#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CELA3A	10136	broad.mit.edu	37	1	22329535	22329535	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:22329535G>T	ENST00000290122.3	+	2	102	c.83G>T	c.(82-84)cGc>cTc	p.R28L	CELA3A_ENST00000374663.1_Missense_Mutation_p.R28L|RN7SL768P_ENST00000584415.1_RNA	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	28					cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCTTCCAGCCGCGTTGTCCAT	0.602																																							uc001bfl.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)	1						c.(82-84)CGC>CTC		elastase 3A, pancreatic preproprotein							74.0	100.0	92.0					1																	22329535		1915	4271	6186	SO:0001583	missense	10136				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity	g.chr1:22329535G>T	D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.83G>T	1.37:g.22329535G>T	ENSP00000290122:p.Arg28Leu		Somatic				CELA3B_uc009vqf.2_Intron	p.R28L	NM_005747	NP_005738	WXS	Illumina HiSeq	Unspecified	P09093	CEL3A_HUMAN			2	102	+			28					B1AQ53|Q9BRW4	Missense_Mutation	SNP	ENST00000290122.3	37	c.83G>T	CCDS220.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835373	0.50951	.	.	ENSG00000142789	ENST00000290122;ENST00000374663;ENST00000374661	T;D	0.94497	2.01;-3.44	3.32	3.32	0.38043	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	.	.	.	.	D	0.96589	0.8887	M	0.79123	2.44	0.09310	N	1	D	0.89917	1.0	D	0.76575	0.988	D	0.89928	0.4064	9	0.87932	D	0	-47.2794	10.3529	0.43948	0.0:0.0:1.0:0.0	.	28	P09093	CEL3A_HUMAN	L	28;28;44	ENSP00000290122:R28L;ENSP00000363795:R28L	ENSP00000290122:R28L	R	+	2	0	CELA3A	22202122	0.998000	0.40836	0.010000	0.14722	0.135000	0.20990	6.724000	0.74747	1.862000	0.54008	0.400000	0.26472	CGC		0.602	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	NM_005747		43	89	1	0	5.73376e-24	0.048971	8.38828e-24	43	89				
ATP1A1	476	broad.mit.edu	37	1	116941354	116941354	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:116941354G>A	ENST00000295598.5	+	16	2488	c.2236G>A	c.(2236-2238)Gct>Act	p.A746T	ATP1A1_ENST00000369496.4_Missense_Mutation_p.A715T|ATP1A1_ENST00000537345.1_Missense_Mutation_p.A746T	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	746					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	CAAGCAAGCTGCTGACATGAT	0.468																																							uc001ege.2		NA																	0				ovary(1)	1						c.(2236-2238)GCT>ACT		Na+/K+ -ATPase alpha 1 subunit isoform a	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)						189.0	180.0	183.0					1																	116941354		2203	4300	6503	SO:0001583	missense	476				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity	g.chr1:116941354G>A	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2236G>A	1.37:g.116941354G>A	ENSP00000295598:p.Ala746Thr		Somatic				ATP1A1_uc010owv.1_Missense_Mutation_p.A715T|ATP1A1_uc010oww.1_Missense_Mutation_p.A746T|ATP1A1_uc010owx.1_Missense_Mutation_p.A715T|C1orf203_uc009whb.2_Intron|ATP1A1_uc001egh.2_5'Flank	p.A746T	NM_000701	NP_000692	WXS	Illumina HiSeq	Unspecified	P05023	AT1A1_HUMAN		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	16	2575	+	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)	746			Cytoplasmic (Potential).		B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	c.2236G>A	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	33	5.270182	0.95429	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.85702	-2.02;-2.02;-2.02	5.23	4.3	0.51218	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95595	0.8568	H	0.99535	4.615	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.992	D	0.96523	0.9387	10	0.87932	D	0	.	14.394	0.66999	0.0724:0.0:0.9276:0.0	.	746;746	F5H3A1;P05023	.;AT1A1_HUMAN	T	746;746;715	ENSP00000295598:A746T;ENSP00000445306:A746T;ENSP00000358508:A715T	ENSP00000295598:A746T	A	+	1	0	ATP1A1	116742877	1.000000	0.71417	0.976000	0.42696	0.998000	0.95712	9.657000	0.98554	2.718000	0.92993	0.655000	0.94253	GCT		0.468	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233		46	45	0	0	0	0.048971	0	46	45				
POGZ	23126	broad.mit.edu	37	1	151378624	151378624	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:151378624C>A	ENST00000271715.2	-	19	3201	c.2887G>T	c.(2887-2889)Ggt>Tgt	p.G963C	POGZ_ENST00000540984.1_Missense_Mutation_p.G325C|POGZ_ENST00000361398.3_Missense_Mutation_p.G910C|POGZ_ENST00000392723.1_Missense_Mutation_p.G910C|POGZ_ENST00000368863.2_Missense_Mutation_p.G868C|POGZ_ENST00000491586.1_Missense_Mutation_p.G919C|POGZ_ENST00000409503.1_Missense_Mutation_p.G954C|POGZ_ENST00000531094.1_Missense_Mutation_p.G901C	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	963					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CCACCACTACCACCACCACCT	0.512																																							uc001eyd.1		NA																	0				ovary(3)	3						c.(2887-2889)GGT>TGT		pogo transposable element with ZNF domain							134.0	121.0	126.0					1																	151378624		2203	4300	6503	SO:0001583	missense	23126				cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding	g.chr1:151378624C>A	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2887G>T	1.37:g.151378624C>A	ENSP00000271715:p.Gly963Cys		Somatic				POGZ_uc001eye.1_Missense_Mutation_p.G910C|POGZ_uc010pdb.1_Missense_Mutation_p.G954C|POGZ_uc001eyf.1_Missense_Mutation_p.G919C|POGZ_uc010pdc.1_Missense_Mutation_p.G901C|POGZ_uc009wmv.1_Missense_Mutation_p.G868C|POGZ_uc010pdd.1_Missense_Mutation_p.G454C	p.G963C	NM_015100	NP_055915	WXS	Illumina HiSeq	Unspecified	Q7Z3K3	POGZ_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		19	3193	-	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		963					B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	c.2887G>T	CCDS997.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.556649	0.45487	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.24151	5.84;5.87;5.84;5.82;5.86;5.85;1.87;5.34	4.78	-3.85	0.04243	.	0.776544	0.11749	N	0.533242	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	B;P;P;P;P;P	0.43169	0.39;0.698;0.8;0.525;0.525;0.698	B;B;B;B;B;B	0.39617	0.161;0.161;0.305;0.305;0.305;0.243	T	0.18272	-1.0342	10	0.49607	T	0.09	0.0011	14.9945	0.71421	0.0:0.7172:0.0:0.2828	.	901;954;868;919;910;963	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	C	910;963;910;868;954;901;325;919	ENSP00000376484:G910C;ENSP00000271715:G963C;ENSP00000354467:G910C;ENSP00000357856:G868C;ENSP00000386836:G954C;ENSP00000431259:G901C;ENSP00000443547:G325C;ENSP00000418408:G919C	ENSP00000271715:G963C	G	-	1	0	POGZ	149645248	0.002000	0.14202	0.000000	0.03702	0.028000	0.11728	-0.131000	0.10482	-0.591000	0.05859	-0.793000	0.03317	GGT		0.512	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171		28	197	1	0	2.47316e-13	0.015359	3.10126e-13	28	197				
HRNR	388697	broad.mit.edu	37	1	152192190	152192190	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:152192190G>T	ENST00000368801.2	-	3	1990	c.1915C>A	c.(1915-1917)Cat>Aat	p.H639N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	639					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGAGCCATGCTGACCGTGG	0.567																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(1915-1917)CAT>AAT		hornerin							230.0	226.0	227.0					1																	152192190		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152192190G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1915C>A	1.37:g.152192190G>T	ENSP00000357791:p.His639Asn		Somatic					p.H639N	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1991	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		639			6.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.1915C>A	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	5.258	0.233042	0.09969	.	.	ENSG00000197915	ENST00000368801	T	0.04970	3.52	4.31	-3.39	0.04868	.	.	.	.	.	T	0.00815	0.0027	N	0.14661	0.345	0.09310	N	1	B	0.26744	0.158	B	0.17098	0.017	T	0.47749	-0.9093	9	0.27785	T	0.31	.	2.6748	0.05078	0.1751:0.402:0.2862:0.1366	.	639	Q86YZ3	HORN_HUMAN	N	639	ENSP00000357791:H639N	ENSP00000357791:H639N	H	-	1	0	HRNR	150458814	0.046000	0.20272	0.000000	0.03702	0.000000	0.00434	0.534000	0.23098	-0.438000	0.07232	-1.922000	0.00515	CAT		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		80	617	1	0	1.13981e-37	0.048971	1.78308e-37	80	617				
SPRR3	6707	broad.mit.edu	37	1	152975887	152975887	+	Missense_Mutation	SNP	A	A	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:152975887A>C	ENST00000295367.4	+	2	433	c.391A>C	c.(391-393)Atc>Ctc	p.I131L	SPRR3_ENST00000331860.3_Missense_Mutation_p.I131L|SPRR3_ENST00000542696.1_Missense_Mutation_p.I123L	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	131	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCCAGGTGCCATCAAAGTTCC	0.547																																							uc001fax.3		NA																	0				skin(1)	1						c.(391-393)ATC>CTC		small proline-rich protein 3							90.0	78.0	82.0					1																	152975887		2203	4300	6503	SO:0001583	missense	6707				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity	g.chr1:152975887A>C	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.391A>C	1.37:g.152975887A>C	ENSP00000295367:p.Ile131Leu		Somatic				SPRR3_uc001faz.3_Missense_Mutation_p.I131L|SPRR3_uc001fay.2_Missense_Mutation_p.I123L	p.I131L	NM_005416	NP_005407	WXS	Illumina HiSeq	Unspecified	Q9UBC9	SPRR3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	541	+	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		131			12.|14 X 8 AA approximate tandem repeats.		A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Missense_Mutation	SNP	ENST00000295367.4	37	c.391A>C	CCDS1033.1	.	.	.	.	.	.	.	.	.	.	A	4.745	0.138448	0.09083	.	.	ENSG00000163209	ENST00000331860;ENST00000443178;ENST00000295367;ENST00000542696	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	2.52	1.31	0.21738	.	.	.	.	.	T	0.02888	0.0086	L	0.40543	1.245	0.09310	N	1	B;B	0.26775	0.028;0.159	B;B	0.24394	0.013;0.053	T	0.41378	-0.9512	9	0.48119	T	0.1	.	6.9258	0.24414	0.7647:0.2352:0.0:0.0	.	123;131	F5GZ12;Q9UBC9	.;SPRR3_HUMAN	L	131;131;131;123	ENSP00000330391:I131L;ENSP00000402016:I131L;ENSP00000295367:I131L;ENSP00000441477:I123L	ENSP00000295367:I131L	I	+	1	0	SPRR3	151242511	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.117000	0.15583	0.376000	0.24707	0.491000	0.48974	ATC		0.547	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416		7	35	0	0	0	0.038147	0	7	35				
PVRL4	81607	broad.mit.edu	37	1	161049727	161049727	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:161049727G>A	ENST00000368012.3	-	2	394	c.92C>T	c.(91-93)gCg>gTg	p.A31V		NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	31					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CAGCTCACCCGCGGGGCACCG	0.622																																					NSCLC(76;1160 1387 14476 16172 29359)	NSCLC(76;1160 1387 14476 16172 29359)	uc001fxo.2		NA																	0				ovary(2)	2						c.(91-93)GCG>GTG		poliovirus receptor-related 4 precursor							29.0	33.0	32.0					1																	161049727		2199	4298	6497	SO:0001583	missense	81607				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane		g.chr1:161049727G>A	AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.92C>T	1.37:g.161049727G>A	ENSP00000356991:p.Ala31Val		Somatic					p.A31V	NM_030916	NP_112178	WXS	Illumina HiSeq	Unspecified	Q96NY8	PVRL4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00165)		2	391	-	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		31					B4DQW3|Q96K15	Missense_Mutation	SNP	ENST00000368012.3	37	c.92C>T	CCDS1216.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927615	0.73327	.	.	ENSG00000143217	ENST00000368012	T	0.42131	0.98	5.51	5.51	0.81932	Immunoglobulin-like (1);	0.104110	0.42682	D	0.000671	T	0.33469	0.0864	L	0.46157	1.445	0.80722	D	1	D	0.57899	0.981	P	0.48270	0.572	T	0.06625	-1.0816	10	0.42905	T	0.14	.	14.9278	0.70893	0.0:0.0:1.0:0.0	.	31	Q96NY8	PVRL4_HUMAN	V	31	ENSP00000356991:A31V	ENSP00000356991:A31V	A	-	2	0	PVRL4	159316351	0.809000	0.29036	0.046000	0.18839	0.746000	0.42486	5.024000	0.64090	2.574000	0.86865	0.650000	0.86243	GCG		0.622	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916		27	118	0	0	0	0.017118	0	27	118				
SCYL3	57147	broad.mit.edu	37	1	169839455	169839455	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:169839455C>A	ENST00000367770.1	-	5	613	c.566G>T	c.(565-567)cGg>cTg	p.R189L	SCYL3_ENST00000367771.6_Missense_Mutation_p.R189L|SCYL3_ENST00000367772.4_Missense_Mutation_p.R189L|SCYL3_ENST00000470238.1_5'UTR			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AAAGGCATCCCGGGCATGTCC	0.398																																							uc001ggs.2		NA																	0				ovary(1)|skin(1)	2						c.(565-567)CGG>CTG		SCY1-like 3 isoform 2							101.0	100.0	101.0					1																	169839455		2203	4300	6503	SO:0001583	missense	57147				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity	g.chr1:169839455C>A	BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.566G>T	1.37:g.169839455C>A	ENSP00000356744:p.Arg189Leu		Somatic				SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.R189L|SCYL3_uc001ggu.2_RNA	p.R189L	NM_181093	NP_851607	WXS	Illumina HiSeq	Unspecified	Q8IZE3	PACE1_HUMAN			6	764	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		189			Protein kinase.		A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Missense_Mutation	SNP	ENST00000367770.1	37	c.566G>T	CCDS1287.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220405	0.58560	.	.	ENSG00000000457	ENST00000367772;ENST00000367771;ENST00000367770;ENST00000423670	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	L	0.31157	0.91	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.75484	0.959;0.986	T	0.61252	-0.7100	10	0.07990	T	0.79	-19.0514	18.852	0.92235	0.0:1.0:0.0:0.0	.	189;189	Q8IZE3-2;Q8IZE3	.;PACE1_HUMAN	L	189	ENSP00000356746:R189L;ENSP00000356745:R189L;ENSP00000356744:R189L;ENSP00000407993:R189L	ENSP00000356744:R189L	R	-	2	0	SCYL3	168106079	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.102000	0.77005	2.614000	0.88457	0.557000	0.71058	CGG		0.398	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093		67	86	1	0	2.05912e-35	0.048971	3.15865e-35	67	86				
CACNA1E	777	broad.mit.edu	37	1	181764126	181764126	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:181764126C>T	ENST00000367573.2	+	46	6154	c.6154C>T	c.(6154-6156)Cgg>Tgg	p.R2052W	CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1990W|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R2003W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2033W|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1941W|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1616W|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R2009W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2052					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTCCCGTCGCCGGAGTTACCA	0.527																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(6025-6027)CGG>TGG		calcium channel, voltage-dependent, R type,							67.0	70.0	69.0					1																	181764126		1939	4128	6067	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181764126C>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6154C>T	1.37:g.181764126C>T	ENSP00000356545:p.Arg2052Trp		Somatic				CACNA1E_uc009wxs.2_Missense_Mutation_p.R1897W|CACNA1E_uc009wxt.2_Missense_Mutation_p.R1278W	p.R2009W	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			45	6190	+			2052			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.6025C>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396172	0.83011	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98345	-4.75;-4.73;-4.55;-4.73;-4.88;-4.55;-4.55	5.91	3.98	0.46160	.	0.690066	0.14408	N	0.321454	D	0.97807	0.9280	L	0.27053	0.805	0.44995	D	0.99801	D;D	0.89917	1.0;1.0	D;D	0.70935	0.967;0.971	D	0.96947	0.9692	10	0.87932	D	0	.	14.7816	0.69772	0.262:0.738:0.0:0.0	.	1990;2009	Q15878-2;Q15878-3	.;.	W	2009;1990;2003;1941;1616;2033;2052	ENSP00000356542:R2009W;ENSP00000434814:R1990W;ENSP00000350183:R2003W;ENSP00000351101:R1941W;ENSP00000356539:R1616W;ENSP00000353222:R2033W;ENSP00000356545:R2052W	ENSP00000350183:R2003W	R	+	1	2	CACNA1E	180030749	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.373000	0.44266	0.764000	0.33197	0.655000	0.94253	CGG		0.527	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		6	83	0	0	0	0.006214	0	6	83				
KCNT2	343450	broad.mit.edu	37	1	196342361	196342361	+	Nonsense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:196342361C>A	ENST00000294725.9	-	14	2227	c.1312G>T	c.(1312-1314)Gaa>Taa	p.E438*	KCNT2_ENST00000367433.5_Nonsense_Mutation_p.E438*|KCNT2_ENST00000367431.4_Nonsense_Mutation_p.E438*|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Nonsense_Mutation_p.E49*|KCNT2_ENST00000609185.1_Nonsense_Mutation_p.E438*			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	438	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTAAACTCTTCTTCACAAACA	0.289																																							uc001gtd.1		NA																	0				ovary(5)|breast(1)|skin(1)	7						c.(1312-1314)GAA>TAA		potassium channel, subfamily T, member 2							84.0	85.0	85.0					1																	196342361		2203	4295	6498	SO:0001587	stop_gained	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196342361C>A	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1312G>T	1.37:g.196342361C>A	ENSP00000294725:p.Glu438*		Somatic				KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Nonsense_Mutation_p.E438*|KCNT2_uc001gtf.1_Nonsense_Mutation_p.E438*|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Nonsense_Mutation_p.E438*|KCNT2_uc009wyv.1_Nonsense_Mutation_p.E413*	p.E438*	NM_198503	NP_940905	WXS	Illumina HiSeq	Unspecified	Q6UVM3	KCNT2_HUMAN			14	1372	-			438			Cytoplasmic (Potential).|RCK N-terminal.		Q3SY59|Q5VTN1|Q6ZMT3	Nonsense_Mutation	SNP	ENST00000294725.9	37	c.1312G>T	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	38	7.218286	0.98143	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	.	.	.	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-20.6969	18.4944	0.90860	0.0:1.0:0.0:0.0	.	.	.	.	X	438;438;259;49;438	.	ENSP00000294725:E438X	E	-	1	0	KCNT2	194608984	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.106000	0.77039	2.728000	0.93425	0.650000	0.86243	GAA		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		35	139	1	0	1.8453e-21	0.039052	2.55752e-21	35	139				
REN	5972	broad.mit.edu	37	1	204124295	204124295	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:204124295C>A	ENST00000272190.8	-	10	1098	c.1070G>T	c.(1069-1071)aGt>aTt	p.S357I	ETNK2_ENST00000367199.2_5'Flank|REN_ENST00000367195.2_Missense_Mutation_p.S354I	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	357					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	CTTTTTACTACTGTAGGATTC	0.562																																							uc001haq.2		NA																	0				skin(3)|central_nervous_system(1)	4						c.(1069-1071)AGT>ATT		renin preproprotein	Aliskiren(DB01258)|Remikiren(DB00212)						104.0	87.0	93.0					1																	204124295		2203	4300	6503	SO:0001583	missense	5972				angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity	g.chr1:204124295C>A	BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.1070G>T	1.37:g.204124295C>A	ENSP00000272190:p.Ser357Ile		Somatic				ETNK2_uc001hao.3_5'Flank|ETNK2_uc001han.3_5'Flank|ETNK2_uc010pqs.1_5'Flank|ETNK2_uc010pqt.1_5'Flank	p.S357I	NM_000537	NP_000528	WXS	Illumina HiSeq	Unspecified	P00797	RENI_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		10	1114	-	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		357					Q6FI38|Q6T5C2	Missense_Mutation	SNP	ENST00000272190.8	37	c.1070G>T	CCDS30981.1	.	.	.	.	.	.	.	.	.	.	C	6.474	0.455689	0.12283	.	.	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.59364	0.27;0.27	4.47	2.37	0.29283	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.894616	0.09716	N	0.765024	T	0.38161	0.1030	L	0.33753	1.03	0.09310	N	1	P	0.43701	0.815	B	0.36464	0.225	T	0.13442	-1.0509	10	0.20046	T	0.44	.	4.2781	0.10818	0.1746:0.5745:0.0:0.2508	.	357	P00797	RENI_HUMAN	I	354;276;357	ENSP00000356163:S354I;ENSP00000272190:S357I	ENSP00000272190:S357I	S	-	2	0	REN	202390918	0.002000	0.14202	0.006000	0.13384	0.015000	0.08874	0.463000	0.21972	0.948000	0.37687	0.591000	0.81541	AGT		0.562	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087891.1	NM_000537		20	98	1	0	4.72057e-08	0.021523	5.56605e-08	20	98				
CR1L	1379	broad.mit.edu	37	1	207868033	207868033	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:207868033C>T	ENST00000508064.2	+	5	859	c.799C>T	c.(799-801)Ccc>Tcc	p.P267S	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	267	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CATGAAAGGGCCCTCCCATGT	0.498																																							uc001hga.3		NA																	0					0						c.(799-801)CCC>TCC		complement component (3b/4b) receptor 1-like							117.0	120.0	119.0					1																	207868033		1959	4152	6111	SO:0001583	missense	1379					cytoplasm|extracellular region|membrane		g.chr1:207868033C>T	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.799C>T	1.37:g.207868033C>T	ENSP00000421736:p.Pro267Ser		Somatic				CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	p.P267S	NM_175710	NP_783641	WXS	Illumina HiSeq	Unspecified	Q2VPA4	CR1L_HUMAN			5	920	+			267			Sushi 4.		Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	c.799C>T	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.331001	0.00227	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.61627	0.09	2.38	-1.64	0.08318	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.20047	0.0482	N	0.01824	-0.7	0.09310	N	1	B	0.14805	0.011	B	0.25506	0.061	T	0.30268	-0.9984	9	0.02654	T	1	.	0.7877	0.01051	0.2251:0.3604:0.2462:0.1682	.	267	Q2VPA4	CR1L_HUMAN	S	267	ENSP00000421736:P267S	ENSP00000434864:P211S	P	+	1	0	CR1L	205934656	0.000000	0.05858	0.046000	0.18839	0.002000	0.02628	-0.171000	0.09883	-0.086000	0.12550	-0.708000	0.03648	CCC		0.498	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735		69	133	0	0	0	0.048971	0	69	133				
USH2A	7399	broad.mit.edu	37	1	216144109	216144109	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:216144109G>A	ENST00000307340.3	-	36	7201	c.6815C>T	c.(6814-6816)aCg>aTg	p.T2272M	USH2A_ENST00000366943.2_Missense_Mutation_p.T2272M	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2272	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATAACTCGTGATAACACC	0.373										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(6814-6816)ACG>ATG		usherin isoform B							97.0	95.0	95.0					1																	216144109		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216144109G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6815C>T	1.37:g.216144109G>A	ENSP00000305941:p.Thr2272Met	HNSCC(13;0.011)	Somatic					p.T2272M	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	36	7202	-			2272			Fibronectin type-III 9.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.6815C>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.256304	0.22965	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57436	0.4;0.4	5.72	4.8	0.61643	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.45361	D	0.000371	T	0.62429	0.2427	M	0.89968	3.075	0.40047	D	0.975726	B	0.28258	0.205	B	0.20767	0.031	T	0.64702	-0.6345	10	0.54805	T	0.06	.	17.8535	0.88755	0.0646:0.0:0.9354:0.0	.	2272	O75445	USH2A_HUMAN	M	2272	ENSP00000305941:T2272M;ENSP00000355910:T2272M	ENSP00000305941:T2272M	T	-	2	0	USH2A	214210732	1.000000	0.71417	0.651000	0.29564	0.513000	0.34164	3.594000	0.54008	0.781000	0.33589	-1.094000	0.02160	ACG		0.373	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		22	172	0	0	0	0.027356	0	22	172				
