42262390A>G	ENST00000022615.4	+	9	776	c.708A>G	c.(706-708)aaA>aaG	p.K236K	VDAC3_ENST00000521158.1_Silent_p.K237K|VDAC3_ENST00000392935.3_Silent_p.K237K|VDAC3_ENST00000522572.1_Intron			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	236					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	CTTAGGCTAAAGTAAATAATG	0.378																																							uc011lct.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(706-708)AAA>AAG		voltage-dependent anion channel 3 isoform b	Dihydroxyaluminium(DB01375)						87.0	81.0	83.0					8																	42262390		2203	4300	6503	SO:0001819	synonymous_variant	7419				adenine transport	mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity	g.chr8:42262390A>G	AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.708A>G	8.37:g.42262390A>G			Somatic				VDAC3_uc003xpc.2_Silent_p.K237K	p.K236K	NM_005662	NP_005653	WXS	Illumina HiSeq	Unspecified	Q9Y277	VDAC3_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		9	851	+	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	236			Beta stranded; (By similarity).		Q9UIS0	Silent	SNP	ENST00000022615.4	37	c.708A>G	CCDS6131.1																																																																																				0.378	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377574.1			29	109	0	0	0	0.012213	0	29	109				
ZNF704	619279	broad.mit.edu	37	8	81733777	81733777	+	Missense_Mutation	SNP	A	A	T	rs372378549		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:81733777A>T	ENST00000327835.3	-	2	284	c.53T>A	c.(52-54)aTg>aAg	p.M18K		NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	18							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			TTGATGAGACATTTTTTTACC	0.418																																							uc003yby.1		NA																	0					0						c.(52-54)ATG>AAG		zinc finger protein 704							250.0	239.0	243.0					8																	81733777		2203	4300	6503	SO:0001583	missense	619279					intracellular	zinc ion binding	g.chr8:81733777A>T	AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.53T>A	8.37:g.81733777A>T	ENSP00000331462:p.Met18Lys		Somatic					p.M18K	NM_001033723	NP_001028895	WXS	Illumina HiSeq	Unspecified	Q6ZNC4	ZN704_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)		2	285	-	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		18					B2RNE6|B9EGW6	Missense_Mutation	SNP	ENST00000327835.3	37	c.53T>A	CCDS34913.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.014614	0.35511	.	.	ENSG00000164684	ENST00000327835;ENST00000519936	T;T	0.42513	1.58;0.97	5.7	1.97	0.26223	.	1.067560	0.07181	N	0.854093	T	0.24967	0.0606	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.26018	-1.0115	10	0.49607	T	0.09	-0.2792	8.3714	0.32417	0.7828:0.0:0.2172:0.0	.	18	Q6ZNC4	ZN704_HUMAN	K	18	ENSP00000331462:M18K;ENSP00000427715:M18K	ENSP00000331462:M18K	M	-	2	0	ZNF704	81896332	0.000000	0.05858	0.266000	0.24541	0.927000	0.56198	0.458000	0.21892	0.402000	0.25451	0.460000	0.39030	ATG		0.418	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379964.2	NM_001033723		36	273	0	0	0	0.036044	0	36	273				
ERICH5	203111	broad.mit.edu	37	8	99102050	99102050	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:99102050G>A	ENST00000318528.3	+	2	1164	c.805G>A	c.(805-807)Gaa>Aaa	p.E269K	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		269	Glu-rich.									kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			TGTAACACCAGAAGTATTGGA	0.443																																							uc003yih.1		NA																	0					0						c.(805-807)GAA>AAA		hypothetical protein LOC203111							78.0	74.0	75.0					8																	99102050		2203	4300	6503	SO:0001583	missense	203111							g.chr8:99102050G>A																												ENST00000318528.3:c.805G>A	8.37:g.99102050G>A	ENSP00000315614:p.Glu269Lys		Somatic					p.E269K	NM_173549	NP_775820	WXS	Illumina HiSeq	Unspecified	Q6P6B1	CH047_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.214)		2	953	+	Breast(36;2.31e-06)		269			Glu-rich.		G3V1K4|Q8N1L8	Missense_Mutation	SNP	ENST00000318528.3	37	c.805G>A	CCDS34929.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952794	0.53293	.	.	ENSG00000177459	ENST00000318528	T	0.26810	1.71	5.13	3.22	0.36961	.	0.635334	0.14758	N	0.300162	T	0.22589	0.0545	L	0.57536	1.79	0.09310	N	0.999995	P	0.35242	0.492	B	0.34779	0.189	T	0.14254	-1.0479	10	0.31617	T	0.26	-4.634	5.6716	0.17725	0.1152:0.2073:0.6774:0.0	.	269	Q6P6B1	CH047_HUMAN	K	269	ENSP00000315614:E269K	ENSP00000315614:E269K	E	+	1	0	C8orf47	99171226	0.010000	0.17322	0.002000	0.10522	0.040000	0.13550	1.664000	0.37439	0.652000	0.30806	0.655000	0.94253	GAA		0.443	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380465.1			7	76	0	0	0	0.00308	0	7	76				
