#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GPX7	2882	broad.mit.edu	37	1	53072531	53072531	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:53072531G>A	ENST00000361314.4	+	2	352	c.314G>A	c.(313-315)cGc>cAc	p.R105H	GPX7_ENST00000459779.1_3'UTR	NM_015696.4	NP_056511.2	Q96SL4	GPX7_HUMAN	glutathione peroxidase 7	105					response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)	p.R105H(1)|p.R105L(1)		breast(1)|kidney(1)|lung(4)|upper_aerodigestive_tract(1)	7					Glutathione(DB00143)	AGCTTTGCCCGCCGCACCTAC	0.572																																							uc001cue.2		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|lung(1)		0						c.(313-315)CGC>CAC		glutathione peroxidase 7 precursor	Glutathione(DB00143)						156.0	146.0	150.0					1																	53072531		2203	4300	6503	SO:0001583	missense	2882				response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr1:53072531G>A	AF091092	CCDS569.1	1p32	2008-02-05			ENSG00000116157	ENSG00000116157			4559	protein-coding gene	gene with protein product		615784				15294905	Standard	NM_015696		Approved	FLJ14777, GPX6, NPGPx	uc001cue.3	Q96SL4	OTTHUMG00000008322	ENST00000361314.4:c.314G>A	1.37:g.53072531G>A	ENSP00000354677:p.Arg105His		Somatic					p.R105H	NM_015696	NP_056511	WXS	Illumina HiSeq	Unspecified	Q96SL4	GPX7_HUMAN			2	353	+			105					O95337|Q5T501	Missense_Mutation	SNP	ENST00000361314.4	37	c.314G>A	CCDS569.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592229	0.86953	.	.	ENSG00000116157	ENST00000361314	T	0.22743	1.94	5.21	5.21	0.72293	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.45256	0.1333	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.65443	0.935	T	0.33137	-0.9880	10	0.48119	T	0.1	-21.8428	18.7552	0.91830	0.0:0.0:1.0:0.0	.	105	Q96SL4	GPX7_HUMAN	H	105	ENSP00000354677:R105H	ENSP00000354677:R105H	R	+	2	0	GPX7	52845119	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.324000	0.96373	2.431000	0.82371	0.467000	0.42956	CGC		0.572	GPX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022913.1	NM_015696		7	102	0	0	0	0.001984	0	7	102				
HSD3B1	3283	broad.mit.edu	37	1	120056843	120056843	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:120056843C>T	ENST00000369413.3	+	4	842	c.697C>T	c.(697-699)Cac>Tac	p.H233Y	HSD3B1_ENST00000235547.6_Missense_Mutation_p.H235Y|HSD3B1_ENST00000528909.1_Missense_Mutation_p.H233Y			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	233					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.H233Y(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	GGCCTGGGCCCACATTCTGGC	0.517																																							uc001ehv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(697-699)CAC>TAC		3 beta-hydroxysteroid dehydrogenase 1	NADH(DB00157)|Trilostane(DB01108)						66.0	70.0	69.0					1																	120056843		2203	4300	6503	SO:0001583	missense	3283				androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:120056843C>T	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.697C>T	1.37:g.120056843C>T	ENSP00000358421:p.His233Tyr		Somatic				HSD3B1_uc001ehw.2_Missense_Mutation_p.H235Y	p.H233Y	NM_000862	NP_000853	WXS	Illumina HiSeq	Unspecified	P14060	3BHS1_HUMAN		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	4	842	+	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)	233					A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	37	c.697C>T	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698055	0.68386	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.87029	-2.2;-2.2;-2.2	3.26	3.26	0.37387	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94644	0.8273	H	0.96861	3.895	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.95584	0.8649	10	0.87932	D	0	-11.1486	12.346	0.55122	0.0:1.0:0.0:0.0	.	235;233	Q5TDG2;P14060	.;3BHS1_HUMAN	Y	233;235;233	ENSP00000358421:H233Y;ENSP00000235547:H235Y;ENSP00000432268:H233Y	ENSP00000235547:H235Y	H	+	1	0	HSD3B1	119858366	1.000000	0.71417	0.985000	0.45067	0.881000	0.50899	7.157000	0.77461	1.799000	0.52666	0.313000	0.20887	CAC		0.517	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862		32	53	0	0	0	0.003271	0	32	53				
CRABP2	1382	broad.mit.edu	37	1	156670345	156670345	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:156670345C>T	ENST00000368222.3	-	3	509	c.355G>A	c.(355-357)Gaa>Aaa	p.E119K	CRABP2_ENST00000368221.1_Missense_Mutation_p.E119K	NM_001199723.1|NM_001878.3	NP_001186652.1|NP_001869.1	P29373	RABP2_HUMAN	cellular retinoic acid binding protein 2	119					epidermis development (GO:0008544)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.E119K(1)		endometrium(2)|lung(3)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)				Alitretinoin(DB00523)|Tretinoin(DB00755)	AGGATCAGTTCCCCATCGTTG	0.537																																							uc001fpr.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(355-357)GAA>AAA		cellular retinoic acid binding protein 2	Alitretinoin(DB00523)						121.0	108.0	112.0					1																	156670345		2203	4300	6503	SO:0001583	missense	1382				epidermis development|regulation of transcription, DNA-dependent|signal transduction	cytoplasm|nucleus	retinal binding|retinol binding|transporter activity	g.chr1:156670345C>T	BC001109	CCDS1152.1	1q21.3	2013-03-01	2001-11-28		ENSG00000143320	ENSG00000143320		"""Fatty acid binding protein family"""	2339	protein-coding gene	gene with protein product		180231	"""cellular retinoic acid-binding protein 2"""			1654334	Standard	NM_001878		Approved	CRABP-II	uc001fpr.3	P29373	OTTHUMG00000041300	ENST00000368222.3:c.355G>A	1.37:g.156670345C>T	ENSP00000357205:p.Glu119Lys		Somatic					p.E119K	NM_001878	NP_001869	WXS	Illumina HiSeq	Unspecified	P29373	RABP2_HUMAN			3	492	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		119					B2R4Z8|D3DVC5|F1T098|Q6ICN6	Missense_Mutation	SNP	ENST00000368222.3	37	c.355G>A	CCDS1152.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.327640	0.24080	.	.	ENSG00000143320	ENST00000368222;ENST00000368221	T;T	0.09073	3.02;3.02	4.98	4.98	0.66077	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.108139	0.64402	D	0.000007	T	0.01940	0.0061	N	0.16790	0.44	0.54753	D	0.999986	B	0.27656	0.184	B	0.30105	0.111	T	0.15867	-1.0422	10	0.02654	T	1	.	15.7613	0.78082	0.0:1.0:0.0:0.0	.	119	P29373	RABP2_HUMAN	K	119	ENSP00000357205:E119K;ENSP00000357204:E119K	ENSP00000357204:E119K	E	-	1	0	CRABP2	154936969	0.996000	0.38824	0.999000	0.59377	0.961000	0.63080	3.267000	0.51577	2.319000	0.78375	0.561000	0.74099	GAA		0.537	CRABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098966.1	NM_001878		21	108	0	0	0	0.00333	0	21	108				
DUSP27	92235	broad.mit.edu	37	1	167095768	167095768	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:167095768G>A	ENST00000361200.2	+	6	1566	c.1400G>A	c.(1399-1401)cGc>cAc	p.R467H	DUSP27_ENST00000271385.5_Missense_Mutation_p.R467H|DUSP27_ENST00000443333.1_Missense_Mutation_p.R467H|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	467					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R467H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGGAGGCGCCGCGCAGACTCG	0.652																																							uc001geb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1399-1401)CGC>CAC		dual specificity phosphatase 27							21.0	21.0	21.0					1																	167095768		2202	4300	6502	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167095768G>A	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1400G>A	1.37:g.167095768G>A	ENSP00000354483:p.Arg467His		Somatic					p.R467H	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	1400	+			467					A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.1400G>A	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155451	0.38021	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03607	3.87;3.87;3.87	5.02	4.1	0.47936	.	0.086313	0.49305	D	0.000150	T	0.02649	0.0080	M	0.67953	2.075	0.30396	N	0.780517	B	0.19817	0.039	B	0.12156	0.007	T	0.12268	-1.0554	10	0.87932	D	0	-16.6929	13.7869	0.63115	0.076:0.0:0.924:0.0	.	467	Q5VZP5	DUS27_HUMAN	H	467	ENSP00000354483:R467H;ENSP00000271385:R467H;ENSP00000404874:R467H	ENSP00000271385:R467H	R	+	2	0	DUSP27	165362392	0.650000	0.27331	0.790000	0.31976	0.263000	0.26337	2.340000	0.43974	2.291000	0.77112	0.643000	0.83706	CGC		0.652	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		4	26	0	0	0	0.000248	0	4	26				
ADCY10	55811	broad.mit.edu	37	1	167798655	167798655	+	Missense_Mutation	SNP	C	C	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:167798655C>G	ENST00000367851.4	-	26	3784	c.3600G>C	c.(3598-3600)aaG>aaC	p.K1200N	ADCY10_ENST00000367848.1_Missense_Mutation_p.K1108N|ADCY10_ENST00000545172.1_Missense_Mutation_p.K1047N	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1200					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.K1200N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GTGCCAGCCTCTTCTTCCTAT	0.453																																							uc001ger.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3598-3600)AAG>AAC		adenylate cyclase 10							92.0	91.0	92.0					1																	167798655		2203	4300	6503	SO:0001583	missense	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167798655C>G	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3600G>C	1.37:g.167798655C>G	ENSP00000356825:p.Lys1200Asn		Somatic				ADCY10_uc009wvj.2_RNA|ADCY10_uc009wvk.2_Missense_Mutation_p.K1108N|ADCY10_uc010plj.1_Missense_Mutation_p.K1047N	p.K1200N	NM_018417	NP_060887	WXS	Illumina HiSeq	Unspecified	Q96PN6	ADCYA_HUMAN			26	3898	-			1200					B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	c.3600G>C	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.248975	0.59103	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.34275	1.37;1.37;1.37	5.52	3.29	0.37713	.	0.273189	0.31834	N	0.006997	T	0.32133	0.0819	M	0.70275	2.135	0.29715	N	0.839077	D;P	0.53312	0.959;0.931	P;P	0.52957	0.714;0.522	T	0.30238	-0.9985	9	0.66056	D	0.02	-15.3759	7.0356	0.24991	0.1754:0.7254:0.0:0.0991	.	1108;1200	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	N	1047;101;1200;1108	ENSP00000441992:K1047N;ENSP00000356825:K1200N;ENSP00000356822:K1108N	ENSP00000271426:K101N	K	-	3	2	ADCY10	166065279	0.986000	0.35501	1.000000	0.80357	0.935000	0.57460	1.014000	0.29950	1.309000	0.44985	0.643000	0.83706	AAG		0.453	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		13	71	0	0	0	0.00245	0	13	71				
F5	2153	broad.mit.edu	37	1	169510388	169510388	+	Missense_Mutation	SNP	G	G	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:169510388G>T	ENST00000367797.3	-	13	4141	c.3940C>A	c.(3940-3942)Cca>Aca	p.P1314T	F5_ENST00000367796.3_Missense_Mutation_p.P1319T	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1314	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.P1314T(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CCGAGGGCTGGGGAAAGGTTT	0.493																																							uc001ggg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(3940-3942)CCA>ACA		coagulation factor V precursor	Drotrecogin alfa(DB00055)						260.0	284.0	276.0					1																	169510388		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169510388G>T	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3940C>A	1.37:g.169510388G>T	ENSP00000356771:p.Pro1314Thr		Somatic					p.P1314T	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			13	4085	-	all_hematologic(923;0.208)		1314			B.|2-15.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.3940C>A	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321632	0.41096	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.31247	1.5;1.5	3.41	1.42	0.22433	.	0.990820	0.08217	N	0.979727	T	0.19087	0.0458	M	0.71206	2.165	0.26347	N	0.977264	P	0.48294	0.908	P	0.44422	0.449	T	0.12372	-1.0550	9	0.36615	T	0.2	.	7.9737	0.30143	0.2335:0.0:0.7665:0.0	.	1314	P12259	FA5_HUMAN	T	1314;1319	ENSP00000356771:P1314T;ENSP00000356770:P1319T	ENSP00000356770:P1319T	P	-	1	0	F5	167777012	0.000000	0.05858	0.029000	0.17559	0.007000	0.05969	0.221000	0.17680	0.551000	0.29008	0.555000	0.69702	CCA		0.493	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		125	632	1	0	2.51135e-46	0.00361	6.49997e-46	125	632				
NAV1	89796	broad.mit.edu	37	1	201751334	201751334	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:201751334G>A	ENST00000367296.4	+	6	2114	c.1694G>A	c.(1693-1695)gGt>gAt	p.G565D	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Missense_Mutation_p.G565D|NAV1_ENST00000295624.6_Missense_Mutation_p.G565D|NAV1_ENST00000367295.1_Missense_Mutation_p.G174D|NAV1_ENST00000367302.1_Missense_Mutation_p.G578D|NAV1_ENST00000367297.4_Missense_Mutation_p.G565D	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	565					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.G565D(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						ACAGACAAGGGTAAGCTTGCA	0.527																																							uc001gwu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(1693-1695)GGT>GAT		neuron navigator 1							108.0	115.0	113.0					1																	201751334		2203	4300	6503	SO:0001583	missense	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201751334G>A	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1694G>A	1.37:g.201751334G>A	ENSP00000356265:p.Gly565Asp		Somatic				NAV1_uc001gwv.1_Missense_Mutation_p.G73D|NAV1_uc001gww.1_Missense_Mutation_p.G174D|NAV1_uc001gwx.2_Missense_Mutation_p.G174D|NAV1_uc001gwy.1_5'UTR	p.G565D	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			6	2041	+			565					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	c.1694G>A	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868612	0.32977	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	5.28	2.32	0.28847	.	0.395181	0.29783	N	0.011211	T	0.31765	0.0807	L	0.42245	1.32	0.20489	N	0.999899	B;B;B;B	0.26845	0.034;0.029;0.161;0.034	B;B;B;B	0.30495	0.023;0.062;0.116;0.036	T	0.31308	-0.9948	10	0.87932	D	0	-12.0945	11.2482	0.49008	0.0705:0.5075:0.422:0.0	.	174;565;73;565	Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.;NAV1_HUMAN;.;.	D	578;565;565;565;565;73;174	ENSP00000356271:G578D;ENSP00000356265:G565D;ENSP00000295624:G565D;ENSP00000356266:G565D;ENSP00000356269:G565D;ENSP00000356264:G174D	ENSP00000295624:G565D	G	+	2	0	NAV1	200017957	1.000000	0.71417	0.718000	0.30602	0.861000	0.49209	3.122000	0.50446	0.349000	0.23975	-0.165000	0.13383	GGT		0.527	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		28	159	0	0	0	0.001786	0	28	159				
REN	5972	broad.mit.edu	37	1	204128652	204128652	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:204128652G>A	ENST00000272190.8	-	5	592	c.564C>T	c.(562-564)gcC>gcT	p.A188A	REN_ENST00000367195.2_Silent_p.A188A	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	188					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)	p.A188A(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	CATCAAACTCGGCCAGCATGA	0.557																																							uc001haq.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(562-564)GCC>GCT		renin preproprotein	Aliskiren(DB01258)|Remikiren(DB00212)						135.0	117.0	123.0					1																	204128652		2203	4300	6503	SO:0001819	synonymous_variant	5972				angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity	g.chr1:204128652G>A	BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.564C>T	1.37:g.204128652G>A			Somatic					p.A188A	NM_000537	NP_000528	WXS	Illumina HiSeq	Unspecified	P00797	RENI_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		5	608	-	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		188					Q6FI38|Q6T5C2	Silent	SNP	ENST00000272190.8	37	c.564C>T	CCDS30981.1																																																																																				0.557	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087891.1	NM_000537		10	63	0	0	0	0.000443	0	10	63				
PIK3C2B	5287	broad.mit.edu	37	1	204419113	204419113	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr1:204419113G>A	ENST00000367187.3	-	14	2655	c.2099C>T	c.(2098-2100)cCt>cTt	p.P700L	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.P700L	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	700	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.P700L(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGTCTCCCGAGGCAGCCGGTT	0.617																																							uc001haw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.(2098-2100)CCT>CTT		phosphoinositide-3-kinase, class 2 beta							22.0	23.0	23.0					1																	204419113		2199	4299	6498	SO:0001583	missense	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204419113G>A	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2099C>T	1.37:g.204419113G>A	ENSP00000356155:p.Pro700Leu		Somatic				PIK3C2B_uc010pqv.1_Missense_Mutation_p.P700L	p.P700L	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		14	2578	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		700					O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	c.2099C>T	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869830	0.91587	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	D;D	0.88664	-2.41;-2.41	4.83	4.83	0.62350	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.194393	0.43747	N	0.000530	D	0.93966	0.8068	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94753	0.7929	10	0.87932	D	0	.	17.5045	0.87741	0.0:0.0:1.0:0.0	.	700;700	F5GWN5;O00750	.;P3C2B_HUMAN	L	700	ENSP00000356155:P700L;ENSP00000400561:P700L	ENSP00000356155:P700L	P	-	2	0	PIK3C2B	202685736	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.536000	0.98067	2.237000	0.73441	0.305000	0.20034	CCT		0.617	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		7	6	0	0	0	0.001984	0	7	6				