RYR2	6262	broad.mit.edu	37	1	237823303	237823303	+	Missense_Mutation	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:237823303T>A	ENST00000366574.2	+	55	8544	c.8227T>A	c.(8227-8229)Tat>Aat	p.Y2743N	RYR2_ENST00000360064.6_Missense_Mutation_p.Y2741N|RYR2_ENST00000542537.1_Missense_Mutation_p.Y2727N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2743	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGATGGATTTATGGAGAAAT	0.308																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(8227-8229)TAT>AAT		cardiac muscle ryanodine receptor							65.0	61.0	62.0					1																	237823303		1799	4059	5858	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237823303T>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8227T>A	1.37:g.237823303T>A	ENSP00000355533:p.Tyr2743Asn		Somatic					p.Y2743N	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		55	8347	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2743			Modulator (Potential).|Cytoplasmic (By similarity).|3.|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.8227T>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771308	0.69992	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93763	-3.28;-3.28;-3.28	5.63	5.63	0.86233	Ryanodine receptor Ryr (1);	0.102244	0.41500	D	0.000861	D	0.95903	0.8666	M	0.88377	2.95	0.80722	D	1	D	0.53151	0.958	P	0.51297	0.665	D	0.96546	0.9404	10	0.87932	D	0	.	15.8497	0.78921	0.0:0.0:0.0:1.0	.	2743	Q92736	RYR2_HUMAN	N	2743;2741;2727	ENSP00000355533:Y2743N;ENSP00000353174:Y2741N;ENSP00000443798:Y2727N	ENSP00000353174:Y2741N	Y	+	1	0	RYR2	235889926	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.009000	0.57110	2.142000	0.66516	0.383000	0.25322	TAT		0.308	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		17	27	0	0	0	0.016522	0	17	27				
OR2G3	81469	broad.mit.edu	37	1	247769715	247769715	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:247769715C>A	ENST00000320002.2	+	1	860	c.828C>A	c.(826-828)ctC>ctA	p.L276L	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTATCTCCCTCTTCTACACCA	0.438																																							uc010pyz.1		NA																	0				central_nervous_system(1)	1						c.(826-828)CTC>CTA		olfactory receptor, family 2, subfamily G,							102.0	96.0	98.0					1																	247769715		2203	4300	6503	SO:0001819	synonymous_variant	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769715C>A	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.828C>A	1.37:g.247769715C>A			Somatic					p.L276L	NM_001001914	NP_001001914	WXS	Illumina HiSeq	Unspecified	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	828	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		276			Helical; Name=7; (Potential).		B2RN64|Q5JQT1|Q6IF45	Silent	SNP	ENST00000320002.2	37	c.828C>A	CCDS31093.1																																																																																				0.438	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			29	67	1	0	1.56442e-22	0.050027	2.20695e-22	29	67				
OR2G6	391211	broad.mit.edu	37	1	248685488	248685488	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:248685488G>T	ENST00000343414.4	+	1	573	c.541G>T	c.(541-543)Gtg>Ttg	p.V181L		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTCTGTGAGGTGCCAGTGCT	0.517																																							uc001ien.1		NA																	0				ovary(2)|skin(1)	3						c.(541-543)GTG>TTG		olfactory receptor, family 2, subfamily G,							116.0	109.0	111.0					1																	248685488		2203	4300	6503	SO:0001583	missense	391211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248685488G>T		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.541G>T	1.37:g.248685488G>T	ENSP00000341291:p.Val181Leu		Somatic					p.V181L	NM_001013355	NP_001013373	WXS	Illumina HiSeq	Unspecified	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	541	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	181			Extracellular (Potential).		B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	c.541G>T	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	13.79	2.342513	0.41498	.	.	ENSG00000188558	ENST00000343414	T	0.35789	1.29	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39985	U	0.001220	T	0.38427	0.1040	N	0.24115	0.695	0.20074	N	0.999937	D	0.89917	1.0	D	0.91635	0.999	T	0.09729	-1.0661	10	0.49607	T	0.09	.	4.4875	0.11797	0.1162:0.0:0.6608:0.223	.	181	Q5TZ20	OR2G6_HUMAN	L	181	ENSP00000341291:V181L	ENSP00000341291:V181L	V	+	1	0	OR2G6	246752111	0.000000	0.05858	1.000000	0.80357	0.709000	0.40893	-2.674000	0.00842	1.869000	0.54173	0.400000	0.26472	GTG		0.517	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		46	51	1	0	8.86878e-18	0.048971	1.19766e-17	46	51				
FAM171A1	221061	broad.mit.edu	37	10	15255962	15255962	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:15255962G>A	ENST00000378116.4	-	8	1631	c.1625C>T	c.(1624-1626)tCg>tTg	p.S542L	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	542						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TACTGATCGCGACATCATACA	0.542																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1624-1626)TCG>TTG		hypothetical protein LOC221061 precursor							150.0	148.0	149.0					10																	15255962		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15255962G>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1625C>T	10.37:g.15255962G>A	ENSP00000367356:p.Ser542Leu		Somatic					p.S542L	NM_001010924	NP_001010924	WXS	Illumina HiSeq	Unspecified	Q5VUB5	F1711_HUMAN			8	1632	-			542			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.1625C>T	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.348404	0.61183	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.34859	1.34	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.62938	0.2469	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61589	-0.7032	10	0.51188	T	0.08	-20.7288	19.6296	0.95694	0.0:0.0:1.0:0.0	.	542	Q5VUB5	F1711_HUMAN	L	542;541	ENSP00000367356:S542L	ENSP00000367356:S542L	S	-	2	0	FAM171A1	15295968	1.000000	0.71417	0.971000	0.41717	0.103000	0.19146	9.615000	0.98356	2.873000	0.98535	0.563000	0.77884	TCG		0.542	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		6	222	0	0	0	0.038147	0	6	222				
MBL2	4153	broad.mit.edu	37	10	54528269	54528269	+	Splice_Site	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:54528269C>T	ENST00000373968.3	-	4	439	c.375G>A	c.(373-375)tgG>tgA	p.W125*		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	125					acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						AGAAGGTGAGCCCTAAAATGT	0.413																																							uc001jjt.2		NA																	0				ovary(1)	1						c.(373-375)TGG>TGA		soluble mannose-binding lectin precursor							70.0	74.0	73.0					10																	54528269		2202	4300	6502	SO:0001630	splice_region_variant	4153				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding	g.chr10:54528269C>T	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.374-1G>A	10.37:g.54528269C>T			Somatic					p.W125*	NM_000242	NP_000233	WXS	Illumina HiSeq	Unspecified	P11226	MBL2_HUMAN			4	440	-			125					Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Nonsense_Mutation	SNP	ENST00000373968.3	37	c.375G>A	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100637	0.76983	.	.	ENSG00000165471	ENST00000373968	.	.	.	4.81	3.82	0.43975	.	0.640861	0.14662	N	0.305863	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	7.5503	0.27793	0.1844:0.637:0.1785:0.0	.	.	.	.	X	125	.	ENSP00000363079:W125X	W	-	3	0	MBL2	54198275	0.138000	0.22547	0.885000	0.34714	0.847000	0.48162	0.339000	0.19875	2.575000	0.86900	0.650000	0.86243	TGG		0.413	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242	Nonsense_Mutation	14	58	0	0	0	0.023175	0	14	58				
PCDH15	65217	broad.mit.edu	37	10	55566840	55566840	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:55566840G>T	ENST00000373965.2	-	36	4948	c.4554C>A	c.(4552-4554)acC>acA	p.T1518T	PCDH15_ENST00000414778.1_Silent_p.T1515T	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	581					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGTTGAGCTGGTTTCATACT	0.353										HNSCC(58;0.16)																													uc010qhq.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4546-4548)ACC>ACA		protocadherin 15 isoform CD3-1 precursor							57.0	52.0	54.0					10																	55566840		1568	3582	5150	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55566840G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4554C>A	10.37:g.55566840G>T		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhr.1_Silent_p.T1511T	p.T1516T	NM_001142771	NP_001136243	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			36	4943	-		Melanoma(3;0.117)|Lung SC(717;0.238)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000373965.2	37	c.4548C>A																																																																																					0.353	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	NM_033056		5	24	1	0	8.12818e-05	0.02938	8.98079e-05	5	24				
HPSE2	60495	broad.mit.edu	37	10	100503793	100503793	+	Missense_Mutation	SNP	A	A	G	rs147866530	byFrequency	TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:100503793A>G	ENST00000370552.3	-	4	690	c.631T>C	c.(631-633)Tat>Cat	p.Y211H	HPSE2_ENST00000370549.1_Intron|HPSE2_ENST00000370546.1_Missense_Mutation_p.Y211H|HPSE2_ENST00000404542.1_Intron	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	211					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GCAAAGTTATAAAGTTTGTCT	0.408													A|||	29	0.00579073	0.0015	0.0043	5008	,	,		18828	0.0		0.006	False		,,,				2504	0.0184						uc001kpn.1		NA																	0				ovary(1)	1						c.(631-633)TAT>CAT		heparanase 2		A	,,HIS/TYR,HIS/TYR	8,4398	14.3+/-33.2	0,8,2195	63.0	63.0	63.0		,,631,631	5.7	1.0	10	dbSNP_134	63	95,8505	51.5+/-111.7	1,93,4206	yes	intron,intron,missense,missense	HPSE2	NM_001166244.1,NM_001166245.1,NM_001166246.1,NM_021828.4	,,83,83	1,101,6401	GG,GA,AA		1.1047,0.1816,0.7919	,,probably-damaging,probably-damaging	,,211/549,211/593	100503793	103,12903	2203	4300	6503	SO:0001583	missense	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100503793A>G	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.631T>C	10.37:g.100503793A>G	ENSP00000359583:p.Tyr211His		Somatic				HPSE2_uc009xwc.1_Missense_Mutation_p.Y201H|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	p.Y211H	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	4	691	-			211					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	c.631T>C	CCDS7477.1	8	0.003663003663003663	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	4	0.005277044854881266	A	20.9	4.065727	0.76187	0.001816	0.011047	ENSG00000172987	ENST00000370552;ENST00000370546	T;T	0.28895	1.59;1.59	5.68	5.68	0.88126	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.16129	-1.0413	10	0.16420	T	0.52	-7.3408	16.2237	0.82280	1.0:0.0:0.0:0.0	.	211;211	Q8WWQ2-2;Q8WWQ2	.;HPSE2_HUMAN	H	211	ENSP00000359583:Y211H;ENSP00000359577:Y211H	ENSP00000359577:Y211H	Y	-	1	0	HPSE2	100493783	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.824000	0.92023	2.289000	0.77006	0.482000	0.46254	TAT		0.408	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		11	24	0	0	0	0.024245	0	11	24				
SEC23IP	11196	broad.mit.edu	37	10	121662475	121662475	+	Silent	SNP	T	T	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:121662475T>G	ENST00000369075.3	+	3	933	c.861T>G	c.(859-861)ccT>ccG	p.P287P	SEC23IP_ENST00000543134.1_Silent_p.P76P	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	287	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TGTGGATGCCTTTTAGTGTGT	0.378																																							uc001leu.1		NA																	0				ovary(3)	3						c.(859-861)CCT>CCG		Sec23-interacting protein p125							119.0	109.0	112.0					10																	121662475		2203	4300	6503	SO:0001819	synonymous_variant	11196				Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding	g.chr10:121662475T>G	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.861T>G	10.37:g.121662475T>G			Somatic				SEC23IP_uc010qtc.1_Silent_p.P76P	p.P287P	NM_007190	NP_009121	WXS	Illumina HiSeq	Unspecified	Q9Y6Y8	S23IP_HUMAN		all cancers(201;0.00515)	3	933	+		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)	287			Interaction with SEC23A.		D3DRD2|Q8IXH5|Q9BUK5	Silent	SNP	ENST00000369075.3	37	c.861T>G	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.305446	0.23736	.	.	ENSG00000107651	ENST00000442952	.	.	.	5.25	4.04	0.47022	.	.	.	.	.	T	0.54013	0.1832	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52215	-0.8605	4	.	.	.	-18.2071	5.5829	0.17260	0.1925:0.0:0.2493:0.5582	.	.	.	.	V	53	.	.	F	+	1	0	SEC23IP	121652465	0.999000	0.42202	1.000000	0.80357	0.973000	0.67179	0.566000	0.23593	2.111000	0.64477	0.533000	0.62120	TTT		0.378	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1			13	45	0	0	0	0.043863	0	13	45				
DMBT1	1755	broad.mit.edu	37	10	124351977	124351977	+	Missense_Mutation	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:124351977G>C	ENST00000338354.3	+	20	2472	c.2366G>C	c.(2365-2367)gGc>gCc	p.G789A	DMBT1_ENST00000368909.3_Missense_Mutation_p.G789A|DMBT1_ENST00000344338.3_Missense_Mutation_p.G779A|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.G779A			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	789	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GCCCGGTTTGGCCAGGGCTCA	0.607																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(2365-2367)GGC>GCC		deleted in malignant brain tumors 1 isoform b							170.0	132.0	145.0					10																	124351977		1992	4110	6102	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124351977G>C		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2366G>C	10.37:g.124351977G>C	ENSP00000342210:p.Gly789Ala		Somatic				DMBT1_uc001lgl.1_Missense_Mutation_p.G779A|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.G789A|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Missense_Mutation_p.G402A	p.G789A	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			20	2472	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	789			SRCR 6.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.2366G>C		.	.	.	.	.	.	.	.	.	.	G	12.47	1.947970	0.34377	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	3.86	3.86	0.44501	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.87341	0.6153	M	0.93062	3.375	0.80722	D	1	D;D;D;D	0.89917	1.0;0.993;0.993;0.994	D;P;P;D	0.91635	0.999;0.879;0.879;0.926	D	0.90983	0.4829	9	0.66056	D	0.02	.	16.2289	0.82318	0.0:0.0:1.0:0.0	.	550;789;779;789	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	A	789;789;789;789;789;789;779;789;779	ENSP00000342210:G789A;ENSP00000343175:G779A;ENSP00000357905:G789A;ENSP00000357951:G779A	ENSP00000342210:G789A	G	+	2	0	DMBT1	124341967	1.000000	0.71417	0.010000	0.14722	0.054000	0.15201	9.243000	0.95416	1.871000	0.54225	0.558000	0.71614	GGC		0.607	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		62	181	0	0	0	0.048971	0	62	181				
EBF3	253738	broad.mit.edu	37	10	131665437	131665437	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr10:131665437C>A	ENST00000355311.5	-	10	1079	c.1007G>T	c.(1006-1008)tGc>tTc	p.C336F	EBF3_ENST00000368648.3_Missense_Mutation_p.C327F			Q9H4W6	COE3_HUMAN	early B-cell factor 3	336	IPT/TIG.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AGCACCTTTGCAGAACTGCTT	0.587																																							uc001lki.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(979-981)TGC>TTC		early B-cell factor 3							87.0	74.0	78.0					10																	131665437		2203	4300	6503	SO:0001583	missense	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131665437C>A		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1007G>T	10.37:g.131665437C>A	ENSP00000347463:p.Cys336Phe		Somatic					p.C327F	NM_001005463	NP_001005463	WXS	Illumina HiSeq	Unspecified	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	10	1039	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	336			IPT/TIG.		A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37	c.980G>T		.	.	.	.	.	.	.	.	.	.	C	23.0	4.361172	0.82353	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.42513	0.97;0.97	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	M	0.72118	2.19	0.80722	D	1	D	0.55605	0.972	P	0.62089	0.898	T	0.66516	-0.5904	10	0.66056	D	0.02	-14.8759	18.9221	0.92529	0.0:1.0:0.0:0.0	.	327	Q9H4W6-2	.	F	336;327	ENSP00000347463:C336F;ENSP00000357637:C327F	ENSP00000347463:C336F	C	-	2	0	EBF3	131555427	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.702000	0.84576	2.632000	0.89209	0.655000	0.94253	TGC		0.587	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		12	30	1	0	7.93312e-07	0.020292	9.21642e-07	12	30				
ODF3	113746	broad.mit.edu	37	11	198578	198578	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:198578T>C	ENST00000325113.4	+	5	844	c.527T>C	c.(526-528)cTa>cCa	p.L176P	ODF3_ENST00000525282.1_Missense_Mutation_p.L176P|BET1L_ENST00000410108.1_Intron	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	176					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGCGACGACCTACACAAGGCA	0.627																																							uc001lob.2		NA																	0				ovary(1)	1						c.(526-528)CTA>CCA		outer dense fiber of sperm tails 3							58.0	60.0	59.0					11																	198578		2203	4300	6503	SO:0001583	missense	113746				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm		g.chr11:198578T>C	AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.527T>C	11.37:g.198578T>C	ENSP00000325868:p.Leu176Pro		Somatic				ODF3_uc010qvk.1_Missense_Mutation_p.L176P|ODF3_uc001loc.2_3'UTR	p.L176P	NM_053280	NP_444510	WXS	Illumina HiSeq	Unspecified	Q96PU9	ODF3A_HUMAN		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)	5	821	+		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	176					B7ZLT0|Q69YX0	Missense_Mutation	SNP	ENST00000325113.4	37	c.527T>C	CCDS7688.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052320	0.55218	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000525282	T;T	0.33216	1.42;1.55	4.19	4.19	0.49359	.	0.000000	0.36740	N	0.002424	T	0.44582	0.1300	L	0.51914	1.62	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.997;0.998	T	0.22521	-1.0214	10	0.28530	T	0.3	-5.7198	9.5875	0.39526	0.0:0.0:0.0:1.0	.	176;176	B7ZLT0;Q96PU9	.;ODF3A_HUMAN	P	176;93;176	ENSP00000325868:L176P;ENSP00000436588:L176P	ENSP00000325868:L176P	L	+	2	0	ODF3	188578	0.910000	0.30920	1.000000	0.80357	0.927000	0.56198	3.605000	0.54088	1.744000	0.51775	0.459000	0.35465	CTA		0.627	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239287.1			3	100	0	0	0	0.009096	0	3	100				
PAX6	5080	broad.mit.edu	37	11	31812372	31812372	+	Missense_Mutation	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:31812372T>A	ENST00000379132.3	-	11	1349	c.1069A>T	c.(1069-1071)Atg>Ttg	p.M357L	PAX6_ENST00000419022.1_Missense_Mutation_p.M371L|PAX6_ENST00000241001.8_Missense_Mutation_p.M357L|PAX6_ENST00000379107.2_Missense_Mutation_p.M371L|PAX6_ENST00000379111.2_Missense_Mutation_p.M357L|PAX6_ENST00000379115.4_Missense_Mutation_p.M371L|PAX6_ENST00000379129.2_Missense_Mutation_p.M371L|PAX6_ENST00000379123.5_Missense_Mutation_p.M357L			P26367	PAX6_HUMAN	paired box 6	357	Pro/Ser/Thr-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GTGGGCAGCATGCAGGAGTAT	0.587									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																														uc001mtd.3		NA																	0				lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9						c.(1069-1071)ATG>TTG		paired box gene 6 isoform a							88.0	77.0	81.0					11																	31812372		2202	4299	6501	SO:0001583	missense	5080	Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome	blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity	g.chr11:31812372T>A	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.1069A>T	11.37:g.31812372T>A	ENSP00000368427:p.Met357Leu		Somatic				PAX6_uc001mte.3_Missense_Mutation_p.M357L|PAX6_uc001mtg.3_Missense_Mutation_p.M371L|PAX6_uc001mtf.3_Missense_Mutation_p.M357L|PAX6_uc001mth.3_Missense_Mutation_p.M357L|PAX6_uc009yjr.2_Missense_Mutation_p.M357L	p.M357L	NM_001127612	NP_001121084	WXS	Illumina HiSeq	Unspecified	P26367	PAX6_HUMAN			11	1959	-	Lung SC(675;0.225)		357			Pro/Ser/Thr-rich.		Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	c.1069A>T	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983486	0.74474	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000464174;ENST00000241001;ENST00000379115;ENST00000474783;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.93811	-3.29;-3.28;-3.29;-3.29;-2.91;-3.28;-3.29;-2.3;-3.28;-3.28;-2.75;-2.75;-3.28;-3.02	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	M	0.76002	2.32	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.002;0.004	D	0.89748	0.3938	10	0.52906	T	0.07	.	16.5047	0.84268	0.0:0.0:0.0:1.0	.	371;357	F1T0F8;P26367	.;PAX6_HUMAN	L	371;357;371;371;156;357;371;47;357;357;221;221;357;312	ENSP00000404100:M371L;ENSP00000368427:M357L;ENSP00000368424:M371L;ENSP00000368401:M371L;ENSP00000431961:M156L;ENSP00000241001:M357L;ENSP00000368410:M371L;ENSP00000450579:M47L;ENSP00000368406:M357L;ENSP00000368418:M357L;ENSP00000451901:M221L;ENSP00000450775:M221L;ENSP00000368403:M357L;ENSP00000451372:M312L	ENSP00000241001:M357L	M	-	1	0	PAX6	31768948	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.662000	0.83803	2.297000	0.77311	0.533000	0.62120	ATG		0.587	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604		14	52	0	0	0	0.0333	0	14	52				
OR4A5	81318	broad.mit.edu	37	11	51411684	51411684	+	Missense_Mutation	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:51411684T>A	ENST00000319760.6	-	1	764	c.712A>T	c.(712-714)Agc>Tgc	p.S238C		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CTGCCGGAGCTGCAGGTAGAC	0.403																																							uc001nhi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(712-714)AGC>TGC		olfactory receptor, family 4, subfamily A,							63.0	63.0	63.0					11																	51411684		2201	4295	6496	SO:0001583	missense	81318				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51411684T>A	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.712A>T	11.37:g.51411684T>A	ENSP00000367664:p.Ser238Cys		Somatic					p.S238C	NM_001005272	NP_001005272	WXS	Illumina HiSeq	Unspecified	Q8NH83	OR4A5_HUMAN			1	712	-		all_lung(304;0.236)	238			Helical; Name=6; (Potential).		Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	c.712A>T	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	8.368	0.834614	0.16820	.	.	ENSG00000221840	ENST00000319760	T	0.38722	1.12	1.93	0.762	0.18454	GPCR, rhodopsin-like superfamily (1);	0.790281	0.10892	N	0.622623	T	0.61286	0.2335	M	0.86268	2.805	0.26196	N	0.979513	D	0.67145	0.996	D	0.70016	0.967	T	0.47341	-0.9125	10	0.52906	T	0.07	.	5.1685	0.15098	0.0:0.172:0.0:0.828	.	238	Q8NH83	OR4A5_HUMAN	C	238	ENSP00000367664:S238C	ENSP00000367664:S238C	S	-	1	0	OR4A5	51268260	0.000000	0.05858	0.311000	0.25182	0.042000	0.13812	-1.940000	0.01543	0.207000	0.20607	0.136000	0.15936	AGC		0.403	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272		19	64	0	0	0	0.012319	0	19	64				