C9orf131	138724	broad.mit.edu	37	9	35045640	35045640	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:35045640C>A	ENST00000312292.5	+	2	3061	c.3014C>A	c.(3013-3015)cCc>cAc	p.P1005H	C9orf131_ENST00000354479.5_Missense_Mutation_p.P932H|C9orf131_ENST00000421362.2_Missense_Mutation_p.P957H|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	1005										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			ACTGCTCTTCCCCAGCTGCTT	0.592																																							uc003zvw.2		NA																	0					0						c.(3013-3015)CCC>CAC		hypothetical protein LOC138724 isoform A							89.0	86.0	87.0					9																	35045640		2203	4300	6503	SO:0001583	missense	138724							g.chr9:35045640C>A	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.3014C>A	9.37:g.35045640C>A	ENSP00000308279:p.Pro1005His		Somatic				C9orf131_uc003zvu.2_Missense_Mutation_p.P957H|C9orf131_uc003zvv.2_Missense_Mutation_p.P932H|C9orf131_uc003zvx.2_Missense_Mutation_p.P970H	p.P1005H	NM_203299	NP_976044	WXS	Illumina HiSeq	Unspecified	Q5VYM1	CI131_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		2	3043	+	all_epithelial(49;0.22)		1005					A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	37	c.3014C>A	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318538	0.60524	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000435140	T;T;T	0.17370	2.29;2.28;2.29	4.6	-2.78	0.05859	.	1.196410	0.06043	N	0.655173	T	0.16471	0.0396	N	0.19112	0.55	0.09310	N	1	D;D;D;D	0.65815	0.99;0.99;0.995;0.995	P;P;P;P	0.57679	0.73;0.73;0.825;0.825	T	0.13926	-1.0491	10	0.66056	D	0.02	0.0146	1.4814	0.02437	0.1391:0.3181:0.1366:0.4063	.	480;1005;932;957	B4DXT9;Q5VYM1;A6NLE6;E9PB26	.;CI131_HUMAN;.;.	H	957;932;1005;480	ENSP00000393683:P957H;ENSP00000346472:P932H;ENSP00000308279:P1005H	ENSP00000308279:P1005H	P	+	2	0	C9orf131	35035640	0.000000	0.05858	0.000000	0.03702	0.564000	0.35744	-0.874000	0.04210	-0.457000	0.07033	0.563000	0.77884	CCC		0.592	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299		10	38	1	0	0.000673444	0.008291	0.000738198	10	38				
SPATA31C2	645961	broad.mit.edu	37	9	90749711	90749711	+	IGR	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:90749711G>A								U6 (136461 upstream) : U3 (239472 downstream)																							TGGTGAGGGTGGGTTGTCACA	0.473																																							uc011lti.1		NA																	0					NA						c.(160-162)CCA>CTA		SubName: Full=cDNA FLJ59639;							69.0	57.0	60.0					9																	90749711		681	1589	2270	SO:0001628	intergenic_variant	0							g.chr9:90749711G>A																													9.37:g.90749711G>A			Somatic					p.P54L			WXS	Illumina HiSeq	Unspecified					1	190	-									Missense_Mutation	SNP		37	c.161C>T																																																																																				0	0.473									6	39	0	0	0	0.02938	0	6	39				
TTF1	7270	broad.mit.edu	37	9	135266209	135266209	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:135266209C>T	ENST00000334270.2	-	7	2036	c.1997G>A	c.(1996-1998)cGt>cAt	p.R666H		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	666	Myb-like 2. {ECO:0000255|PROSITE- ProRule:PRU00133}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CCAAGCACCACGATTTCTTTC	0.368																																							uc004cbl.