UPF2	26019	broad.mit.edu	37	10	11985140	11985140	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr10:11985140C>T	ENST00000356352.2	-	16	3675	c.3202G>A	c.(3202-3204)Gga>Aga	p.G1068R	UPF2_ENST00000357604.5_Missense_Mutation_p.G1068R|UPF2_ENST00000397053.2_Missense_Mutation_p.G1068R			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1068	Glu-rich.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.G1068R(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TCTTCTTCTCCCTCATCATCA	0.328																																							uc001ila.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3202-3204)GGA>AGA		UPF2 regulator of nonsense transcripts homolog							153.0	135.0	141.0					10																	11985140		2202	4300	6502	SO:0001583	missense	26019				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding	g.chr10:11985140C>T	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3202G>A	10.37:g.11985140C>T	ENSP00000348708:p.Gly1068Arg		Somatic				UPF2_uc001ilb.2_Missense_Mutation_p.G1068R|UPF2_uc001ilc.2_Missense_Mutation_p.G1068R	p.G1068R	NM_080599	NP_542166	WXS	Illumina HiSeq	Unspecified	Q9HAU5	RENT2_HUMAN			16	3676	-		Renal(717;0.228)	1068			Glu-rich.|Sufficient for interaction with EIF4A1 and EIF1.		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	c.3202G>A	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.633758	0.29068	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.06608	3.28;3.28;3.28	5.32	4.41	0.53225	Up-frameshift suppressor 2 (1);	0.123733	0.56097	D	0.000032	T	0.02929	0.0087	N	0.03154	-0.405	0.31837	N	0.623998	B	0.02656	0.0	B	0.06405	0.002	T	0.22906	-1.0203	10	0.25106	T	0.35	.	10.1106	0.42561	0.0:0.8492:0.0:0.1508	.	1068	Q9HAU5	RENT2_HUMAN	R	1068	ENSP00000348708:G1068R;ENSP00000350221:G1068R;ENSP00000380244:G1068R	ENSP00000348708:G1068R	G	-	1	0	UPF2	12025146	0.969000	0.33509	0.993000	0.49108	0.989000	0.77384	1.739000	0.38217	2.657000	0.90304	0.644000	0.83932	GGA		0.328	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1			17	113	0	0	0	0.006122	0	17	113				
AGAP5	729092	broad.mit.edu	37	10	75457292	75457292	+	Splice_Site	SNP	T	T	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr10:75457292T>A	ENST00000374094.4	-	1	262	c.222A>T	c.(220-222)gaA>gaT	p.E74D	RP11-464F9.1_ENST00000399449.3_RNA|RP11-574K11.28_ENST00000580790.1_RNA|AGAP5_ENST00000443782.2_Splice_Site_p.E74D	NM_001144000.1	NP_001137472.1	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 5	74					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.E74D(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(5)|skin(1)	12						CCTCCTTACCTTCAGGCATCT	0.582																																							uc009xri.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(220-222)GAA>GAT		ArfGAP with GTPase domain, ankyrin repeat and PH							95.0	88.0	90.0					10																	75457292		692	1591	2283	SO:0001630	splice_region_variant	729092				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:75457292T>A		CCDS44439.1	10q22.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000172650	ENSG00000172650		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23467	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 2"""	CTGLF2			Standard	NM_001144000		Approved	Em:AC073389.1	uc009xri.3	A6NIR3	OTTHUMG00000018473	ENST00000374094.4:c.223+1A>T	10.37:g.75457292T>A			Somatic				AGAP5_uc001juu.3_Missense_Mutation_p.E35D	p.E74D	NM_001144000	NP_001137472	WXS	Illumina HiSeq	Unspecified	A6NIR3	AGAP5_HUMAN			1	263	-			74					A8MSN5	Missense_Mutation	SNP	ENST00000374094.4	37	c.222A>T	CCDS44439.1	.	.	.	.	.	.	.	.	.	.	-	16.85	3.236879	0.58886	.	.	ENSG00000172650	ENST00000374094;ENST00000443782	D;D	0.88586	-2.4;-2.4	1.4	1.4	0.22301	.	0.058594	0.64402	N	0.000004	T	0.75781	0.3896	L	0.31664	0.95	0.21675	N	0.999592	P	0.35401	0.499	B	0.29176	0.099	T	0.63440	-0.6637	10	0.26408	T	0.33	.	4.9529	0.14023	0.0:0.0:0.0:1.0	.	74	A6NIR3	AGAP5_HUMAN	D	74	ENSP00000363207:E74D;ENSP00000402792:E74D	ENSP00000363207:E74D	E	-	3	2	AGAP5	75127298	1.000000	0.71417	0.994000	0.49952	0.138000	0.21146	1.262000	0.32992	0.903000	0.36546	0.155000	0.16302	GAA		0.582	AGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_001132585	Missense_Mutation	7	134	0	0	0	0.00245	0	7	134				
MKI67	4288	broad.mit.edu	37	10	129905598	129905598	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr10:129905598G>A	ENST00000368654.3	-	13	4881	c.4506C>T	c.(4504-4506)gaC>gaT	p.D1502D	MKI67_ENST00000368653.3_Silent_p.D1142D	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1502	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.D1502D(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGTTGGTGTGTCCACTGGGT	0.498																																							uc001lke.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(4504-4506)GAC>GAT		antigen identified by monoclonal antibody Ki-67							277.0	259.0	265.0					10																	129905598		2203	4300	6503	SO:0001819	synonymous_variant	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129905598G>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4506C>T	10.37:g.129905598G>A			Somatic				MKI67_uc001lkf.2_Silent_p.D1142D|MKI67_uc009yav.1_Silent_p.D1077D|MKI67_uc009yaw.1_Silent_p.D652D	p.D1502D	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	4701	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	1502			5.|16 X 122 AA approximate repeats.		Q5VWH2	Silent	SNP	ENST00000368654.3	37	c.4506C>T	CCDS7659.1																																																																																				0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		105	268	0	0	0	0.00361	0	105	268				
GPR123	84435	broad.mit.edu	37	10	134942303	134942303	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr10:134942303G>A	ENST00000392607.3	+	7	1407	c.971G>A	c.(970-972)cGc>cAc	p.R324H	GPR123_ENST00000392606.2_Missense_Mutation_p.R227H|GPR123_ENST00000607359.1_Missense_Mutation_p.R1043H	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	324					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R324H(1)|p.R1043H(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TGCCCGCCCCGCAAGGACGCC	0.726																																							uc001llx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(970-972)CGC>CAC		G protein-coupled receptor 123							23.0	21.0	22.0					10																	134942303		2171	4249	6420	SO:0001583	missense	84435					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:134942303G>A	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.971G>A	10.37:g.134942303G>A	ENSP00000376384:p.Arg324His		Somatic				GPR123_uc001llw.2_Missense_Mutation_p.R1043H	p.R324H	NM_001083909	NP_001077378	WXS	Illumina HiSeq	Unspecified	Q86SQ6	GP123_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)	7	1407	+		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)	324			Cytoplasmic (Potential).		A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	37	c.971G>A	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	.	15.32	2.799362	0.50208	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.38887	1.11	4.38	4.38	0.52667	.	0.376195	0.20822	N	0.085049	T	0.48804	0.1520	M	0.67953	2.075	0.23696	N	0.997082	P;D	0.54964	0.894;0.969	B;P	0.51415	0.217;0.669	T	0.47636	-0.9102	10	0.66056	D	0.02	-36.4683	8.4198	0.32694	0.1054:0.0:0.8946:0.0	.	324;1043	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	H	1043;324;228	ENSP00000376384:R324H	ENSP00000357566:R1043H	R	+	2	0	GPR123	134792293	0.156000	0.22821	0.121000	0.21740	0.011000	0.07611	2.027000	0.41078	2.442000	0.82660	0.561000	0.74099	CGC		0.726	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2			7	27	0	0	0	0.001984	0	7	27				
OR4C16	219428	broad.mit.edu	37	11	55340039	55340039	+	Missense_Mutation	SNP	G	G	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr11:55340039G>T	ENST00000314634.3	+	1	436	c.436G>T	c.(436-438)Gcc>Tcc	p.A146S		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A146S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GATGGCTGTGGCCTGGGTGGG	0.498																																							uc010rih.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(436-438)GCC>TCC		olfactory receptor, family 4, subfamily C,							160.0	149.0	153.0					11																	55340039		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55340039G>T	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.436G>T	11.37:g.55340039G>T	ENSP00000324913:p.Ala146Ser		Somatic					p.A146S	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	436	+		all_epithelial(135;0.0748)	146			Helical; Name=4; (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.436G>T	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102993	0.37145	.	.	ENSG00000181935	ENST00000314634	T	0.36520	1.25	4.9	3.98	0.46160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000008	T	0.29652	0.0740	N	0.05383	-0.06	0.23903	N	0.99651	P	0.49185	0.92	P	0.59357	0.856	T	0.07347	-1.0777	10	0.25751	T	0.34	.	6.9317	0.24445	0.0938:0.1753:0.7309:0.0	.	146	Q8NGL9	OR4CG_HUMAN	S	146	ENSP00000324913:A146S	ENSP00000324913:A146S	A	+	1	0	OR4C16	55096615	0.000000	0.05858	0.833000	0.33012	0.438000	0.31896	-0.107000	0.10873	1.295000	0.44724	0.549000	0.68633	GCC		0.498	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		66	200	1	0	6.2918e-36	0.00361	1.60953e-35	66	200				
GANAB	23193	broad.mit.edu	37	11	62397858	62397858	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr11:62397858G>A	ENST00000356638.3	-	12	1522	c.1506C>T	c.(1504-1506)tgC>tgT	p.C502C	GANAB_ENST00000534779.1_Silent_p.C410C|GANAB_ENST00000346178.4_Silent_p.C524C|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_Silent_p.C405C	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	502					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.C502C(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TACCTGGCCAGCACCAGCCCT	0.572																																					Melanoma(23;1005 1074 15747 18937)	Melanoma(23;1005 1074 15747 18937)	uc001nub.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1504-1506)TGC>TGT		neutral alpha-glucosidase AB isoform 2							44.0	42.0	43.0					11																	62397858		2202	4299	6501	SO:0001819	synonymous_variant	23193				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding	g.chr11:62397858G>A	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1506C>T	11.37:g.62397858G>A			Somatic				GANAB_uc001nua.2_Silent_p.C524C|GANAB_uc001nuc.2_Silent_p.C405C|GANAB_uc010rma.1_Silent_p.C410C|GANAB_uc010rmb.1_Silent_p.C388C	p.C502C	NM_198334	NP_938148	WXS	Illumina HiSeq	Unspecified	Q14697	GANAB_HUMAN			12	1539	-			502					A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	c.1506C>T	CCDS8026.1																																																																																				0.572	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334		3	43	0	0	0	0.004672	0	3	43				
BCL9L	283149	broad.mit.edu	37	11	118770825	118770825	+	Silent	SNP	T	T	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr11:118770825T>C	ENST00000334801.3	-	7	4171	c.3207A>G	c.(3205-3207)ctA>ctG	p.L1069L	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1069	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.L1069L(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AAGTGAATGGTAGGCTGGGGT	0.642																																							uc001pug.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(3205-3207)CTA>CTG		B-cell CLL/lymphoma 9-like							108.0	103.0	104.0					11																	118770825		2200	4295	6495	SO:0001819	synonymous_variant	283149				negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity	g.chr11:118770825T>C	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3207A>G	11.37:g.118770825T>C			Somatic				BCL9L_uc009zal.2_Silent_p.L1064L	p.L1069L	NM_182557	NP_872363	WXS	Illumina HiSeq	Unspecified	Q86UU0	BCL9L_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)	7	4172	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)	1069			Pro-rich.		A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	37	c.3207A>G	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.522657	0.27211	.	.	ENSG00000186174	ENST00000530293	.	.	.	4.38	0.169	0.15017	.	.	.	.	.	T	0.51770	0.1694	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	-10.3736	6.1415	0.20263	0.1761:0.6357:0.0:0.1882	.	.	.	.	C	89	.	.	Y	-	2	0	BCL9L	118276035	0.987000	0.35691	0.999000	0.59377	0.996000	0.88848	0.243000	0.18106	0.012000	0.14892	0.459000	0.35465	TAC		0.642	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557		25	76	0	0	0	0.001061	0	25	76				
FLT1	2321	broad.mit.edu	37	13	28964125	28964125	+	Missense_Mutation	SNP	G	G	A	rs377395740	byFrequency	TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr13:28964125G>A	ENST00000282397.4	-	13	2028	c.1777C>T	c.(1777-1779)Cgg>Tgg	p.R593W	FLT1_ENST00000541932.1_Missense_Mutation_p.R593W	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	593	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.R593W(2)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTAACTGTCCGCAGTAAAATC	0.393													G|||	2	0.000399361	0.0	0.0029	5008	,	,		20429	0.0		0.0	False		,,,				2504	0.0						uc001usb.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(1777-1779)CGG>TGG		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)	G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	235.0	205.0	215.0		1777,1777,1777	6.2	1.0	13		215	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	FLT1	NM_001159920.1,NM_001160030.1,NM_002019.4	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	593/688,593/734,593/1339	28964125	1,13005	2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:28964125G>A	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1777C>T	13.37:g.28964125G>A	ENSP00000282397:p.Arg593Trp		Somatic				FLT1_uc010aar.1_Missense_Mutation_p.R593W|FLT1_uc001usc.3_Missense_Mutation_p.R593W|FLT1_uc010aas.1_RNA|FLT1_uc010aat.1_Missense_Mutation_p.R76W	p.R593W	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	13	2062	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	593			Ig-like C2-type 6.|Extracellular (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.1777C>T	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602666	0.66445	0.0	1.16E-4	ENSG00000102755	ENST00000282397;ENST00000541932	T;T	0.67698	-0.28;-0.28	6.16	6.16	0.99307	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.063541	0.64402	D	0.000013	T	0.77831	0.4189	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	P;P;P	0.59761	0.857;0.857;0.863	T	0.78319	-0.2250	10	0.62326	D	0.03	.	15.4294	0.75081	0.0:0.0:0.8295:0.1705	.	593;593;593	P17948-3;P17948-2;P17948	.;.;VGFR1_HUMAN	W	593	ENSP00000282397:R593W;ENSP00000437631:R593W	ENSP00000282397:R593W	R	-	1	2	FLT1	27862125	0.935000	0.31712	0.995000	0.50966	0.834000	0.47266	2.091000	0.41691	2.937000	0.99478	0.650000	0.86243	CGG		0.393	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			5	116	0	0	0	0.000602	0	5	116				
MYH6	4624	broad.mit.edu	37	14	23870001	23870001	+	Missense_Mutation	SNP	G	G	A	rs182373896		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr14:23870001G>A	ENST00000356287.3	-	12	1356	c.1327C>T	c.(1327-1329)Cgc>Tgc	p.R443C	MYH6_ENST00000405093.3_Missense_Mutation_p.R443C			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	443	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.R443C(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GCGTTGATGCGCGTCACCATC	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		21265	0.0		0.001	False		,,,				2504	0.0						uc001wjv.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(1327-1329)CGC>TGC		myosin heavy chain 6							153.0	118.0	130.0					14																	23870001		2203	4300	6503	SO:0001583	missense	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23870001G>A	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1327C>T	14.37:g.23870001G>A	ENSP00000348634:p.Arg443Cys		Somatic				MYH6_uc010akp.1_Missense_Mutation_p.R443C	p.R443C	NM_002471	NP_002462	WXS	Illumina HiSeq	Unspecified	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	13	1394	-	all_cancers(95;2.54e-05)		443			Myosin head-like.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	c.1327C>T	CCDS9600.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	.	16.05	3.013163	0.54468	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.89050	-2.46;-2.46	4.03	3.11	0.35812	Myosin head, motor domain (2);	.	.	.	.	D	0.96166	0.8750	H	0.98155	4.16	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95927	0.8935	9	0.87932	D	0	.	11.1099	0.48226	0.0:0.0:0.535:0.4649	.	443;443	D9YZU2;P13533	.;MYH6_HUMAN	C	443	ENSP00000386041:R443C;ENSP00000348634:R443C	ENSP00000348634:R443C	R	-	1	0	MYH6	22939841	0.000000	0.05858	0.755000	0.31263	0.863000	0.49368	-0.203000	0.09438	0.793000	0.33875	0.580000	0.79431	CGC		0.577	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			14	101	0	0	0	0.004007	0	14	101				
AKAP6	9472	broad.mit.edu	37	14	33292074	33292074	+	Silent	SNP	G	G	A	rs377635525		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr14:33292074G>A	ENST00000280979.4	+	13	5225	c.5055G>A	c.(5053-5055)gcG>gcA	p.A1685A	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1685	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.A1685A(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAGACTCAGCGGCATCTCTAA	0.433																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(5053-5055)GCG>GCA		A-kinase anchor protein 6		G		1,4405	2.1+/-5.4	0,1,2202	88.0	84.0	85.0		5055	-10.8	0.1	14		85	0,8600		0,0,4300	no	coding-synonymous	AKAP6	NM_004274.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1685/2320	33292074	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33292074G>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5055G>A	14.37:g.33292074G>A			Somatic					p.A1685A	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	5225	+	Breast(36;0.0388)|Prostate(35;0.15)		1685			Ser-rich.		A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	c.5055G>A	CCDS9644.1																																																																																				0.433	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		27	92	0	0	0	0.001786	0	27	92				