OR1S1	219959	broad.mit.edu	37	11	57982442	57982442	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:57982442C>G	ENST00000309433.6	+	1	226	c.226C>G	c.(226-228)Ctt>Gtt	p.L76V		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				GTATCTCTTCCTTGCCAATCT	0.443																																							uc010rkc.1		NA																	0				breast(1)	1						c.(226-228)CTT>GTT		olfactory receptor, family 1, subfamily S,							295.0	276.0	282.0					11																	57982442		2201	4296	6497	SO:0001583	missense	219959				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57982442C>G	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.226C>G	11.37:g.57982442C>G	ENSP00000311688:p.Leu76Val		Somatic					p.L76V	NM_001004458	NP_001004458	WXS	Illumina HiSeq	Unspecified	Q8NH92	OR1S1_HUMAN			1	226	+		Breast(21;0.0589)	76			Helical; Name=2; (Potential).		Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	37	c.226C>G	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539536	0.45176	.	.	ENSG00000172774	ENST00000309433	T	0.00700	5.82	3.45	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000536	T	0.06280	0.0162	H	0.96460	3.825	0.28583	N	0.910021	D	0.89917	1.0	D	0.85130	0.997	T	0.03184	-1.1063	10	0.66056	D	0.02	.	8.2101	0.31478	0.0:0.8867:0.0:0.1133	.	76	Q8NH92	OR1S1_HUMAN	V	76	ENSP00000311688:L76V	ENSP00000311688:L76V	L	+	1	0	OR1S1	57739018	0.993000	0.37304	1.000000	0.80357	0.945000	0.59286	0.512000	0.22755	1.770000	0.52166	0.479000	0.44913	CTT		0.443	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458		58	170	0	0	0	0.048971	0	58	170				
CPT1A	1374	broad.mit.edu	37	11	68579920	68579920	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:68579920C>G	ENST00000265641.5	-	3	420	c.266G>C	c.(265-267)cGg>cCg	p.R89P	CPT1A_ENST00000540367.1_Missense_Mutation_p.R89P|CPT1A_ENST00000376618.2_Missense_Mutation_p.R89P|CPT1A_ENST00000539743.1_Missense_Mutation_p.R89P	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	89					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TTCCAGAGTCCGATTGATTTT	0.453																																							uc001oog.3		NA																	0				skin(2)	2						c.(265-267)CGG>CCG		carnitine palmitoyltransferase 1A liver isoform	L-Carnitine(DB00583)|Perhexiline(DB01074)						168.0	156.0	160.0					11																	68579920		2200	4294	6494	SO:0001583	missense	1374				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr11:68579920C>G	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.266G>C	11.37:g.68579920C>G	ENSP00000265641:p.Arg89Pro		Somatic				CPT1A_uc001oof.3_Missense_Mutation_p.R89P|CPT1A_uc009ysj.2_Missense_Mutation_p.R89P	p.R89P	NM_001876	NP_001867	WXS	Illumina HiSeq	Unspecified	P50416	CPT1A_HUMAN	LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		3	436	-	Esophageal squamous(3;3.28e-14)		89			Mitochondrial intermembrane (Potential).		Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	c.266G>C	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.584467	0.28268	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.83	-0.804	0.10882	.	0.789876	0.12203	N	0.490036	T	0.73442	0.3587	L	0.46614	1.455	0.34746	D	0.731229	B;B;P	0.42483	0.001;0.393;0.781	B;B;P	0.47015	0.007;0.264;0.534	T	0.72750	-0.4199	10	0.31617	T	0.26	.	10.254	0.43385	0.0:0.5317:0.0:0.4683	.	89;89;89	B2RAQ8;P50416;P50416-2	.;CPT1A_HUMAN;.	P	89	ENSP00000439084:R89P;ENSP00000365803:R89P;ENSP00000265641:R89P;ENSP00000446108:R89P	ENSP00000265641:R89P	R	-	2	0	CPT1A	68336496	0.638000	0.27225	0.551000	0.28230	0.271000	0.26615	0.340000	0.19892	-0.029000	0.13827	0.561000	0.74099	CGG		0.453	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876		28	86	0	0	0	0.025465	0	28	86				
FGF4	2249	broad.mit.edu	37	11	69588224	69588224	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:69588224C>T	ENST00000168712.1	-	3	792	c.474G>A	c.(472-474)aaG>aaA	p.K158K	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_5'UTR	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	158					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	GGAGAATCTCCTTGAACGTGC	0.572																																							uc001opg.1		NA																	0					0						c.(472-474)AAG>AAA		fibroblast growth factor 4 precursor	Pentosan Polysulfate(DB00686)						230.0	196.0	208.0					11																	69588224		2200	4294	6494	SO:0001819	synonymous_variant	2249				cell-cell signaling|chondroblast differentiation|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade	extracellular region	growth factor activity|heparin binding	g.chr11:69588224C>T	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.474G>A	11.37:g.69588224C>T			Somatic				FGF4_uc010rqj.1_3'UTR	p.K158K	NM_002007	NP_001998	WXS	Illumina HiSeq	Unspecified	P08620	FGF4_HUMAN	LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		3	793	-	Melanoma(5;1.89e-05)		158					B7U994	Silent	SNP	ENST00000168712.1	37	c.474G>A	CCDS8194.1																																																																																				0.572	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007		11	156	0	0	0	0.013537	0	11	156				
TRPC6	7225	broad.mit.edu	37	11	101375285	101375285	+	Silent	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:101375285A>G	ENST00000344327.3	-	2	839	c.415T>C	c.(415-417)Ttg>Ctg	p.L139L	TRPC6_ENST00000532133.1_Silent_p.L139L|TRPC6_ENST00000360497.4_Silent_p.L139L|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000348423.4_Silent_p.L139L	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	139					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GCCACTGCCAACTGTAGGGCA	0.448																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(415-417)TTG>CTG		transient receptor potential cation channel,							106.0	92.0	97.0					11																	101375285		2203	4299	6502	SO:0001819	synonymous_variant	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101375285A>G	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.415T>C	11.37:g.101375285A>G			Somatic				TRPC6_uc009ywy.2_Silent_p.L139L|TRPC6_uc009ywz.1_Silent_p.L139L	p.L139L	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	2	840	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	139			Cytoplasmic (Potential).|ANK 2.		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Silent	SNP	ENST00000344327.3	37	c.415T>C	CCDS8311.1																																																																																				0.448	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		24	58	0	0	0	0.021523	0	24	58				
DSCAML1	57453	broad.mit.edu	37	11	117374709	117374709	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:117374709G>T	ENST00000321322.6	-	11	2391	c.2390C>A	c.(2389-2391)cCt>cAt	p.P797H	DSCAML1_ENST00000527706.1_Missense_Mutation_p.P527H	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	737	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GAGGGGCACAGGGTGGTACTG	0.642																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(2389-2391)CCT>CAT		Down syndrome cell adhesion molecule like 1							89.0	83.0	85.0					11																	117374709		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117374709G>T		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2390C>A	11.37:g.117374709G>T	ENSP00000315465:p.Pro797His		Somatic					p.P797H	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	11	2392	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	737			Extracellular (Potential).|Ig-like C2-type 8.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.2390C>A	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546806	0.86022	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66460	-0.21;-0.21	4.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78953	0.4365	L	0.60012	1.86	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.81391	-0.0954	9	0.62326	D	0.03	.	16.9369	0.86205	0.0:0.0:1.0:0.0	.	737	Q8TD84	DSCL1_HUMAN	H	527;797;504	ENSP00000434335:P527H;ENSP00000315465:P797H	ENSP00000315465:P797H	P	-	2	0	DSCAML1	116879919	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	9.597000	0.98273	2.237000	0.73441	0.462000	0.41574	CCT		0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		47	122	1	0	3.00063e-23	0.048971	4.34953e-23	47	122				
RNF26	79102	broad.mit.edu	37	11	119206355	119206355	+	Missense_Mutation	SNP	G	G	T	rs374945166		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:119206355G>T	ENST00000311413.4	+	1	1119	c.523G>T	c.(523-525)Ggg>Tgg	p.G175W	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	175						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		TGCAGTGACCGGGCCTCTGTG	0.587																																							uc001pwh.2		NA																	0				ovary(1)	1						c.(523-525)GGG>TGG		ring finger protein 26							101.0	88.0	92.0					11																	119206355		2199	4295	6494	SO:0001583	missense	79102						zinc ion binding	g.chr11:119206355G>T	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.523G>T	11.37:g.119206355G>T	ENSP00000312439:p.Gly175Trp		Somatic					p.G175W	NM_032015	NP_114404	WXS	Illumina HiSeq	Unspecified	Q9BY78	RNF26_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)	1	1119	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	175			Leu-rich.		Q542Y8	Missense_Mutation	SNP	ENST00000311413.4	37	c.523G>T	CCDS8419.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775752	0.49786	.	.	ENSG00000173456	ENST00000311413	T	0.79352	-1.26	5.12	5.12	0.69794	.	0.156567	0.42420	D	0.000720	T	0.76821	0.4041	L	0.44542	1.39	0.34892	D	0.745591	D	0.57257	0.979	P	0.53649	0.731	T	0.83265	-0.0046	10	0.72032	D	0.01	-18.2643	7.9825	0.30192	0.173:0.0:0.827:0.0	.	175	Q9BY78	RNF26_HUMAN	W	175	ENSP00000312439:G175W	ENSP00000312439:G175W	G	+	1	0	RNF26	118711565	0.997000	0.39634	0.362000	0.25862	0.753000	0.42808	1.425000	0.34859	2.393000	0.81446	0.561000	0.74099	GGG		0.587	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	NM_032015		14	47	1	0	9.16793e-09	0.0333	1.10575e-08	14	47				
TECTA	7007	broad.mit.edu	37	11	120989283	120989283	+	Silent	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:120989283G>A	ENST00000392793.1	+	7	1330	c.1059G>A	c.(1057-1059)ttG>ttA	p.L353L	TECTA_ENST00000264037.2_Silent_p.L353L			O75443	TECTA_HUMAN	tectorin alpha	353	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GACAGTGTTTGCAGACTTCCA	0.562																																							uc010rzo.1		NA																	0				breast(6)|ovary(2)|skin(2)	10						c.(1057-1059)TTG>TTA		tectorin alpha precursor							133.0	120.0	124.0					11																	120989283		2203	4299	6502	SO:0001819	synonymous_variant	7007				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr11:120989283G>A	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1059G>A	11.37:g.120989283G>A			Somatic					p.L353L	NM_005422	NP_005413	WXS	Illumina HiSeq	Unspecified	O75443	TECTA_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	6	1059	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)	353			VWFD 1.			Silent	SNP	ENST00000392793.1	37	c.1059G>A	CCDS8434.1																																																																																				0.562	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		7	126	0	0	0	0.006214	0	7	126				
CCDC15	80071	broad.mit.edu	37	11	124857495	124857495	+	Missense_Mutation	SNP	A	A	C	rs113451248	byFrequency	TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr11:124857495A>C	ENST00000344762.5	+	8	1632	c.1373A>C	c.(1372-1374)cAc>cCc	p.H458P	CCDC15_ENST00000529051.1_Missense_Mutation_p.H458P	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	458						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CATGTTCTCCACAAAGACCAA	0.418													C|||	6	0.00119808	0.0008	0.0	5008	,	,		19182	0.005		0.0	False		,,,				2504	0.0						uc001qbm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1372-1374)CAC>CCC		coiled-coil domain containing 15		C	PRO/HIS	5,3679		0,5,1837	109.0	105.0	106.0		1373	-1.4	0.0	11	dbSNP_132	106	0,8170		0,0,4085	yes	missense	CCDC15	NM_025004.2	77	0,5,5922	CC,CA,AA		0.0,0.1357,0.0422	benign	458/952	124857495	5,11849	1842	4085	5927	SO:0001583	missense	80071					centrosome		g.chr11:124857495A>C	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.1373A>C	11.37:g.124857495A>C	ENSP00000341684:p.His458Pro		Somatic					p.H458P	NM_025004	NP_079280	WXS	Illumina HiSeq	Unspecified	Q0P6D6	CCD15_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)	8	1632	+	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	458					Q9H8U7	Missense_Mutation	SNP	ENST00000344762.5	37	c.1373A>C	CCDS44756.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	C	0.007	-1.935858	0.00484	0.001357	0.0	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.29142	1.6;1.58	3.32	-1.4	0.08968	.	.	.	.	.	T	0.04272	0.0118	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29882	-0.9997	9	0.02654	T	1	0.0636	3.381	0.07255	0.5595:0.2054:0.1382:0.0969	.	458	Q0P6D6	CCD15_HUMAN	P	458	ENSP00000435403:H458P;ENSP00000341684:H458P	ENSP00000341684:H458P	H	+	2	0	CCDC15	124362705	.	.	0.000000	0.03702	0.085000	0.17905	.	.	-0.576000	0.05974	-0.215000	0.12644	CAC		0.418	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004		3	81	0	0	0	0.009096	0	3	81				
ETV6	2120	broad.mit.edu	37	12	12022897	12022897	+	Missense_Mutation	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:12022897A>G	ENST00000396373.4	+	5	1277	c.1003A>G	c.(1003-1005)Ata>Gta	p.I335V		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	335					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CATTGGGAGAATAGCAGGTGA	0.572			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																		uc001qzz.2		NA		Dom	yes		12	12p13	2120	T	ets variant gene 6 (TEL oncogene)			"""L, E, M"""	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5		congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL	ETV6/NTRK3(234)|ETV6/JAK2(11)	0				soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250						c.(1003-1005)ATA>GTA		ets variant 6							65.0	68.0	67.0					12																	12022897		2203	4300	6503	SO:0001583	missense	2120					cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:12022897A>G	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1003A>G	12.37:g.12022897A>G	ENSP00000379658:p.Ile335Val		Somatic				ETV6_uc001raa.1_Missense_Mutation_p.I128V	p.I335V	NM_001987	NP_001978	WXS	Illumina HiSeq	Unspecified	P41212	ETV6_HUMAN			5	1277	+		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)	335					A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	37	c.1003A>G	CCDS8643.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957396	0.73902	.	.	ENSG00000139083	ENST00000396373	T	0.03689	3.84	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.13329	0.0323	L	0.52011	1.625	0.58432	D	0.999996	D;P	0.67145	0.996;0.897	D;P	0.77557	0.99;0.685	T	0.07809	-1.0753	10	0.29301	T	0.29	.	15.7457	0.77939	1.0:0.0:0.0:0.0	.	39;335	Q0ZHH2;P41212	.;ETV6_HUMAN	V	335	ENSP00000379658:I335V	ENSP00000379658:I335V	I	+	1	0	ETV6	11914164	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.142000	0.89619	2.191000	0.70037	0.533000	0.62120	ATA		0.572	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987		25	58	0	0	0	0.024334	0	25	58				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		7	27	1	0	1.12685e-05	0.047766	1.28088e-05	7	27				
SYT10	341359	broad.mit.edu	37	12	33579161	33579161	+	Missense_Mutation	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:33579161G>C	ENST00000228567.3	-	2	717	c.421C>G	c.(421-423)Cca>Gca	p.P141A	SYT10_ENST00000535526.1_5'UTR|SYT10_ENST00000567656.1_5'Flank	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	141					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					ACTTCTGCTGGGATGTCAGGG	0.388																																							uc001rll.1		NA																	0				ovary(1)|skin(1)	2						c.(421-423)CCA>GCA		synaptotagmin X							187.0	194.0	191.0					12																	33579161		2203	4300	6503	SO:0001583	missense	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33579161G>C	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.421C>G	12.37:g.33579161G>C	ENSP00000228567:p.Pro141Ala		Somatic				SYT10_uc009zju.1_5'UTR	p.P141A	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			2	718	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		141			Cytoplasmic (Potential).		Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	c.421C>G	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009816	0.75046	.	.	ENSG00000110975	ENST00000228567	T	0.54479	0.57	3.78	3.78	0.43462	.	0.173987	0.27240	U	0.020263	T	0.61098	0.2320	M	0.77486	2.375	0.80722	D	1	P	0.47677	0.899	P	0.46885	0.53	T	0.69727	-0.5067	10	0.56958	D	0.05	.	15.8987	0.79356	0.0:0.0:1.0:0.0	.	141	Q6XYQ8	SYT10_HUMAN	A	141	ENSP00000228567:P141A	ENSP00000228567:P141A	P	-	1	0	SYT10	33470428	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.590000	0.90821	2.390000	0.81377	0.655000	0.94253	CCA		0.388	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		32	160	0	0	0	0.025465	0	32	160				
SMARCD1	6602	broad.mit.edu	37	12	50481255	50481255	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:50481255G>A	ENST00000394963.4	+	5	1039	c.641G>A	c.(640-642)cGg>cAg	p.R214Q	SMARCD1_ENST00000381513.4_Missense_Mutation_p.R214Q|SMARCD1_ENST00000548573.1_5'Flank	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GTAGAAGGACGGCTCCTGGAG	0.532																																							uc001rvx.3		NA																	0				ovary(1)	1						c.(640-642)CGG>CAG		SWI/SNF-related matrix-associated							147.0	145.0	145.0					12																	50481255		2203	4300	6503	SO:0001583	missense	6602				chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity	g.chr12:50481255G>A	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.641G>A	12.37:g.50481255G>A	ENSP00000378414:p.Arg214Gln		Somatic				SMARCD1_uc010smo.1_Missense_Mutation_p.R214Q|SMARCD1_uc001rvy.3_Missense_Mutation_p.R214Q|SMARCD1_uc009zlp.2_Intron	p.R214Q	NM_003076	NP_003067	WXS	Illumina HiSeq	Unspecified	Q96GM5	SMRD1_HUMAN			5	811	+			214			Necessary for GR/NR3C1-mediated remodeling and transcription from chromatin; required for GR/NR3C1 interaction with the BRG1/SMARCA4 complex in vivo.|Interaction with SMARCC1 and SMARCC2.			Missense_Mutation	SNP	ENST00000394963.4	37	c.641G>A	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	G	29.5	5.011922	0.93346	.	.	ENSG00000066117	ENST00000394963;ENST00000381513	T;T	0.50813	0.73;0.73	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.62636	0.2444	M	0.80422	2.495	0.80722	D	1	P;P;P	0.52316	0.952;0.851;0.876	P;B;B	0.49683	0.619;0.388;0.277	T	0.69709	-0.5072	10	0.87932	D	0	-13.8837	18.9398	0.92601	0.0:0.0:1.0:0.0	.	214;214;214	B4DF50;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	Q	214	ENSP00000378414:R214Q;ENSP00000370924:R214Q	ENSP00000370924:R214Q	R	+	2	0	SMARCD1	48767522	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.713000	0.84693	2.797000	0.96272	0.561000	0.74099	CGG		0.532	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076		52	96	0	0	0	0.048971	0	52	96				
OAS2	4939	broad.mit.edu	37	12	113435349	113435349	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:113435349C>A	ENST00000342315.4	+	4	866	c.652C>A	c.(652-654)Ccc>Acc	p.P218T	OAS2_ENST00000392583.2_Missense_Mutation_p.P218T|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	218	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CAAGGATTTACCCTCGCTGTC	0.488																																					Pancreas(199;709 2232 18410 33584 35052)	Pancreas(199;709 2232 18410 33584 35052)	uc001tuj.2		NA																	0				ovary(1)	1						c.(652-654)CCC>ACC		2'-5'-oligoadenylate synthetase 2 isoform 1							99.0	87.0	91.0					12																	113435349		2203	4300	6503	SO:0001583	missense	4939				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113435349C>A	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.652C>A	12.37:g.113435349C>A	ENSP00000342278:p.Pro218Thr		Somatic				OAS2_uc001tui.1_Missense_Mutation_p.P218T	p.P218T	NM_016817	NP_058197	WXS	Illumina HiSeq	Unspecified	P29728	OAS2_HUMAN			4	792	+			218			OAS domain 1.		A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	c.652C>A	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	C	9.460	1.092840	0.20471	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000552756	T;T;T	0.40225	1.04;1.04;1.04	3.95	-4.0	0.04057	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.727768	0.11231	U	0.585657	T	0.34048	0.0884	M	0.76727	2.345	0.09310	N	1	B;B	0.18741	0.03;0.019	B;B	0.17098	0.017;0.007	T	0.44390	-0.9331	10	0.72032	D	0.01	-0.6858	1.2074	0.01897	0.1626:0.3496:0.1661:0.3217	.	218;218	P29728;P29728-2	OAS2_HUMAN;.	T	218;218;143	ENSP00000342278:P218T;ENSP00000376362:P218T;ENSP00000446977:P143T	ENSP00000342278:P218T	P	+	1	0	OAS2	111919732	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.560000	0.02160	-0.871000	0.04042	-0.384000	0.06662	CCC		0.488	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			20	47	1	0	2.44723e-14	0.024334	3.16937e-14	20	47				
RITA1	84934	broad.mit.edu	37	12	113624562	113624562	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:113624562C>T	ENST00000548278.1	+	3	703	c.11C>T	c.(10-12)cCc>cTc	p.P4L	DDX54_ENST00000314045.7_5'Flank|RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000549621.1_Missense_Mutation_p.P4L|DDX54_ENST00000306014.5_5'Flank|C12orf52_ENST00000552495.1_Missense_Mutation_p.P28L	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		4					negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						ATGAAGACCCCCGTGGAGCTG	0.647																																							uc001tur.1		NA																	0					0						c.(10-12)CCC>CTC		hypothetical protein LOC84934							35.0	34.0	34.0					12																	113624562		2203	4300	6503	SO:0001583	missense	84934				negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|neurogenesis|Notch signaling pathway|nuclear export	centrosome|nucleus	tubulin binding	g.chr12:113624562C>T																												ENST00000548278.1:c.11C>T	12.37:g.113624562C>T	ENSP00000449841:p.Pro4Leu		Somatic				DDX54_uc001tuq.3_5'Flank|DDX54_uc001tup.2_5'Flank|C12orf52_uc009zwg.1_Missense_Mutation_p.P4L|C12orf52_uc001tus.1_Missense_Mutation_p.P4L|C12orf52_uc001tut.1_Missense_Mutation_p.P28L	p.P4L	NM_032848	NP_116237	WXS	Illumina HiSeq	Unspecified	Q96K30	RITA_HUMAN			3	479	+			4					B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Missense_Mutation	SNP	ENST00000548278.1	37	c.11C>T	CCDS9166.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249665	0.22880	.	.	ENSG00000139405	ENST00000549621;ENST00000548278;ENST00000552495;ENST00000436053;ENST00000299731;ENST00000266813	T;T;T	0.36520	1.41;1.41;1.25	4.86	3.05	0.35203	.	0.547984	0.15371	N	0.265839	T	0.33962	0.0881	L	0.57536	1.79	0.35423	D	0.793377	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.13407	0.009;0.009;0.009	T	0.37267	-0.9713	10	0.72032	D	0.01	-9.5811	8.8275	0.35063	0.0:0.8225:0.0:0.1775	.	4;28;4	Q96K30-2;F8VRG5;Q96K30	.;.;RITA_HUMAN	L	4;4;28;4;4;4	ENSP00000448289:P4L;ENSP00000449841:P4L;ENSP00000448680:P28L	ENSP00000266813:P4L	P	+	2	0	C12orf52	112108945	0.000000	0.05858	0.664000	0.29753	0.022000	0.10575	0.153000	0.16323	0.647000	0.30713	-0.136000	0.14681	CCC		0.647	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405239.1			5	32	0	0	0	0.02938	0	5	32				
TMEM132B	114795	broad.mit.edu	37	12	126135237	126135237	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:126135237G>A	ENST00000299308.3	+	7	1645	c.1637G>A	c.(1636-1638)cGg>cAg	p.R546Q	TMEM132B_ENST00000535886.1_Missense_Mutation_p.R58Q	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	546						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGGCCTACCCGGGAAAGCGAT	0.532																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(1636-1638)CGG>CAG		transmembrane protein 132B							67.0	75.0	72.0					12																	126135237		2163	4279	6442	SO:0001583	missense	114795					integral to membrane		g.chr12:126135237G>A	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1637G>A	12.37:g.126135237G>A	ENSP00000299308:p.Arg546Gln		Somatic				TMEM132B_uc001uhf.1_Missense_Mutation_p.R58Q	p.R546Q	NM_052907	NP_443139	WXS	Illumina HiSeq	Unspecified	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	7	1645	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		546			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.1637G>A	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336484	0.60963	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.19938	2.11;2.11	5.15	4.26	0.50523	.	0.000000	0.56097	D	0.000031	T	0.21427	0.0516	L	0.55834	1.745	0.80722	D	1	B	0.30033	0.266	B	0.23852	0.049	T	0.03068	-1.1076	10	0.59425	D	0.04	.	13.6005	0.62015	0.0751:0.0:0.9249:0.0	.	546	Q14DG7	T132B_HUMAN	Q	546;58	ENSP00000299308:R546Q;ENSP00000440436:R58Q	ENSP00000299308:R546Q	R	+	2	0	TMEM132B	124701190	1.000000	0.71417	0.835000	0.33067	0.020000	0.10135	7.316000	0.79007	1.143000	0.42306	0.655000	0.94253	CGG		0.532	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		14	39	0	0	0	0.038395	0	14	39				