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(1996-1998)CGT>CAT		transcription termination factor, RNA polymerase							89.0	98.0	95.0					9																	135266209		2203	4300	6503	SO:0001583	missense	7270				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding	g.chr9:135266209C>T	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1997G>A	9.37:g.135266209C>T	ENSP00000333920:p.Arg666His		Somatic				TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Missense_Mutation_p.R151H	p.R666H	NM_007344	NP_031370	WXS	Illumina HiSeq	Unspecified	Q15361	TTF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)	7	2049	-		Myeloproliferative disorder(178;0.204)	666			Myb-like 2.		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	c.1997G>A	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	C	0.215	-1.033374	0.02029	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.44083	0.93	5.48	-3.68	0.04463	SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);MYB-like (1);	0.602780	0.15545	N	0.256728	T	0.13286	0.0322	N	0.01277	-0.915	0.22001	N	0.999424	B	0.24132	0.098	B	0.17722	0.019	T	0.28138	-1.0053	10	0.20046	T	0.44	.	12.6906	0.56972	0.0:0.6663:0.0:0.3337	.	666	Q15361	TTF1_HUMAN	H	666	ENSP00000333920:R666H	ENSP00000245588:R666H	R	-	2	0	TTF1	134256030	0.001000	0.12720	0.042000	0.18584	0.584000	0.36387	-0.777000	0.04669	-0.601000	0.05783	-0.218000	0.12543	CGT		0.368	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344		18	44	0	0	0	0.016522	0	18	44				
ADAMTS13	11093	broad.mit.edu	37	9	136313805	136313805	+	Silent	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:136313805T>C	ENST00000371929.3	+	22	3261	c.2817T>C	c.(2815-2817)ccT>ccC	p.P939P	ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000355699.2_Silent_p.P939P|ADAMTS13_ENST00000356589.2_Silent_p.P908P	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	939	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CAAGCAAGCCTGGGAGCCGGC	0.642																																							uc004cdv.3		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(2815-2817)CCT>CCC		ADAM metallopeptidase with thrombospondin type 1							53.0	54.0	53.0					9																	136313805		2203	4300	6503	SO:0001819	synonymous_variant	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136313805T>C	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2817T>C	9.37:g.136313805T>C			Somatic				ADAMTS13_uc004cdp.3_Silent_p.P166P|ADAMTS13_uc004cdt.1_Silent_p.P939P|ADAMTS13_uc004cdu.1_Silent_p.P908P|ADAMTS13_uc004cdw.3_Silent_p.P939P|ADAMTS13_uc004cdx.3_Silent_p.P908P|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Silent_p.P609P	p.P939P	NM_139025	NP_620594	WXS	Illumina HiSeq	Unspecified	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	22	3261	+			939			TSP type-1 5.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	c.2817T>C	CCDS6970.1																																																																																				0.642	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		11	23	0	0	0	0.010729	0	11	23				
ARHGAP6	395	broad.mit.edu	37	X	11206861	11206861	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:11206861C>T	ENST00000337414.4	-	4	1936	c.1064G>A	c.(1063-1065)cGg>cAg	p.R355Q	ARHGAP6_ENST00000380718.1_Missense_Mutation_p.R355Q|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.R164Q|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.R180Q|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.R152Q|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.R387Q|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.R152Q	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	355					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CCTCCTAGCCCGAGGAGCCGG	0.478																																							uc004cup.1		NA																	0				urinary_tract(1)|lung(1)	2						c.(1063-1065)CGG>CAG		Rho GTPase activating protein 6 isoform 1							77.0	71.0	73.0					X																	11206861		2203	4300	6503	SO:0001583	missense	395				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity	g.chrX:11206861C>T	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1064G>A	X.37:g.11206861C>T	ENSP00000338967:p.Arg355Gln		Somatic				ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.R355Q|ARHGAP6_uc004cum.1_Missense_Mutation_p.R152Q|ARHGAP6_uc004cun.1_Missense_Mutation_p.R175Q|ARHGAP6_uc010neb.1_Missense_Mutation_p.R177Q|ARHGAP6_uc011mif.1_Missense_Mutation_p.R152Q	p.R355Q	NM_013427	NP_038286	WXS	Illumina HiSeq	Unspecified	O43182	RHG06_HUMAN			4	1937	-			355					B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	c.1064G>A	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487938	0.84854	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.26660	1.79;1.72;1.72;1.74;1.79;1.75;1.86;1.9	5.49	5.49	0.81192	.	