SOCS4	122809	broad.mit.edu	37	14	55510343	55510343	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr14:55510343C>T	ENST00000395472.2	+	2	916	c.584C>T	c.(583-585)cCc>cTc	p.P195L	SOCS4_ENST00000339298.2_Missense_Mutation_p.P195L|SOCS4_ENST00000555846.1_Missense_Mutation_p.P195L	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	195					intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)			p.P195L(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						AATGTTCAGCCCTGTGTCATA	0.398																																							uc001xbo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(583-585)CCC>CTC		suppressor of cytokine signaling 4							121.0	111.0	115.0					14																	55510343		2203	4300	6503	SO:0001583	missense	122809				intracellular signal transduction|negative regulation of signal transduction|regulation of growth			g.chr14:55510343C>T	AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.584C>T	14.37:g.55510343C>T	ENSP00000378855:p.Pro195Leu		Somatic				SOCS4_uc001xbp.2_Missense_Mutation_p.P195L	p.P195L	NM_199421	NP_955453	WXS	Illumina HiSeq	Unspecified	Q8WXH5	SOCS4_HUMAN			3	1149	+			195						Missense_Mutation	SNP	ENST00000395472.2	37	c.584C>T	CCDS9722.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318113	0.23994	.	.	ENSG00000180008	ENST00000395472;ENST00000555846;ENST00000339298	T;T;T	0.29917	1.55;1.55;1.55	5.34	4.46	0.54185	.	0.298023	0.27126	N	0.020808	T	0.25344	0.0616	L	0.34521	1.04	0.54753	D	0.999984	B	0.06786	0.001	B	0.06405	0.002	T	0.03651	-1.1016	10	0.48119	T	0.1	-13.0505	13.9237	0.63950	0.0:0.9276:0.0:0.0723	.	195	Q8WXH5	SOCS4_HUMAN	L	195	ENSP00000378855:P195L;ENSP00000452522:P195L;ENSP00000341327:P195L	ENSP00000341327:P195L	P	+	2	0	SOCS4	54580096	0.998000	0.40836	0.979000	0.43373	0.702000	0.40608	4.053000	0.57427	1.480000	0.48289	0.650000	0.86243	CCC		0.398	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276910.1			24	96	0	0	0	0.00333	0	24	96				
PSMA3	5684	broad.mit.edu	37	14	58727695	58727695	+	Missense_Mutation	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr14:58727695A>G	ENST00000216455.4	+	6	524	c.434A>G	c.(433-435)gAc>gGc	p.D145G	PSMA3_ENST00000557508.1_Missense_Mutation_p.D70G|PSMA3_ENST00000412908.2_Missense_Mutation_p.D138G	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3	145					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)	p.D145G(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						AGTGTGAATGACGGTGCGCAA	0.313																																							uc001xdj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(433-435)GAC>GGC		proteasome alpha 3 subunit isoform 1							154.0	145.0	148.0					14																	58727695		2203	4300	6503	SO:0001583	missense	5684				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity	g.chr14:58727695A>G		CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.434A>G	14.37:g.58727695A>G	ENSP00000216455:p.Asp145Gly		Somatic				C14orf37_uc010tro.1_Intron|PSMA3_uc001xdk.1_Missense_Mutation_p.D138G	p.D145G	NM_002788	NP_002779	WXS	Illumina HiSeq	Unspecified	P25788	PSA3_HUMAN			6	480	+			145					B2RCK6|Q86U83|Q8N1D8|Q9BS70	Missense_Mutation	SNP	ENST00000216455.4	37	c.434A>G	CCDS9731.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657717	0.47467	.	.	ENSG00000100567	ENST00000216455;ENST00000412908;ENST00000557508	T;T;T	0.18338	2.22;2.22;2.22	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.13072	0.0317	N	0.25201	0.72	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.14578	0.01;0.011	T	0.08493	-1.0719	10	0.26408	T	0.33	-13.87	15.1388	0.72595	1.0:0.0:0.0:0.0	.	138;145	P25788-2;P25788	.;PSA3_HUMAN	G	145;138;70	ENSP00000216455:D145G;ENSP00000390491:D138G;ENSP00000452056:D70G	ENSP00000216455:D145G	D	+	2	0	PSMA3	57797448	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	8.424000	0.90267	2.048000	0.60808	0.383000	0.25322	GAC		0.313	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276923.1	NM_002788		3	99	0	0	0	0.004672	0	3	99				
LTBP2	4053	broad.mit.edu	37	14	75017917	75017917	+	Silent	SNP	C	C	T	rs371191837		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr14:75017917C>T	ENST00000261978.4	-	7	1922	c.1536G>A	c.(1534-1536)ccG>ccA	p.P512P	LTBP2_ENST00000557425.1_5'UTR|LTBP2_ENST00000556690.1_Silent_p.P512P|CTD-2207P18.1_ENST00000554552.1_lincRNA	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	512					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.P512P(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCAGCCAGGGCGGGGGTCTGG	0.701																																							uc001xqa.2		NA																	1	Substitution - coding silent(1)		lung(1)	liver(1)|skin(1)	2						c.(1534-1536)CCG>CCA		latent transforming growth factor beta binding		C		0,4404		0,0,2202	22.0	25.0	24.0		1536	-6.3	0.0	14		24	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LTBP2	NM_000428.2		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		512/1822	75017917	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:75017917C>T		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1536G>A	14.37:g.75017917C>T			Somatic					p.P512P	NM_000428	NP_000419	WXS	Illumina HiSeq	Unspecified	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	7	1923	-			512					Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	c.1536G>A	CCDS9831.1																																																																																				0.701	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		9	22	0	0	0	0.004482	0	9	22				
SNRPN	6638	broad.mit.edu	37	15	25221477	25221477	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:25221477C>T	ENST00000400100.1	+	9	1071	c.181C>T	c.(181-183)Cgt>Tgt	p.R61C	SNRPN_ENST00000444203.2_Missense_Mutation_p.R65C|SNRPN_ENST00000390687.4_Missense_Mutation_p.R61C|SNRPN_ENST00000554227.2_Missense_Mutation_p.R65C|SNRPN_ENST00000346403.6_Missense_Mutation_p.R61C|SNRPN_ENST00000400098.1_Missense_Mutation_p.R61C|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000577565.1_Missense_Mutation_p.R61C|SNRPN_ENST00000400097.1_Missense_Mutation_p.R61C|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	61					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)	p.R61C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		GCAACCAGAGCGTGAAGAAAA	0.428									Prader-Willi syndrome																														uc001ywp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(181-183)CGT>TGT		small nuclear ribonucleoprotein polypeptide N							87.0	91.0	89.0					15																	25221477		1900	4118	6018	SO:0001583	missense	6638	Prader-Willsyndrome	Familial Cancer Database	Prader-Labhart-Willi syndrome	RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding	g.chr15:25221477C>T	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.181C>T	15.37:g.25221477C>T	ENSP00000382972:p.Arg61Cys		Somatic				SNRPN_uc001ywq.1_Missense_Mutation_p.R61C|SNRPN_uc001ywr.1_Missense_Mutation_p.R61C|SNRPN_uc001yws.1_Missense_Mutation_p.R61C|SNRPN_uc001ywt.1_Missense_Mutation_p.R61C|SNRPN_uc001ywv.1_Missense_Mutation_p.R64C|SNRPN_uc001yww.1_Missense_Mutation_p.R61C|SNRPN_uc001ywx.1_Missense_Mutation_p.R61C|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	p.R61C	NM_022807	NP_073718	WXS	Illumina HiSeq	Unspecified	P63162	RSMN_HUMAN		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)	9	1071	+		all_cancers(20;9.33e-22)|Breast(32;0.000625)	61					B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	37	c.181C>T	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885805	0.51908	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	4.21	1.22	0.21188	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.137297	0.48767	D	0.000174	T	0.47358	0.1441	M	0.88979	2.995	0.80722	D	1	P;P	0.34997	0.479;0.479	B;B	0.32677	0.15;0.15	T	0.45716	-0.9242	10	0.62326	D	0.03	-1.3672	5.3002	0.15773	0.1637:0.651:0.0:0.1853	.	65;61	B3KVR1;P63162	.;RSMN_HUMAN	C	61;61;61;65;61;65	ENSP00000382972:R61C;ENSP00000382970:R61C;ENSP00000382969:R61C;ENSP00000452342:R65C;ENSP00000375105:R61C;ENSP00000408767:R65C	ENSP00000375105:R61C	R	+	1	0	SNRPN	22772570	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	4.028000	0.57246	0.296000	0.22592	0.591000	0.81541	CGT		0.428	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097		22	91	0	0	0	0.003954	0	22	91				
CAPN3	825	broad.mit.edu	37	15	42695961	42695961	+	Missense_Mutation	SNP	G	G	A	rs370809015		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:42695961G>A	ENST00000397163.3	+	14	1987	c.1768G>A	c.(1768-1770)Gtg>Atg	p.V590M	CAPN3_ENST00000318023.7_Missense_Mutation_p.V590M|CAPN3_ENST00000569136.1_5'Flank|CAPN3_ENST00000561817.1_5'Flank|CAPN3_ENST00000357568.3_Missense_Mutation_p.V590M|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_5'Flank|CAPN3_ENST00000356316.3_Missense_Mutation_p.V503M|CAPN3_ENST00000397200.4_Missense_Mutation_p.V78M|CAPN3_ENST00000397204.4_5'Flank|CAPN3_ENST00000349748.3_Missense_Mutation_p.V542M	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	590	Linker.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.V590M(2)|p.V503M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TACCATCTCCGTGGATCGGCC	0.557																																							uc001zpn.1		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)	central_nervous_system(1)	1						c.(1768-1770)GTG>ATG		calpain 3 isoform a		G	MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	152.0	148.0	149.0		1768,1768,1624,232	4.8	0.7	15		149	0,8598		0,0,4299	no	missense,missense,missense,missense	CAPN3	NM_000070.2,NM_024344.1,NM_173087.1,NM_173088.1	21,21,21,21	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	590/822,590/816,542/730,78/310	42695961	1,13003	2203	4299	6502	SO:0001583	missense	825				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity	g.chr15:42695961G>A	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1768G>A	15.37:g.42695961G>A	ENSP00000380349:p.Val590Met		Somatic				CAPN3_uc001zpk.1_Missense_Mutation_p.V363M|CAPN3_uc001zpl.1_Missense_Mutation_p.V503M|CAPN3_uc010udf.1_Missense_Mutation_p.V503M|CAPN3_uc010udg.1_Missense_Mutation_p.V455M|CAPN3_uc001zpo.1_Missense_Mutation_p.V590M|CAPN3_uc001zpp.1_Missense_Mutation_p.V542M|CAPN3_uc001zpq.1_Missense_Mutation_p.V78M|CAPN3_uc010bcv.1_5'Flank|CAPN3_uc001zpr.1_5'Flank|CAPN3_uc001zps.1_5'Flank|CAPN3_uc001zpt.1_5'Flank	p.V590M	NM_000070	NP_000061	WXS	Illumina HiSeq	Unspecified	P20807	CAN3_HUMAN		GBM - Glioblastoma multiforme(94;7.36e-07)	14	2074	+		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	590			Linker.		A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	c.1768G>A	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	g	16.11	3.030878	0.54790	2.27E-4	0.0	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200	D;D;D;D;D;D	0.88509	-2.32;-2.39;-2.39;-2.23;-2.39;-1.59	5.68	4.76	0.60689	.	0.153416	0.42821	U	0.000660	T	0.77942	0.4206	N	0.08118	0	0.31225	N	0.696951	B;B;B;P;B;B	0.36125	0.266;0.403;0.385;0.538;0.403;0.425	B;B;B;B;B;B	0.31495	0.043;0.042;0.092;0.131;0.062;0.066	T	0.80306	-0.1438	10	0.66056	D	0.02	.	15.066	0.71996	0.0:0.1414:0.8586:0.0	.	455;503;542;590;590;503	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	M	503;78;590;590;542;590;78	ENSP00000348667:V503M;ENSP00000380349:V590M;ENSP00000350181:V590M;ENSP00000183936:V542M;ENSP00000326281:V590M;ENSP00000380384:V78M	ENSP00000326281:V590M	V	+	1	0	CAPN3	40483253	1.000000	0.71417	0.732000	0.30844	0.904000	0.53231	5.764000	0.68826	1.401000	0.46761	0.651000	0.88453	GTG		0.557	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1			8	155	0	0	0	0.00308	0	8	155				
STRC	161497	broad.mit.edu	37	15	43893702	43893702	+	Silent	SNP	A	A	G	rs201633242		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:43893702A>G	ENST00000450892.2	-	24	4670	c.4593T>C	c.(4591-4593)ctT>ctC	p.L1531L	RNU6-554P_ENST00000410466.1_RNA|STRC_ENST00000541030.1_Silent_p.L758L	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1531					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)		p.L1531L(1)		skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		AGAGCCTACCAAGCTGCAGGA	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18222	0.0		0.001	False		,,,				2504	0.0						uc001zsf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(4591-4593)CTT>CTC		stereocilin precursor		G		1,4399	825.6+/-416.5	0,1,2199	74.0	68.0	70.0		4593	-1.9	0.3	15		70	0,8594		0,0,4297	no	coding-synonymous	STRC	NM_153700.2		0,1,6496	GG,GA,AA		0.0,0.0227,0.0077		1531/1776	43893702	1,12993	2200	4297	6497	SO:0001819	synonymous_variant	161497				sensory perception of sound	cell surface		g.chr15:43893702A>G	BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.4593T>C	15.37:g.43893702A>G			Somatic				STRC_uc010bdl.2_Silent_p.L758L|STRC_uc001zse.2_Silent_p.L49L	p.L1531L	NM_153700	NP_714544	WXS	Illumina HiSeq	Unspecified	Q7RTU9	STRC_HUMAN		GBM - Glioblastoma multiforme(94;3.56e-07)	24	4671	-		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	1531						Silent	SNP	ENST00000450892.2	37	c.4593T>C	CCDS10098.1																																																																																				0.547	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133140.1	NM_153700		11	82	0	0	0	0.001855	0	11	82				
STRC	161497	broad.mit.edu	37	15	43893725	43893725	+	Missense_Mutation	SNP	G	G	C	rs147990592		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:43893725G>C	ENST00000450892.2	-	24	4647	c.4570C>G	c.(4570-4572)Cgt>Ggt	p.R1524G	RNU6-554P_ENST00000410466.1_RNA|STRC_ENST00000541030.1_Missense_Mutation_p.R751G	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1524					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)		p.R1524G(1)		skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TGCTCAGGACGAAATCCCCGG	0.532																																							uc001zsf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4570-4572)CGT>GGT		stereocilin precursor		G	GLY/ARG	0,4400		0,0,2200	53.0	50.0	51.0		4570	4.6	1.0	15	dbSNP_134	51	1,8593	1.2+/-3.3	0,1,4296	no	missense	STRC	NM_153700.2	125	0,1,6496	CC,CG,GG		0.0116,0.0,0.0077	benign	1524/1776	43893725	1,12993	2200	4297	6497	SO:0001583	missense	161497				sensory perception of sound	cell surface		g.chr15:43893725G>C	BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.4570C>G	15.37:g.43893725G>C	ENSP00000401513:p.Arg1524Gly		Somatic				STRC_uc010bdl.2_Missense_Mutation_p.R751G|STRC_uc001zse.2_Missense_Mutation_p.R42G	p.R1524G	NM_153700	NP_714544	WXS	Illumina HiSeq	Unspecified	Q7RTU9	STRC_HUMAN		GBM - Glioblastoma multiforme(94;3.56e-07)	24	4648	-		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	1524						Missense_Mutation	SNP	ENST00000450892.2	37	c.4570C>G	CCDS10098.1	.	.	.	.	.	.	.	.	.	.	g	17.63	3.436718	0.62955	0.0	1.16E-4	ENSG00000242866	ENST00000450892;ENST00000299992;ENST00000541030	T;T	0.78003	-1.14;-1.13	4.62	4.62	0.57501	.	0.081201	0.44285	D	0.000468	T	0.78978	0.4369	.	.	.	0.33075	D	0.535904	D;P	0.54397	0.966;0.866	P;B	0.56865	0.808;0.338	T	0.79085	-0.1948	9	0.21540	T	0.41	-3.6983	10.4643	0.44598	0.0:0.0:0.806:0.194	.	751;1524	F5GXA4;Q7RTU9	.;STRC_HUMAN	G	1524;1524;751	ENSP00000401513:R1524G;ENSP00000440413:R751G	ENSP00000299992:R1524G	R	-	1	0	STRC	41681017	0.733000	0.28132	1.000000	0.80357	0.858000	0.48976	1.717000	0.37991	2.586000	0.87340	0.556000	0.70494	CGT		0.532	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133140.1	NM_153700		5	73	0	0	0	0.001984	0	5	73				
DUOX1	53905	broad.mit.edu	37	15	45424180	45424180	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:45424180G>A	ENST00000321429.4	+	3	423	c.16G>A	c.(16-18)Gct>Act	p.A6T	DUOX1_ENST00000389037.3_Missense_Mutation_p.A6T|DUOXA1_ENST00000558422.1_5'Flank|DUOXA1_ENST00000558996.1_5'Flank|DUOXA1_ENST00000559407.1_5'Flank|DUOXA1_ENST00000559014.1_5'Flank|DUOXA1_ENST00000267803.4_5'Flank	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	6					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.A6T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CTTCTGCCTGGCTCTAGCATG	0.517																																							uc001zus.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(16-18)GCT>ACT		dual oxidase 1 precursor							124.0	133.0	130.0					15																	45424180		2198	4298	6496	SO:0001583	missense	53905				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity	g.chr15:45424180G>A	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.16G>A	15.37:g.45424180G>A	ENSP00000317997:p.Ala6Thr		Somatic				DUOXA1_uc001zup.2_5'Flank|DUOXA1_uc010bec.2_5'Flank|DUOXA1_uc001zur.1_5'Flank|DUOXA1_uc010bed.1_5'Flank|DUOX1_uc001zut.1_Missense_Mutation_p.A6T|DUOX1_uc010bee.1_5'UTR	p.A6T	NM_017434	NP_059130	WXS	Illumina HiSeq	Unspecified	Q9NRD9	DUOX1_HUMAN		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)	3	362	+		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	6					A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	c.16G>A	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382354	0.61845	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.85629	-2.01;-2.01	5.82	4.9	0.64082	.	1.250450	0.05535	N	0.564690	T	0.75228	0.3821	N	0.25647	0.755	0.26969	N	0.965635	B	0.33413	0.411	B	0.24701	0.055	T	0.59156	-0.7507	10	0.09084	T	0.74	-2.1106	10.9678	0.47422	0.0857:0.0:0.9143:0.0	.	6	Q9NRD9	DUOX1_HUMAN	T	6	ENSP00000317997:A6T;ENSP00000373689:A6T	ENSP00000317997:A6T	A	+	1	0	DUOX1	43211472	0.960000	0.32886	0.969000	0.41365	0.992000	0.81027	1.611000	0.36879	1.463000	0.47967	0.655000	0.94253	GCT		0.517	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		10	254	0	0	0	0.000673	0	10	254				
CA12	771	broad.mit.edu	37	15	63618490	63618490	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr15:63618490G>A	ENST00000178638.3	-	11	1499	c.1059C>T	c.(1057-1059)caC>caT	p.H353H	CA12_ENST00000422263.2_Silent_p.H282H|CA12_ENST00000560666.1_5'UTR|CA12_ENST00000344366.3_Silent_p.H342H	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	353					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.H353H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GACCTCAAGCGTGGGCCTCAG	0.512																																							uc002amc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1057-1059)CAC>CAT		carbonic anhydrase XII isoform 1 precursor	Acetazolamide(DB00819)						112.0	109.0	110.0					15																	63618490		2203	4300	6503	SO:0001819	synonymous_variant	771				one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding	g.chr15:63618490G>A	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.1059C>T	15.37:g.63618490G>A			Somatic				CA12_uc002amd.2_Silent_p.H342H|CA12_uc002ame.2_Silent_p.H282H	p.H353H	NM_001218	NP_001209	WXS	Illumina HiSeq	Unspecified	O43570	CAH12_HUMAN			11	1215	-			353			Cytoplasmic (Potential).		B2RE24|Q53YE5|Q9BWG2	Silent	SNP	ENST00000178638.3	37	c.1059C>T	CCDS10185.1																																																																																				0.512	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218		24	94	0	0	0	0.001061	0	24	94				