POTEG	404785	broad.mit.edu	37	14	19553672	19553672	+	Missense_Mutation	SNP	C	C	A	rs146829084	byFrequency	TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr14:19553672C>A	ENST00000409832.3	+	1	308	c.256C>A	c.(256-258)Cac>Aac	p.H86N		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	86										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TTCTGGAGACCACGACGACTC	0.607																																							uc001vuz.1		NA																	0				ovary(1)	1						c.(256-258)CAC>AAC		POTE ankyrin domain family, member G							79.0	101.0	94.0					14																	19553672		1954	3996	5950	SO:0001583	missense	404785							g.chr14:19553672C>A		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.256C>A	14.37:g.19553672C>A	ENSP00000386971:p.His86Asn		Somatic				POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.H86N	NM_001005356	NP_001005356	WXS	Illumina HiSeq	Unspecified	Q6S5H5	POTEG_HUMAN			1	308	+			86					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.256C>A	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	c	6.430	0.447558	0.12223	.	.	ENSG00000222036	ENST00000409832	T	0.32515	1.45	0.34	0.34	0.15985	.	.	.	.	.	T	0.22322	0.0538	L	0.39898	1.24	0.09310	N	1	B	0.25007	0.116	B	0.25140	0.058	T	0.23547	-1.0185	8	0.36615	T	0.2	.	.	.	.	.	86	Q6S5H5	POTEG_HUMAN	N	86	ENSP00000386971:H86N	ENSP00000386971:H86N	H	+	1	0	POTEG	18623672	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.784000	0.04633	0.410000	0.25675	0.410000	0.27636	CAC		0.607	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		12	275	1	0	4.87955e-14	0.027356	6.26805e-14	12	275				
POTEM	641455	broad.mit.edu	37	14	20019965	20019965	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr14:20019965G>T	ENST00000551509.1	-	1	307	c.256C>A	c.(256-258)Cac>Aac	p.H86N		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	86										endometrium(4)|kidney(1)|lung(4)	9						GAGTCGTCGTGGTCTCCAGAA	0.612																																							uc001vwc.3		NA																	0					0						c.(256-258)CAC>AAC		prostate-specific P704P							8.0	14.0	13.0					14																	20019965		310	1137	1447	SO:0001583	missense	641455							g.chr14:20019965G>T		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.256C>A	14.37:g.20019965G>T	ENSP00000452296:p.His86Asn		Somatic				P704P_uc001vwb.3_RNA	p.H86N	NM_001145442	NP_001138914	WXS	Illumina HiSeq	Unspecified	A6NI47	POTEM_HUMAN			1	308	-			86						Missense_Mutation	SNP	ENST00000551509.1	37	c.256C>A	CCDS45076.1	.	.	.	.	.	.	.	.	.	.	g	3.802	-0.041562	0.07452	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.31769	1.48	.	.	.	.	.	.	.	.	T	0.21103	0.0508	L	0.39898	1.24	0.09310	N	1	B	0.27791	0.189	B	0.24541	0.054	T	0.19811	-1.0294	6	.	.	.	.	.	.	.	.	86	A6NI47	POTEM_HUMAN	N	86	ENSP00000452296:H86N	.	H	-	1	0	POTEM	19089965	0.001000	0.12720	0.001000	0.08648	0.022000	0.10575	-0.566000	0.05922	0.483000	0.27608	0.152000	0.16155	CAC		0.612	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409490.3	NM_001145442		34	525	1	0	3.85841e-42	0.048971	6.15787e-42	34	525				
FAM179B	23116	broad.mit.edu	37	14	45433134	45433134	+	Missense_Mutation	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr14:45433134G>C	ENST00000361577.3	+	1	1724	c.1510G>C	c.(1510-1512)Gag>Cag	p.E504Q	FAM179B_ENST00000361462.2_Missense_Mutation_p.E504Q|KLHL28_ENST00000396128.4_5'Flank|KLHL28_ENST00000553817.1_5'UTR|KLHL28_ENST00000355081.2_5'Flank|FAM179B_ENST00000382233.2_Missense_Mutation_p.E504Q	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	504										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTATCCTAGTGAGGATTTTGA	0.473																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(1510-1512)GAG>CAG		hypothetical protein LOC23116							123.0	108.0	113.0					14																	45433134		2203	4300	6503	SO:0001583	missense	23116						binding	g.chr14:45433134G>C	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1510G>C	14.37:g.45433134G>C	ENSP00000355045:p.Glu504Gln		Somatic				FAM179B_uc001wvw.2_Missense_Mutation_p.E504Q|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvq.2_5'Flank|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.E504Q|FAM179B_uc001wvu.2_Missense_Mutation_p.E504Q	p.E504Q	NM_015091	NP_055906	WXS	Illumina HiSeq	Unspecified	Q9Y4F4	F179B_HUMAN			1	1719	+			504			HEAT 3.		Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	c.1510G>C	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.537552	0.45176	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.55413	0.52;0.52;0.52	4.29	4.29	0.51040	Armadillo-like helical (1);Armadillo-type fold (1);	0.315987	0.28135	N	0.016479	T	0.37517	0.1006	N	0.01576	-0.805	0.29951	N	0.820202	P;D;P;P	0.56035	0.666;0.974;0.955;0.666	B;P;P;B	0.56216	0.428;0.794;0.648;0.428	T	0.37384	-0.9708	10	0.26408	T	0.33	-12.5466	13.8249	0.63343	0.0:0.1544:0.8456:0.0	.	504;504;504;504	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	Q	504	ENSP00000355045:E504Q;ENSP00000354917:E504Q;ENSP00000371668:E504Q	ENSP00000354917:E504Q	E	+	1	0	FAM179B	44502884	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.176000	0.58269	2.379000	0.81126	0.561000	0.74099	GAG		0.473	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		40	113	0	0	0	0.045515	0	40	113				
ZFP36L1	677	broad.mit.edu	37	14	69256365	69256365	+	Missense_Mutation	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr14:69256365T>A	ENST00000439696.2	-	2	1203	c.902A>T	c.(901-903)gAc>gTc	p.D301V	ZFP36L1_ENST00000555997.1_3'UTR|ZFP36L1_ENST00000336440.3_Missense_Mutation_p.D301V	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	301					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GCCCTCCTGGTCCGAGAGAGA	0.632											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkh.1		NA																	0				ovary(1)	1						c.(901-903)GAC>GTC		butyrate response factor 1							65.0	74.0	71.0					14																	69256365		2203	4300	6503	SO:0001583	missense	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69256365T>A	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.902A>T	14.37:g.69256365T>A	ENSP00000388402:p.Asp301Val		Somatic	OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1113	ZFP36L1_uc001xki.1_Missense_Mutation_p.D301V	p.D301V	NM_004926	NP_004917	WXS	Illumina HiSeq	Unspecified	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	2	1032	-			301					Q13851	Missense_Mutation	SNP	ENST00000439696.2	37	c.902A>T	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.125570	0.77436	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246	T;T	0.28069	1.63;1.63	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.54382	0.1855	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59810	-0.7384	10	0.87932	D	0	-13.7889	14.2641	0.66104	0.0:0.0:0.0:1.0	.	301	Q07352	TISB_HUMAN	V	301;301;284	ENSP00000388402:D301V;ENSP00000337386:D301V	ENSP00000337386:D301V	D	-	2	0	ZFP36L1	68326118	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.455000	0.80726	1.954000	0.56735	0.482000	0.46254	GAC		0.632	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			47	112	0	0	0	0.048971	0	47	112				
GOLGA6B	55889	broad.mit.edu	37	15	72953662	72953662	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr15:72953662C>T	ENST00000421285.3	+	8	622	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W		NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	208						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						CATAAAGGAGCGGGCGCTGCT	0.592																																							uc010uks.1		NA																	0					0						c.(622-624)CGG>TGG		golgi autoantigen, golgin subfamily a, 6B							52.0	68.0	62.0					15																	72953662		1462	2622	4084	SO:0001583	missense	55889							g.chr15:72953662C>T		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.622C>T	15.37:g.72953662C>T	ENSP00000408132:p.Arg208Trp		Somatic					p.R208W	NM_018652	NP_061122	WXS	Illumina HiSeq	Unspecified	A6NDN3	GOG6B_HUMAN			8	663	+			208			Potential.		A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	c.622C>T	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	8.985	0.976187	0.18736	.	.	ENSG00000215186	ENST00000421285	T	0.22743	1.94	0.39	0.39	0.16275	.	.	.	.	.	T	0.18130	0.0435	M	0.76170	2.325	0.25398	N	0.98847	P	0.41159	0.74	B	0.27715	0.082	T	0.18713	-1.0328	9	0.87932	D	0	.	6.668	0.23052	0.0:0.9998:0.0:2.0E-4	.	208	A6NDN3	GOG6B_HUMAN	W	208	ENSP00000408132:R208W	ENSP00000408132:R208W	R	+	1	2	GOLGA6B	70740716	0.952000	0.32445	0.028000	0.17463	0.012000	0.07955	0.508000	0.22692	0.472000	0.27344	0.134000	0.15878	CGG		0.592	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652		19	149	0	0	0	0.037714	0	19	149				
RGMA	56963	broad.mit.edu	37	15	93595608	93595608	+	Missense_Mutation	SNP	C	C	A	rs368408820		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr15:93595608C>A	ENST00000329082.7	-	3	531	c.260G>T	c.(259-261)cGg>cTg	p.R87L	RGMA_ENST00000557420.1_Intron|RGMA_ENST00000557301.1_Missense_Mutation_p.R95L|RGMA_ENST00000556087.1_Missense_Mutation_p.R71L|RGMA_ENST00000425933.2_Missense_Mutation_p.R71L|RGMA_ENST00000555584.1_5'UTR|RGMA_ENST00000556658.1_5'UTR|RGMA_ENST00000542321.2_Missense_Mutation_p.R71L|RGMA_ENST00000538818.1_5'UTR|RGMA_ENST00000543599.1_Missense_Mutation_p.R71L	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	87					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GGCCGTCCGCCGCGTGCACAG	0.677																																							uc002bss.1		NA																	0					0						c.(259-261)CGG>CTG		RGM domain family, member A precursor							12.0	15.0	14.0					15																	93595608		2130	4203	6333	SO:0001583	missense	56963				axon guidance	anchored to membrane|endoplasmic reticulum|plasma membrane		g.chr15:93595608C>A	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.260G>T	15.37:g.93595608C>A	ENSP00000330005:p.Arg87Leu		Somatic				RGMA_uc002bsq.1_Missense_Mutation_p.R71L|RGMA_uc010boi.1_5'UTR|RGMA_uc002bsr.1_5'UTR|RGMA_uc010urc.1_Missense_Mutation_p.R95L	p.R87L	NM_020211	NP_064596	WXS	Illumina HiSeq	Unspecified	Q96B86	RGMA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)		3	532	-	Lung NSC(78;0.0542)|all_lung(78;0.0786)		87					B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	37	c.260G>T	CCDS45357.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696735	0.88830	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000557301;ENST00000555598	D;D;D;D;D;D	0.97642	-4.47;-4.47;-4.47;-4.47;-4.47;-4.47	5.15	5.15	0.70609	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97523	0.9189	M	0.73962	2.25	0.80722	D	1	P;P	0.51147	0.929;0.942	P;P	0.55923	0.682;0.787	D	0.97740	1.0208	10	0.72032	D	0.01	-0.7563	12.6645	0.56833	0.0:0.919:0.0:0.081	.	95;87	G3V518;Q96B86	.;RGMA_HUMAN	L	71;71;87;71;95;71	ENSP00000442498:R71L;ENSP00000404442:R71L;ENSP00000330005:R87L;ENSP00000440025:R71L;ENSP00000452126:R95L;ENSP00000451709:R71L	ENSP00000330005:R87L	R	-	2	0	RGMA	91396612	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.965000	0.40471	2.409000	0.81822	0.462000	0.41574	CGG		0.677	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	NM_020211		8	16	1	0	1.12685e-05	0.047766	1.28088e-05	8	16				
TPSD1	23430	broad.mit.edu	37	16	1308080	1308080	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr16:1308080C>A	ENST00000211076.3	+	4	689	c.541C>A	c.(541-543)Ccg>Acg	p.P181T	PRSS29P_ENST00000568091.1_lincRNA|TPSD1_ENST00000397534.2_Missense_Mutation_p.P174T|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	181	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				GCCGCCATACCCGCTGAAGGA	0.657																																							uc002clb.1		NA																	0					0						c.(541-543)CCG>ACG		tryptase delta 1 precursor							27.0	27.0	27.0					16																	1308080		2184	4284	6468	SO:0001583	missense	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1308080C>A	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.541C>A	16.37:g.1308080C>A	ENSP00000211076:p.Pro181Thr		Somatic				TPSD1_uc010brm.1_Missense_Mutation_p.P110T	p.P181T	NM_012217	NP_036349	WXS	Illumina HiSeq	Unspecified	Q9BZJ3	TRYD_HUMAN			4	550	+		Hepatocellular(780;0.00369)	181			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	c.541C>A	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	N	12.25	1.880839	0.33255	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.87179	-2.22;-2.22	3.31	3.31	0.37934	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.144539	0.32372	N	0.006193	T	0.70272	0.3205	N	0.00707	-1.245	0.25642	N	0.986197	P;P	0.46706	0.721;0.883	P;P	0.53102	0.592;0.718	T	0.67413	-0.5677	10	0.02654	T	1	.	12.4326	0.55583	0.0:1.0:0.0:0.0	.	165;181	C9JJL5;Q9BZJ3	.;TRYD_HUMAN	T	174;181	ENSP00000380668:P174T;ENSP00000211076:P181T	ENSP00000211076:P181T	P	+	1	0	TPSD1	1248081	0.000000	0.05858	0.023000	0.16930	0.074000	0.17049	0.011000	0.13264	1.537000	0.49254	0.478000	0.44815	CCG		0.657	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			3	9	1	0	0.004672	0.004672	0.00485642	3	9				
THUMPD1	55623	broad.mit.edu	37	16	20748389	20748389	+	Missense_Mutation	SNP	G	G	A	rs139713563	byFrequency	TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr16:20748389G>A	ENST00000381337.2	-	4	1219	c.875C>T	c.(874-876)gCg>gTg	p.A292V	THUMPD1_ENST00000431224.2_Missense_Mutation_p.A378V|THUMPD1_ENST00000396083.2_Missense_Mutation_p.A292V	NM_017736.3	NP_060206.2	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	292							poly(A) RNA binding (GO:0044822)	p.A292V(1)		NS(2)|large_intestine(2)|lung(6)|pancreas(1)|urinary_tract(1)	12						TGATTTGTCCGCAGATTCCAG	0.448													G|||	12	0.00239617	0.0091	0.0	5008	,	,		19860	0.0		0.0	False		,,,				2504	0.0						uc002dho.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(874-876)GCG>GTG		THUMP domain containing 1		G	VAL/ALA	20,4382	28.1+/-56.4	0,20,2181	218.0	187.0	197.0		875	-5.4	0.0	16	dbSNP_134	197	0,8600		0,0,4300	yes	missense	THUMPD1	NM_017736.3	64	0,20,6481	AA,AG,GG		0.0,0.4543,0.1538	benign	292/354	20748389	20,12982	2201	4300	6501	SO:0001583	missense	55623							g.chr16:20748389G>A	BC000448	CCDS10588.1	16p13.11	2010-06-17			ENSG00000066654	ENSG00000066654			23807	protein-coding gene	gene with protein product							Standard	XM_005255422		Approved	FLJ20274	uc002dho.3	Q9NXG2	OTTHUMG00000131558	ENST00000381337.2:c.875C>T	16.37:g.20748389G>A	ENSP00000370741:p.Ala292Val		Somatic				THUMPD1_uc010vaz.1_Missense_Mutation_p.A145V|THUMPD1_uc002dhp.2_Missense_Mutation_p.A292V	p.A292V	NM_017736	NP_060206	WXS	Illumina HiSeq	Unspecified	Q9NXG2	THUM1_HUMAN			4	1013	-			292					Q9BWC3	Missense_Mutation	SNP	ENST00000381337.2	37	c.875C>T	CCDS10588.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	6.987	0.552178	0.13374	0.004543	0.0	ENSG00000066654	ENST00000381337;ENST00000431224;ENST00000396083	T;T;T	0.48522	0.87;0.81;0.87	5.92	-5.4	0.02656	.	0.858549	0.10028	N	0.725178	T	0.15305	0.0369	N	0.02011	-0.69	0.09310	N	1	B	0.22003	0.063	B	0.14578	0.011	T	0.18178	-1.0345	10	0.29301	T	0.29	.	5.1671	0.15092	0.1244:0.1788:0.0869:0.6099	.	292	Q9NXG2	THUM1_HUMAN	V	292;378;292	ENSP00000370741:A292V;ENSP00000392282:A378V;ENSP00000379392:A292V	ENSP00000370741:A292V	A	-	2	0	THUMPD1	20655890	0.000000	0.05858	0.012000	0.15200	0.126000	0.20510	0.039000	0.13884	-0.766000	0.04639	-0.311000	0.09066	GCG		0.448	THUMPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254420.1	NM_017736		22	76	0	0	0	0.055883	0	22	76				
TNRC6A	27327	broad.mit.edu	37	16	24834870	24834870	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr16:24834870C>T	ENST00000395799.3	+	25	5760	c.5631C>T	c.(5629-5631)tcC>tcT	p.S1877S	TNRC6A_ENST00000315183.7_Silent_p.S1828S|TNRC6A_ENST00000432286.2_Silent_p.S355S	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1877	Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CTCTCGGGTCCAGCCAGAGCC	0.567																																							uc002dmm.2		NA																	0				ovary(2)	2						c.(5629-5631)TCC>TCT		trinucleotide repeat containing 6A							83.0	91.0	88.0					16																	24834870		2197	4300	6497	SO:0001819	synonymous_variant	27327				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding	g.chr16:24834870C>T	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.5631C>T	16.37:g.24834870C>T			Somatic				TNRC6A_uc010bxs.2_Silent_p.S1624S|TNRC6A_uc002dmn.2_Silent_p.S1575S|TNRC6A_uc002dmo.2_Silent_p.S1516S|TNRC6A_uc002dmr.2_Silent_p.S76S	p.S1877S	NM_014494	NP_055309	WXS	Illumina HiSeq	Unspecified	Q8NDV7	TNR6A_HUMAN		GBM - Glioblastoma multiforme(48;0.0394)	25	5745	+			1877			Sufficient for interaction with EIF2C2.		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	37	c.5631C>T	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	c	2.649	-0.282383	0.05642	.	.	ENSG00000090905	ENST00000450465	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.6799	8.8363	0.35115	0.1503:0.7756:0.0:0.0741	.	.	.	.	X	768	.	.	Q	+	1	0	TNRC6A	24742371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.170000	0.50816	2.638000	0.89438	0.651000	0.88453	CAG		0.567	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		53	131	0	0	0	0.048971	0	53	131				
IL4R	3566	broad.mit.edu	37	16	27353517	27353517	+	Missense_Mutation	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr16:27353517A>G	ENST00000395762.2	+	4	405	c.146A>G	c.(145-147)aAt>aGt	p.N49S	IL4R_ENST00000380922.3_Missense_Mutation_p.N34S|IL4R_ENST00000543915.2_Missense_Mutation_p.N49S|IL4R_ENST00000170630.2_Missense_Mutation_p.N49S|IL4R_ENST00000449195.1_Missense_Mutation_p.N49S	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	49					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TGGAAGATGAATGGTCCCACC	0.572																																							uc002don.2		NA																	0				ovary(1)|skin(1)	2						c.(145-147)AAT>AGT		interleukin 4 receptor alpha chain isoform a							148.0	120.0	130.0					16																	27353517		2197	4300	6497	SO:0001583	missense	3566				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity	g.chr16:27353517A>G	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.146A>G	16.37:g.27353517A>G	ENSP00000379111:p.Asn49Ser		Somatic				IL4R_uc002dom.2_Missense_Mutation_p.N49S|IL4R_uc002dop.3_Missense_Mutation_p.N34S|IL4R_uc010bxy.2_Missense_Mutation_p.N49S|IL4R_uc002doo.2_5'UTR	p.N49S	NM_000418	NP_000409	WXS	Illumina HiSeq	Unspecified	P24394	IL4RA_HUMAN			4	388	+			49			Extracellular (Potential).		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	c.146A>G	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	A	0.160	-1.081926	0.01888	.	.	ENSG00000077238	ENST00000380925;ENST00000449195;ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94	3.61	-7.22	0.01485	Interleukin-4 receptor alpha chain, N-terminal (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.185490	0.05674	N	0.589247	T	0.09949	0.0244	N	0.19112	0.55	0.09310	N	1	B;B;B	0.18013	0.025;0.015;0.008	B;B;B	0.15052	0.012;0.008;0.003	T	0.33929	-0.9849	10	0.10902	T	0.67	-13.4711	7.4642	0.27312	0.3982:0.4244:0.1774:0.0	.	34;49;49	B4E076;P24394;P24394-2	.;IL4RA_HUMAN;.	S	49;49;49;49;34;49	ENSP00000410322:N49S;ENSP00000379111:N49S;ENSP00000441667:N49S;ENSP00000370309:N34S;ENSP00000170630:N49S	ENSP00000170630:N49S	N	+	2	0	IL4R	27261018	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	-0.277000	0.08502	-1.756000	0.01318	-1.258000	0.01471	AAT		0.572	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4			14	148	0	0	0	0.038395	0	14	148				
TMEM102	284114	broad.mit.edu	37	17	7340297	7340297	+	Silent	SNP	C	C	T	rs111344839		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:7340297C>T	ENST00000323206.1	+	3	1272	c.999C>T	c.(997-999)agC>agT	p.S333S	RP11-104H15.9_ENST00000570444.1_RNA|FGF11_ENST00000575235.1_5'Flank|FGF11_ENST00000572907.1_5'Flank|RP11-104H15.7_ENST00000575310.1_RNA|RP11-104H15.10_ENST00000575331.1_RNA|FGF11_ENST00000293829.4_5'Flank|TMEM102_ENST00000396568.1_Silent_p.S333S|RP11-104H15.8_ENST00000576615.1_RNA	NM_178518.2	NP_848613.1	Q8N9M5	TM102_HUMAN	transmembrane protein 102	333					apoptotic process (GO:0006915)|positive regulation of cell adhesion (GO:0045785)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				kidney(1)|lung(3)|skin(1)	5		Prostate(122;0.173)				GGGCTCGGAGCCACTCGTGGG	0.726																																							uc002ggx.1		NA																	0					0						c.(997-999)AGC>AGT		transmembrane protein 102							6.0	8.0	8.0					17																	7340297		1682	3457	5139	SO:0001819	synonymous_variant	284114				regulation of apoptosis|response to cytokine stimulus|signal transduction	cell surface|integral to membrane|intracellular	protein binding	g.chr17:7340297C>T	AK094197	CCDS11104.1	17p13.1	2008-04-21			ENSG00000181284	ENSG00000181284			26722	protein-coding gene	gene with protein product		613936				12477932	Standard	NM_178518		Approved	FLJ36878	uc002ggx.1	Q8N9M5	OTTHUMG00000132901	ENST00000323206.1:c.999C>T	17.37:g.7340297C>T			Somatic				FGF11_uc010vtw.1_Intron|TMEM102_uc002ggy.1_Silent_p.S333S|FGF11_uc010cmh.1_5'Flank|FGF11_uc010cmi.2_5'Flank|FGF11_uc002ggz.2_5'Flank	p.S333S	NM_178518	NP_848613	WXS	Illumina HiSeq	Unspecified	Q8N9M5	TM102_HUMAN			3	1272	+		Prostate(122;0.173)	333			Cytoplasmic (Potential).		D3DTP8	Silent	SNP	ENST00000323206.1	37	c.999C>T	CCDS11104.1																																																																																				0.726	TMEM102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256405.1	NM_178518		12	20	0	0	0	0.020292	0	12	20				
SLC13A2	9058	broad.mit.edu	37	17	26817852	26817852	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:26817852G>A	ENST00000314669.5	+	4	922	c.502G>A	c.(502-504)Gtc>Atc	p.V168I	SLC13A2_ENST00000545060.1_Missense_Mutation_p.V125I|SLC13A2_ENST00000537681.1_Missense_Mutation_p.V97I|SLC13A2_ENST00000444914.3_Missense_Mutation_p.V217I	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	168					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CAGCAGCAACGTCGAGGAGGG	0.597																																							uc002hbh.2		NA																	0					0						c.(502-504)GTC>ATC		solute carrier family 13, member 2 isoform b	Succinic acid(DB00139)						67.0	58.0	61.0					17																	26817852		2203	4300	6503	SO:0001583	missense	9058					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity	g.chr17:26817852G>A	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.502G>A	17.37:g.26817852G>A	ENSP00000316202:p.Val168Ile		Somatic				SLC13A2_uc010wal.1_Missense_Mutation_p.V125I|SLC13A2_uc010wam.1_Missense_Mutation_p.V124I|SLC13A2_uc010wan.1_Missense_Mutation_p.V217I|SLC13A2_uc010wao.1_Missense_Mutation_p.V125I|SLC13A2_uc002hbi.2_Missense_Mutation_p.V97I	p.V168I	NM_003984	NP_003975	WXS	Illumina HiSeq	Unspecified	Q13183	S13A2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	4	569	+	all_lung(13;0.000871)|Lung NSC(42;0.0027)		168					B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	c.502G>A	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	9.530	1.110561	0.20714	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.70631	-0.19;-0.2;-0.5;-0.5	5.42	-2.85	0.05734	.	1.692810	0.03099	N	0.160855	T	0.66157	0.2761	M	0.63843	1.955	0.09310	N	1	B;B;B;B;B	0.16166	0.009;0.014;0.016;0.007;0.016	B;B;B;B;B	0.18561	0.004;0.022;0.009;0.005;0.009	T	0.42982	-0.9419	10	0.30078	T	0.28	-2.0318	8.1258	0.30997	0.4036:0.1821:0.4143:0.0	.	125;217;124;97;168	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	I	168;217;125;124;97	ENSP00000316202:V168I;ENSP00000392411:V217I;ENSP00000441935:V125I;ENSP00000440802:V97I	ENSP00000316202:V168I	V	+	1	0	SLC13A2	23841979	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.016000	0.13377	-1.239000	0.02532	-2.230000	0.00291	GTC		0.597	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984		19	41	0	0	0	0.043863	0	19	41				