0.000000	0.49305	D	0.000155	T	0.48822	0.1521	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;1.0	P;P;D;D;D	0.71414	0.749;0.905;0.951;0.973;0.961	T	0.43861	-0.9365	10	0.52906	T	0.07	.	18.4769	0.90797	0.0:1.0:0.0:0.0	.	164;152;355;355;355	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	Q	180;152;152;355;191;355;164;387	ENSP00000438135:R180Q;ENSP00000370112:R152Q;ENSP00000302312:R152Q;ENSP00000338967:R355Q;ENSP00000370093:R191Q;ENSP00000370094:R355Q;ENSP00000389394:R164Q;ENSP00000370108:R387Q	ENSP00000302312:R152Q	R	-	2	0	ARHGAP6	11116782	1.000000	0.71417	1.000000	0.80357	0.527000	0.34593	7.332000	0.79203	2.305000	0.77605	0.600000	0.82982	CGG		0.478	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427		13	61	0	0	0	0.020292	0	13	61				
TKTL1	8277	broad.mit.edu	37	X	153539342	153539342	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:153539342G>A	ENST00000369915.3	+	4	695	c.506G>A	c.(505-507)tGc>tAc	p.C169Y	TKTL1_ENST00000369912.2_Missense_Mutation_p.C113Y|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	169					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCGAGCACTGCATAAACATC	0.507																																							uc004fkg.2		NA																	0				ovary(3)|skin(1)	4						c.(505-507)TGC>TAC		transketolase-like 1 isoform a							125.0	104.0	111.0					X																	153539342		2203	4300	6503	SO:0001583	missense	8277				glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity	g.chrX:153539342G>A	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.506G>A	X.37:g.153539342G>A	ENSP00000358931:p.Cys169Tyr		Somatic				TKTL1_uc011mzl.1_Missense_Mutation_p.C163Y|TKTL1_uc011mzm.1_Intron|TKTL1_uc004fkh.2_Missense_Mutation_p.C113Y	p.C169Y	NM_012253	NP_036385	WXS	Illumina HiSeq	Unspecified	P51854	TKTL1_HUMAN			4	692	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		169					A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	c.506G>A	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	5.682	0.310453	0.10733	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000426989;ENST00000369912	T;T;T	0.29397	1.57;1.57;1.57	4.29	2.48	0.30137	Transketolase, N-terminal (1);	0.457400	0.27258	N	0.020190	T	0.20981	0.0505	L	0.39898	1.24	0.32255	N	0.570873	B;B	0.12013	0.005;0.005	B;B	0.15052	0.012;0.012	T	0.13442	-1.0509	10	0.66056	D	0.02	-10.0359	3.471	0.07567	0.3121:0.1952:0.4927:0.0	.	163;169	B7Z7I0;P51854	.;TKTL1_HUMAN	Y	169;113;169;113	ENSP00000358931:C169Y;ENSP00000401111:C169Y;ENSP00000358928:C113Y	ENSP00000358928:C113Y	C	+	2	0	TKTL1	153192536	0.760000	0.28428	0.072000	0.20136	0.090000	0.18270	2.817000	0.48034	0.384000	0.24942	0.529000	0.55759	TGC		0.507	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253		3	82	0	0	0	0.004672	0	3	82				
HRNR	388697	broad.mit.edu	37	1	152188597	152188597	+	Frame_Shift_Del	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152188597delC	ENST00000368801.2	-	3	5583	c.5508delG	c.(5506-5508)gggfs	p.G1836fs	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1836					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGAACCGGACCCATGTCGGC	0.612																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(5506-5508)GGGfs		hornerin							23.0	44.0	37.0					1																	152188597		2088	4239	6327	SO:0001589	frameshift_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152188597delC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5508delG	1.37:g.152188597delC	ENSP00000357791:p.Gly1836fs		Somatic					p.G1836fs	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5584	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1836			20.		Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	37	c.5508delG	CCDS30859.1																																																																																				0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		21	174	NA	NA	NA	NA	NA	21	174	---	---	---	---