SMG1P5	595101	broad.mit.edu	37	16	30292628	30292628	+	RNA	SNP	A	A	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr16:30292628A>C	ENST00000459570.1	-	0	0																											AGTAATATTCACAGAAGATTT	0.323																																							uc002dxp.1		NA																	0					0						c.e15+1		Homo sapiens cDNA FLJ39663 fis, clone SMINT2007187.																																						595101							g.chr16:30292628A>C																													16.37:g.30292628A>C			Somatic						NR_002453		WXS	Illumina HiSeq	Unspecified					15		-									Splice_Site	SNP	ENST00000459570.1	37	c.2564_splice																																																																																					0.323	snoU13.394-201	NOVEL	basic	snoRNA	snoRNA				4	26	0	0	0	0.000248	0	4	26				
PITPNM3	83394	broad.mit.edu	37	17	6364731	6364731	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr17:6364731G>A	ENST00000262483.8	-	18	2539	c.2452C>T	c.(2452-2454)Cgg>Tgg	p.R818W	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Missense_Mutation_p.R782W	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	818					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.R818W(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCCTTCTGCCGCAGCGGGTCA	0.637																																							uc002gdd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(2452-2454)CGG>TGG		PITPNM family member 3 isoform 1							115.0	103.0	107.0					17																	6364731		2203	4300	6503	SO:0001583	missense	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6364731G>A	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2452C>T	17.37:g.6364731G>A	ENSP00000262483:p.Arg818Trp		Somatic				PITPNM3_uc010cln.2_Missense_Mutation_p.R782W|PITPNM3_uc010clm.2_Missense_Mutation_p.R301W|PITPNM3_uc002gdc.3_Missense_Mutation_p.R409W	p.R818W	NM_031220	NP_112497	WXS	Illumina HiSeq	Unspecified	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	18	2603	-			818					A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	c.2452C>T	CCDS11076.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921013	0.73213	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.76709	-1.04;-1.04	4.94	-0.272	0.12919	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.85682	D	0.000000	D	0.86293	0.5898	M	0.82517	2.595	0.45502	D	0.998469	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.95	D	0.87299	0.2304	10	0.87932	D	0	.	12.49	0.55895	0.0:0.0:0.4662:0.5338	.	782;818	F8WEW5;Q9BZ71	.;PITM3_HUMAN	W	818;782	ENSP00000262483:R818W;ENSP00000407882:R782W	ENSP00000262483:R818W	R	-	1	2	PITPNM3	6305455	0.771000	0.28555	1.000000	0.80357	0.989000	0.77384	0.705000	0.25675	0.417000	0.25871	0.462000	0.41574	CGG		0.637	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		25	53	0	0	0	0.005443	0	25	53				
MYH8	4626	broad.mit.edu	37	17	10322033	10322033	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr17:10322033C>T	ENST00000403437.2	-	5	534	c.440G>A	c.(439-441)gGc>gAc	p.G147D	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	147	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.G147D(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GCGCTTTTTGCCTCTGTAGGC	0.542									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(439-441)GGC>GAC		myosin, heavy chain 8, skeletal muscle,							77.0	86.0	82.0					17																	10322033		2203	4297	6500	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10322033C>T		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.440G>A	17.37:g.10322033C>T	ENSP00000384330:p.Gly147Asp		Somatic				uc002gml.1_Intron	p.G147D	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			5	535	-			147			Myosin head-like.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.440G>A	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580375	0.86645	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.91740	-2.9	3.74	3.74	0.42951	Myosin head, motor domain (2);	0.000000	0.42548	U	0.000688	D	0.96262	0.8781	M	0.86343	2.81	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.97193	0.9859	10	0.87932	D	0	.	16.0535	0.80777	0.0:1.0:0.0:0.0	.	147	P13535	MYH8_HUMAN	D	147	ENSP00000384330:G147D	ENSP00000252173:G147D	G	-	2	0	MYH8	10262758	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.518000	0.81795	2.090000	0.63153	0.591000	0.81541	GGC		0.542	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		4	141	0	0	0	0.000248	0	4	141				
ZNF286A	57335	broad.mit.edu	37	17	15620341	15620341	+	Missense_Mutation	SNP	G	G	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr17:15620341G>C	ENST00000464847.2	+	5	1856	c.1303G>C	c.(1303-1305)Gag>Cag	p.E435Q	ZNF286A_ENST00000583566.1_Missense_Mutation_p.E435Q|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000421016.1_Missense_Mutation_p.E435Q|ZNF286A_ENST00000413242.2_Missense_Mutation_p.E435Q|ZNF286A_ENST00000593105.1_Missense_Mutation_p.E425Q|ZNF286A_ENST00000395894.2_3'UTR			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E435Q(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TCACACTGGAGAGAAACCCTA	0.388																																							uc010cot.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1303-1305)GAG>CAG		zinc finger protein 286							46.0	54.0	52.0					17																	15620341		2203	4299	6502	SO:0001583	missense	57335				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:15620341G>C	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.1303G>C	17.37:g.15620341G>C	ENSP00000464218:p.Glu435Gln		Somatic				ZNF286A_uc002goz.3_Missense_Mutation_p.E323Q|ZNF286A_uc010vwa.1_Missense_Mutation_p.E435Q|ZNF286A_uc002gpa.2_Missense_Mutation_p.E435Q	p.E435Q	NM_001130842	NP_001124314	WXS	Illumina HiSeq	Unspecified	Q9HBT8	Z286A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)	6	1699	+			435					B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	37	c.1303G>C	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	g	17.57	3.421321	0.62622	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.25912	1.77;1.77	4.02	4.02	0.46733	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42053	D	0.000771	T	0.42154	0.1190	L	0.44542	1.39	0.40650	D	0.982028	D	0.65815	0.995	D	0.77557	0.99	T	0.41197	-0.9522	10	0.87932	D	0	-18.6853	14.0549	0.64761	0.0:0.0:1.0:0.0	.	435	Q9HBT8	Z286A_HUMAN	Q	435;425;435	ENSP00000397163:E435Q;ENSP00000408168:E425Q	ENSP00000435872:E435Q	E	+	1	0	ZNF286A	15561066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.532000	0.81985	2.248000	0.74166	0.585000	0.79938	GAG		0.388	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652		13	33	0	0	0	0.00499	0	13	33				
CACNA1G	8913	broad.mit.edu	37	17	48696099	48696099	+	Silent	SNP	G	G	A	rs375464264		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr17:48696099G>A	ENST00000359106.5	+	33	5511	c.5511G>A	c.(5509-5511)acG>acA	p.T1837T	CACNA1G_ENST00000352832.5_Silent_p.T1803T|CACNA1G_ENST00000514079.1_Silent_p.T1844T|CACNA1G_ENST00000507896.1_Silent_p.T1826T|CACNA1G_ENST00000513964.1_Silent_p.T1792T|CACNA1G_ENST00000507609.1_Silent_p.T1830T|CACNA1G_ENST00000513689.2_Silent_p.T1792T|CACNA1G_ENST00000502264.1_Silent_p.T1814T|CACNA1G_ENST00000507336.1_Silent_p.T1826T|CACNA1G_ENST00000507510.2_Silent_p.T1837T|CACNA1G_ENST00000360761.4_Silent_p.T1814T|CACNA1G_ENST00000514181.1_Silent_p.T1812T|CACNA1G_ENST00000510366.1_Silent_p.T1785T|CACNA1G_ENST00000512389.1_Silent_p.T1826T|CACNA1G_ENST00000514717.1_Silent_p.T1780T|CACNA1G_ENST00000515765.1_Silent_p.T1826T|CACNA1G_ENST00000505165.1_Silent_p.T1837T|CACNA1G_ENST00000515411.1_Silent_p.T1819T|CACNA1G_ENST00000442258.2_Silent_p.T1796T|CACNA1G_ENST00000515165.1_Silent_p.T1837T|CACNA1G_ENST00000354983.4_Silent_p.T1803T|CACNA1G_ENST00000503485.1_Silent_p.T1803T|CACNA1G_ENST00000510115.1_Silent_p.T1803T|CACNA1G_ENST00000358244.5_Silent_p.T1803T|CACNA1G_ENST00000429973.2_Silent_p.T1819T	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1837					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)	p.T1837T(2)|p.T1803T(1)		breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TCGTGCTGACGGCCCAGTTCG	0.592																																							uc002irk.1		NA																	3	Substitution - coding silent(3)		lung(3)	breast(1)	1						c.(5509-5511)ACG>ACA		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						67.0	68.0	68.0					17																	48696099		2172	4252	6424	SO:0001819	synonymous_variant	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48696099G>A	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.5511G>A	17.37:g.48696099G>A			Somatic				CACNA1G_uc002irj.1_Silent_p.T1803T|CACNA1G_uc002irl.1_Silent_p.T1814T|CACNA1G_uc002irm.1_Silent_p.T1803T|CACNA1G_uc002irn.1_Silent_p.T1796T|CACNA1G_uc002iro.1_Silent_p.T1803T|CACNA1G_uc002irp.1_Silent_p.T1837T|CACNA1G_uc002irq.1_Silent_p.T1814T|CACNA1G_uc002irr.1_Silent_p.T1837T|CACNA1G_uc002irs.1_Silent_p.T1826T|CACNA1G_uc002irt.1_Silent_p.T1819T|CACNA1G_uc002irv.1_Silent_p.T1826T|CACNA1G_uc002irw.1_Silent_p.T1814T|CACNA1G_uc002iru.1_Silent_p.T1803T|CACNA1G_uc002irx.1_Silent_p.T1750T|CACNA1G_uc002iry.1_Silent_p.T1739T|CACNA1G_uc002irz.1_Silent_p.T1743T|CACNA1G_uc002isa.1_Silent_p.T1716T|CACNA1G_uc002isb.1_Silent_p.T1757T|CACNA1G_uc002isc.1_Silent_p.T1739T|CACNA1G_uc002isd.1_Silent_p.T1725T|CACNA1G_uc002ise.1_Silent_p.T1705T|CACNA1G_uc002isf.1_Silent_p.T1732T|CACNA1G_uc002isg.1_Silent_p.T1698T|CACNA1G_uc002ish.1_Silent_p.T1705T|CACNA1G_uc002isi.1_Silent_p.T1693T	p.T1837T	NM_018896	NP_061496	WXS	Illumina HiSeq	Unspecified	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		33	5883	+	Breast(11;6.7e-17)		1837			IV.|Helical; Name=S6 of repeat IV; (Potential).		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	37	c.5511G>A	CCDS45730.1																																																																																				0.592	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		8	46	0	0	0	0.004482	0	8	46				
ST6GALNAC1	55808	broad.mit.edu	37	17	74625694	74625694	+	Silent	SNP	T	T	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr17:74625694T>A	ENST00000156626.7	-	2	430	c.231A>T	c.(229-231)gcA>gcT	p.A77A	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	77					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.A77A(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						GCACTGGCTCTGCATAGATGG	0.572																																							uc002jsh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(229-231)GCA>GCT		sialyltransferase 7A							165.0	146.0	153.0					17																	74625694		2203	4300	6503	SO:0001819	synonymous_variant	55808				protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity	g.chr17:74625694T>A	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.231A>T	17.37:g.74625694T>A			Somatic				ST6GALNAC1_uc002jsi.2_5'UTR|ST6GALNAC1_uc002jsj.2_RNA	p.A77A	NM_018414	NP_060884	WXS	Illumina HiSeq	Unspecified	Q9NSC7	SIA7A_HUMAN			2	405	-			77			Lumenal (Potential).		Q6UW90|Q9NSC6	Silent	SNP	ENST00000156626.7	37	c.231A>T	CCDS11748.1																																																																																				0.572	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414		7	217	0	0	0	0.001984	0	7	217				
CTAGE1	64693	broad.mit.edu	37	18	19996170	19996170	+	5'Flank	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr18:19996170C>T	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Silent_p.P535P			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)		p.P535P(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TCTGATGGTCCGGAGGATTCC	0.552																																							uc002ktv.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1603-1605)CCG>CCA		cutaneous T-cell lymphoma-associated antigen 1							95.0	98.0	97.0					18																	19996170		2202	4300	6502	SO:0001631	upstream_gene_variant	64693					integral to membrane		g.chr18:19996170C>T	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19996170C>T	Exception_encountered		Somatic					p.P535P	NM_172241	NP_758441	WXS	Illumina HiSeq	Unspecified	Q96RT6	CTGE2_HUMAN			1	1709	-	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)		535					B0YIZ3	Silent	SNP	ENST00000525417.1	37	c.1605G>A																																																																																					0.552	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		4	115	0	0	0	0.000248	0	4	115				
LONP1	9361	broad.mit.edu	37	19	5699098	5699098	+	Missense_Mutation	SNP	C	C	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr19:5699098C>A	ENST00000360614.3	-	10	1782	c.1625G>T	c.(1624-1626)cGa>cTa	p.R542L	LONP1_ENST00000540670.2_Missense_Mutation_p.R346L|LONP1_ENST00000590729.1_Missense_Mutation_p.R412L|LONP1_ENST00000585374.1_Missense_Mutation_p.R428L|LONP1_ENST00000593119.1_Missense_Mutation_p.R478L	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial									p.R542L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGTACTCTCGGTTCAGGGC	0.652																																							uc002mcx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1624-1626)CGA>CTA		mitochondrial lon peptidase 1 precursor							63.0	54.0	57.0					19																	5699098		2203	4300	6503	SO:0001583	missense	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5699098C>A	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1625G>T	19.37:g.5699098C>A	ENSP00000353826:p.Arg542Leu		Somatic				LONP1_uc002mcy.2_Missense_Mutation_p.R478L|LONP1_uc010duh.2_Missense_Mutation_p.R283L|LONP1_uc010dui.2_Missense_Mutation_p.R526L|LONP1_uc002mcz.2_Missense_Mutation_p.R346L	p.R542L	NM_004793	NP_004784	WXS	Illumina HiSeq	Unspecified	P36776	LONM_HUMAN			10	1658	-			542						Missense_Mutation	SNP	ENST00000360614.3	37	c.1625G>T	CCDS12148.1	.	.	.	.	.	.	.	.	.	.	C	35	5.458838	0.96240	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	D;D	0.92495	-3.05;-3.05	4.73	4.73	0.59995	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000001	D	0.95579	0.8563	M	0.75884	2.315	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96125	0.9088	10	0.87932	D	0	-17.3962	15.1874	0.73016	0.0:1.0:0.0:0.0	.	542;478;542	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	L	542;506;346	ENSP00000353826:R542L;ENSP00000441523:R346L	ENSP00000351177:R506L	R	-	2	0	LONP1	5650098	1.000000	0.71417	0.970000	0.41538	0.994000	0.84299	7.526000	0.81920	2.183000	0.69458	0.549000	0.68633	CGA		0.652	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		12	39	1	0	1.5842e-08	0.001855	3.916e-08	12	39				
ZNF506	440515	broad.mit.edu	37	19	19905881	19905881	+	Missense_Mutation	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr19:19905881A>G	ENST00000540806.2	-	4	903	c.815T>C	c.(814-816)cTt>cCt	p.L272P	ZNF506_ENST00000450683.2_Missense_Mutation_p.L240P|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000443905.2_Missense_Mutation_p.L272P|ZNF506_ENST00000587461.1_Intron			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	272					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L272P(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						ATGTGAAAAAAGGGTTGCAGG	0.373																																							uc010eci.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(814-816)CTT>CCT		zinc finger protein 506 isoform 1							47.0	53.0	51.0					19																	19905881		2180	4286	6466	SO:0001583	missense	440515				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding	g.chr19:19905881A>G	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.815T>C	19.37:g.19905881A>G	ENSP00000440625:p.Leu272Pro		Somatic				ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Missense_Mutation_p.L240P	p.L272P	NM_001099269	NP_001092739	WXS	Illumina HiSeq	Unspecified	Q5JVG8	ZN506_HUMAN			4	963	-			272			C2H2-type 3.		B3KTH6	Missense_Mutation	SNP	ENST00000540806.2	37	c.815T>C	CCDS42531.1	.	.	.	.	.	.	.	.	.	.	a	11.88	1.771408	0.31320	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.16196	2.36;2.36;2.36	0.974	0.974	0.19715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45196	0.1330	M	0.92649	3.33	0.26449	N	0.975639	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.20273	-1.0280	9	0.87932	D	0	.	5.7771	0.18285	1.0:0.0:0.0:0.0	.	272;240	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	P	272;272;240	ENSP00000393835:L272P;ENSP00000440625:L272P;ENSP00000408892:L240P	ENSP00000393835:L272P	L	-	2	0	ZNF506	19766881	0.624000	0.27102	0.011000	0.14972	0.010000	0.07245	4.488000	0.60300	0.358000	0.24211	0.347000	0.21830	CTT		0.373	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218		3	56	0	0	0	0.000248	0	3	56				
ZNF208	7757	broad.mit.edu	37	19	22154452	22154452	+	Silent	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr19:22154452A>G	ENST00000397126.4	-	4	3532	c.3384T>C	c.(3382-3384)ctT>ctC	p.L1128L	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L1000L(2)|p.L1128L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGTTTAGTAAGGATTGAGA	0.373																																							uc002nqp.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(5)|skin(2)	7						c.(2998-3000)CTT>CTC		zinc finger protein 208							57.0	61.0	60.0					19																	22154452		2123	4245	6368	SO:0001819	synonymous_variant	7757							g.chr19:22154452A>G	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3384T>C	19.37:g.22154452A>G			Somatic				ZNF208_uc002nqo.1_Intron	p.L1000L	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					6	3149	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.3000T>C	CCDS54240.1																																																																																				0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		3	107	0	0	0	0.004672	0	3	107				