NUFIP2	57532	broad.mit.edu	37	17	27620945	27620945	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:27620945G>T	ENST00000225388.4	-	1	191	c.133C>A	c.(133-135)Cac>Aac	p.H45N	NUFIP2_ENST00000579665.1_Missense_Mutation_p.H45N	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	45	His-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			tggtggtggtggttgtggctg	0.587																																							uc002hdy.3		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(133-135)CAC>AAC		nuclear fragile X mental retardation protein							127.0	125.0	125.0					17																	27620945		2203	4300	6503	SO:0001583	missense	57532					nucleus|polysomal ribosome	protein binding|RNA binding	g.chr17:27620945G>T	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.133C>A	17.37:g.27620945G>T	ENSP00000225388:p.His45Asn		Somatic				NUFIP2_uc002hdx.3_Missense_Mutation_p.H45N	p.H45N	NM_020772	NP_065823	WXS	Illumina HiSeq	Unspecified	Q7Z417	NUFP2_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)		1	222	-			45			His-rich.		A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	c.133C>A	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778902	0.49891	.	.	ENSG00000108256	ENST00000225388	.	.	.	5.41	5.41	0.78517	.	0.000000	0.46758	D	0.000266	T	0.24470	0.0593	N	0.08118	0	0.32353	N	0.558245	B;B	0.34226	0.238;0.443	B;B	0.30943	0.122;0.047	T	0.33777	-0.9855	9	0.45353	T	0.12	0.0249	14.6859	0.69049	0.0:0.0:1.0:0.0	.	45;45	Q7Z417;A1L3A6	NUFP2_HUMAN;.	N	45	.	ENSP00000225388:H45N	H	-	1	0	NUFIP2	24645071	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.321000	0.65846	2.539000	0.85634	0.467000	0.42956	CAC		0.587	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772		4	131	1	0	1.024e-07	0.014758	1.19846e-07	4	131				
KRT10	3858	broad.mit.edu	37	17	38976885	38976885	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:38976885C>T	ENST00000269576.5	-	3	754	c.745G>A	c.(745-747)Gag>Aag	p.E249K	TMEM99_ENST00000301665.3_Intron|TMEM99_ENST00000496847.1_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	249	Coil 1B.|Gly-rich.|Rod.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ATGTCAGCCTCCACGCTCTGG	0.507																																							uc002hvi.2		NA																	0					0						c.(745-747)GAG>AAG		keratin 10							96.0	92.0	93.0					17																	38976885		2203	4300	6503	SO:0001583	missense	3858				epidermis development		protein binding|structural constituent of epidermis	g.chr17:38976885C>T	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.745G>A	17.37:g.38976885C>T	ENSP00000269576:p.Glu249Lys		Somatic				KRT10_uc010cxd.2_5'Flank|TMEM99_uc002hvj.1_Intron	p.E249K	NM_000421	NP_000412	WXS	Illumina HiSeq	Unspecified	P13645	K1C10_HUMAN			3	771	-		Breast(137;0.000301)	249			Coil 1B.|Rod.|Gly-rich.		Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	37	c.745G>A	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	37	6.153172	0.97329	.	.	ENSG00000186395	ENST00000269576	D	0.94723	-3.5	5.84	5.84	0.93424	Filament (1);	0.000000	0.36740	N	0.002426	D	0.98239	0.9417	H	0.94345	3.525	0.80722	D	1	D	0.67145	0.996	D	0.85130	0.997	D	0.98737	1.0715	10	0.87932	D	0	.	20.1533	0.98095	0.0:1.0:0.0:0.0	.	249	P13645	K1C10_HUMAN	K	249	ENSP00000269576:E249K	ENSP00000269576:E249K	E	-	1	0	KRT10	36230411	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.773000	0.85462	2.758000	0.94735	0.655000	0.94253	GAG		0.507	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421		35	83	0	0	0	0.017118	0	35	83				
PTRF	284119	broad.mit.edu	37	17	40557198	40557198	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:40557198C>A	ENST00000357037.5	-	2	1099	c.680G>T	c.(679-681)cGg>cTg	p.R227L		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GTCCACGCGCCGCAGGCCGCT	0.622																																							uc002hzo.2		NA																	0				breast(1)	1						c.(679-681)CGG>CTG		polymerase I and transcript release factor							103.0	103.0	103.0					17																	40557198		2203	4300	6503	SO:0001583	missense	284119				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding	g.chr17:40557198C>A	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.680G>T	17.37:g.40557198C>A	ENSP00000349541:p.Arg227Leu		Somatic				PTRF_uc010wgi.1_Missense_Mutation_p.R209L	p.R227L	NM_012232	NP_036364	WXS	Illumina HiSeq	Unspecified	Q6NZI2	PTRF_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.193)	2	839	-		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)	227			Potential.			Missense_Mutation	SNP	ENST00000357037.5	37	c.680G>T	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464200	0.63513	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.60299	0.2	5.35	5.35	0.76521	.	0.216731	0.41823	D	0.000809	T	0.57902	0.2085	L	0.43152	1.355	0.40987	D	0.984829	P;P	0.51537	0.946;0.946	P;P	0.49528	0.614;0.614	T	0.63229	-0.6684	10	0.72032	D	0.01	-25.3094	12.8648	0.57934	0.0:0.9151:0.0:0.0849	.	209;227	B4DNU9;Q6NZI2	.;PTRF_HUMAN	L	227;182	ENSP00000349541:R227L	ENSP00000349541:R227L	R	-	2	0	PTRF	37810724	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.899000	0.56288	2.511000	0.84671	0.446000	0.29264	CGG		0.622	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232		26	83	1	0	1.75199e-13	0.034045	2.23237e-13	26	83				
SGSH	6448	broad.mit.edu	37	17	78185956	78185956	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:78185956G>A	ENST00000326317.6	-	7	949	c.863C>T	c.(862-864)cCg>cTg	p.P288L	SGSH_ENST00000572208.1_5'Flank|SGSH_ENST00000570923.1_3'UTR|SGSH_ENST00000534910.1_Missense_Mutation_p.P85L	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	288			P -> S (in MPS3A). {ECO:0000269|PubMed:11793481}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)	p.P288L(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			AGCAGTGCCCGGCCAGTACAG	0.617																																							uc002jxz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(862-864)CCG>CTG		N-sulfoglucosamine sulfohydrolase precursor							70.0	57.0	62.0					17																	78185956		2203	4300	6503	SO:0001583	missense	6448				proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity	g.chr17:78185956G>A	BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.863C>T	17.37:g.78185956G>A	ENSP00000314606:p.Pro288Leu		Somatic				SGSH_uc002jya.3_Missense_Mutation_p.P85L|SGSH_uc002jxy.2_3'UTR|SGSH_uc010wue.1_3'UTR	p.P288L	NM_000199	NP_000190	WXS	Illumina HiSeq	Unspecified	P51688	SPHM_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		7	950	-	all_neural(118;0.0952)		288		P -> S (in MPS3A).			A8K5E2	Missense_Mutation	SNP	ENST00000326317.6	37	c.863C>T	CCDS11770.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.930044	0.52759	.	.	ENSG00000181523	ENST00000326317;ENST00000534910	D;D	0.98567	-5.0;-5.0	4.62	4.62	0.57501	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.065842	0.64402	D	0.000006	D	0.97068	0.9042	L	0.54323	1.7	0.51482	D	0.999929	P	0.41345	0.746	B	0.44044	0.439	D	0.96734	0.9541	10	0.22706	T	0.39	-37.7294	17.0355	0.86474	0.0:0.0:1.0:0.0	.	288	P51688	SPHM_HUMAN	L	288;85	ENSP00000314606:P288L;ENSP00000437778:P85L	ENSP00000314606:P288L	P	-	2	0	SGSH	75800551	1.000000	0.71417	0.976000	0.42696	0.538000	0.34931	7.531000	0.81973	2.115000	0.64714	0.557000	0.71058	CCG		0.617	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199		22	43	0	0	0	0.024334	0	22	43				
AATK	9625	broad.mit.edu	37	17	79094976	79094976	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:79094976G>T	ENST00000326724.4	-	11	2784	c.2760C>A	c.(2758-2760)ttC>ttA	p.F920L	AATK_ENST00000417379.1_Missense_Mutation_p.F817L	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	920					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCGACGGGCTGAAGACCTCAT	0.637																																							uc010dia.2		NA																	0				stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9						c.(2758-2760)TTC>TTA		apoptosis-associated tyrosine kinase							11.0	13.0	13.0					17																	79094976		1998	4162	6160	SO:0001583	missense	9625					integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:79094976G>T	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.2760C>A	17.37:g.79094976G>T	ENSP00000324196:p.Phe920Leu		Somatic				AATK_uc010dhz.2_Intron	p.F920L	NM_001080395	NP_001073864	WXS	Illumina HiSeq	Unspecified	Q6ZMQ8	LMTK1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)		11	2840	-	all_neural(118;0.101)		920					O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	c.2760C>A	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.788|9.788	1.177230|1.177230	0.21787|0.21787	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000326724|ENST00000417379	T|.	0.76968|.	-1.06|.	3.95|3.95	-0.889|-0.889	0.10580|0.10580	.|.	0.420318|.	0.22387|.	N|.	0.060737|.	T|.	0.24812|.	0.0602|.	L|L	0.35414|0.35414	1.06|1.06	0.23496|0.23496	N|N	0.99755|0.99755	B|.	0.12630|.	0.006|.	B|.	0.09377|.	0.004|.	T|.	0.28235|.	-1.0050|.	10|.	0.02654|.	T|.	1|.	.|.	4.183|4.183	0.10385|0.10385	0.0817:0.1296:0.5068:0.2818|0.0817:0.1296:0.5068:0.2818	.|.	920|.	Q6ZMQ8|.	LMTK1_HUMAN|.	L|X	920|873	ENSP00000324196:F920L|.	ENSP00000324196:F920L|.	F|S	-|-	3|2	2|0	AATK|AATK	76709571|76709571	0.995000|0.995000	0.38212|0.38212	0.969000|0.969000	0.41365|0.41365	0.563000|0.563000	0.35712|0.35712	1.826000|1.826000	0.39092|0.39092	-0.021000|-0.021000	0.14009|0.14009	0.462000|0.462000	0.41574|0.41574	TTC|TCA		0.637	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920		5	9	1	0	0.000602214	0.014758	0.000642905	5	9				
DLGAP1	9229	broad.mit.edu	37	18	3879494	3879494	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr18:3879494T>C	ENST00000315677.3	-	4	1170	c.575A>G	c.(574-576)aAg>aGg	p.K192R	DLGAP1_ENST00000515196.2_Missense_Mutation_p.K192R|DLGAP1_ENST00000584874.1_Missense_Mutation_p.K192R|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000581527.1_Missense_Mutation_p.K192R	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	192					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGGCCGGGCCTTGGGCTCCGC	0.697																																							uc002kmf.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(574-576)AAG>AGG		discs large homolog-associated protein 1 isoform							58.0	68.0	65.0					18																	3879494		2202	4298	6500	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3879494T>C	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.575A>G	18.37:g.3879494T>C	ENSP00000316377:p.Lys192Arg		Somatic				DLGAP1_uc010wyz.1_Missense_Mutation_p.K192R|DLGAP1_uc002kmk.2_Missense_Mutation_p.K192R|uc002kml.1_Intron	p.K192R	NM_004746	NP_004737	WXS	Illumina HiSeq	Unspecified	O14490	DLGP1_HUMAN			1	642	-		Colorectal(8;0.0257)	192					A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.575A>G	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393099	0.62066	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.15017	2.46;2.46	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.34658	0.0905	L	0.47716	1.5	0.80722	D	1	D;D;P	0.71674	0.997;0.998;0.928	D;D;P	0.80764	0.985;0.994;0.609	T	0.01993	-1.1233	10	0.33940	T	0.23	-24.786	15.6239	0.76833	0.0:0.0:0.0:1.0	.	192;192;192	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	R	192	ENSP00000316377:K192R;ENSP00000445973:K192R	ENSP00000316377:K192R	K	-	2	0	DLGAP1	3869494	1.000000	0.71417	0.993000	0.49108	0.572000	0.35998	4.872000	0.63050	2.105000	0.64084	0.533000	0.62120	AAG		0.697	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			3	141	0	0	0	0.004672	0	3	141				
SETBP1	26040	broad.mit.edu	37	18	42532001	42532001	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr18:42532001T>C	ENST00000282030.5	+	4	2992	c.2696T>C	c.(2695-2697)cTg>cCg	p.L899P		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	899						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TTCTGCTCCCTGGACAACCCG	0.557									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2695-2697)CTG>CCG		SET binding protein 1 isoform a							46.0	34.0	38.0					18																	42532001		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532001T>C	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2696T>C	18.37:g.42532001T>C	ENSP00000282030:p.Leu899Pro		Somatic					p.L899P	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	2992	+			899					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.2696T>C	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	T	14.25	2.478142	0.44044	.	.	ENSG00000152217	ENST00000282030	D	0.90844	-2.74	6.17	6.17	0.99709	.	0.075543	0.53938	D	0.000045	D	0.91673	0.7368	N	0.24115	0.695	0.58432	D	0.999996	D	0.76494	0.999	D	0.67548	0.952	D	0.93022	0.6441	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	899	Q9Y6X0	SETBP_HUMAN	P	899	ENSP00000282030:L899P	ENSP00000282030:L899P	L	+	2	0	SETBP1	40785999	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	4.130000	0.57964	2.371000	0.80710	0.533000	0.62120	CTG		0.557	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		14	22	0	0	0	0.016723	0	14	22				
KEAP1	9817	broad.mit.edu	37	19	10602925	10602925	+	Missense_Mutation	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:10602925T>A	ENST00000171111.5	-	3	1200	c.653A>T	c.(652-654)gAg>gTg	p.E218V	KEAP1_ENST00000588024.1_5'UTR|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.E218V	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	218	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GAAGAACTCCTCTTGCTTGGC	0.607																																							uc002moq.1		NA																	0		p.E218Q(1)		lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(652-654)GAG>GTG		kelch-like ECH-associated protein 1							54.0	42.0	46.0					19																	10602925		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602925T>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.653A>T	19.37:g.10602925T>A	ENSP00000171111:p.Glu218Val		Somatic				KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.E218V	p.E218V	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	809	-			218			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.653A>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.720862	0.89205	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.72505	-0.66;-0.66	5.75	5.75	0.90469	BTB/Kelch-associated (2);	0.217246	0.47852	D	0.000217	T	0.81536	0.4843	M	0.87038	2.855	0.80722	D	1	P	0.50443	0.935	P	0.52159	0.691	D	0.85206	0.1018	10	0.87932	D	0	.	14.0131	0.64509	0.0:0.0:0.0:1.0	.	218	Q14145	KEAP1_HUMAN	V	218	ENSP00000171111:E218V;ENSP00000377245:E218V	ENSP00000171111:E218V	E	-	2	0	KEAP1	10463925	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.167000	0.71902	2.196000	0.70406	0.397000	0.26171	GAG		0.607	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		28	28	0	0	0	0.041601	0	28	28				
ZNF563	147837	broad.mit.edu	37	19	12429722	12429722	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:12429722T>C	ENST00000293725.5	-	4	1322	c.1117A>G	c.(1117-1119)Acg>Gcg	p.T373A		NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						TGAGATAACGTTTTCCCACAC	0.413																																					GBM(39;623 795 5132 29510 31476)	GBM(39;623 795 5132 29510 31476)	uc002mtp.2		NA																	0					0						c.(1117-1119)ACG>GCG		zinc finger protein 563							191.0	181.0	184.0					19																	12429722		2203	4300	6503	SO:0001583	missense	147837				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12429722T>C	BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.1117A>G	19.37:g.12429722T>C	ENSP00000293725:p.Thr373Ala		Somatic					p.T373A	NM_145276	NP_660319	WXS	Illumina HiSeq	Unspecified	Q8TA94	ZN563_HUMAN			4	1355	-			373			C2H2-type 9.		B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	37	c.1117A>G	CCDS12270.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.253024	0.00268	.	.	ENSG00000188868	ENST00000293725	T	0.03745	3.82	1.0	-1.65	0.08291	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01320	0.0043	N	0.05259	-0.085	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45963	-0.9225	9	0.02654	T	1	.	2.3025	0.04165	0.3613:0.2701:0.0:0.3686	.	373	Q8TA94	ZN563_HUMAN	A	373	ENSP00000293725:T373A	ENSP00000293725:T373A	T	-	1	0	ZNF563	12290722	0.000000	0.05858	0.003000	0.11579	0.233000	0.25261	-3.012000	0.00647	-0.501000	0.06605	-0.765000	0.03448	ACG		0.413	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276		3	160	0	0	0	0.014758	0	3	160				
HOOK2	29911	broad.mit.edu	37	19	12874498	12874498	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:12874498C>A	ENST00000397668.3	-	21	1995	c.1922G>T	c.(1921-1923)cGc>cTc	p.R641L	HOOK2_ENST00000589965.1_5'Flank|HOOK2_ENST00000264827.5_Missense_Mutation_p.R639L	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	641	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GTGTCGGATGCGGACATCCCG	0.587																																							uc002muy.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1921-1923)CGC>CTC		hook homolog 2 isoform 1							89.0	101.0	97.0					19																	12874498		2203	4300	6503	SO:0001583	missense	29911				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding	g.chr19:12874498C>A	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1922G>T	19.37:g.12874498C>A	ENSP00000380785:p.Arg641Leu		Somatic				HOOK2_uc010xmq.1_Missense_Mutation_p.R46L|HOOK2_uc002muz.2_Missense_Mutation_p.R639L	p.R641L	NM_013312	NP_037444	WXS	Illumina HiSeq	Unspecified	Q96ED9	HOOK2_HUMAN			21	2093	-			641			Sufficient for interaction with CEP110.|Required for localization to the centrosome and induction of aggresome formation.		O60562	Missense_Mutation	SNP	ENST00000397668.3	37	c.1922G>T	CCDS42508.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890857	0.33348	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.18338	2.22;2.22	5.72	1.22	0.21188	.	0.112377	0.52532	D	0.000071	T	0.18130	0.0435	L	0.38175	1.15	0.09310	N	1	P;P	0.52842	0.946;0.956	P;P	0.56163	0.69;0.793	T	0.11717	-1.0576	10	0.20519	T	0.43	-19.2967	5.9218	0.19086	0.0:0.6225:0.1411:0.2364	.	639;641	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	L	641;639	ENSP00000380785:R641L;ENSP00000264827:R639L	ENSP00000264827:R639L	R	-	2	0	HOOK2	12735498	0.001000	0.12720	0.033000	0.17914	0.351000	0.29236	0.207000	0.17395	0.346000	0.23899	-0.145000	0.13849	CGC		0.587	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312		28	47	1	0	6.00712e-18	0.050027	8.18212e-18	28	47				
ZFP30	22835	broad.mit.edu	37	19	38126058	38126058	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:38126058C>G	ENST00000351218.2	-	6	1941	c.1384G>C	c.(1384-1386)Ggt>Cgt	p.G462R	ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000392144.1_Missense_Mutation_p.G462R|ZFP30_ENST00000514101.2_Missense_Mutation_p.G462R	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGCTTTTCACCAGTATGAATA	0.373																																							uc002ogv.1		NA																	0					0						c.(1384-1386)GGT>CGT		zinc finger protein 30 homolog							86.0	79.0	81.0					19																	38126058		2203	4300	6503	SO:0001583	missense	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38126058C>G	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1384G>C	19.37:g.38126058C>G	ENSP00000343581:p.Gly462Arg		Somatic				ZFP30_uc002ogw.1_Missense_Mutation_p.G462R|ZFP30_uc002ogx.1_Missense_Mutation_p.G462R|ZFP30_uc010xtt.1_Missense_Mutation_p.G461R	p.G462R	NM_014898	NP_055713	WXS	Illumina HiSeq	Unspecified	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1900	-			462					Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	c.1384G>C	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951183	0.73787	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.26223	1.75;1.75;1.75	3.9	3.9	0.45041	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35646	N	0.003065	T	0.50752	0.1634	M	0.73598	2.24	0.49582	D	0.999805	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57648	-0.7775	10	0.72032	D	0.01	.	15.1477	0.72671	0.0:1.0:0.0:0.0	.	462;462	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	R	462;462;462;377	ENSP00000343581:G462R;ENSP00000422930:G462R;ENSP00000375988:G462R	ENSP00000343581:G462R	G	-	1	0	ZFP30	42817898	0.589000	0.26807	1.000000	0.80357	0.998000	0.95712	3.575000	0.53870	2.175000	0.68902	0.591000	0.81541	GGT		0.373	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		28	34	0	0	0	0.034045	0	28	34				
SIGLECL1	284369	broad.mit.edu	37	19	51768793	51768793	+	Nonsense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:51768793G>A	ENST00000316401.7	+	3	575	c.194G>A	c.(193-195)tGg>tAg	p.W65*	SIGLECL1_ENST00000597824.1_Intron|CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_Intron	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	423	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										CTTGGCCCCTGGGCTAACAGC	0.557																																							uc002pwb.1		NA																	0				ovary(1)|pancreas(1)	2						c.(193-195)TGG>TAG		hypothetical protein LOC284369							66.0	61.0	63.0					19																	51768793		2203	4300	6503	SO:0001587	stop_gained	284369					integral to membrane		g.chr19:51768793G>A	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.194G>A	19.37:g.51768793G>A	ENSP00000321249:p.Trp65*		Somatic				C19orf75_uc010eov.1_Intron|C19orf75_uc010ycw.1_Intron	p.W65*	NM_173635	NP_775906	WXS	Illumina HiSeq	Unspecified	Q8N7X8	CS075_HUMAN			3	575	+			65					Q8IYH7	Nonsense_Mutation	SNP	ENST00000316401.7	37	c.194G>A	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	G	34	5.349537	0.95830	.	.	ENSG00000179213	ENST00000316401	.	.	.	3.68	3.68	0.42216	.	0.000000	0.33959	N	0.004394	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7334	11.1	0.48168	0.0:0.0:1.0:0.0	.	.	.	.	X	65	.	ENSP00000321249:W65X	W	+	2	0	C19orf75	56460605	1.000000	0.71417	0.997000	0.53966	0.356000	0.29392	3.927000	0.56499	2.035000	0.60131	0.557000	0.71058	TGG		0.557	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635		22	25	0	0	0	0.016522	0	22	25				
USP29	57663	broad.mit.edu	37	19	57641606	57641606	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:57641606G>T	ENST00000254181.4	+	4	2017	c.1563G>T	c.(1561-1563)ttG>ttT	p.L521F	USP29_ENST00000598197.1_Missense_Mutation_p.L521F	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	521	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGCTTGGTTGCTGGTGAAGA	0.403																																							uc002qny.2		NA																	0				lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1561-1563)TTG>TTT		ubiquitin specific peptidase 29							123.0	128.0	126.0					19																	57641606		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641606G>T		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1563G>T	19.37:g.57641606G>T	ENSP00000254181:p.Leu521Phe		Somatic					p.L521F	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	1919	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	521						Missense_Mutation	SNP	ENST00000254181.4	37	c.1563G>T	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	6.027	0.373342	0.11409	.	.	ENSG00000131864	ENST00000254181	T	0.31510	1.49	2.69	0.174	0.15040	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	3.010160	0.02444	U	0.084874	T	0.45458	0.1343	L	0.50333	1.59	0.09310	N	1	D	0.60160	0.987	P	0.57846	0.828	T	0.35525	-0.9785	10	0.59425	D	0.04	5.5076	8.8009	0.34907	0.0:0.0:0.3934:0.6066	.	521	Q9HBJ7	UBP29_HUMAN	F	521	ENSP00000254181:L521F	ENSP00000254181:L521F	L	+	3	2	USP29	62333418	0.776000	0.28616	0.001000	0.08648	0.094000	0.18550	0.027000	0.13621	0.105000	0.17753	0.591000	0.81541	TTG		0.403	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			61	75	1	0	2.54232e-27	0.048971	3.78949e-27	61	75				