FGD6	55785	broad.mit.edu	37	12	95486540	95486542	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	ACA	ACA	-	-	ACA	ACA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:95486540_95486542delACA	ENST00000343958.4	-	16	3903_3905	c.3680_3682delTGT	c.(3679-3684)atgtgt>agt	p.1227_1228MC>S	FGD6_ENST00000546711.1_In_Frame_Del_p.1227_1228MC>S	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1227					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CAGATCATACACATTGTGGCTCT	0.488																																							uc001tdp.3		NA																	0				ovary(2)|breast(1)	3						c.(3679-3684)ATGTGT>AGT		FYVE, RhoGEF and PH domain containing 6																																				SO:0001651	inframe_deletion	55785				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:95486540_95486542delACA	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3680_3682delTGT	12.37:g.95486540_95486542delACA	ENSP00000344446:p.Met1227_Cys1228delinsSer		Somatic				FGD6_uc009zsx.2_In_Frame_Del_p.360_361MC>S|FGD6_uc001tdq.1_In_Frame_Del_p.263_264MC>S	p.1227_1228MC>S	NM_018351	NP_060821	WXS	Illumina HiSeq	Unspecified	Q6ZV73	FGD6_HUMAN			16	3904_3906	-			1227_1228			FYVE-type.		Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	In_Frame_Del	DEL	ENST00000343958.4	37	c.3680_3682delTGT	CCDS31878.1																																																																																				0.488	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351		17	43	NA	NA	NA	NA	NA	17	43	---	---	---	---
EDC4	23644	broad.mit.edu	37	16	67913767	67913769	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:67913767_67913769delCAG	ENST00000358933.5	+	16	2075_2077	c.1836_1838delCAG	c.(1834-1839)cccagc>ccc	p.S617del	AC040162.1_ENST00000408599.1_RNA|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	617	Ser-rich.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTGCCTCTCCcagcagcagcagc	0.611																																							uc002eur.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1834-1839)CCCAGC>CCC		autoantigen RCD8																																				SO:0001651	inframe_deletion	23644				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	g.chr16:67913767_67913769delCAG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1836_1838delCAG	16.37:g.67913776_67913778delCAG	ENSP00000351811:p.Ser617del		Somatic				EDC4_uc010cer.2_In_Frame_Del_p.S236del|EDC4_uc010vkg.1_In_Frame_Del_p.S549del|EDC4_uc002eus.2_In_Frame_Del_p.S347del|EDC4_uc002eut.1_5'Flank	p.S617del	NM_014329	NP_055144	WXS	Illumina HiSeq	Unspecified	Q6P2E9	EDC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	16	2002_2004	+		Ovarian(137;0.0563)	617			Ser-rich.		A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	In_Frame_Del	DEL	ENST00000358933.5	37	c.1836_1838delCAG	CCDS10849.1																																																																																				0.611	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329		7	95	NA	NA	NA	NA	NA	7	95	---	---	---	---
SLC26A11	284129	broad.mit.edu	37	17	78201649	78201651	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:78201649_78201651delTGC	ENST00000361193.3	+	7	906_908	c.626_628delTGC	c.(625-630)atgctg>atg	p.L213del	SLC26A11_ENST00000411502.3_In_Frame_Del_p.L213del|SLC26A11_ENST00000572725.1_In_Frame_Del_p.L213del|SLC26A11_ENST00000546047.2_In_Frame_Del_p.L213del	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGTCTGCATGCTGCTGCTGCT	0.675																																							uc002jyb.1		NA																	0					0						c.(625-630)ATGCTG>ATG		solute carrier family 26, member 11																																				SO:0001651	inframe_deletion	284129					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity	g.chr17:78201649_78201651delTGC		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.626_628delTGC	17.37:g.78201658_78201660delTGC	ENSP00000355384:p.Leu213del		Somatic				SLC26A11_uc002jyc.1_In_Frame_Del_p.L213del|SLC26A11_uc002jyd.1_In_Frame_Del_p.L213del|SLC26A11_uc010dhv.1_In_Frame_Del_p.L213del	p.L213del	NM_173626	NP_775897	WXS	Illumina HiSeq	Unspecified	Q86WA9	S2611_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		7	895_897	+	all_neural(118;0.0538)		213			Helical; (Potential).			