KLK3	354	broad.mit.edu	37	19	51361824	51361824	+	Silent	SNP	C	C	T	rs370658603		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr19:51361824C>T	ENST00000326003.2	+	4	644	c.603C>T	c.(601-603)cgC>cgT	p.R201R	KLK3_ENST00000593997.1_Silent_p.R201R|KLK3_ENST00000597483.1_Silent_p.R158R|KLK3_ENST00000595952.1_Silent_p.R158R|KLK3_ENST00000360617.3_Silent_p.R201R	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	201	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R201R(2)		breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GTGCTGGACGCTGGACAGGGG	0.527																																					Colon(185;1767 2023 13025 30120 37630)	Colon(185;1767 2023 13025 30120 37630)	uc002pts.1		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(601-603)CGC>CGT		prostate specific antigen isoform 3		C	,,	0,4406		0,0,2203	141.0	127.0	132.0		603,474,603	0.2	0.0	19		132	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	KLK3	NM_001030047.1,NM_001030048.1,NM_001648.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	201/239,158/219,201/262	51361824	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	354				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51361824C>T	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.603C>T	19.37:g.51361824C>T			Somatic				KLK3_uc010ycj.1_Silent_p.R160R|KLK3_uc002ptr.1_Silent_p.R158R|KLK3_uc010eof.1_RNA	p.R201R	NM_001030047	NP_001025218	WXS	Illumina HiSeq	Unspecified	P07288	KLK3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)	4	644	+		all_neural(266;0.057)	201			Peptidase S1.		C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Silent	SNP	ENST00000326003.2	37	c.603C>T	CCDS12807.1																																																																																				0.527	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864		48	39	0	0	0	0.00361	0	48	39				
AGBL5	60509	broad.mit.edu	37	2	27281274	27281274	+	Nonsense_Mutation	SNP	C	C	T	rs534435290		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr2:27281274C>T	ENST00000360131.4	+	10	1837	c.1678C>T	c.(1678-1680)Cga>Tga	p.R560*	AGBL5-IT1_ENST00000411862.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.R560*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	560					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.R560*(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAGGTGGGACGAGCTATGGC	0.582																																							uc002rie.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1678-1680)CGA>TGA		ATP/GTP binding protein-like 5 isoform 1							107.0	98.0	101.0					2																	27281274		2203	4300	6503	SO:0001587	stop_gained	60509				protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr2:27281274C>T	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1678C>T	2.37:g.27281274C>T	ENSP00000353249:p.Arg560*		Somatic				AGBL5_uc002rid.2_Nonsense_Mutation_p.R560*|AGBL5_uc002rif.2_RNA	p.R560*	NM_021831	NP_068603	WXS	Illumina HiSeq	Unspecified	Q8NDL9	CBPC5_HUMAN			10	1895	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		560					A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	ENST00000360131.4	37	c.1678C>T	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	C	39	7.458385	0.98296	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	.	.	.	5.79	4.0	0.46444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9452	14.6168	0.68556	0.4505:0.5495:0.0:0.0	.	.	.	.	X	560	.	ENSP00000323681:R560X	R	+	1	2	AGBL5	27134778	0.751000	0.28327	0.998000	0.56505	0.944000	0.59088	1.003000	0.29809	0.805000	0.34159	-0.791000	0.03333	CGA		0.582	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831		16	33	0	0	0	0.006122	0	16	33				
CLASP1	23332	broad.mit.edu	37	2	122139812	122139812	+	Missense_Mutation	SNP	T	T	C	rs368898801		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr2:122139812T>C	ENST00000263710.4	-	33	3852	c.3463A>G	c.(3463-3465)Aag>Gag	p.K1155E	CLASP1_ENST00000545861.1_Intron|CLASP1_ENST00000541377.1_Intron|CLASP1_ENST00000397587.3_Intron|CLASP1_ENST00000455322.2_Intron|CLASP1_ENST00000541859.1_Intron|CLASP1_ENST00000409078.3_Intron	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1155					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)	p.K1155E(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CTGAGAGCCTTGTGGGAGGGA	0.532																																							uc002tnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(3463-3465)AAG>GAG		CLIP-associating protein 1 isoform 1		T	,,,GLU/LYS	1,3979		0,1,1989	58.0	69.0	66.0		,,,3463	5.6	1.0	2		66	0,8290		0,0,4145	no	intron,intron,intron,missense	CLASP1	NM_001142273.1,NM_001142274.1,NM_001207051.1,NM_015282.2	,,,56	0,1,6134	CC,CT,TT		0.0,0.0251,0.0081	,,,benign	,,,1155/1539	122139812	1,12269	1990	4145	6135	SO:0001583	missense	23332				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding	g.chr2:122139812T>C	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3463A>G	2.37:g.122139812T>C	ENSP00000263710:p.Lys1155Glu		Somatic				CLASP1_uc010yyv.1_Intron|CLASP1_uc002tmz.2_Missense_Mutation_p.K240E|CLASP1_uc002tna.2_Intron|CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tnf.2_Intron	p.K1155E	NM_015282	NP_056097	WXS	Illumina HiSeq	Unspecified	Q7Z460	CLAP1_HUMAN			32	3853	-	Renal(3;0.0496)		1155					B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37	c.3463A>G		.	.	.	.	.	.	.	.	.	.	T	13.16	2.155091	0.38021	2.51E-4	0.0	ENSG00000074054	ENST00000263710	T	0.16897	2.31	5.55	5.55	0.83447	Armadillo-type fold (1);	0.212494	0.34088	N	0.004273	T	0.08044	0.0201	N	0.08118	0	0.80722	D	1	B	0.32918	0.39	B	0.24701	0.055	T	0.33523	-0.9865	10	0.11182	T	0.66	-12.1487	14.559	0.68123	0.0:0.0:0.0:1.0	.	1155	Q7Z460	CLAP1_HUMAN	E	1155	ENSP00000263710:K1155E	ENSP00000263710:K1155E	K	-	1	0	CLASP1	121856282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.344000	0.79328	2.234000	0.73211	0.533000	0.62120	AAG		0.532	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282		4	11	0	0	0	0.000248	0	4	11				
FRG1B	284802	broad.mit.edu	37	20	29614328	29614328	+	Splice_Site	SNP	G	G	A	rs200267032		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr20:29614328G>A	ENST00000278882.3	+	2	320		c.e2+1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGATACGTTGGTGAGTCAGTT	0.289																																							uc010ztk.1		NA																	0					0						c.e1+1		RecName: Full=Protein FRG1B;																																				SO:0001630	splice_region_variant	284802							g.chr20:29614328G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-61+1G>A	20.37:g.29614328G>A			Somatic				FRG1B_uc002wvm.1_Splice_Site|FRG1B_uc010ztj.1_Splice_Site|FRG1B_uc010gdr.1_Splice_Site				WXS	Illumina HiSeq	Unspecified					1	67	+								C4AME5	Splice_Site	SNP	ENST00000278882.3	37	c.-6_splice																																																																																					0.289	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron	5	82	0	0	0	0.00308	0	5	82				
FAM83C	128876	broad.mit.edu	37	20	33876276	33876276	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr20:33876276G>A	ENST00000374408.3	-	3	890	c.794C>T	c.(793-795)gCg>gTg	p.A265V	FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	265								p.A265V(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GTAACTGCCCGCCACCACTTG	0.637																																							uc010zux.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(793-795)GCG>GTG		hypothetical protein LOC128876							63.0	63.0	63.0					20																	33876276		2203	4300	6503	SO:0001583	missense	128876							g.chr20:33876276G>A	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.794C>T	20.37:g.33876276G>A	ENSP00000363529:p.Ala265Val		Somatic				FAM83C_uc002xcb.1_Intron	p.A265V	NM_178468	NP_848563	WXS	Illumina HiSeq	Unspecified	Q9BQN1	FA83C_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00252)		3	912	-			265					Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	c.794C>T	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	9.489	1.100173	0.20552	.	.	ENSG00000125998	ENST00000374408	T	0.11169	2.8	4.52	0.106	0.14540	.	0.291196	0.30820	N	0.008804	T	0.07593	0.0191	L	0.34521	1.04	0.49915	D	0.999836	B	0.18863	0.031	B	0.17433	0.018	T	0.26292	-1.0107	10	0.40728	T	0.16	-9.2287	8.19	0.31363	0.3754:0.0:0.6246:0.0	.	265	Q9BQN1	FA83C_HUMAN	V	265	ENSP00000363529:A265V	ENSP00000363529:A265V	A	-	2	0	FAM83C	33339690	0.297000	0.24408	0.083000	0.20561	0.470000	0.32858	3.187000	0.50950	-0.145000	0.11294	-0.254000	0.11334	GCG		0.637	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3			19	41	0	0	0	0.001882	0	19	41				
BLCAP	10904	broad.mit.edu	37	20	36147457	36147457	+	Silent	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr20:36147457C>T	ENST00000373537.2	-	2	434	c.120G>A	c.(118-120)cgG>cgA	p.R40R	BLCAP_ENST00000397137.1_Silent_p.R40R|BLCAP_ENST00000397134.1_Silent_p.R40R|NNAT_ENST00000062104.2_5'Flank|BLCAP_ENST00000414542.2_Silent_p.R40R|BLCAP_ENST00000397135.1_Silent_p.R40R|BLCAP_ENST00000397131.1_Silent_p.R40R|NNAT_ENST00000346199.2_5'Flank	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	P62952	BLCAP_HUMAN	bladder cancer associated protein	40					apoptotic nuclear changes (GO:0030262)|cell cycle (GO:0007049)	integral component of membrane (GO:0016021)		p.R40R(1)		breast(1)|large_intestine(1)|lung(2)|stomach(1)	5		Myeloproliferative disorder(115;0.00878)				TGCAAGGCTTCCGTTCCAGGA	0.567																																							uc002xha.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(118-120)CGG>CGA		bladder cancer associated protein							61.0	60.0	60.0					20																	36147457		2203	4300	6503	SO:0001819	synonymous_variant	10904				apoptosis|cell cycle	integral to membrane		g.chr20:36147457C>T	AF053470	CCDS13295.1	20q11.23	2006-01-29			ENSG00000166619	ENSG00000166619			1055	protein-coding gene	gene with protein product		613110				10197429	Standard	NM_006698		Approved	BC10	uc021wdf.1	P62952	OTTHUMG00000032419	ENST00000373537.2:c.120G>A	20.37:g.36147457C>T			Somatic				BLCAP_uc002xhb.2_Silent_p.R40R|BLCAP_uc002xhc.2_Silent_p.R40R|NNAT_uc002xhd.2_5'Flank|NNAT_uc002xhe.2_5'Flank	p.R40R	NM_006698	NP_006689	WXS	Illumina HiSeq	Unspecified	P62952	BLCAP_HUMAN			2	323	-		Myeloproliferative disorder(115;0.00878)	40					A2A2K7|O60629|Q9D3B5	Silent	SNP	ENST00000373537.2	37	c.120G>A	CCDS13295.1																																																																																				0.567	BLCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079113.2	NM_006698		5	28	0	0	0	0.000602	0	5	28				
RFPL1	5988	broad.mit.edu	37	22	29837625	29837625	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr22:29837625G>A	ENST00000354373.2	+	2	677	c.468G>A	c.(466-468)cgG>cgA	p.R156R	RFPL1S_ENST00000539579.1_RNA|RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	156	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)	p.R156R(1)		endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						CACAGAATCGGCAAGACCTTG	0.557																																							uc003afn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(466-468)CGG>CGA		ret finger protein-like 1							150.0	129.0	136.0					22																	29837625		2203	4300	6503	SO:0001819	synonymous_variant	5988						zinc ion binding	g.chr22:29837625G>A	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.468G>A	22.37:g.29837625G>A			Somatic				RFPL1S_uc003afm.1_RNA	p.R156R	NM_021026	NP_066306	WXS	Illumina HiSeq	Unspecified	O75677	RFPL1_HUMAN			2	677	+			156			B30.2/SPRY.		Q6IC06|Q9UJ97	Silent	SNP	ENST00000354373.2	37	c.468G>A	CCDS13857.2																																																																																				0.557	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	NM_021026		4	81	0	0	0	0.000602	0	4	81				
TMPRSS6	164656	broad.mit.edu	37	22	37499438	37499438	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr22:37499438G>A	ENST00000346753.3	-	2	163	c.47C>T	c.(46-48)cCc>cTc	p.P16L	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.P7L|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.P7L|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.P7L|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.P16L	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	16					angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.P16L(1)		breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						AGCCACCTGGGGGGCCTCGGC	0.657																																							uc003aqs.1		NA																	1	Substitution - Missense(1)	p.P16fs*12(1)	lung(1)	breast(4)|ovary(1)|skin(1)	6						c.(46-48)CCC>CTC		transmembrane protease, serine 6							93.0	101.0	98.0					22																	37499438		2203	4300	6503	SO:0001583	missense	164656				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity	g.chr22:37499438G>A	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.47C>T	22.37:g.37499438G>A	ENSP00000334962:p.Pro16Leu		Somatic				TMPRSS6_uc003aqt.1_Missense_Mutation_p.P7L|TMPRSS6_uc003aqu.2_Missense_Mutation_p.P7L	p.P16L	NM_153609	NP_705837	WXS	Illumina HiSeq	Unspecified	Q8IU80	TMPS6_HUMAN			2	161	-			16			Cytoplasmic (Potential).		B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	c.47C>T	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527783	0.44969	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782;ENST00000423761	D;D;D;D;D;D	0.92647	-3.07;-3.08;-3.06;-3.07;-1.5;-2.85	4.03	2.97	0.34412	.	0.000000	0.37178	N	0.002219	D	0.92090	0.7493	L	0.51422	1.61	0.41937	D	0.990591	D;P;P	0.63046	0.992;0.944;0.906	P;P;B	0.57620	0.824;0.548;0.346	D	0.90193	0.4251	10	0.42905	T	0.14	.	9.7806	0.40645	0.0:0.211:0.789:0.0	.	16;7;16	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	L	7;16;7;7;16;7	ENSP00000371211:P7L;ENSP00000334962:P16L;ENSP00000385453:P7L;ENSP00000384964:P7L;ENSP00000397691:P16L;ENSP00000400317:P7L	ENSP00000334962:P16L	P	-	2	0	TMPRSS6	35829384	1.000000	0.71417	0.989000	0.46669	0.306000	0.27790	2.800000	0.47900	0.779000	0.33543	0.498000	0.49722	CCC		0.657	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609		27	93	0	0	0	0.001271	0	27	93				
DHX30	22907	broad.mit.edu	37	3	47859533	47859533	+	Missense_Mutation	SNP	G	G	A	rs138729543		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr3:47859533G>A	ENST00000445061.1	+	4	457	c.50G>A	c.(49-51)cGt>cAt	p.R17H	DHX30_ENST00000476446.1_3'UTR|DHX30_ENST00000348968.4_5'UTR|DHX30_ENST00000446256.2_5'UTR	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	17						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.R17H(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		cacaggcagcgtcagtgcaaa	0.607																																							uc003cru.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(49-51)CGT>CAT		DEAH (Asp-Glu-Ala-His) box polypeptide 30		G	,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	166.0	149.0	155.0		,50	4.8	1.0	3	dbSNP_134	155	0,8600		0,0,4300	no	utr-5,missense	DHX30	NM_014966.3,NM_138615.2	,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging	,17/1195	47859533	1,13005	2203	4300	6503	SO:0001583	missense	22907					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr3:47859533G>A	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.50G>A	3.37:g.47859533G>A	ENSP00000405620:p.Arg17His		Somatic				DHX30_uc003crs.2_5'UTR|DHX30_uc003crt.2_5'UTR	p.R17H	NM_138615	NP_619520	WXS	Illumina HiSeq	Unspecified	Q7L2E3	DHX30_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	4	476	+			17					A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	c.50G>A	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444257	0.63067	2.27E-4	0.0	ENSG00000132153	ENST00000445061	T	0.03553	3.89	5.73	4.85	0.62838	.	1.026420	0.07775	N	0.952467	T	0.04048	0.0113	N	0.22421	0.69	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43065	-0.9414	10	0.87932	D	0	.	9.6697	0.40004	0.092:0.0:0.908:0.0	.	17	Q7L2E3	DHX30_HUMAN	H	17	ENSP00000405620:R17H	ENSP00000379094:R17H	R	+	2	0	DHX30	47834537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.987000	0.49378	2.706000	0.92434	0.563000	0.77884	CGT		0.607	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		27	87	0	0	0	0.002445	0	27	87				
PTPRG	5793	broad.mit.edu	37	3	62254711	62254711	+	Splice_Site	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr3:62254711G>A	ENST00000474889.1	+	20	3253	c.2876G>A	c.(2875-2877)cGa>cAa	p.R959Q	PTPRG-AS1_ENST00000479018.1_RNA|PTPRG_ENST00000295874.10_Splice_Site_p.R930Q|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	959	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R959Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TTTCTGCAGCGAAAATGTGAT	0.363																																							uc003dlb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(2)	7						c.(2875-2877)CGA>CAA		protein tyrosine phosphatase, receptor type, G							87.0	79.0	82.0					3																	62254711		2203	4300	6503	SO:0001630	splice_region_variant	5793				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr3:62254711G>A	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2875-1G>A	3.37:g.62254711G>A			Somatic				PTPRG_uc003dlc.2_Missense_Mutation_p.R930Q|PTPRG_uc011bfi.1_Missense_Mutation_p.R205Q|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	p.R959Q	NM_002841	NP_002832	WXS	Illumina HiSeq	Unspecified	P23470	PTPRG_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)	20	3595	+			959			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.		B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	c.2876G>A	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	G	35	5.558374	0.96514	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	D;D	0.83419	-1.72;-1.72	5.83	5.83	0.93111	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	L	0.47078	1.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;P;D	0.79108	0.992;0.861;0.982	D	0.88963	0.3395	10	0.62326	D	0.03	.	20.1338	0.98010	0.0:0.0:1.0:0.0	.	205;930;959	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	Q	959;930	ENSP00000418112:R959Q;ENSP00000295874:R930Q	ENSP00000295874:R930Q	R	+	2	0	PTPRG	62229751	1.000000	0.71417	0.996000	0.52242	0.897000	0.52465	9.710000	0.98732	2.770000	0.95276	0.655000	0.94253	CGA		0.363	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	Missense_Mutation	5	50	0	0	0	0.001984	0	5	50				