TPO	7173	broad.mit.edu	37	2	1481007	1481007	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr2:1481007C>G	ENST00000345913.4	+	8	1060	c.969C>G	c.(967-969)ttC>ttG	p.F323L	TPO_ENST00000337415.3_Missense_Mutation_p.F323L|TPO_ENST00000382198.1_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.F323L|TPO_ENST00000329066.4_Missense_Mutation_p.F323L|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.F323L|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	323					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGACCTCGTTCCTGGACGCGT	0.697																																							uc002qww.2		NA																	0				ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(967-969)TTC>TTG		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						21.0	19.0	19.0					2																	1481007		2202	4291	6493	SO:0001583	missense	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1481007C>G		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.969C>G	2.37:g.1481007C>G	ENSP00000318820:p.Phe323Leu		Somatic				TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.F323L|TPO_uc002qwr.2_Missense_Mutation_p.F323L|TPO_uc002qwx.2_Missense_Mutation_p.F323L|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Missense_Mutation_p.F323L	p.F323L	NM_000547	NP_000538	WXS	Illumina HiSeq	Unspecified	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	8	1060	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	323			Extracellular (Potential).	Calcium; via carbonyl oxygen (By similarity).	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.969C>G	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.393750	0.83011	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000536482;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	4.99	4.11	0.48088	.	0.048533	0.85682	D	0.000000	D	0.83266	0.5217	M	0.90542	3.125	0.80722	D	1	D;D;D	0.61697	0.987;0.987;0.99	P;P;P	0.60541	0.873;0.803;0.876	D	0.85071	0.0940	10	0.87932	D	0	-38.5505	9.5402	0.39246	0.0:0.8395:0.0:0.1605	.	323;323;323	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	L	323;323;323;7;323;323;252	ENSP00000337263:F323L;ENSP00000318820:F323L;ENSP00000263886:F323L;ENSP00000329869:F323L;ENSP00000371636:F323L;ENSP00000405788:F252L	ENSP00000329869:F323L	F	+	3	2	TPO	1460014	0.985000	0.35326	1.000000	0.80357	0.684000	0.39900	1.549000	0.36212	1.103000	0.41568	0.460000	0.39030	TTC		0.697	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		7	13	0	0	0	0.047766	0	7	13				
LCT	3938	broad.mit.edu	37	2	136562358	136562358	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr2:136562358C>A	ENST00000264162.2	-	10	4453	c.4443G>T	c.(4441-4443)ctG>ctT	p.L1481L		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1481	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGCTGGCGGCCAGCAGTGTAT	0.562																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(4441-4443)CTG>CTT		lactase-phlorizin hydrolase preproprotein							57.0	60.0	59.0					2																	136562358		2203	4300	6503	SO:0001819	synonymous_variant	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136562358C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4443G>T	2.37:g.136562358C>A			Somatic					p.L1481L	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	10	4454	-			1481			Extracellular (Potential).|4.|4 X approximate repeats.		Q4ZG58	Silent	SNP	ENST00000264162.2	37	c.4443G>T	CCDS2178.1																																																																																				0.562	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		18	70	1	0	1.32003e-05	0.027356	1.48975e-05	18	70				
RPRM	56475	broad.mit.edu	37	2	154335041	154335041	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr2:154335041G>T	ENST00000325926.3	-	1	281	c.39C>A	c.(37-39)ggC>ggA	p.G13G	AC012501.2_ENST00000424322.1_RNA	NM_019845.2	NP_062819.1	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependent G2 arrest mediator candidate	13					cell cycle arrest (GO:0007050)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)|prostate(1)	4						CCAGGAACAGGCCCGCCACGT	0.751																																							uc002tyq.1		NA																	0					0						c.(37-39)GGC>GGA		reprimo, TP53 dependant G2 arrest mediator							16.0	14.0	14.0					2																	154335041		2176	4262	6438	SO:0001819	synonymous_variant	56475				cell cycle arrest	cytoplasm|integral to membrane	protein binding	g.chr2:154335041G>T	AK074808	CCDS2198.1	2q24.1	2011-01-26	2005-12-01		ENSG00000177519	ENSG00000177519			24201	protein-coding gene	gene with protein product	"""candidate mediator of the p53 dependent G2 arrest"", ""REPRIMO"""	612171	"""reprimo, TP53 dependant G2 arrest mediator candidate"""			10930422	Standard	NM_019845		Approved	FLJ90327, REPRIMO	uc002tyq.1	Q9NS64	OTTHUMG00000131905	ENST00000325926.3:c.39C>A	2.37:g.154335041G>T			Somatic					p.G13G	NM_019845	NP_062819	WXS	Illumina HiSeq	Unspecified	Q9NS64	RPRM_HUMAN			1	282	-			13					B2R4V1	Silent	SNP	ENST00000325926.3	37	c.39C>A	CCDS2198.1																																																																																				0.751	RPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254856.1	NM_019845		7	10	1	0	1.12685e-05	0.047766	1.28088e-05	7	10				
CYP20A1	57404	broad.mit.edu	37	2	204161566	204161566	+	Missense_Mutation	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr2:204161566A>G	ENST00000356079.4	+	13	1447	c.1324A>G	c.(1324-1326)Aca>Gca	p.T442A	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Missense_Mutation_p.T450A	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	442						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						GGTTATTGAAACAAAGTATGA	0.348																																							uc002uzv.3		NA																	0					0						c.(1324-1326)ACA>GCA		cytochrome P450, family 20, subfamily A,							105.0	105.0	105.0					2																	204161566		2203	4300	6503	SO:0001583	missense	57404					integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr2:204161566A>G	AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1324A>G	2.37:g.204161566A>G	ENSP00000348380:p.Thr442Ala		Somatic				CYP20A1_uc002uzx.3_Missense_Mutation_p.T340A|CYP20A1_uc010zif.1_Missense_Mutation_p.T450A|CYP20A1_uc002uzy.3_Missense_Mutation_p.T340A|CYP20A1_uc002uzw.3_RNA|CYP20A1_uc010ftw.2_Missense_Mutation_p.T172A	p.T442A	NM_177538	NP_803882	WXS	Illumina HiSeq	Unspecified	Q6UW02	CP20A_HUMAN			13	1946	+			442					Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	ENST00000356079.4	37	c.1324A>G	CCDS2357.1	.	.	.	.	.	.	.	.	.	.	A	9.025	0.985927	0.18889	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815	T;T	0.29397	1.57;1.57	5.63	5.63	0.86233	.	0.248374	0.41823	D	0.000806	T	0.21674	0.0522	L	0.28274	0.84	0.30913	N	0.728906	B;B	0.11235	0.004;0.004	B;B	0.08055	0.003;0.003	T	0.11542	-1.0583	10	0.27082	T	0.32	-0.5822	11.7238	0.51698	0.9292:0.0:0.0708:0.0	.	450;442	E9PHG5;Q6UW02	.;CP20A_HUMAN	A	442;415;450	ENSP00000348380:T442A;ENSP00000407860:T450A	ENSP00000348380:T442A	T	+	1	0	CYP20A1	203869811	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	2.584000	0.46102	2.134000	0.65973	0.482000	0.46254	ACA		0.348	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674		28	43	0	0	0	0.041601	0	28	43				
ADAM33	80332	broad.mit.edu	37	20	3655458	3655458	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr20:3655458G>T	ENST00000356518.2	-	5	613	c.372C>A	c.(370-372)ccC>ccA	p.P124P	ADAM33_ENST00000350009.2_Silent_p.P124P|ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000379861.4_Silent_p.P124P	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	124					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CCCAGGAGTCGGGGAAGCCCC	0.632																																							uc002wit.2		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(370-372)CCC>CCA		ADAM metallopeptidase domain 33 isoform alpha							40.0	42.0	42.0					20																	3655458		2203	4300	6503	SO:0001819	synonymous_variant	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3655458G>T	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.372C>A	20.37:g.3655458G>T			Somatic				ADAM33_uc002wir.1_Silent_p.P124P|ADAM33_uc002wis.2_5'Flank|ADAM33_uc002wiu.2_Silent_p.P124P|ADAM33_uc002wiw.1_RNA|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Intron|ADAM33_uc010zqg.1_Silent_p.P136P|ADAM33_uc010zqh.1_Silent_p.P124P	p.P124P	NM_025220	NP_079496	WXS	Illumina HiSeq	Unspecified	Q9BZ11	ADA33_HUMAN			5	459	-			124			Extracellular (Potential).		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	c.372C>A	CCDS13058.1																																																																																				0.632	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		4	42	1	0	0.000602214	0.014758	0.000642905	4	42				
PLCB1	23236	broad.mit.edu	37	20	8709754	8709754	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr20:8709754C>A	ENST00000338037.6	+	18	1848	c.1821C>A	c.(1819-1821)tcC>tcA	p.S607S	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Silent_p.S607S|PLCB1_ENST00000378641.3_Silent_p.S607S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	607	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TGGATTCATCCAACTATATGC	0.378																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(1819-1821)TCC>TCA		phosphoinositide-specific phospholipase C beta 1							159.0	133.0	142.0					20																	8709754		2203	4300	6503	SO:0001819	synonymous_variant	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8709754C>A	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1821C>A	20.37:g.8709754C>A			Somatic				PLCB1_uc010zrb.1_Silent_p.S506S|PLCB1_uc002wna.2_Silent_p.S607S|PLCB1_uc002wnc.1_Silent_p.S506S|PLCB1_uc002wnd.1_Silent_p.S184S	p.S607S	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			18	1824	+			607			PI-PLC Y-box.		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	c.1821C>A	CCDS13102.1																																																																																				0.378	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			43	58	1	0	1.81118e-26	0.048971	2.67446e-26	43	58				
FITM2	128486	broad.mit.edu	37	20	42935469	42935469	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr20:42935469C>A	ENST00000396825.3	-	2	605	c.585G>T	c.(583-585)ctG>ctT	p.L195L		NM_001080472.1	NP_001073941.1	Q8N6M3	FITM2_HUMAN	fat storage-inducing transmembrane protein 2	195					cellular triglyceride homeostasis (GO:0035356)|cytoskeleton organization (GO:0007010)|lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of cell morphogenesis (GO:0022604)|regulation of triglyceride biosynthetic process (GO:0010866)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)				endometrium(2)|lung(2)|skin(2)	6						TCAGAATGCCCAGGGCCACAA	0.522																																							uc002xlr.1		NA																	0				skin(2)	2						c.(583-585)CTG>CTT		fat storage-inducing transmembrane protein 2							101.0	82.0	88.0					20																	42935469		2203	4300	6503	SO:0001819	synonymous_variant	128486				cellular triglyceride homeostasis|lipid particle organization|positive regulation of sequestering of triglyceride|regulation of triglyceride biosynthetic process	integral to endoplasmic reticulum membrane		g.chr20:42935469C>A	BC029662	CCDS33473.1	20q13.12	2009-04-29	2009-04-29	2009-04-29	ENSG00000197296	ENSG00000197296			16135	protein-coding gene	gene with protein product	"""fat inducing transcript 2"""	612029	"""chromosome 20 open reading frame 142"""	C20orf142		18160536	Standard	NM_001080472		Approved	dJ881L22.2, FIT2	uc002xlr.1	Q8N6M3	OTTHUMG00000032522	ENST00000396825.3:c.585G>T	20.37:g.42935469C>A			Somatic					p.L195L	NM_001080472	NP_001073941	WXS	Illumina HiSeq	Unspecified	Q8N6M3	FITM2_HUMAN			2	686	-			195			Helical; (Potential).		A1L492|B9EGQ4|Q5TE59|Q9H3Y1	Silent	SNP	ENST00000396825.3	37	c.585G>T	CCDS33473.1																																																																																				0.522	FITM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079342.2	XM_371399		12	47	1	0	0.00010058	0.013537	0.000110359	12	47				
SEMG2	6407	broad.mit.edu	37	20	43850359	43850359	+	Missense_Mutation	SNP	A	A	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr20:43850359A>C	ENST00000372769.3	+	2	176	c.86A>C	c.(85-87)aAa>aCa	p.K29T		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	29					sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				GGTGGATCAAAAGGCCAATTG	0.403																																							uc010ggz.2		NA																	0				skin(1)	1						c.(85-87)AAA>ACA		semenogelin II precursor							83.0	82.0	82.0					20																	43850359		2203	4300	6503	SO:0001583	missense	6407				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43850359A>C		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.86A>C	20.37:g.43850359A>C	ENSP00000361855:p.Lys29Thr		Somatic				SEMG2_uc002xnk.2_Missense_Mutation_p.K29T|SEMG2_uc002xnl.2_Missense_Mutation_p.K29T	p.K29T	NM_003008	NP_002999	WXS	Illumina HiSeq	Unspecified	Q02383	SEMG2_HUMAN			2	143	+		Myeloproliferative disorder(115;0.0122)	29					Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	c.86A>C	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	12.03	1.816714	0.32145	.	.	ENSG00000124157	ENST00000372769	T	0.11930	2.73	1.75	1.75	0.24633	.	.	.	.	.	T	0.30854	0.0778	M	0.71036	2.16	0.26246	N	0.978792	D;D;D	0.76494	0.991;0.999;0.999	D;D;D	0.85130	0.988;0.997;0.997	T	0.04537	-1.0944	9	0.87932	D	0	.	5.567	0.17177	1.0:0.0:0.0:0.0	.	29;29;29	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	T	29	ENSP00000361855:K29T	ENSP00000361855:K29T	K	+	2	0	SEMG2	43283773	0.004000	0.15560	0.001000	0.08648	0.026000	0.11368	1.979000	0.40608	1.067000	0.40740	0.379000	0.24179	AAA		0.403	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008		27	70	0	0	0	0.030593	0	27	70				
SYCP2	10388	broad.mit.edu	37	20	58489197	58489197	+	Silent	SNP	T	T	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr20:58489197T>A	ENST00000357552.3	-	11	969	c.744A>T	c.(742-744)gcA>gcT	p.A248A	SYCP2_ENST00000371001.2_Silent_p.A248A			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	248					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.A248A(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TTCTTTTAAATGCCTTAGCAA	0.289																																							uc002yaz.2		NA																	1	Substitution - coding silent(1)		central_nervous_system(1)	ovary(3)|lung(2)	5						c.(742-744)GCA>GCT		synaptonemal complex protein 2							76.0	75.0	76.0					20																	58489197		2201	4295	6496	SO:0001819	synonymous_variant	10388				cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding	g.chr20:58489197T>A	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.744A>T	20.37:g.58489197T>A			Somatic				SYCP2_uc010gju.1_Silent_p.A149A	p.A248A	NM_014258	NP_055073	WXS	Illumina HiSeq	Unspecified	Q9BX26	SYCP2_HUMAN	BRCA - Breast invasive adenocarcinoma(7;1.19e-09)		10	883	-	all_lung(29;0.00344)		248					A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Silent	SNP	ENST00000357552.3	37	c.744A>T	CCDS13482.1																																																																																				0.289	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258		12	46	0	0	0	0.016723	0	12	46				
POTEH	23784	broad.mit.edu	37	22	16267070	16267071	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr22:16267070_16267071CC>AA	ENST00000343518.6	-	9	1429_1430	c.1378_1379GG>TT	c.(1378-1380)GGa>TTa	p.G460L		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	460										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						ATGAGTACTTCCGTGCTTCTTC	0.361																																							uc010gqp.2		NA																	0				skin(1)	1						c.(1378-1380)GGA>TTA		ANKRD26-like family C, member 3																																				SO:0001583	missense	23784							g.chr22:16267070_16267071CC>AA	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1378_1379delinsAA	22.37:g.16267070_16267071delinsAA	ENSP00000340610:p.Gly460Leu		Somatic				POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.G179L|POTEH_uc002zlj.1_Missense_Mutation_p.G295L	p.G460L	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			9	1430_1431	-			460					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	DNP	ENST00000343518.6	37	c.1378_1379GG>TT	CCDS46658.1																																																																																				0.361	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		24	345	0	0	0	0.004672	0	24	345				
SSTR3	6753	broad.mit.edu	37	22	37603252	37603252	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr22:37603252C>A	ENST00000328544.3	-	2	1124	c.591G>T	c.(589-591)gaG>gaT	p.E197D	SSTR3_ENST00000402501.1_Missense_Mutation_p.E197D	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	197					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	CCGCCGCCGGCTCGGGCCACT	0.697																																							uc003ara.2		NA																	0				lung(1)	1						c.(589-591)GAG>GAT		somatostatin receptor 3							9.0	12.0	11.0					22																	37603252		2070	4105	6175	SO:0001583	missense	6753				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity	g.chr22:37603252C>A		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.591G>T	22.37:g.37603252C>A	ENSP00000330138:p.Glu197Asp		Somatic				SSTR3_uc003arb.2_Missense_Mutation_p.E197D	p.E197D	NM_001051	NP_001042	WXS	Illumina HiSeq	Unspecified	P32745	SSR3_HUMAN			2	653	-			197			Extracellular (Potential).		A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	c.591G>T	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246449	0.59103	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.37584	1.19;1.19	5.66	5.66	0.87406	GPCR, rhodopsin-like superfamily (1);	0.060679	0.64402	D	0.000004	T	0.36771	0.0979	L	0.41824	1.3	0.53688	D	0.999977	B	0.27351	0.176	B	0.38194	0.267	T	0.10428	-1.0630	10	0.23302	T	0.38	.	14.9479	0.71047	0.0:0.9295:0.0:0.0705	.	197	P32745	SSR3_HUMAN	D	197	ENSP00000330138:E197D;ENSP00000384904:E197D	ENSP00000330138:E197D	E	-	3	2	SSTR3	35933198	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	2.600000	0.46240	2.677000	0.91161	0.551000	0.68910	GAG		0.697	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1			3	14	1	0	6.4e-05	0.004672	7.12113e-05	3	14				
SOX10	6663	broad.mit.edu	37	22	38374042	38374042	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr22:38374042G>T	ENST00000396884.2	-	3	811	c.529C>A	c.(529-531)Cgg>Agg	p.R177R	SOX10_ENST00000470555.1_5'Flank|POLR2F_ENST00000405557.1_Intron|POLR2F_ENST00000407936.1_Intron|SOX10_ENST00000360880.2_Silent_p.R177R	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	177					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)	p.R177W(1)		NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					TTCTTCCGCCGCCTGGGCTGG	0.667																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	uc003aun.1		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(529-531)CGG>AGG		SRY (sex determining region Y)-box 10							29.0	27.0	28.0					22																	38374042		2202	4300	6502	SO:0001819	synonymous_variant	6663					cytoplasm|nucleus	DNA binding|identical protein binding|transcription coactivator activity	g.chr22:38374042G>T		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.529C>A	22.37:g.38374042G>T			Somatic				POLR2F_uc003aum.2_Intron|SOX10_uc003auo.1_Silent_p.R177R	p.R177R	NM_006941	NP_008872	WXS	Illumina HiSeq	Unspecified	P56693	SOX10_HUMAN			3	807	-	Melanoma(58;0.045)		177					B4DV62|Q6FHW7	Silent	SNP	ENST00000396884.2	37	c.529C>A	CCDS13964.1																																																																																				0.667	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313875.1	NM_006941		3	11	1	0	0.00909568	0.009096	0.00933193	3	11				
CACNA1I	8911	broad.mit.edu	37	22	40066162	40066162	+	Silent	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr22:40066162G>A	ENST00000402142.3	+	25	4314	c.4314G>A	c.(4312-4314)cgG>cgA	p.R1438R	CACNA1I_ENST00000407673.1_Silent_p.R1403R|CACNA1I_ENST00000401624.1_Silent_p.R1438R|CACNA1I_ENST00000400164.3_Silent_p.R1403R|CACNA1I_ENST00000404898.1_Silent_p.R1403R|CACNA1I_ENST00000336649.4_Silent_p.R1444R	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1438					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	ACAAGTGCCGGCAGCACCAGG	0.612																																							uc003ayc.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(4312-4314)CGG>CGA		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						182.0	182.0	182.0					22																	40066162		2103	4216	6319	SO:0001819	synonymous_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40066162G>A	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4314G>A	22.37:g.40066162G>A			Somatic				CACNA1I_uc003ayd.2_Silent_p.R1403R|CACNA1I_uc003aye.2_Silent_p.R1353R|CACNA1I_uc003ayf.2_Silent_p.R1318R	p.R1438R	NM_021096	NP_066919	WXS	Illumina HiSeq	Unspecified	Q9P0X4	CAC1I_HUMAN			25	4314	+	Melanoma(58;0.0749)		1438			Cytoplasmic (Potential).		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.4314G>A	CCDS46710.1																																																																																				0.612	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		4	122	0	0	0	0.014758	0	4	122				
ARHGAP8	23779	broad.mit.edu	37	22	45198039	45198039	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr22:45198039G>T	ENST00000389774.2	+	3	303	c.162G>T	c.(160-162)ctG>ctT	p.L54L	ARHGAP8_ENST00000517296.3_Silent_p.L308L|ARHGAP8_ENST00000356099.6_Silent_p.L54L|PRR5-ARHGAP8_ENST00000361473.5_Silent_p.L185L|ARHGAP8_ENST00000336963.4_Silent_p.L54L|ARHGAP8_ENST00000389773.5_Silent_p.L176L|PRR5-ARHGAP8_ENST00000352766.7_Silent_p.L308L	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	54	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		ACCAGCGGCTGCTGGAGTAAG	0.592																																							uc003bfd.2		NA																	0				skin(2)	2						c.(922-924)CTG>CTT		Rho GTPase activating protein 8 isoform 2							113.0	97.0	103.0					22																	45198039		2203	4300	6503	SO:0001819	synonymous_variant	553158							g.chr22:45198039G>T	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.162G>T	22.37:g.45198039G>T			Somatic				PRR5-ARHGAP8_uc003bfc.2_Silent_p.L185L|PRR5-ARHGAP8_uc011aqi.1_Silent_p.L176L|PRR5-ARHGAP8_uc011aqj.1_Silent_p.L90L|ARHGAP8_uc003bfi.2_Silent_p.L54L|ARHGAP8_uc010gzv.2_Silent_p.L54L|ARHGAP8_uc003bfj.2_Silent_p.L54L|ARHGAP8_uc003bfk.2_Silent_p.L54L|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Silent_p.L90L	p.L308L	NM_181335	NP_851852	WXS	Illumina HiSeq	Unspecified					9	1196	+								A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Silent	SNP	ENST00000389774.2	37	c.924G>T	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	G	2.578	-0.298057	0.05532	.	.	ENSG00000248405	ENST00000515632	.	.	.	4.07	-1.16	0.09678	.	.	.	.	.	T	0.50222	0.1603	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41770	-0.9490	4	.	.	.	.	5.345	0.16004	0.2653:0.2755:0.4592:0.0	.	.	.	.	F	108	.	.	C	+	2	0	PRR5-ARHGAP8	43576703	0.990000	0.36364	0.987000	0.45799	0.248000	0.25809	0.066000	0.14489	0.093000	0.17368	-0.156000	0.13503	TGC		0.592	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701		38	70	1	0	1.61572e-30	0.039052	2.45466e-30	38	70				