In_Frame_Del	DEL	ENST00000361193.3	37	c.626_628delTGC	CCDS11771.2																																																																																				0.675	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1			7	305	NA	NA	NA	NA	NA	7	305	---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47164506	47164507	+	Frame_Shift_Del	DEL	TC	TC	-	rs371758386		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:47164506_47164507delTC	ENST00000409792.3	-	3	1661_1662	c.1619_1620delGA	c.(1618-1620)cgafs	p.R541fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	541					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATGACCCTCGTCGGAATCCCAG	0.356			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(1618-1620)CGAfs		SET domain containing 2																																				SO:0001589	frameshift_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47164506_47164507delTC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1619_1620delGA	3.37:g.47164506_47164507delTC	ENSP00000386759:p.Arg541fs		Somatic				SETD2_uc003cqv.2_Frame_Shift_Del_p.R529fs	p.R540fs	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	3	1672_1673	-		Acute lymphoblastic leukemia(5;0.0169)	540					O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	c.1619_1620delGA	CCDS2749.2																																																																																				0.356	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		102	62	NA	NA	NA	NA	NA	102	62	---	---	---	---
PPP1R17	10842	broad.mit.edu	37	7	31735179	31735179	+	Frame_Shift_Del	DEL	A	A	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:31735179delA	ENST00000342032.3	+	3	807	c.179delA	c.(178-180)caafs	p.Q60fs	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	60					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)										GAGTCAGACCAAAAAAAACCA	0.438																																							uc003tcl.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(178-180)CAAfs		G-substrate isoform 1			,	4,0,4260		0,0,4,0,0,2128	142.0	138.0	140.0		,	3.6	0.8	7		141	1,3,8250		0,0,1,0,3,4123	no	codingComplex,intron	C7orf16	NM_006658.4,NM_001145123.2	,	0,0,5,0,3,6251	A1A1,A1A2,A1R,A2A2,A2R,RR		0.0485,0.0938,0.0639	,	,	31735179	5,3,12510	2203	4300	6503	SO:0001589	frameshift_variant	10842				behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction		g.chr7:31735179delA	AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.179delA	7.37:g.31735179delA	ENSP00000340125:p.Gln60fs		Somatic				C7orf16_uc011kaf.1_Intron	p.Q60fs	NM_006658	NP_006649	WXS	Illumina HiSeq	Unspecified	O96001	GSUB_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		3	337	+			60					B4DE58|Q9UDQ0	Frame_Shift_Del	DEL	ENST00000342032.3	37	c.179delA	CCDS5436.1																																																																																				0.438	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658		8	357	NA	NA	NA	NA	NA	8	357	---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55241679	55241681	+	In_Frame_Del	DEL	AAC	AAC	-	rs397517086|rs397517087		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	AAC	AAC	-	-	AAC	AAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:55241679_55241681delAAC	ENST00000275493.2	+	18	2304_2306	c.2127_2129delAAC	c.(2125-2130)gaaact>gat	p.709_710ET>D	EGFR_ENST00000455089.1_In_Frame_Del_p.664_665ET>D|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_In_Frame_Del_p.656_657ET>D	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	709			E -> A (found in a lung cancer sample; more sensitive to gefitinib than wild- type). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.|E -> G (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type). {ECO:0000269|PubMed:15623594}.