P2RY1	5028	broad.mit.edu	37	3	152553609	152553609	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr3:152553609C>T	ENST00000305097.3	+	1	874	c.38C>T	c.(37-39)aCg>aTg	p.T13M		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	13					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.T13M(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CCCAACGGGACGGACGCTGCC	0.692																																							uc003ezq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(37-39)ACG>ATG		purinergic receptor P2Y1							22.0	23.0	23.0					3																	152553609		2202	4298	6500	SO:0001583	missense	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152553609C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.38C>T	3.37:g.152553609C>T	ENSP00000304767:p.Thr13Met		Somatic					p.T13M	NM_002563	NP_002554	WXS	Illumina HiSeq	Unspecified	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	874	+			13			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000305097.3	37	c.38C>T	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611440	0.87258	.	.	ENSG00000169860	ENST00000305097	T	0.68479	-0.33	5.09	5.09	0.68999	.	0.516897	0.17268	N	0.180493	T	0.52901	0.1763	N	0.08118	0	0.58432	D	0.999993	D	0.61080	0.989	B	0.44315	0.446	T	0.64558	-0.6379	10	0.72032	D	0.01	.	17.4954	0.87716	0.0:1.0:0.0:0.0	.	13	P47900	P2RY1_HUMAN	M	13	ENSP00000304767:T13M	ENSP00000304767:T13M	T	+	2	0	P2RY1	154036299	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.220000	0.58567	2.332000	0.79248	0.561000	0.74099	ACG		0.692	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		4	32	0	0	0	0.000248	0	4	32				
SKIL	6498	broad.mit.edu	37	3	170078422	170078422	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr3:170078422G>A	ENST00000458537.3	+	1	1012	c.303G>A	c.(301-303)ctG>ctA	p.L101L	SKIL_ENST00000426052.2_Silent_p.L81L|SKIL_ENST00000413427.2_Silent_p.L101L|SKIL_ENST00000259119.4_Silent_p.L101L	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	101					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.L101L(2)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AGAGCTCGCTGGGTGGACCAG	0.463																																							uc003fgu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(301-303)CTG>CTA		SKI-like isoform 1							150.0	156.0	154.0					3																	170078422		2203	4300	6503	SO:0001819	synonymous_variant	6498				cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity	g.chr3:170078422G>A	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.303G>A	3.37:g.170078422G>A			Somatic				SKIL_uc011bps.1_Silent_p.L81L|SKIL_uc003fgv.2_Silent_p.L101L|SKIL_uc003fgw.2_Silent_p.L101L	p.L101L	NM_005414	NP_005405	WXS	Illumina HiSeq	Unspecified	P12757	SKIL_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		2	1015	+	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		101					A6NGT1|B4DT50|O00464|P12756|Q07501	Silent	SNP	ENST00000458537.3	37	c.303G>A	CCDS33890.1																																																																																				0.463	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414		59	214	0	0	0	0.00361	0	59	214				
CHRD	8646	broad.mit.edu	37	3	184103862	184103862	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr3:184103862C>T	ENST00000204604.1	+	15	2093	c.1847C>T	c.(1846-1848)cCg>cTg	p.P616L	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Missense_Mutation_p.P246L|CHRD_ENST00000348986.3_Missense_Mutation_p.P576L|CHRD_ENST00000450923.1_Missense_Mutation_p.P616L	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	616	CHRD 4. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)	p.P329L(1)|p.P616L(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACCTGGAGCCGGAACTGCTG	0.592																																							uc003fov.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1846-1848)CCG>CTG		chordin precursor							95.0	97.0	96.0					3																	184103862		2203	4300	6503	SO:0001583	missense	8646				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding	g.chr3:184103862C>T	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1847C>T	3.37:g.184103862C>T	ENSP00000204604:p.Pro616Leu		Somatic				CHRD_uc003fow.2_Missense_Mutation_p.P246L|CHRD_uc003fox.2_Missense_Mutation_p.P616L|CHRD_uc003foy.2_Missense_Mutation_p.P246L|CHRD_uc010hyc.2_Missense_Mutation_p.P206L|CHRD_uc011brr.1_Missense_Mutation_p.P246L	p.P616L	NM_003741	NP_003732	WXS	Illumina HiSeq	Unspecified	Q9H2X0	CHRD_HUMAN	Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		15	2093	+	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		616			CHRD 4.		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	c.1847C>T	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657331	0.29425	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.51	4.51	0.55191	CHRD (3);	0.225469	0.38837	N	0.001546	T	0.26991	0.0661	L	0.35341	1.055	0.48040	D	0.999575	B;P;B;P	0.39737	0.025;0.635;0.4;0.685	B;B;B;B	0.33799	0.012;0.05;0.17;0.084	T	0.04333	-1.0959	10	0.24483	T	0.36	-10.4793	9.9666	0.41727	0.0:0.9053:0.0:0.0947	.	246;576;616;616	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	L	616;616;576;246;329	ENSP00000204604:P616L;ENSP00000408972:P616L;ENSP00000334036:P576L;ENSP00000442948:P246L	ENSP00000204604:P616L	P	+	2	0	CHRD	185586556	0.799000	0.28903	0.929000	0.37066	0.729000	0.41735	2.019000	0.41001	2.245000	0.73994	0.655000	0.94253	CCG		0.592	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741		5	94	0	0	0	0.001168	0	5	94				
NFKB1	4790	broad.mit.edu	37	4	103498166	103498166	+	Missense_Mutation	SNP	G	G	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr4:103498166G>C	ENST00000505458.1	+	7	815	c.538G>C	c.(538-540)Gca>Cca	p.A180P	NFKB1_ENST00000394820.4_Missense_Mutation_p.A180P|NFKB1_ENST00000600343.1_5'Flank|NFKB1_ENST00000510638.1_3'UTR|NFKB1_ENST00000226574.4_Missense_Mutation_p.A181P			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	180	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.A181P(1)		biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CTATTTGCAAGCAGAAGGTGG	0.483																																							uc011ceq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|skin(1)	5						c.(538-540)GCA>CCA		nuclear factor kappa-B, subunit 1 isoform 1	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)						115.0	116.0	116.0					4																	103498166		2203	4300	6503	SO:0001583	missense	4790				anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr4:103498166G>C	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.538G>C	4.37:g.103498166G>C	ENSP00000424790:p.Ala180Pro		Somatic				NFKB1_uc011cep.1_Missense_Mutation_p.A181P|NFKB1_uc011cer.1_5'Flank	p.A180P	NM_003998	NP_003989	WXS	Illumina HiSeq	Unspecified	P19838	NFKB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	7	1005	+		Hepatocellular(203;0.217)	180			RHD.		A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	ENST00000505458.1	37	c.538G>C	CCDS54783.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548402	0.45383	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000507079;ENST00000505458	T;T;T	0.38240	1.15;1.15;1.15	5.23	3.29	0.37713	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.273852	0.34750	N	0.003706	T	0.25082	0.0609	L	0.31926	0.97	0.44780	D	0.997782	B;B	0.13145	0.007;0.001	B;B	0.10450	0.005;0.003	T	0.06075	-1.0847	10	0.40728	T	0.16	.	7.9289	0.29891	0.1697:0.1454:0.6849:0.0	.	180;181	P19838;P19838-2	NFKB1_HUMAN;.	P	181;180;189;180	ENSP00000226574:A181P;ENSP00000378297:A180P;ENSP00000424790:A180P	ENSP00000226574:A181P	A	+	1	0	NFKB1	103717204	1.000000	0.71417	0.975000	0.42487	0.949000	0.60115	3.441000	0.52893	1.131000	0.42111	0.456000	0.33151	GCA		0.483	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1			29	72	0	0	0	0.001786	0	29	72				
GALNT7	51809	broad.mit.edu	37	4	174213396	174213396	+	Missense_Mutation	SNP	T	T	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr4:174213396T>C	ENST00000265000.4	+	3	808	c.725T>C	c.(724-726)aTt>aCt	p.I242T	GALNT7_ENST00000502407.1_3'UTR|GALNT7_ENST00000512285.1_Missense_Mutation_p.I242T	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	242	Catalytic subdomain A.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I242T(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTAGCAGAAATTGTGTTAATT	0.343																																							uc003isz.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(724-726)ATT>ACT		polypeptide N-acetylgalactosaminyltransferase 7							80.0	85.0	84.0					4																	174213396		2203	4300	6503	SO:0001583	missense	51809				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:174213396T>C	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.725T>C	4.37:g.174213396T>C	ENSP00000265000:p.Ile242Thr		Somatic				GALNT7_uc011ckb.1_Missense_Mutation_p.I19T	p.I242T	NM_017423	NP_059119	WXS	Illumina HiSeq	Unspecified	Q86SF2	GALT7_HUMAN		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)	3	808	+		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)	242			Catalytic subdomain A.|Lumenal (Potential).		B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	37	c.725T>C	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546716	0.86022	.	.	ENSG00000109586	ENST00000265000;ENST00000512285;ENST00000458613	T;T	0.67865	-0.29;-0.29	5.77	5.77	0.91146	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.85852	0.5793	M	0.92691	3.335	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.74348	0.983;0.978	D	0.89273	0.3606	10	0.87932	D	0	.	16.3948	0.83586	0.0:0.0:0.0:1.0	.	19;242	B4DIB4;Q86SF2	.;GALT7_HUMAN	T	242;242;19	ENSP00000265000:I242T;ENSP00000427050:I242T	ENSP00000265000:I242T	I	+	2	0	GALNT7	174449971	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	ATT		0.343	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423		15	36	0	0	0	0.003163	0	15	36				
SLC12A7	10723	broad.mit.edu	37	5	1083938	1083938	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:1083938C>T	ENST00000264930.5	-	8	1094	c.1051G>A	c.(1051-1053)Gcc>Acc	p.A351T		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	351					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.A351T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCGTCACAGGCGGCGCTGGGC	0.647																																							uc003jbu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(1051-1053)GCC>ACC		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						70.0	67.0	68.0					5																	1083938		2201	4298	6499	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1083938C>T	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1051G>A	5.37:g.1083938C>T	ENSP00000264930:p.Ala351Thr		Somatic					p.A351T	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		8	1117	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		351					A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.1051G>A	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	1.339	-0.594543	0.03771	.	.	ENSG00000113504	ENST00000264930	T	0.58797	0.31	3.67	-5.56	0.02529	.	0.944603	0.08811	N	0.890246	T	0.12774	0.0310	N	0.00251	-1.775	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.22034	-1.0228	10	0.02654	T	1	.	3.2881	0.06939	0.2894:0.2674:0.0:0.4431	.	351	Q9Y666	S12A7_HUMAN	T	351	ENSP00000264930:A351T	ENSP00000264930:A351T	A	-	1	0	SLC12A7	1136938	0.301000	0.24444	0.000000	0.03702	0.523000	0.34469	-0.096000	0.11059	-1.303000	0.02332	-0.511000	0.04467	GCC		0.647	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		15	42	0	0	0	0.00245	0	15	42				
OSMR	9180	broad.mit.edu	37	5	38885486	38885486	+	Missense_Mutation	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:38885486A>G	ENST00000274276.3	+	6	1141	c.739A>G	c.(739-741)Acc>Gcc	p.T247A	OSMR_ENST00000502536.1_Missense_Mutation_p.T247A	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	247					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.T247A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TTCTTGTGAAACCGAGGACTT	0.428																																							uc003jln.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(739-741)ACC>GCC		oncostatin M receptor precursor							100.0	97.0	98.0					5																	38885486		2203	4300	6503	SO:0001583	missense	9180				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity	g.chr5:38885486A>G	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.739A>G	5.37:g.38885486A>G	ENSP00000274276:p.Thr247Ala		Somatic				OSMR_uc003jlm.1_Missense_Mutation_p.T247A	p.T247A	NM_003999	NP_003990	WXS	Illumina HiSeq	Unspecified	Q99650	OSMR_HUMAN			6	1106	+	all_lung(31;0.000365)		247			Extracellular (Potential).		Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	c.739A>G	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478528	0.44044	.	.	ENSG00000145623	ENST00000502536;ENST00000274276	T;T	0.70282	-0.47;-0.47	5.33	2.92	0.33932	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.478221	0.25720	N	0.028746	T	0.80773	0.4687	M	0.82323	2.585	0.35269	D	0.780318	D;D	0.76494	0.999;0.962	D;P	0.80764	0.994;0.636	T	0.80614	-0.1304	10	0.42905	T	0.14	.	4.9654	0.14087	0.7521:0.0:0.087:0.1609	.	247;247	Q99650;Q99650-2	OSMR_HUMAN;.	A	247	ENSP00000422023:T247A;ENSP00000274276:T247A	ENSP00000274276:T247A	T	+	1	0	OSMR	38921243	0.999000	0.42202	0.941000	0.38009	0.231000	0.25187	2.261000	0.43276	0.347000	0.23924	-1.007000	0.02485	ACC		0.428	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		33	68	0	0	0	0.002445	0	33	68				
SKIV2L2	23517	broad.mit.edu	37	5	54649009	54649009	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:54649009C>T	ENST00000230640.5	+	14	1699	c.1445C>T	c.(1444-1446)aCg>aTg	p.T482M	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.T381M	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	482	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.T482M(1)		NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTATTTGCCACGGAGACCTTT	0.318																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1444-1446)ACG>ATG		superkiller viralicidic activity 2-like 2							92.0	100.0	98.0					5																	54649009		2203	4300	6503	SO:0001583	missense	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54649009C>T	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1445C>T	5.37:g.54649009C>T	ENSP00000230640:p.Thr482Met		Somatic				SKIV2L2_uc011cqi.1_Missense_Mutation_p.T381M	p.T482M	NM_015360	NP_056175	WXS	Illumina HiSeq	Unspecified	P42285	SK2L2_HUMAN			14	1711	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	482			Helicase C-terminal.		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	c.1445C>T	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896072	0.91962	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	D;D	0.81499	-1.5;-1.5	6.02	6.02	0.97574	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95626	0.8578	H	0.99924	4.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	D	0.97347	0.9961	10	0.87932	D	0	-17.4213	20.547	0.99278	0.0:1.0:0.0:0.0	.	381;482	F5H7E2;P42285	.;SK2L2_HUMAN	M	482;381	ENSP00000230640:T482M;ENSP00000442583:T381M	ENSP00000230640:T482M	T	+	2	0	SKIV2L2	54684766	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.566000	0.82347	2.850000	0.98022	0.650000	0.86243	ACG		0.318	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			8	157	0	0	0	0.000978	0	8	157				
ERAP2	64167	broad.mit.edu	37	5	96253168	96253168	+	Silent	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:96253168G>A	ENST00000437043.3	+	19	3453	c.2742G>A	c.(2740-2742)gtG>gtA	p.V914V	CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000379904.4_Silent_p.V869V	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	914					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V914V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		TTTTACAGGTGAAACTATTTT	0.398																																							uc003kmq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2740-2742)GTG>GTA		endoplasmic reticulum aminopeptidase 2							61.0	66.0	65.0					5																	96253168		2203	4300	6503	SO:0001819	synonymous_variant	64167				antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr5:96253168G>A	AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.2742G>A	5.37:g.96253168G>A			Somatic				uc003kmo.1_Intron|ERAP2_uc003kmt.2_Silent_p.V914V|ERAP2_uc003kmr.2_RNA|ERAP2_uc003kms.2_Silent_p.V863V|ERAP2_uc003kmu.2_RNA	p.V914V	NM_022350	NP_071745	WXS	Illumina HiSeq	Unspecified	Q6P179	ERAP2_HUMAN		COAD - Colon adenocarcinoma(37;0.0703)	19	3452	+		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)	914			Lumenal (Potential).		Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Silent	SNP	ENST00000437043.3	37	c.2742G>A	CCDS4086.1																																																																																				0.398	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2	NM_022350		25	48	0	0	0	0.003954	0	25	48				
PCDHB15	56121	broad.mit.edu	37	5	140625383	140625383	+	Silent	SNP	G	G	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:140625383G>T	ENST00000231173.3	+	1	237	c.237G>T	c.(235-237)ctG>ctT	p.L79L		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L79L(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTTGATCTGCAGACCGGGC	0.537																																							uc003lje.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)|skin(1)	5						c.(235-237)CTG>CTT		protocadherin beta 15 precursor							48.0	54.0	52.0					5																	140625383		2203	4300	6503	SO:0001819	synonymous_variant	56121				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140625383G>T	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.237G>T	5.37:g.140625383G>T			Somatic					p.L79L	NM_018935	NP_061758	WXS	Illumina HiSeq	Unspecified	Q9Y5E8	PCDBF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	237	+			79			Extracellular (Potential).|Cadherin 1.		Q8IUX5	Silent	SNP	ENST00000231173.3	37	c.237G>T	CCDS4257.1																																																																																				0.537	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935		19	41	1	0	1.33834e-09	0.000958	3.34584e-09	19	41				
PCDHGB7	56099	broad.mit.edu	37	5	140798770	140798770	+	Silent	SNP	C	C	T	rs201698529		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:140798770C>T	ENST00000398594.2	+	1	1344	c.1344C>T	c.(1342-1344)aaC>aaT	p.N448N	PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N448N(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAATGACAACGCGCCGGTTT	0.572													c|||	1	0.000199681	0.0	0.0	5008	,	,		18878	0.0		0.001	False		,,,				2504	0.0						uc003lkn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1342-1344)AAC>AAT		protocadherin gamma subfamily B, 7 isoform 1							63.0	73.0	69.0					5																	140798770		2144	4240	6384	SO:0001819	synonymous_variant	56099				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140798770C>T	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1344C>T	5.37:g.140798770C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Silent_p.N448N|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	p.N448N	NM_018927	NP_061750	WXS	Illumina HiSeq	Unspecified	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1489	+			448			Extracellular (Potential).|Cadherin 4.		Q9UN63	Silent	SNP	ENST00000398594.2	37	c.1344C>T	CCDS47293.1																																																																																				0.572	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		14	28	0	0	0	0.001855	0	14	28				