ATP2B2	491	broad.mit.edu	37	3	10413716	10413716	+	Missense_Mutation	SNP	T	T	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:10413716T>G	ENST00000352432.4	-	11	1505	c.1436A>C	c.(1435-1437)aAc>aCc	p.N479T	ATP2B2_ENST00000383800.4_Missense_Mutation_p.N434T|ATP2B2_ENST00000360273.2_Missense_Mutation_p.N479T|ATP2B2_ENST00000397077.1_Missense_Mutation_p.N434T|ATP2B2_ENST00000343816.4_Missense_Mutation_p.N465T			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	479					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GCGTACCAGGTTGTTGTCCTT	0.577																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1435-1437)AAC>ACC		plasma membrane calcium ATPase 2 isoform 1							139.0	120.0	126.0					3																	10413716		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10413716T>G	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1436A>C	3.37:g.10413716T>G	ENSP00000324172:p.Asn479Thr		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.N434T|ATP2B2_uc003bvw.2_Missense_Mutation_p.N434T|ATP2B2_uc010hdo.2_Missense_Mutation_p.N184T	p.N479T	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			12	1875	-			479			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.1436A>C	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.147931	0.57151	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	4.71	4.71	0.59529	ATPase, P-type, ATPase-associated domain (1);	0.090231	0.85682	D	0.000000	D	0.92779	0.7704	M	0.83774	2.66	0.80722	D	1	B;B;P	0.36315	0.0;0.447;0.547	B;P;B	0.48738	0.001;0.588;0.417	D	0.93800	0.7100	10	0.87932	D	0	-30.4583	14.3667	0.66810	0.0:0.0:0.0:1.0	.	414;446;479	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	T	479;434;434;479;465;414;335;479	ENSP00000324172:N479T;ENSP00000373311:N434T;ENSP00000380267:N434T;ENSP00000353414:N479T;ENSP00000344677:N465T;ENSP00000414854:N335T	ENSP00000342954:N479T	N	-	2	0	ATP2B2	10388716	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.782000	0.85680	1.979000	0.57680	0.533000	0.62120	AAC		0.577	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		17	78	0	0	0	0.043863	0	17	78				
SCN11A	11280	broad.mit.edu	37	3	38913746	38913746	+	Missense_Mutation	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:38913746A>G	ENST00000302328.3	-	20	3631	c.3433T>C	c.(3433-3435)Tcc>Ccc	p.S1145P	SCN11A_ENST00000456224.3_Missense_Mutation_p.S1107P|SCN11A_ENST00000450244.1_Missense_Mutation_p.S1145P|SCN11A_ENST00000444237.2_Missense_Mutation_p.S1145P	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1145					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCCGGAAGGACTTCAATTCC	0.478																																							uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(3433-3435)TCC>CCC		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						127.0	123.0	125.0					3																	38913746		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38913746A>G	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3433T>C	3.37:g.38913746A>G	ENSP00000307599:p.Ser1145Pro		Somatic					p.S1145P	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	20	3632	-			1145			Helical; Voltage-sensor; Name=S4 of repeat III; (By similarity).|III.		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.3433T>C	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478759	0.44044	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	5.54	2.88	0.33553	Ion transport (1);	0.316354	0.37095	N	0.002258	D	0.97096	0.9051	M	0.84846	2.72	0.42515	D	0.992986	B	0.28208	0.203	B	0.32583	0.148	D	0.93631	0.6956	10	0.38643	T	0.18	.	5.9149	0.19050	0.7345:0.1576:0.1079:0.0	.	1145	Q9UI33	SCNBA_HUMAN	P	1145;1145;1107;1145	ENSP00000307599:S1145P;ENSP00000400945:S1145P;ENSP00000416757:S1107P;ENSP00000408028:S1145P	ENSP00000307599:S1145P	S	-	1	0	SCN11A	38888750	1.000000	0.71417	0.948000	0.38648	0.007000	0.05969	5.128000	0.64733	0.270000	0.21984	0.459000	0.35465	TCC		0.478	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		5	124	0	0	0	0.02938	0	5	124				
POMGNT2	84892	broad.mit.edu	37	3	43122492	43122492	+	Silent	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:43122492G>C	ENST00000344697.2	-	2	777	c.432C>G	c.(430-432)ccC>ccG	p.P144P	POMGNT2_ENST00000441964.1_Silent_p.P144P	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	144					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										ACACCGGCTTGGGCATGAAGC	0.597																																							uc003cmq.1		NA																	0				ovary(1)|skin(1)	2						c.(430-432)CCC>CCG		glycosyltransferase precursor							108.0	101.0	103.0					3																	43122492		2203	4300	6503	SO:0001819	synonymous_variant	84892					extracellular region	transferase activity, transferring glycosyl groups	g.chr3:43122492G>C	AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.432C>G	3.37:g.43122492G>C			Somatic				C3orf39_uc003cmr.1_Silent_p.P144P	p.P144P	NM_032806	NP_116195	WXS	Illumina HiSeq	Unspecified	Q8NAT1	AGO61_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)	2	573	-			144					B3KWC3|Q96SY3	Silent	SNP	ENST00000344697.2	37	c.432C>G	CCDS2709.1																																																																																				0.597	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256643.1	NM_032806		14	99	0	0	0	0.024245	0	14	99				
CCDC51	79714	broad.mit.edu	37	3	48475178	48475178	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:48475178C>G	ENST00000395694.2	-	3	501	c.416G>C	c.(415-417)cGt>cCt	p.R139P	CCDC51_ENST00000442740.1_Missense_Mutation_p.R30P|CCDC51_ENST00000447018.1_Missense_Mutation_p.R30P|CCDC51_ENST00000395696.1_Missense_Mutation_p.R139P|CCDC51_ENST00000412398.2_Missense_Mutation_p.R30P	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	139						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCTGGAGACACGGTCCAAGCG	0.597																																							uc003csz.2		NA																	0					0						c.(415-417)CGT>CCT		coiled-coil domain containing 51							121.0	133.0	129.0					3																	48475178		2102	4210	6312	SO:0001583	missense	79714					integral to membrane		g.chr3:48475178C>G	AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.416G>C	3.37:g.48475178C>G	ENSP00000379047:p.Arg139Pro		Somatic				CCDC51_uc003cta.2_Missense_Mutation_p.R30P|CCDC51_uc003ctb.2_Missense_Mutation_p.R30P|CCDC51_uc003ctc.2_Missense_Mutation_p.R139P|CCDC51_uc003ctd.2_Missense_Mutation_p.R30P	p.R139P	NM_024661	NP_078937	WXS	Illumina HiSeq	Unspecified	Q96ER9	CCD51_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	3	537	-			139			Potential.		Q9HA01	Missense_Mutation	SNP	ENST00000395694.2	37	c.416G>C	CCDS2766.2	.	.	.	.	.	.	.	.	.	.	C	31	5.091338	0.94149	.	.	ENSG00000164051	ENST00000447018;ENST00000395694;ENST00000412398;ENST00000395696;ENST00000442740;ENST00000446140	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64011	-0.6507	10	0.87932	D	0	-17.8165	17.7049	0.88306	0.0:1.0:0.0:0.0	.	139	Q96ER9	CCD51_HUMAN	P	30;139;30;139;30;139	ENSP00000412300:R30P;ENSP00000379047:R139P;ENSP00000401194:R30P;ENSP00000379049:R139P;ENSP00000392898:R30P;ENSP00000409494:R139P	ENSP00000379047:R139P	R	-	2	0	CCDC51	48450182	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.449000	0.80643	2.419000	0.82065	0.655000	0.94253	CGT		0.597	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344599.2	NM_024661		40	106	0	0	0	0.030466	0	40	106				
ROBO2	6092	broad.mit.edu	37	3	77666736	77666736	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:77666736G>T	ENST00000461745.1	+	22	4266	c.3366G>T	c.(3364-3366)ctG>ctT	p.L1122L	ROBO2_ENST00000332191.8_Silent_p.L1122L|ROBO2_ENST00000469233.1_3'UTR|ROBO2_ENST00000487694.3_Silent_p.L1138L	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1122					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAGATGAACTGGAAGAAGATG	0.458																																							uc003dpy.3		NA																	0				lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(3364-3366)CTG>CTT		roundabout, axon guidance receptor, homolog 2							124.0	116.0	119.0					3																	77666736		2005	4172	6177	SO:0001819	synonymous_variant	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77666736G>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3366G>T	3.37:g.77666736G>T			Somatic				ROBO2_uc003dpz.2_Silent_p.L1126L|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.L1126L|ROBO2_uc003dqa.2_Silent_p.L249L	p.L1122L	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	22	4009	+			1122			Cytoplasmic (Potential).		O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	c.3366G>T	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	7.914	0.737136	0.15574	.	.	ENSG00000185008	ENST00000490991	.	.	.	5.58	2.58	0.30949	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.36359	-0.9751	3	.	.	.	.	4.4867	0.11794	0.249:0.0:0.5158:0.2352	.	.	.	.	L	279	.	.	W	+	2	0	ROBO2	77749426	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	1.270000	0.33086	1.345000	0.45676	0.655000	0.94253	TGG		0.458	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		17	80	1	0	1.45105e-14	0.038395	1.89476e-14	17	80				
COL6A6	131873	broad.mit.edu	37	3	130329537	130329537	+	Silent	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:130329537G>A	ENST00000358511.6	+	22	4828	c.4797G>A	c.(4795-4797)gtG>gtA	p.V1599V	COL6A6_ENST00000453409.2_Silent_p.V1599V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1599	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AAGGAGGTGTGGGAAGTAAAG	0.388																																							uc010htl.2		NA																	0				ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(4795-4797)GTG>GTA		collagen type VI alpha 6 precursor							108.0	105.0	106.0					3																	130329537		1901	4107	6008	SO:0001819	synonymous_variant	131873				axon guidance|cell adhesion	collagen		g.chr3:130329537G>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4797G>A	3.37:g.130329537G>A			Somatic				COL6A6_uc003eni.3_5'UTR	p.V1599V	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			22	4828	+			1599			Triple-helical region.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	37	c.4797G>A	CCDS46911.1																																																																																				0.388	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		3	5	0	0	0	0.004672	0	3	5				
CP	1356	broad.mit.edu	37	3	148924112	148924112	+	Missense_Mutation	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:148924112A>G	ENST00000264613.6	-	6	1313	c.1051T>C	c.(1051-1053)Ttt>Ctt	p.F351L		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	351	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ACCTGGAAAAAGGCTTGCAAA	0.433																																							uc003ewy.3		NA																	0				ovary(1)	1						c.(1051-1053)TTT>CTT		ceruloplasmin precursor	Drotrecogin alfa(DB00055)						110.0	109.0	109.0					3																	148924112		2203	4300	6503	SO:0001583	missense	1356				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity	g.chr3:148924112A>G	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1051T>C	3.37:g.148924112A>G	ENSP00000264613:p.Phe351Leu		Somatic				CP_uc011bnr.1_RNA|CP_uc003ewx.3_Missense_Mutation_p.F132L|CP_uc003ewz.2_Missense_Mutation_p.F351L|CP_uc010hvf.1_Missense_Mutation_p.F77L	p.F351L	NM_000096	NP_000087	WXS	Illumina HiSeq	Unspecified	P00450	CERU_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		6	1304	-		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	351			F5/8 type A 1.|Plastocyanin-like 2.		Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	c.1051T>C	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	A	6.550	0.469792	0.12461	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.82081	-1.57;-1.57	5.81	5.81	0.92471	Cupredoxin (2);Multicopper oxidase, type 1 (1);	0.228465	0.46758	D	0.000267	T	0.63141	0.2486	N	0.12502	0.225	0.41867	D	0.990256	B;B;B;B	0.24258	0.045;0.045;0.045;0.1	B;B;B;B	0.26864	0.074;0.05;0.074;0.057	T	0.58858	-0.7562	10	0.07482	T	0.82	-28.9754	5.0512	0.14508	0.7516:0.0:0.0869:0.1615	.	351;351;351;351	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	L	351;134	ENSP00000264613:F351L;ENSP00000420545:F134L	ENSP00000264613:F351L	F	-	1	0	CP	150406802	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.782000	0.55401	2.224000	0.72417	0.533000	0.62120	TTT		0.433	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096		3	110	0	0	0	0.009096	0	3	110				
MCF2L2	23101	broad.mit.edu	37	3	182994678	182994678	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr3:182994678C>T	ENST00000328913.3	-	15	2141	c.1844G>A	c.(1843-1845)gGa>gAa	p.G615E	MCF2L2_ENST00000473233.1_Missense_Mutation_p.G615E|MCF2L2_ENST00000447025.2_Missense_Mutation_p.G615E|MCF2L2_ENST00000414362.2_Missense_Mutation_p.G615E	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	615							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGAAAGGTCTCCGAGCCTGGC	0.547																																							uc003fli.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(1843-1845)GGA>GAA		Rho family guanine-nucleotide exchange factor							26.0	25.0	26.0					3																	182994678		2203	4300	6503	SO:0001583	missense	23101				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr3:182994678C>T	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1844G>A	3.37:g.182994678C>T	ENSP00000328118:p.Gly615Glu		Somatic				MCF2L2_uc003flj.1_Missense_Mutation_p.G615E|MCF2L2_uc011bqr.1_RNA	p.G615E	NM_015078	NP_055893	WXS	Illumina HiSeq	Unspecified	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		15	1934	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		615					O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	c.1844G>A	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	C	0.097	-1.158361	0.01686	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000437431;ENST00000414362	T;T;T;T	0.04234	4.7;4.71;3.8;3.67	4.94	1.21	0.21127	Dbl homology (DH) domain (1);	3.821670	0.00589	N	0.000357	T	0.02230	0.0069	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40136	-0.9579	10	0.15066	T	0.55	.	3.449	0.07491	0.0:0.2369:0.2019:0.5611	.	615;615	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	E	615;615;615;151;615	ENSP00000328118:G615E;ENSP00000420070:G615E;ENSP00000388190:G615E;ENSP00000414131:G615E	ENSP00000328118:G615E	G	-	2	0	MCF2L2	184477372	0.002000	0.14202	0.001000	0.08648	0.013000	0.08279	0.210000	0.17455	0.113000	0.18004	0.585000	0.79938	GGA		0.547	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078		3	18	0	0	0	0.004672	0	3	18				
TACC3	10460	broad.mit.edu	37	4	1746481	1746481	+	Silent	SNP	G	G	A	rs565079218	byFrequency	TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:1746481G>A	ENST00000313288.4	+	15	2479	c.2373G>A	c.(2371-2373)gcG>gcA	p.A791A		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	791					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			AGGCCCAGGCGGAAGCGTTGG	0.672													g|||	6	0.00119808	0.0	0.0029	5008	,	,		15950	0.0		0.001	False		,,,				2504	0.0031				Ovarian(120;482 2294 11894 35824)	Ovarian(120;482 2294 11894 35824)	uc003gdo.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2371-2373)GCG>GCA		transforming, acidic coiled-coil containing							25.0	27.0	26.0					4																	1746481		2196	4298	6494	SO:0001819	synonymous_variant	10460					centrosome		g.chr4:1746481G>A	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.2373G>A	4.37:g.1746481G>A			Somatic				TACC3_uc003gdp.2_Silent_p.A431A|TACC3_uc010ica.2_Silent_p.A212A	p.A791A	NM_006342	NP_006333	WXS	Illumina HiSeq	Unspecified	Q9Y6A5	TACC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)		15	2481	+		Breast(71;0.212)|all_epithelial(65;0.241)	791			Potential.		Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	ENST00000313288.4	37	c.2373G>A	CCDS3352.1																																																																																				0.672	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2			3	26	0	0	0	0.009096	0	3	26				
DRD5	1816	broad.mit.edu	37	4	9785025	9785025	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:9785025G>T	ENST00000304374.2	+	1	1768	c.1372G>T	c.(1372-1374)Gac>Tac	p.D458Y		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	458					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTGGGAGCTGGACTGCGAGGG	0.507																																							uc003gmb.3		NA																	0				skin(1)	1						c.(1372-1374)GAC>TAC		dopamine receptor D5	Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)						50.0	51.0	51.0					4																	9785025		2203	4300	6503	SO:0001583	missense	1816				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane		g.chr4:9785025G>T	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1372G>T	4.37:g.9785025G>T	ENSP00000306129:p.Asp458Tyr		Somatic					p.D458Y	NM_000798	NP_000789	WXS	Illumina HiSeq	Unspecified	P21918	DRD5_HUMAN			1	1768	+			458			Cytoplasmic (Potential).		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	c.1372G>T	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	g	18.84	3.709540	0.68730	.	.	ENSG00000169676	ENST00000304374	T	0.70749	-0.51	4.53	4.53	0.55603	.	0.116186	0.56097	D	0.000029	T	0.81912	0.4923	M	0.79693	2.465	0.58432	D	0.999999	D	0.69078	0.997	P	0.57371	0.819	D	0.85560	0.1227	10	0.87932	D	0	.	16.464	0.84073	0.0:0.0:1.0:0.0	.	458	P21918	DRD5_HUMAN	Y	458	ENSP00000306129:D458Y	ENSP00000306129:D458Y	D	+	1	0	DRD5	9394123	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.987000	0.63857	2.357000	0.79964	0.460000	0.39030	GAC		0.507	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			21	65	1	0	2.48779e-11	0.027356	3.07087e-11	21	65				
GABRA4	2557	broad.mit.edu	37	4	46967068	46967069	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:46967068_46967069GG>CC	ENST00000264318.3	-	8	2034_2035	c.1052_1053CC>GG	c.(1051-1053)gCC>gGG	p.A351G		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	351					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A351A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TCTTCCTTTTGGCTTTTTCCAT	0.47																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(1051-1053)GCC>GGG		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)																																			SO:0001583	missense	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46967068_46967069GG>CC		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1052_1053delinsCC	4.37:g.46967068_46967069delinsCC	ENSP00000264318:p.Ala351Gly		Somatic					p.A351G	NM_000809	NP_000800	WXS	Illumina HiSeq	Unspecified	P48169	GBRA4_HUMAN			8	1191_1192	-			351			Cytoplasmic (Probable).		Q8IYR7	Missense_Mutation	DNP	ENST00000264318.3	37	c.1052_1053CC>GG	CCDS3473.1																																																																																				0.470	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			14	46	0	0	0	0.004672	0	14	46				
PCDH18	54510	broad.mit.edu	37	4	138451510	138451510	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:138451510C>A	ENST00000344876.4	-	1	2119	c.1733G>T	c.(1732-1734)gGg>gTg	p.G578V	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.G578V|PCDH18_ENST00000507846.1_Missense_Mutation_p.G358V	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	578					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CAATGCAGGCCCTATAACCAC	0.463																																							uc003ihe.3		NA																	0				pancreas(3)|skin(2)	5						c.(1732-1734)GGG>GTG		protocadherin 18 precursor							204.0	191.0	195.0					4																	138451510		2203	4300	6503	SO:0001583	missense	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138451510C>A	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1733G>T	4.37:g.138451510C>A	ENSP00000355082:p.Gly578Val		Somatic				PCDH18_uc003ihf.3_Missense_Mutation_p.G571V|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Missense_Mutation_p.G358V|PCDH18_uc011cha.1_Intron	p.G578V	NM_019035	NP_061908	WXS	Illumina HiSeq	Unspecified	Q9HCL0	PCD18_HUMAN			1	2120	-	all_hematologic(180;0.24)		578			Extracellular (Potential).		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	c.1733G>T	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	1.814	-0.473945	0.04414	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.58210	0.35;0.35;0.35	5.93	2.03	0.26663	Cadherin-like (1);	0.000000	0.44285	D	0.000480	T	0.14830	0.0358	N	0.00483	-1.445	0.20074	N	0.999937	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.20207	-1.0282	10	0.18276	T	0.48	.	3.4946	0.07650	0.1284:0.4867:0.249:0.1359	.	358;578;578	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	V	578;578;358	ENSP00000355082:G578V;ENSP00000390688:G578V;ENSP00000425903:G358V	ENSP00000355082:G578V	G	-	2	0	PCDH18	138670960	0.017000	0.18338	0.916000	0.36221	0.426000	0.31534	0.638000	0.24674	0.377000	0.24735	0.563000	0.77884	GGG		0.463	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		64	155	1	0	5.96624e-29	0.048971	8.97778e-29	64	155				
SLC45A2	51151	broad.mit.edu	37	5	33947279	33947279	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:33947279C>T	ENST00000296589.4	-	6	1503	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K	SLC45A2_ENST00000382102.3_Missense_Mutation_p.E453K|SLC45A2_ENST00000342059.3_Missense_Mutation_p.E394K	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	453					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						TCCTTTTCTTCCTCGCGGTGG	0.512																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(1357-1359)GAA>AAA		membrane-associated transporter protein isoform							217.0	209.0	212.0					5																	33947279		2203	4300	6503	SO:0001583	missense	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33947279C>T	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1357G>A	5.37:g.33947279C>T	ENSP00000296589:p.Glu453Lys		Somatic				SLC45A2_uc003jie.2_Missense_Mutation_p.E453K	p.E453K	NM_016180	NP_057264	WXS	Illumina HiSeq	Unspecified	Q9UMX9	S45A2_HUMAN			6	1449	-			453			Cytoplasmic (Potential).		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	c.1357G>A	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727586	0.48833	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102	D;T;T	0.87334	-2.24;2.33;1.54	5.46	4.58	0.56647	Major facilitator superfamily domain, general substrate transporter (1);	0.198259	0.52532	D	0.000062	T	0.81173	0.4767	L	0.39245	1.2	0.80722	D	1	B;B	0.30686	0.29;0.006	B;B	0.34418	0.182;0.016	T	0.74794	-0.3544	10	0.07325	T	0.83	-10.4618	14.0393	0.64665	0.0:0.8473:0.1527:0.0	.	453;453	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	K	453;394;453	ENSP00000296589:E453K;ENSP00000341014:E394K;ENSP00000371534:E453K	ENSP00000296589:E453K	E	-	1	0	SLC45A2	33983036	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	5.684000	0.68197	1.302000	0.44855	0.650000	0.86243	GAA		0.512	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		99	194	0	0	0	0.048971	0	99	194				
PCDHA12	56137	broad.mit.edu	37	5	140256740	140256740	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:140256740C>T	ENST00000398631.2	+	1	1683	c.1683C>T	c.(1681-1683)aaC>aaT	p.N561N	PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	561	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCGGCAC	0.697																																					Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	0					0						c.(1681-1683)AAC>AAT		protocadherin alpha 12 isoform 1 precursor							147.0	152.0	150.0					5																	140256740		2203	4299	6502	SO:0001819	synonymous_variant	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256740C>T	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1683C>T	5.37:g.140256740C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.N561N	p.N561N	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1810	+			561			Cadherin 5.|Extracellular (Potential).		O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	c.1683C>T	CCDS47285.1																																																																																				0.697	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		52	127	0	0	0	0.048971	0	52	127				