|E -> K (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.E709H(2)|p.T710A(1)|p.E709_T710>D(1)|p.E709_T710>G(1)|p.E709_T710>A(1)|p.E709fs*1(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TCTTGAAGGAAACTGAATTCAAA	0.567		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		7	Substitution - Missense(3)|Complex - deletion inframe(3)|Deletion - Frameshift(1)	p.E709K(17)|p.E709A(11)|p.E709G(7)|p.E709V(5)|p.E709_T710>D(5)|p.E709H(2)|p.E709_T710>G(1)|p.E709_T710>A(1)|p.E709fs*1(1)	lung(6)|large_intestine(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2125-2130)GAAACT>GAT		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)																																			SO:0001651	inframe_deletion	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55241679_55241681delAAC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2127_2129delAAC	7.37:g.55241679_55241681delAAC	ENSP00000275493:p.Glu709_Thr710delinsAsp	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_In_Frame_Del_p.664_665ET>D|EGFR_uc011kco.1_In_Frame_Del_p.656_657ET>D	p.709_710ET>D	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		18	2373_2375	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		709_710			Cytoplasmic (Potential).		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	In_Frame_Del	DEL	ENST00000275493.2	37	c.2127_2129delAAC	CCDS5514.1																																																																																				0.567	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		95	79	NA	NA	NA	NA	NA	95	79	---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75915108	75915108	+	3'UTR	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:75915108delC	ENST00000326382.8	+	0	2116				SRRM3_ENST00000388802.4_Frame_Shift_Del_p.T637fs|RN7SL212P_ENST00000583729.1_RNA	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3											NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						CCCTCGAGGACCCCCAGTCCC	0.711																																							uc010ldi.2		NA																	0					0						c.(1909-1911)ACCfs		serine/arginine repetitive matrix 3							7.0	13.0	11.0					7																	75915108		1332	3140	4472	SO:0001624	3_prime_UTR_variant	222183							g.chr7:75915108delC	AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.*115C>-	7.37:g.75915108delC			Somatic				SRRM3_uc003uet.1_Frame_Shift_Del_p.T93fs	p.T637fs	NM_001110199	NP_001103669	WXS	Illumina HiSeq	Unspecified					16	2119	+								A6ND75	Frame_Shift_Del	DEL	ENST00000326382.8	37	c.1910delC																																																																																					0.711	SRRM3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000252889.2	NM_001110199		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
DTX2	113878	broad.mit.edu	37	7	76112249	76112249	+	Frame_Shift_Del	DEL	A	A	-	rs147779783	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:76112249delA	ENST00000324432.5	+	5	1203	c.693delA	c.(691-693)ccafs	p.P231fs	DTX2_ENST00000413936.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000446600.1_Frame_Shift_Del_p.P140fs|DTX2_ENST00000430490.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000446820.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000307569.8_Frame_Shift_Del_p.P231fs	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	231					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AGCACCCCCCACACAGGACCG	0.657																																							uc003uff.3		NA																	0				ovary(1)|skin(1)	2						c.(691-693)CCAfs		deltex 2 isoform a							125.0	130.0	128.0					7																	76112249		2203	4300	6503	SO:0001589	frameshift_variant	113878				Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding	g.chr7:76112249delA		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.693delA	7.37:g.76112249delA	ENSP00000322885:p.Pro231fs		Somatic				DTX2_uc011kgk.1_Frame_Shift_Del_p.P140fs|DTX2_uc003ufg.3_Frame_Shift_Del_p.P231fs|DTX2_uc003ufh.3_Frame_Shift_Del_p.P231fs|DTX2_uc003ufj.3_Frame_Shift_Del_p.P231fs	p.P231fs	NM_020892	NP_065943	WXS	Illumina HiSeq	Unspecified	Q86UW9	DTX2_HUMAN			5	1249	+			231					Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Frame_Shift_Del	DEL	ENST00000324432.5	37	c.693delA	CCDS5587.1																																																																																				0.657	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			10	558	NA	NA	NA	NA	NA	10	558	---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143310866	143310868	+	In_Frame_Del	DEL	GAT	GAT	-	rs142964918|rs577569567		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	GAT	GAT	-	-	GAT	GAT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:143310866_143310868delGAT	ENST00000307180.3	-	13	1636_1638	c.1519_1521delATC	c.