RBM27	54439	broad.mit.edu	37	5	145649137	145649137	+	Missense_Mutation	SNP	C	C	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr5:145649137C>A	ENST00000265271.5	+	17	2847	c.2681C>A	c.(2680-2682)aCa>aAa	p.T894K	RBM27_ENST00000506502.1_Missense_Mutation_p.T839K	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	894					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T894K(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAAGTGAAGACAAAAACGGAG	0.353																																							uc003lnz.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|pancreas(1)	3						c.(2680-2682)ACA>AAA		RNA binding motif protein 27							75.0	68.0	70.0					5																	145649137		1568	3582	5150	SO:0001583	missense	54439				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr5:145649137C>A	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2681C>A	5.37:g.145649137C>A	ENSP00000265271:p.Thr894Lys		Somatic				RBM27_uc003lny.2_Missense_Mutation_p.T839K	p.T894K	NM_018989	NP_061862	WXS	Illumina HiSeq	Unspecified	Q9P2N5	RBM27_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		17	2847	+			894					Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	c.2681C>A	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832416	0.71258	.	.	ENSG00000091009	ENST00000265271	T	0.50001	0.76	5.72	5.72	0.89469	.	0.078248	0.53938	D	0.000045	T	0.41143	0.1146	N	0.25332	0.735	0.58432	D	0.999994	B	0.20052	0.041	B	0.20767	0.031	T	0.17471	-1.0368	10	0.51188	T	0.08	-14.6659	19.8751	0.96867	0.0:1.0:0.0:0.0	.	894	Q9P2N5	RBM27_HUMAN	K	894	ENSP00000265271:T894K	ENSP00000265271:T894K	T	+	2	0	RBM27	145629330	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.411000	0.66386	2.695000	0.91970	0.655000	0.94253	ACA		0.353	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128		23	14	1	0	5.45024e-15	0.00333	1.37822e-14	23	14				
DNAH8	1769	broad.mit.edu	37	6	38919259	38919259	+	Silent	SNP	C	C	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr6:38919259C>A	ENST00000359357.3	+	80	12017	c.11763C>A	c.(11761-11763)acC>acA	p.T3921T	DNAH8_ENST00000449981.2_Silent_p.T4138T|DNAH8_ENST00000441566.1_Silent_p.T3885T|RP1-207H1.3_ENST00000416948.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3921	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T3921T(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CTGACCCCACCAATCAAATTG	0.413																																							uc003ooe.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(11761-11763)ACC>ACA		dynein, axonemal, heavy polypeptide 8							190.0	201.0	197.0					6																	38919259		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38919259C>A	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11763C>A	6.37:g.38919259C>A			Somatic				DNAH8_uc003oog.1_Silent_p.T370T|uc003oof.1_Intron	p.T3921T	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					80	12363	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.11763C>A																																																																																					0.413	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		18	492	1	0	2.94398e-08	0.000958	7.1964e-08	18	492				
COL19A1	1310	broad.mit.edu	37	6	70637868	70637868	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr6:70637868G>A	ENST00000322773.4	+	5	436	c.334G>A	c.(334-336)Gcc>Acc	p.A112T		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	112	Laminin G-like.			FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358). {ECO:0000305}.	cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.A112T(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						ACGAAGAAACGCCAAAAAGGA	0.428																																							uc003pfc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(334-336)GCC>ACC		alpha 1 type XIX collagen precursor							123.0	124.0	124.0					6																	70637868		2203	4300	6503	SO:0001583	missense	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70637868G>A		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.334G>A	6.37:g.70637868G>A	ENSP00000316030:p.Ala112Thr		Somatic				COL19A1_uc010kam.1_Missense_Mutation_p.A8T	p.A112T	NM_001858	NP_001849	WXS	Illumina HiSeq	Unspecified	Q14993	COJA1_HUMAN			5	451	+			112	FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358).		TSP N-terminal.		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	c.334G>A	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306849	0.23821	.	.	ENSG00000082293	ENST00000322773	T	0.37915	1.17	5.71	3.2	0.36748	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.063706	0.64402	N	0.000016	T	0.02047	0.0064	N	0.00135	-2.02	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43829	-0.9367	10	0.06625	T	0.88	.	9.9775	0.41793	0.8613:0.0:0.1387:0.0	.	112	Q14993	COJA1_HUMAN	T	112	ENSP00000316030:A112T	ENSP00000316030:A112T	A	+	1	0	COL19A1	70694589	0.943000	0.32029	0.622000	0.29159	0.357000	0.29423	2.537000	0.45702	0.434000	0.26340	-0.290000	0.09829	GCC		0.428	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			35	63	0	0	0	0.002836	0	35	63				
BCLAF1	9774	broad.mit.edu	37	6	136599486	136599486	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr6:136599486G>A	ENST00000531224.1	-	4	785	c.533C>T	c.(532-534)cCg>cTg	p.P178L	BCLAF1_ENST00000353331.4_Missense_Mutation_p.P176L|BCLAF1_ENST00000527536.1_Missense_Mutation_p.P178L|BCLAF1_ENST00000530767.1_Missense_Mutation_p.P178L|BCLAF1_ENST00000527759.1_Missense_Mutation_p.P176L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.P176L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	178					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P178L(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTTTTCAACGGACTCTCTTC	0.418																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(532-534)CCG>CTG		BCL2-associated transcription factor 1 isoform							219.0	220.0	220.0					6																	136599486		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599486G>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.533C>T	6.37:g.136599486G>A	ENSP00000435210:p.Pro178Leu		Somatic				BCLAF1_uc003qgw.1_Missense_Mutation_p.P178L|BCLAF1_uc003qgy.1_Missense_Mutation_p.P176L|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.P176L	p.P178L	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	786	-	Colorectal(23;0.24)		178					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.533C>T	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436107	0.62955	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61;2.61;2.61	5.77	4.9	0.64082	.	0.181068	0.39687	N	0.001288	T	0.03348	0.0097	N	0.08118	0	0.80722	D	1	B;B;B;B	0.25169	0.045;0.119;0.045;0.119	B;B;B;B	0.14578	0.006;0.006;0.006;0.011	T	0.27157	-1.0082	10	0.66056	D	0.02	-5.309	14.8456	0.70257	0.0691:0.0:0.9309:0.0	.	176;176;178;178	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	L	178;176;178;178;176;176;178	ENSP00000435210:P178L;ENSP00000229446:P176L;ENSP00000435441:P178L;ENSP00000436501:P178L;ENSP00000434826:P176L;ENSP00000376159:P176L;ENSP00000431734:P178L	ENSP00000229446:P176L	P	-	2	0	BCLAF1	136641179	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.074000	0.76791	1.449000	0.47699	-0.145000	0.13849	CCG		0.418	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		30	257	0	0	0	0.001512	0	30	257				
GARS	2617	broad.mit.edu	37	7	30639610	30639610	+	Missense_Mutation	SNP	G	G	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr7:30639610G>A	ENST00000389266.3	+	3	613	c.372G>A	c.(370-372)atG>atA	p.M124I		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	124					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.M124I(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GAGCAAAAATGGAAGATACCC	0.408																																							uc003tbm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(370-372)ATG>ATA		glycyl-tRNA synthetase	Glycine(DB00145)						110.0	107.0	108.0					7																	30639610		1849	4085	5934	SO:0001583	missense	2617				cell death|diadenosine tetraphosphate biosynthetic process|glycyl-tRNA aminoacylation	cytosol|mitochondrial matrix|soluble fraction	ATP binding|glycine-tRNA ligase activity|protein dimerization activity	g.chr7:30639610G>A	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.372G>A	7.37:g.30639610G>A	ENSP00000373918:p.Met124Ile		Somatic					p.M124I	NM_002047	NP_002038	WXS	Illumina HiSeq	Unspecified	P41250	SYG_HUMAN			3	729	+			124					B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	c.372G>A	CCDS43564.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999893	0.74818	.	.	ENSG00000106105	ENST00000389266	T	0.77098	-1.07	5.58	4.68	0.58851	.	0.034774	0.85682	D	0.000000	T	0.60457	0.2270	N	0.10707	0.03	0.80722	D	1	B	0.16603	0.018	B	0.17433	0.018	T	0.60301	-0.7290	10	0.62326	D	0.03	-24.333	13.1381	0.59421	0.0822:0.0:0.9178:0.0	.	124	P41250	SYG_HUMAN	I	124	ENSP00000373918:M124I	ENSP00000373918:M124I	M	+	3	0	GARS	30606135	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.827000	0.99397	2.793000	0.96121	0.655000	0.94253	ATG		0.408	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047		28	177	0	0	0	0.002445	0	28	177				
GTF2IRD2P1	401375	broad.mit.edu	37	7	72657788	72657788	+	RNA	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr7:72657788A>G	ENST00000425256.1	-	0	2123									GTF2I repeat domain containing 2 pseudogene 1																		cagttttgctaggaacacccg	0.483																																							uc003txs.1		NA																	0					0						c.(1195-1197)CTA>CCA		RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;																																						401375							g.chr7:72657788A>G	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72657788A>G			Somatic				FKBP6_uc003twz.2_Intron	p.L399P	NR_002164		WXS	Illumina HiSeq	Unspecified					13	2124	-									Missense_Mutation	SNP	ENST00000425256.1	37	c.1196T>C																																																																																					0.483	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164		60	306	0	0	0	0.00361	0	60	306				
CNOT4	4850	broad.mit.edu	37	7	135048808	135048808	+	Missense_Mutation	SNP	A	A	C			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr7:135048808A>C	ENST00000451834.1	-	11	1912	c.1629T>G	c.(1627-1629)agT>agG	p.S543R	CNOT4_ENST00000361528.4_Intron|CNOT4_ENST00000473470.1_5'UTR|CNOT4_ENST00000423368.2_Intron|CNOT4_ENST00000541284.1_Missense_Mutation_p.S546R			O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	0					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S546R(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TCTCTACAGAACTGCTGTTGT	0.383																																					Ovarian(51;766 1130 5502 35047 50875)	Ovarian(51;766 1130 5502 35047 50875)	uc011kpy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1636-1638)AGT>AGG		CCR4-NOT transcription complex, subunit 4							198.0	179.0	184.0					7																	135048808		876	1991	2867	SO:0001583	missense	4850				nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:135048808A>C	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000451834.1:c.1629T>G	7.37:g.135048808A>C	ENSP00000388491:p.Ser543Arg		Somatic				CNOT4_uc003vss.2_Intron|CNOT4_uc011kpz.1_Missense_Mutation_p.S543R|CNOT4_uc003vst.2_Intron	p.S546R	NM_001008225	NP_001008226	WXS	Illumina HiSeq	Unspecified	O95628	CNOT4_HUMAN			10	1730	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000451834.1	37	c.1638T>G	CCDS55167.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024816	0.35701	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000262563	T;T	0.44083	0.93;0.93	5.85	5.85	0.93711	.	0.045744	0.85682	D	0.000000	T	0.26738	0.0654	N	0.08118	0	0.80722	D	1	B;B	0.21905	0.037;0.062	B;B	0.19391	0.011;0.025	T	0.06734	-1.0810	10	0.33940	T	0.23	-8.3967	16.2303	0.82332	1.0:0.0:0.0:0.0	.	543;546	E7ET38;F8VQP3	.;.	R	546;543;546	ENSP00000445508:S546R;ENSP00000388491:S543R	ENSP00000262563:S546R	S	-	3	2	CNOT4	134699348	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.868000	0.69605	2.233000	0.73108	0.533000	0.62120	AGT		0.383	CNOT4-003	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340670.1	NM_013316		12	270	0	0	0	0.001855	0	12	270				
MKRN1	23608	broad.mit.edu	37	7	140154416	140154416	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr7:140154416C>T	ENST00000255977.2	-	8	1574	c.1350G>A	c.(1348-1350)atG>atA	p.M450I	MKRN1_ENST00000474576.1_Missense_Mutation_p.M386I|MKRN1_ENST00000437223.2_Missense_Mutation_p.M184I	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	450					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M450I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					CAGCCAAAAGCATAAGCAACA	0.463																																							uc003vvt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1348-1350)ATG>ATA		makorin ring finger protein 1 isoform 1							112.0	89.0	97.0					7																	140154416		2203	4300	6503	SO:0001583	missense	23608						ligase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr7:140154416C>T	AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1350G>A	7.37:g.140154416C>T	ENSP00000255977:p.Met450Ile		Somatic				MKRN1_uc003vvs.2_Missense_Mutation_p.M386I|MKRN1_uc011krd.1_Missense_Mutation_p.M184I	p.M450I	NM_013446	NP_038474	WXS	Illumina HiSeq	Unspecified	Q9UHC7	MKRN1_HUMAN			8	1575	-	Melanoma(164;0.00956)		450					A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	37	c.1350G>A	CCDS5860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.11|16.11	3.030497|3.030497	0.54790|0.54790	.|.	.|.	ENSG00000133606|ENSG00000133606	ENST00000463142|ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576	.|T;T;T	.|0.29655	.|2.95;1.56;2.28	5.26|5.26	4.38|4.38	0.52667|0.52667	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.30166|0.30166	0.0756|0.0756	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999998|0.999998	.|P	.|0.47350	.|0.894	.|B	.|0.42555	.|0.391	T|T	0.06232|0.06232	-1.0838|-1.0838	6|10	0.72032|0.44086	D|T	0.01|0.13	.|.	13.8257|13.8257	0.63348|0.63348	0.0:0.9272:0.0:0.0728|0.0:0.9272:0.0:0.0728	.|.	.|450	.|Q9UHC7	.|MKRN1_HUMAN	Y|I	103|450;386;184;386	.|ENSP00000255977:M450I;ENSP00000439823:M184I;ENSP00000417863:M386I	ENSP00000417346:C103Y|ENSP00000255977:M450I	C|M	-|-	2|3	0|0	MKRN1|MKRN1	139800885|139800885	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.266000|7.266000	0.78452|0.78452	1.456000|1.456000	0.47831|0.47831	0.650000|0.650000	0.86243|0.86243	TGC|ATG		0.463	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1	NM_013446		19	77	0	0	0	0.001216	0	19	77				
GTF2E2	2961	broad.mit.edu	37	8	30464636	30464636	+	Missense_Mutation	SNP	C	C	T	rs527328234		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr8:30464636C>T	ENST00000355904.4	-	6	863	c.581G>A	c.(580-582)cGt>cAt	p.R194H	GTF2E2_ENST00000522833.1_5'UTR	NM_002095.4	NP_002086.1	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2, beta 34kDa	194					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIE complex (GO:0005673)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R194H(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)		CTTATCGGGACGATTTACAAA	0.303													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13452	0.0		0.0	False		,,,				2504	0.0						uc003xig.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(580-582)CGT>CAT		general transcription factor IIE, polypeptide 2,							59.0	64.0	63.0					8																	30464636		2203	4296	6499	SO:0001583	missense	2961				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIE complex	DNA binding|protein binding	g.chr8:30464636C>T	BC030572	CCDS6078.1	8p12	2010-03-23	2002-08-29		ENSG00000197265	ENSG00000197265		"""General transcription factors"""	4651	protein-coding gene	gene with protein product		189964	"""general transcription factor IIE, polypeptide 2 (beta subunit, 34kD)"""			1956404	Standard	NM_002095		Approved	TFIIE-B, FE, TF2E2	uc003xig.3	P29084	OTTHUMG00000163934	ENST00000355904.4:c.581G>A	8.37:g.30464636C>T	ENSP00000348168:p.Arg194His		Somatic					p.R194H	NM_002095	NP_002086	WXS	Illumina HiSeq	Unspecified	P29084	T2EB_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)	6	834	-			194					D3DSV2|Q9H2B9	Missense_Mutation	SNP	ENST00000355904.4	37	c.581G>A	CCDS6078.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737022	0.89482	.	.	ENSG00000197265	ENST00000355904;ENST00000518599	T;T	0.40756	1.34;1.02	5.73	5.73	0.89815	.	0.093152	0.64402	D	0.000001	T	0.68622	0.3021	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.73751	-0.3884	10	0.72032	D	0.01	-3.1681	17.3973	0.87449	0.0:1.0:0.0:0.0	.	194	P29084	T2EB_HUMAN	H	194	ENSP00000348168:R194H;ENSP00000429921:R194H	ENSP00000348168:R194H	R	-	2	0	GTF2E2	30584178	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	5.966000	0.70395	2.712000	0.92718	0.650000	0.86243	CGT		0.303	GTF2E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376459.2	NM_002095		23	91	0	0	0	0.004656	0	23	91				
LYN	4067	broad.mit.edu	37	8	56910924	56910924	+	Missense_Mutation	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr8:56910924A>G	ENST00000519728.1	+	11	1366	c.1070A>G	c.(1069-1071)tAc>tGc	p.Y357C	LYN_ENST00000520220.2_Missense_Mutation_p.Y336C|LYN_ENST00000420292.1_3'UTR	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	357	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.Y357C(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	GGAATGGCATACATCGAGCGG	0.458																																							uc003xsk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1069-1071)TAC>TGC		Yamaguchi sarcoma viral (v-yes-1) oncogene							99.0	95.0	96.0					8																	56910924		2203	4300	6503	SO:0001583	missense	4067				erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity	g.chr8:56910924A>G	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1070A>G	8.37:g.56910924A>G	ENSP00000428924:p.Tyr357Cys		Somatic				LYN_uc003xsl.3_Missense_Mutation_p.Y336C	p.Y357C	NM_002350	NP_002341	WXS	Illumina HiSeq	Unspecified	P07948	LYN_HUMAN	Epithelial(17;0.000834)|all cancers(17;0.00598)		11	1352	+		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	357			Protein kinase.		A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	37	c.1070A>G	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.648599	0.67358	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	D;D	0.89270	-2.49;-2.49	5.52	4.31	0.51392	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.127610	0.53938	D	0.000045	D	0.94739	0.8302	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.962	D	0.95182	0.8300	10	0.66056	D	0.02	.	11.8936	0.52644	0.8698:0.0:0.0:0.1302	.	427;357	Q6NUK7;P07948	.;LYN_HUMAN	C	357;336	ENSP00000428924:Y357C;ENSP00000428424:Y336C	ENSP00000428924:Y357C	Y	+	2	0	LYN	57073478	1.000000	0.71417	0.997000	0.53966	0.869000	0.49853	3.600000	0.54052	2.100000	0.63781	0.533000	0.62120	TAC		0.458	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350		4	64	0	0	0	0.000248	0	4	64				
VPS13B	157680	broad.mit.edu	37	8	100866351	100866351	+	Silent	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr8:100866351C>T	ENST00000358544.2	+	56	10920	c.10809C>T	c.(10807-10809)ctC>ctT	p.L3603L	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.L3578L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3603					protein transport (GO:0015031)			p.L3578L(1)|p.L3603L(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACGCTTCCCTCAAGCTGTACA	0.547																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(10807-10809)CTC>CTT		vacuolar protein sorting 13B isoform 5							129.0	106.0	114.0					8																	100866351		2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100866351C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10809C>T	8.37:g.100866351C>T			Somatic				VPS13B_uc003yiw.2_Silent_p.L3578L	p.L3603L	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		56	10920	+	Breast(36;3.73e-07)		3603					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.10809C>T	CCDS6280.1																																																																																				0.547	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		63	51	0	0	0	0.00361	0	63	51				
KLHL9	55958	broad.mit.edu	37	9	21334730	21334730	+	Silent	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr9:21334730A>G	ENST00000359039.4	-	1	649	c.129T>C	c.(127-129)ctT>ctC	p.L43L	KLHL9_ENST00000537938.1_Intron			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	43					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.L43L(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		CTTCTATTCTAAGCTGATCAA	0.468																																							uc003zoy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(127-129)CTT>CTC		kelch-like 9							105.0	94.0	98.0					9																	21334730		2203	4300	6503	SO:0001819	synonymous_variant	55958				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		g.chr9:21334730A>G	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.129T>C	9.37:g.21334730A>G			Somatic				KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	p.L43L	NM_018847	NP_061335	WXS	Illumina HiSeq	Unspecified	Q9P2J3	KLHL9_HUMAN		Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)	1	700	-			43					Q8TCQ2	Silent	SNP	ENST00000359039.4	37	c.129T>C	CCDS6503.1																																																																																				0.468	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		42	48	0	0	0	0.001951	0	42	48				
Unknown	0	broad.mit.edu	37	9	66499680	66499680	+	IGR	SNP	C	C	A	rs370931238		TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr9:66499680C>A								RP11-262H14.1 (30370 upstream) : RP11-262H14.7 (17525 downstream)																							TCATGTTAACCCCTTCCCAGG	0.582																																							uc004aee.1		NA																	0					0						c.(490-492)CCC>ACC		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499680C>A																													9.37:g.66499680C>A			Somatic				LOC442421_uc004aed.1_RNA	p.P164T			WXS	Illumina HiSeq	Unspecified					1	490	+									Missense_Mutation	SNP		37	c.490C>A																																																																																				0	0.582									5	43	1	0	1.23904e-05	0.000602	2.93106e-05	5	43				
Unknown	0	broad.mit.edu	37	9	66499794	66499794	+	IGR	SNP	C	C	T	rs538639564	byFrequency	TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr9:66499794C>T								RP11-262H14.1 (30484 upstream) : RP11-262H14.7 (17411 downstream)																							GTGCAAGTCGCGCAAGGAGCA	0.587													c|||	7	0.00139776	0.0045	0.0014	5008	,	,		39239	0.0		0.0	False		,,,				2504	0.0						uc004aee.1		NA																	0					0						c.(604-606)CGC>TGC		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499794C>T																													9.37:g.66499794C>T			Somatic				LOC442421_uc004aed.1_RNA	p.R202C			WXS	Illumina HiSeq	Unspecified					1	604	+									Missense_Mutation	SNP		37	c.604C>T																																																																																				0	0.587									5	83	0	0	0	0.001855	0	5	83				
OTUD5	55593	broad.mit.edu	37	X	48791832	48791832	+	Missense_Mutation	SNP	C	C	A			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chrX:48791832C>A	ENST00000156084.4	-	5	1039	c.979G>T	c.(979-981)Gtt>Ttt	p.V327F	OTUD5_ENST00000428668.2_Missense_Mutation_p.V105F|OTUD5_ENST00000396743.3_Missense_Mutation_p.V322F|OTUD5_ENST00000484499.1_5'UTR|OTUD5_ENST00000376488.3_Missense_Mutation_p.V322F	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	327	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)	p.V298F(1)|p.V327F(1)		endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						TGGTAGCTAACACGAATGGGT	0.512																																							uc004dlu.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(979-981)GTT>TTT		OTU domain containing 5 isoform a							178.0	121.0	140.0					X																	48791832		2203	4300	6503	SO:0001583	missense	55593				negative regulation of type I interferon production		cysteine-type peptidase activity	g.chrX:48791832C>A		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.979G>T	X.37:g.48791832C>A	ENSP00000156084:p.Val327Phe		Somatic				OTUD5_uc004dlt.3_Missense_Mutation_p.V322F|OTUD5_uc004dlv.2_Missense_Mutation_p.V322F|OTUD5_uc011mmp.1_Missense_Mutation_p.V105F	p.V327F	NM_017602	NP_060072	WXS	Illumina HiSeq	Unspecified	Q96G74	OTUD5_HUMAN			5	1040	-			327			OTU.		B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	37	c.979G>T	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415327	0.62511	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000455452;ENST00000156084;ENST00000376488;ENST00000428668	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.5	4.63	0.57726	Ovarian tumour, otubain (2);	0.000000	0.64402	D	0.000004	T	0.61311	0.2337	M	0.71206	2.165	0.58432	D	0.999994	D;D;D	0.76494	0.998;0.996;0.999	D;D;D	0.71656	0.974;0.971;0.969	T	0.64651	-0.6357	10	0.72032	D	0.01	-13.6676	12.1624	0.54110	0.1715:0.8284:0.0:0.0	.	105;327;322	B4DGG7;Q96G74;G5E9D7	.;OTUD5_HUMAN;.	F	322;298;200;327;322;105	ENSP00000379969:V322F;ENSP00000390767:V200F;ENSP00000156084:V327F;ENSP00000365671:V322F;ENSP00000401629:V105F	ENSP00000156084:V327F	V	-	1	0	OTUD5	48676776	1.000000	0.71417	0.984000	0.44739	0.550000	0.35303	6.719000	0.74718	1.190000	0.43042	0.529000	0.55759	GTT		0.512	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602		5	85	1	0	0.000602214	0.000602	0.00140944	5	85				
TAF1	6872	broad.mit.edu	37	X	70613945	70613945	+	Missense_Mutation	SNP	A	A	G			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chrX:70613945A>G	ENST00000373790.4	+	22	3304	c.3253A>G	c.(3253-3255)Act>Gct	p.T1085A	TAF1_ENST00000423759.1_Missense_Mutation_p.T1106A|TAF1_ENST00000276072.3_Missense_Mutation_p.T1106A|TAF1_ENST00000449580.1_Missense_Mutation_p.T1085A	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1085					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.T1106A(1)|p.T1085A(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AGTCTTATCAACTGACACAGA	0.383																																							uc004dzu.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17						c.(3253-3255)ACT>GCT		TBP-associated factor 1 isoform 2							79.0	60.0	66.0					X																	70613945		2203	4300	6503	SO:0001583	missense	6872				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity	g.chrX:70613945A>G		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3253A>G	X.37:g.70613945A>G	ENSP00000362895:p.Thr1085Ala		Somatic				BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.T1106A|TAF1_uc004dzv.3_Missense_Mutation_p.T259A	p.T1085A	NM_138923	NP_620278	WXS	Illumina HiSeq	Unspecified	P21675	TAF1_HUMAN			22	3304	+	Renal(35;0.156)	all_lung(315;0.000321)	1085					A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	c.3253A>G	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	23.2	4.381979	0.82792	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	M	0.79693	2.465	0.80722	D	1	D;D;D	0.76494	0.997;0.995;0.999	D;D;D	0.76575	0.987;0.972;0.988	T	0.48625	-0.9019	10	0.72032	D	0.01	.	14.5215	0.67853	1.0:0.0:0.0:0.0	.	1085;1085;1106	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	A	1085;1085;1106;1106	ENSP00000362895:T1085A;ENSP00000389000:T1085A;ENSP00000406549:T1106A;ENSP00000276072:T1106A	ENSP00000276072:T1106A	T	+	1	0	TAF1	70530670	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.954000	0.93051	1.809000	0.52856	0.430000	0.28490	ACT		0.383	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606		4	44	0	0	0	0.000248	0	4	44				
POF1B	79983	broad.mit.edu	37	X	84634283	84634283	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chrX:84634283C>T	ENST00000262753.4	-	2	322	c.177G>A	c.(175-177)atG>atA	p.M59I	POF1B_ENST00000373145.3_Missense_Mutation_p.M59I	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	59						tight junction (GO:0005923)		p.M59I(1)		central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						CCACCTTGTTCATGGGCCCAC	0.532																																							uc004eer.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(175-177)ATG>ATA		premature ovarian failure, 1B							113.0	87.0	96.0					X																	84634283		2203	4300	6503	SO:0001583	missense	79983						actin binding	g.chrX:84634283C>T	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.177G>A	X.37:g.84634283C>T	ENSP00000262753:p.Met59Ile		Somatic				POF1B_uc004ees.2_Missense_Mutation_p.M59I	p.M59I	NM_024921	NP_079197	WXS	Illumina HiSeq	Unspecified	Q8WVV4	POF1B_HUMAN			2	323	-			59					A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	37	c.177G>A	CCDS14452.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.422813	0.43020	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.09723	2.95;2.95	5.67	3.77	0.43336	.	0.105878	0.42053	N	0.000761	T	0.10294	0.0252	L	0.47716	1.5	0.27940	N	0.937549	B;B	0.15141	0.012;0.009	B;B	0.18561	0.022;0.013	T	0.12941	-1.0528	10	0.56958	D	0.05	.	7.5254	0.27652	0.1893:0.6316:0.1791:0.0	.	59;59	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	I	59	ENSP00000262753:M59I;ENSP00000362238:M59I	ENSP00000262753:M59I	M	-	3	0	POF1B	84520939	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.233000	0.32648	1.129000	0.42072	-0.362000	0.07510	ATG		0.532	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921		4	47	0	0	0	0.000248	0	4	47				
GPC4	2239	broad.mit.edu	37	X	132439841	132439841	+	Missense_Mutation	SNP	C	C	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chrX:132439841C>T	ENST00000370828.3	-	6	1638	c.1114G>A	c.(1114-1116)Gaa>Aaa	p.E372K	GPC4_ENST00000535467.1_Missense_Mutation_p.E302K	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	372					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.E372K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					GTTGGGCGTTCCTCGGGGTGA	0.552																																							uc004exc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1114-1116)GAA>AAA		glypican 4 precursor							172.0	170.0	171.0					X																	132439841		2203	4300	6503	SO:0001583	missense	2239				anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chrX:132439841C>T	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.1114G>A	X.37:g.132439841C>T	ENSP00000359864:p.Glu372Lys		Somatic				GPC4_uc011mvg.1_Missense_Mutation_p.E302K	p.E372K	NM_001448	NP_001439	WXS	Illumina HiSeq	Unspecified	O75487	GPC4_HUMAN			6	1326	-	Acute lymphoblastic leukemia(192;0.000127)		372					B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	37	c.1114G>A	CCDS14637.1	.	.	.	.	.	.	.	.	.	.	c	29.7	5.024423	0.93518	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.52057	0.68;0.68	5.78	4.88	0.63580	.	0.172880	0.35805	N	0.002971	T	0.56108	0.1963	M	0.76170	2.325	0.46609	D	0.999122	B	0.34103	0.437	B	0.41135	0.348	T	0.59252	-0.7489	10	0.66056	D	0.02	-6.7009	14.4865	0.67622	0.0:0.8237:0.1763:0.0	.	372	O75487	GPC4_HUMAN	K	372;366;302	ENSP00000359864:E372K;ENSP00000444959:E302K	ENSP00000359864:E372K	E	-	1	0	GPC4	132267507	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.681000	0.61663	1.090000	0.41315	0.597000	0.82753	GAA		0.552	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448		29	301	0	0	0	0.001512	0	29	301				
FREM2	341640	broad.mit.edu	37	13	39261568	39261570	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	GCT	GCT	-	-	GCT	GCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr13:39261568_39261570delGCT	ENST00000280481.7	+	1	303_305	c.87_89delGCT	c.(85-90)cggctg>cgg	p.L38del		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	38					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CGCCGCCCCGgctgctgctgctg	0.695																																							uc001uwv.2		NA																	0				ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(85-90)CGGCTG>CGG		FRAS1-related extracellular matrix protein 2				173,3751		21,131,1810						1.4	0.0			9	282,7392		17,248,3572	no	coding	FREM2	NM_207361.4		38,379,5382	A1A1,A1R,RR		3.6747,4.4088,3.9231				455,11143				SO:0001651	inframe_deletion	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39261568_39261570delGCT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.87_89delGCT	13.37:g.39261577_39261579delGCT	ENSP00000280481:p.Leu38del		Somatic					p.L38del	NM_207361	NP_997244	WXS	Illumina HiSeq	Unspecified	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	1	396_398	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	38					Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	In_Frame_Del	DEL	ENST00000280481.7	37	c.87_89delGCT	CCDS31960.1																																																																																				0.695	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
CCDC88A	55704	broad.mit.edu	37	2	55555500	55555501	+	Frame_Shift_Ins	INS	-	-	T			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr2:55555500_55555501insT	ENST00000436346.1	-	17	3767_3768	c.2926_2927insA	c.(2926-2928)attfs	p.I976fs	AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Frame_Shift_Ins_p.I975fs|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000263630.8_Frame_Shift_Ins_p.I976fs|CCDC88A_ENST00000413716.2_Frame_Shift_Ins_p.I975fs|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000599475.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	976					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TAAAGCAGCAATTTTTTCTTCT	0.307																																							uc002ryv.2		NA																	0				ovary(2)|skin(2)	4						c.(2923-2925)ATTfs		coiled-coil domain containing 88A isoform 1																																				SO:0001589	frameshift_variant	55704				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding	g.chr2:55555500_55555501insT	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2927dupA	2.37:g.55555506_55555506dupT	ENSP00000410608:p.Ile976fs		Somatic				CCDC88A_uc010yoz.1_Frame_Shift_Ins_p.I976fs|CCDC88A_uc010ypa.1_Frame_Shift_Ins_p.I975fs|CCDC88A_uc002ryu.2_Frame_Shift_Ins_p.I258fs|CCDC88A_uc002rys.2_5'UTR|CCDC88A_uc002ryw.2_Frame_Shift_Ins_p.I259fs|CCDC88A_uc010fby.1_5'UTR	p.I975fs	NM_001135597	NP_001129069	WXS	Illumina HiSeq	Unspecified	Q3V6T2	GRDN_HUMAN			17	3765_3766	-			976			Potential.		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Frame_Shift_Ins	INS	ENST00000436346.1	37	c.2923_2924insA																																																																																					0.307	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571		14	26	NA	NA	NA	NA	NA	14	26	---	---	---	---
CEP170P1	645455	broad.mit.edu	37	4	119434815	119434822	+	RNA	DEL	AGAGCCAC	AGAGCCAC	-			TCGA-71-6725-01A-11D-1855-08	TCGA-71-6725-10A-01D-1855-08	AGAGCCAC	AGAGCCAC	-	-	AGAGCCAC	AGAGCCAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3a146eb4-7b9b-4834-b3d0-eac80f9173ec	056f3049-18f0-4c6b-8681-f4b11908fb53	g.chr4:119434815_119434822delAGAGCCAC	ENST00000412784.2	+	0	0					NR_003135.2		Q96L14	C170L_HUMAN	centrosomal protein 170kDa pseudogene 1								identical protein binding (GO:0042802)										AAGTCTCTTGAGAGCCACAGAGCAAAGG	0.452																																							uc010imy.1		NA																	0					NA						c.(100-108)GAGAGCCACfs		Homo sapiens cDNA, FLJ98257.																																						0							g.chr4:119434815_119434822delAGAGCCAC	BC014590		4q26	2010-10-11	2010-10-11	2010-10-11	ENSG00000154608	ENSG00000154608			28364	pseudogene	pseudogene			"""KIAA0470-like"", ""centrosomal protein 170kDa-like"""	KIAA0470L, CEP170L			Standard	NR_003135		Approved	MGC26143, FAM68B	uc003icb.3	Q96L14	OTTHUMG00000132958		4.37:g.119434815_119434822delAGAGCCAC			Somatic				CEP170L_uc003icb.2_5'Flank	p.E34fs			WXS	Illumina HiSeq	Unspecified					2	170_177	+									Frame_Shift_Del	DEL	ENST00000412784.2	37	c.101_108delAGAGCCAC																																																																																					0.452	CEP170P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000364033.2	NR_003135.2		9	43	NA	NA	NA	NA	NA	9	43	---	---	---	---