(1519-1521)atcdel	p.I507del	TSNARE1_ENST00000524325.1_In_Frame_Del_p.I506del|TSNARE1_ENST00000520166.1_In_Frame_Del_p.I507del	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	507	Poly-Ile.				intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGAGGTGGCGATGATGATGATG	0.512																																							uc003ywk.2		NA																	0					0						c.(1519-1521)ATCdel		t-SNARE domain containing 1																																				SO:0001651	inframe_deletion	203062				vesicle-mediated transport	integral to membrane		g.chr8:143310866_143310868delGAT			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1519_1521delATC	8.37:g.143310875_143310877delGAT	ENSP00000303437:p.Ile507del		Somatic				TSNARE1_uc011lju.1_In_Frame_Del_p.I506del|TSNARE1_uc003ywj.2_In_Frame_Del_p.I508del	p.I507del	NM_145003	NP_659440	WXS	Illumina HiSeq	Unspecified	Q96NA8	TSNA1_HUMAN			13	1637_1639	-	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		507			Poly-Ile.|Helical; (Potential).		B7ZLB0|Q14D03	In_Frame_Del	DEL	ENST00000307180.3	37	c.1519_1521delATC	CCDS6384.1																																																																																				0.512	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003		7	139	NA	NA	NA	NA	NA	7	139	---	---	---	---
TDRD7	23424	broad.mit.edu	37	9	100190916	100190916	+	Frame_Shift_Del	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:100190916delC	ENST00000355295.4	+	2	464	c.169delC	c.(169-171)ccafs	p.P57fs	TDRD7_ENST00000422139.2_Intron	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	57	HTH OST-type 1. {ECO:0000255|PROSITE- ProRule:PRU00975}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				GAGAAGTGTGCCAGCAGTGGT	0.473																																							uc004axj.2		NA																	0				ovary(2)|pancreas(1)	3						c.(169-171)CCAfs		tudor domain containing 7							104.0	103.0	103.0					9																	100190916		2203	4300	6503	SO:0001589	frameshift_variant	23424				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding	g.chr9:100190916delC	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.169delC	9.37:g.100190916delC	ENSP00000347444:p.Pro57fs		Somatic				TDRD7_uc011lux.1_Intron	p.P57fs	NM_014290	NP_055105	WXS	Illumina HiSeq	Unspecified	Q8NHU6	TDRD7_HUMAN			2	394	+		Acute lymphoblastic leukemia(62;0.158)	57			Lotus/OST-HTH 1.		A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Frame_Shift_Del	DEL	ENST00000355295.4	37	c.169delC	CCDS6725.1																																																																																				0.473	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290		22	73	NA	NA	NA	NA	NA	22	73	---	---	---	---
MAGEC1	9947	broad.mit.edu	37	X	140994939	140994940	+	In_Frame_Ins	INS	-	-	CCT			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:140994939_140994940insCCT	ENST00000285879.4	+	4	2035_2036	c.1749_1750insCCT	c.(1750-1752)cct>CCTcct	p.584_584P>PP	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	584										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTCAGAGCCCTCAGGGGGA	0.584										HNSCC(15;0.026)																													uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1747-1752)insCCT		melanoma antigen family C, 1																																				SO:0001652	inframe_insertion	9947						protein binding	g.chrX:140994939_140994940insCCT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1750_1752dupCCT	X.37:g.140994940_140994942dupCCT	ENSP00000285879:p.Pro584dup	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.584_585insP	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2035_2036	+	Acute lymphoblastic leukemia(192;6.56e-05)		584_585					A0PK03|O75451|Q8TCV4	In_Frame_Ins	INS	ENST00000285879.4	37	c.1749_1750insCCT	CCDS35417.1																																																																																				0.584	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		8	637	NA	NA	NA	NA	NA	8	637	---	---	---	---