PCDHB2	56133	broad.mit.edu	37	5	140475913	140475913	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:140475913C>A	ENST00000194155.4	+	1	1687	c.1539C>A	c.(1537-1539)ggC>ggA	p.G513G		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	513	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGACAACGGCCACCTGTTCG	0.706																																							uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(1537-1539)GGC>GGA		protocadherin beta 2 precursor							87.0	93.0	91.0					5																	140475913		2203	4300	6503	SO:0001819	synonymous_variant	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475913C>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1539C>A	5.37:g.140475913C>A			Somatic				PCDHB2_uc003lim.1_Silent_p.G174G	p.G513G	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1677	+			513			Extracellular (Potential).|Cadherin 5.		Q4KMU1	Silent	SNP	ENST00000194155.4	37	c.1539C>A	CCDS4244.1																																																																																				0.706	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		18	158	1	0	1.40151e-16	0.055883	1.86083e-16	18	158				
PCDHB14	56122	broad.mit.edu	37	5	140605063	140605063	+	Silent	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:140605063G>C	ENST00000239449.4	+	1	1986	c.1986G>C	c.(1984-1986)ctG>ctC	p.L662L	PCDHB14_ENST00000515856.2_Silent_p.L509L	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	662	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGTGCTCCTGGTGGACGGCT	0.706																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	0				ovary(1)	1						c.(1984-1986)CTG>CTC		protocadherin beta 14 precursor							29.0	34.0	33.0					5																	140605063		2074	4121	6195	SO:0001819	synonymous_variant	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140605063G>C	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1986G>C	5.37:g.140605063G>C			Somatic				PCDHB14_uc011dal.1_Silent_p.L509L	p.L662L	NM_018934	NP_061757	WXS	Illumina HiSeq	Unspecified	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1986	+			662			Cadherin 6.|Extracellular (Potential).		B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	37	c.1986G>C	CCDS4256.1																																																																																				0.706	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		35	77	0	0	0	0.021022	0	35	77				
NR3C1	2908	broad.mit.edu	37	5	142779500	142779500	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:142779500C>A	ENST00000343796.2	-	2	1898	c.905G>T	c.(904-906)tGt>tTt	p.C302F	NR3C1_ENST00000503201.1_Missense_Mutation_p.C302F|NR3C1_ENST00000424646.2_Missense_Mutation_p.C302F|NR3C1_ENST00000394464.2_Missense_Mutation_p.C302F|NR3C1_ENST00000231509.3_Missense_Mutation_p.C302F|NR3C1_ENST00000394466.2_Missense_Mutation_p.C302F|NR3C1_ENST00000416954.2_Intron|NR3C1_ENST00000415690.2_Missense_Mutation_p.C302F|NR3C1_ENST00000504572.1_Missense_Mutation_p.C302F	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	302	Modulating.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	GCTTGCCTGACAGTAAACTGT	0.423																																							uc003lmz.2		NA																	0				ovary(2)	2						c.(904-906)TGT>TTT		glucocorticoid receptor isoform alpha	Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)						78.0	81.0	80.0					5																	142779500		2203	4300	6503	SO:0001583	missense	2908				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding	g.chr5:142779500C>A	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.905G>T	5.37:g.142779500C>A	ENSP00000343205:p.Cys302Phe		Somatic				NR3C1_uc003lmy.2_Missense_Mutation_p.C302F|NR3C1_uc003lna.2_Missense_Mutation_p.C302F|NR3C1_uc003lnb.2_Missense_Mutation_p.C302F|NR3C1_uc011dbk.1_Intron|NR3C1_uc003lnc.2_Missense_Mutation_p.C302F|NR3C1_uc003lnd.2_Missense_Mutation_p.C302F|NR3C1_uc003lne.2_Missense_Mutation_p.C302F|NR3C1_uc003lnf.2_Missense_Mutation_p.C302F|NR3C1_uc003lng.2_Missense_Mutation_p.C302F|NR3C1_uc003lnh.2_Missense_Mutation_p.C302F|NR3C1_uc003lni.2_Missense_Mutation_p.C302F	p.C302F	NM_000176	NP_000167	WXS	Illumina HiSeq	Unspecified	P04150	GCR_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		2	1397	-		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	302			Modulating.		A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	c.905G>T	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980160	0.74474	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000503201	T;T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28	5.65	5.65	0.86999	.	0.099677	0.64402	D	0.000001	T	0.80132	0.4567	M	0.85197	2.74	0.80722	D	1	P;D;D	0.89917	0.716;0.999;1.0	P;D;D	0.91635	0.478;0.998;0.999	T	0.81820	-0.0757	10	0.59425	D	0.04	.	19.7202	0.96139	0.0:1.0:0.0:0.0	.	302;302;302	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	F	302	ENSP00000377977:C302F;ENSP00000343205:C302F;ENSP00000387672:C302F;ENSP00000405282:C302F;ENSP00000422518:C302F;ENSP00000377979:C302F;ENSP00000231509:C302F;ENSP00000427672:C302F	ENSP00000231509:C302F	C	-	2	0	NR3C1	142759693	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.921000	0.75805	2.656000	0.90262	0.650000	0.86243	TGT		0.423	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1			35	85	1	0	7.05121e-23	0.039052	1.01281e-22	35	85				
HK3	3101	broad.mit.edu	37	5	176317672	176317672	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr5:176317672C>A	ENST00000292432.5	-	6	685	c.594G>T	c.(592-594)gtG>gtT	p.V198V		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	198	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCTGGACCACATCCTGGC	0.597																																							uc003mfa.2		NA																	0				ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(592-594)GTG>GTT		hexokinase 3							220.0	211.0	214.0					5																	176317672		2203	4300	6503	SO:0001819	synonymous_variant	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176317672C>A		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.594G>T	5.37:g.176317672C>A			Somatic				HK3_uc003mez.2_5'Flank	p.V198V	NM_002115	NP_002106	WXS	Illumina HiSeq	Unspecified	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		6	686	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	198			Regulatory.		Q8N1E7	Silent	SNP	ENST00000292432.5	37	c.594G>T	CCDS4407.1																																																																																				0.597	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			112	301	1	0	9.89263e-63	0.048971	1.59493e-62	112	301				
HSP90AB1	3326	broad.mit.edu	37	6	44218146	44218146	+	Missense_Mutation	SNP	A	A	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr6:44218146A>T	ENST00000371554.1	+	6	981	c.767A>T	c.(766-768)gAt>gTt	p.D256V	HSP90AB1_ENST00000371646.5_Missense_Mutation_p.D256V|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.D256V			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	256					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			gtgggttcagatgaggaggat	0.388																																							uc003oxa.1		NA																	0				lung(3)|breast(1)	4						c.(766-768)GAT>GTT		heat shock 90kDa protein 1, beta							53.0	53.0	53.0					6																	44218146		2203	4300	6503	SO:0001583	missense	3326				axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding	g.chr6:44218146A>T	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.767A>T	6.37:g.44218146A>T	ENSP00000360609:p.Asp256Val		Somatic				HSP90AB1_uc011dvr.1_Missense_Mutation_p.D246V|HSP90AB1_uc003oxb.1_Missense_Mutation_p.D256V|HSP90AB1_uc011dvs.1_Missense_Mutation_p.D76V|HSP90AB1_uc003oxc.1_5'UTR	p.D256V	NM_007355	NP_031381	WXS	Illumina HiSeq	Unspecified	P08238	HS90B_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		6	851	+	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		256					B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	c.767A>T	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851442	0.51270	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.10477	2.87;2.87;2.87	4.41	4.41	0.53225	.	0.074205	0.51477	U	0.000100	T	0.13756	0.0333	H	0.94345	3.525	0.80722	D	1	B;B;B	0.15141	0.012;0.0;0.002	B;B;B	0.12156	0.007;0.001;0.005	T	0.07252	-1.0782	10	0.52906	T	0.07	-25.7441	13.3386	0.60533	1.0:0.0:0.0:0.0	.	218;246;256	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	V	256	ENSP00000360709:D256V;ENSP00000325875:D256V;ENSP00000360609:D256V	ENSP00000325875:D256V	D	+	2	0	HSP90AB1	44326124	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	8.892000	0.92491	1.643000	0.50594	0.377000	0.23210	GAT		0.388	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355		12	11	0	0	0	0.010729	0	12	11				
TNFRSF21	27242	broad.mit.edu	37	6	47251781	47251781	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr6:47251781T>C	ENST00000296861.2	-	3	1529	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	379					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCGGGGCCCCTTTTTCAGAGT	0.512																																							uc003oyv.2		NA																	0					0						c.(1135-1137)AAG>AGG		tumor necrosis factor receptor superfamily,							98.0	104.0	102.0					6																	47251781		2203	4300	6503	SO:0001583	missense	27242				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity	g.chr6:47251781T>C	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1136A>G	6.37:g.47251781T>C	ENSP00000296861:p.Lys379Arg		Somatic					p.K379R	NM_014452	NP_055267	WXS	Illumina HiSeq	Unspecified	O75509	TNR21_HUMAN	Lung(136;0.189)		3	1569	-			379			Cytoplasmic (Potential).		B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	c.1136A>G	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.960173	0.92791	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.70631	-0.5	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79753	0.4500	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82068	-0.0640	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	O75509	TNR21_HUMAN	R	379;68	ENSP00000296861:K379R	ENSP00000296861:K379R	K	-	2	0	TNFRSF21	47359740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.708000	0.68377	2.371000	0.80710	0.533000	0.62120	AAG		0.512	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452		3	159	0	0	0	0.014758	0	3	159				
TINAG	27283	broad.mit.edu	37	6	54191662	54191662	+	Missense_Mutation	SNP	G	G	A	rs368916966		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr6:54191662G>A	ENST00000259782.4	+	4	668	c.572G>A	c.(571-573)cGc>cAc	p.R191H	TINAG_ENST00000370869.3_Missense_Mutation_p.R187H|TINAG_ENST00000370864.3_Missense_Mutation_p.R173H	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	191					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R191H(1)|p.R191L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TTTAAATTTCGCCTTGGCACT	0.373																																							uc003pcj.2		NA																	2	Substitution - Missense(2)		haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	ovary(3)|central_nervous_system(1)	4						c.(571-573)CGC>CAC		tubulointerstitial nephritis antigen		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	139.0	127.0	131.0		572	4.0	1.0	6		131	0,8600		0,0,4300	no	missense	TINAG	NM_014464.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	191/477	54191662	1,13005	2203	4300	6503	SO:0001583	missense	27283				cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity	g.chr6:54191662G>A	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.572G>A	6.37:g.54191662G>A	ENSP00000259782:p.Arg191His		Somatic				TINAG_uc010jzt.2_RNA	p.R191H	NM_014464	NP_055279	WXS	Illumina HiSeq	Unspecified	Q9UJW2	TINAG_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.246)		4	718	+	Lung NSC(77;0.0518)		191					Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	c.572G>A	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501658	0.44455	2.27E-4	0.0	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;T;T	0.77750	-1.12;-1.12;-1.12	5.82	4.01	0.46588	.	0.349950	0.28544	N	0.014979	T	0.53077	0.1774	M	0.67517	2.055	0.45822	D	0.99869	P	0.44659	0.84	B	0.26517	0.07	T	0.62798	-0.6778	10	0.59425	D	0.04	.	6.5973	0.22681	0.0884:0.0:0.7325:0.1791	.	191	Q9UJW2	TINAG_HUMAN	H	187;141;191;173	ENSP00000359906:R187H;ENSP00000259782:R191H;ENSP00000359901:R173H	ENSP00000259782:R191H	R	+	2	0	TINAG	54299621	1.000000	0.71417	0.994000	0.49952	0.709000	0.40893	2.893000	0.48633	1.420000	0.47138	0.643000	0.83706	CGC		0.373	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464		40	114	0	0	0	0.048971	0	40	114				
DST	667	broad.mit.edu	37	6	56347530	56347530	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr6:56347530C>T	ENST00000361203.3	-	84	20400	c.20393G>A	c.(20392-20394)tGt>tAt	p.C6798Y	DST_ENST00000370754.5_Missense_Mutation_p.C7087Y|DST_ENST00000370769.4_Missense_Mutation_p.C6909Y|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.C4821Y|DST_ENST00000244364.6_Missense_Mutation_p.C4495Y|DST_ENST00000446842.2_Missense_Mutation_p.C6583Y|DST_ENST00000370788.2_Missense_Mutation_p.C4712Y			Q03001	DYST_HUMAN	dystonin	6799					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGAAAGTGCACACACGGTCTC	0.498																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(14995-14997)TGT>TAT		dystonin isoform 2							91.0	87.0	88.0					6																	56347530		1927	4140	6067	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56347530C>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20393G>A	6.37:g.56347530C>T	ENSP00000354508:p.Cys6798Tyr		Somatic				DST_uc003pcz.3_Missense_Mutation_p.C4821Y|DST_uc011dxj.1_Missense_Mutation_p.C4850Y|DST_uc011dxk.1_Missense_Mutation_p.C4861Y|DST_uc003pcy.3_Missense_Mutation_p.C4495Y	p.C4999Y	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		83	15024	-	Lung NSC(77;0.103)		6907			Spectrin 19.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.14996G>A		.	.	.	.	.	.	.	.	.	.	C	21.6	4.166470	0.78339	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71;0.71	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000012	T	0.59770	0.2218	L	0.53671	1.685	0.35964	D	0.834807	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.967	D;D;D;D;P	0.97110	0.999;1.0;0.999;0.999;0.786	T	0.50189	-0.8857	9	0.35671	T	0.21	.	20.3431	0.98773	0.0:1.0:0.0:0.0	.	4821;6909;7087;6907;4495	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	Y	4495;7087;6909;4821;6583;4712;6798	ENSP00000244364:C4495Y;ENSP00000359790:C7087Y;ENSP00000359805:C6909Y;ENSP00000400883:C4821Y;ENSP00000393645:C6583Y;ENSP00000359824:C4712Y;ENSP00000354508:C6798Y	ENSP00000244364:C4495Y	C	-	2	0	DST	56455489	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	6.001000	0.70685	2.880000	0.98712	0.650000	0.86243	TGT		0.498	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		14	116	0	0	0	0.024245	0	14	116				
DST	667	broad.mit.edu	37	6	56510705	56510705	+	Silent	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr6:56510705G>A	ENST00000361203.3	-	11	1111	c.1104C>T	c.(1102-1104)gcC>gcT	p.A368A	DST_ENST00000370754.5_Silent_p.A546A|DST_ENST00000370769.4_Silent_p.A368A|DST_ENST00000312431.6_Silent_p.A368A|DST_ENST00000421834.2_Silent_p.A368A|DST_ENST00000244364.6_5'Flank|DST_ENST00000370788.2_Silent_p.A368A			Q03001	DYST_HUMAN	dystonin	368					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTCTAGCATGGCAATAATGA	0.438																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(1636-1638)GCC>GCT		dystonin isoform 2							122.0	112.0	115.0					6																	56510705		1836	4098	5934	SO:0001819	synonymous_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56510705G>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1104C>T	6.37:g.56510705G>A			Somatic				DST_uc003pcz.3_Silent_p.A368A|DST_uc011dxj.1_Silent_p.A397A|DST_uc011dxk.1_Silent_p.A408A|DST_uc011dxl.1_Silent_p.A397A|DST_uc003pde.2_Silent_p.A484A	p.A546A	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		14	1666	-	Lung NSC(77;0.103)		368					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37	c.1638C>T																																																																																					0.438	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		50	76	0	0	0	0.048971	0	50	76				
DFNA5	1687	broad.mit.edu	37	7	24784262	24784262	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:24784262C>T	ENST00000342947.3	-	3	748	c.323G>A	c.(322-324)cGc>cAc	p.R108H	DFNA5_ENST00000409970.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.R108H|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000419307.1_5'UTR	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	108					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GCTCTCTACGCGGCTGCTGCC	0.552																																					GBM(78;184 1250 20134 20900 23600)	GBM(78;184 1250 20134 20900 23600)	uc010kus.1		NA																	0		p.R108R(1)		ovary(1)	1						c.(322-324)CGC>CAC		deafness, autosomal dominant 5 protein isoform							93.0	85.0	88.0					7																	24784262		2203	4300	6503	SO:0001583	missense	1687				sensory perception of sound			g.chr7:24784262C>T	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.323G>A	7.37:g.24784262C>T	ENSP00000339587:p.Arg108His		Somatic				DFNA5_uc003swz.2_5'UTR|DFNA5_uc003sxa.1_Missense_Mutation_p.R108H|DFNA5_uc010kut.1_5'UTR|DFNA5_uc003sxb.2_Missense_Mutation_p.R108H|DFNA5_uc003sxc.2_Missense_Mutation_p.R108H	p.R108H	NM_001127453	NP_001120925	WXS	Illumina HiSeq	Unspecified	O60443	DFNA5_HUMAN			3	411	-			108					A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	c.323G>A	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	C	3.995	-0.003645	0.07773	.	.	ENSG00000105928	ENST00000342947;ENST00000409775	T;T	0.22539	1.95;1.95	5.7	3.22	0.36961	.	0.492049	0.23466	N	0.047878	T	0.06872	0.0175	N	0.02539	-0.55	0.09310	N	0.999998	B;B	0.15930	0.015;0.008	B;B	0.12837	0.008;0.005	T	0.36286	-0.9754	10	0.15499	T	0.54	-3.516	6.2349	0.20758	0.4915:0.2315:0.0:0.277	.	108;108	A4FTY0;O60443	.;DFNA5_HUMAN	H	108	ENSP00000339587:R108H;ENSP00000386670:R108H	ENSP00000339587:R108H	R	-	2	0	DFNA5	24750787	0.776000	0.28616	0.328000	0.25416	0.003000	0.03518	1.573000	0.36472	1.008000	0.39264	-0.271000	0.10264	CGC		0.552	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403		14	53	0	0	0	0.0333	0	14	53				
HOXA6	3203	broad.mit.edu	37	7	27185328	27185328	+	Silent	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:27185328G>A	ENST00000222728.3	-	2	675	c.651C>T	c.(649-651)atC>atT	p.I217I	HOXA5_ENST00000222726.3_5'Flank|HOXA6_ENST00000521478.1_5'UTR|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	217					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						GCGTGGAATTGATGAGCTTGT	0.612																																							uc003syo.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(649-651)ATC>ATT		homeobox A6							140.0	132.0	135.0					7																	27185328		2203	4300	6503	SO:0001819	synonymous_variant	3203					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27185328G>A		CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.651C>T	7.37:g.27185328G>A			Somatic				HOXA5_uc003syn.1_5'Flank|uc003syp.1_5'Flank	p.I217I	NM_024014	NP_076919	WXS	Illumina HiSeq	Unspecified	P31267	HXA6_HUMAN			2	651	-			217					A4D192|Q2M3G3|Q9UPM0	Silent	SNP	ENST00000222728.3	37	c.651C>T	CCDS5407.1																																																																																				0.612	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358697.1			47	99	0	0	0	0.048971	0	47	99				
BBS9	27241	broad.mit.edu	37	7	33380516	33380516	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:33380516G>T	ENST00000242067.6	+	11	1727	c.1206G>T	c.(1204-1206)tgG>tgT	p.W402C	BBS9_ENST00000354265.4_Missense_Mutation_p.W402C|BBS9_ENST00000396127.2_Missense_Mutation_p.W402C|BBS9_ENST00000355070.2_Missense_Mutation_p.W402C|BBS9_ENST00000350941.3_Missense_Mutation_p.W402C	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	402					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CAGGTGTTTGGCCCATGACTG	0.308									Bardet-Biedl syndrome																														uc003tdn.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(1204-1206)TGG>TGT		parathyroid hormone-responsive B1 isoform 2							155.0	141.0	145.0					7																	33380516		2203	4300	6503	SO:0001583	missense	27241	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding	g.chr7:33380516G>T		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1206G>T	7.37:g.33380516G>T	ENSP00000242067:p.Trp402Cys		Somatic				BBS9_uc003tdo.1_Missense_Mutation_p.W402C|BBS9_uc003tdp.1_Missense_Mutation_p.W402C|BBS9_uc003tdq.1_Missense_Mutation_p.W402C|BBS9_uc010kwn.1_RNA|BBS9_uc011kao.1_Missense_Mutation_p.W280C	p.W402C	NM_198428	NP_940820	WXS	Illumina HiSeq	Unspecified	Q3SYG4	PTHB1_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)		11	1719	+			402					E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	c.1206G>T	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676569	0.47886	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000537775	T;T;T;T;T	0.57436	0.4;0.4;0.41;0.4;0.41	4.48	4.48	0.54585	.	0.247314	0.35067	N	0.003475	T	0.53642	0.1809	N	0.22421	0.69	0.80722	D	1	P;P;P;P	0.50943	0.94;0.879;0.94;0.94	P;P;P;P	0.55161	0.717;0.689;0.717;0.77	T	0.54275	-0.8318	10	0.38643	T	0.18	-6.9642	17.6399	0.88132	0.0:0.0:1.0:0.0	.	402;402;402;402	Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;PTHB1_HUMAN	C	402;402;402;402;402;402;402;280	ENSP00000242067:W402C;ENSP00000313122:W402C;ENSP00000379433:W402C;ENSP00000347182:W402C;ENSP00000346214:W402C	ENSP00000242067:W402C	W	+	3	0	BBS9	33347041	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.542000	0.60677	2.433000	0.82419	0.650000	0.86243	TGG		0.308	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1			12	62	1	0	4.93089e-13	0.020292	6.13449e-13	12	62				
ABCA13	154664	broad.mit.edu	37	7	48634392	48634392	+	Silent	SNP	G	G	C	rs377117907		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:48634392G>C	ENST00000435803.1	+	58	14751	c.14727G>C	c.(14725-14727)gcG>gcC	p.A4909A	ABCA13_ENST00000544596.1_Silent_p.A639A	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4909	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCTGTGCTGCGGTGCTGACCT	0.502																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(14725-14727)GCG>GCC		ATP binding cassette, sub-family A (ABC1),							133.0	142.0	139.0					7																	48634392		2031	4190	6221	SO:0001819	synonymous_variant	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48634392G>C	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14727G>C	7.37:g.48634392G>C			Somatic				ABCA13_uc010kys.1_Silent_p.A1984A|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Silent_p.A639A	p.A4909A	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			58	14752	+			4909			ABC transporter 2.		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	c.14727G>C	CCDS47584.1																																																																																				0.502	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		31	101	0	0	0	0.054565	0	31	101				
ZNF479	90827	broad.mit.edu	37	7	57187809	57187809	+	Missense_Mutation	SNP	T	T	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:57187809T>G	ENST00000331162.4	-	5	1583	c.1313A>C	c.(1312-1314)aAa>aCa	p.K438T		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCTTCACATTTGTAGGGTCT	0.453																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(1312-1314)AAA>ACA		zinc finger protein 479							15.0	13.0	14.0					7																	57187809		1651	3694	5345	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57187809T>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1313A>C	7.37:g.57187809T>G	ENSP00000333776:p.Lys438Thr		Somatic					p.K438T	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1584	-			438			C2H2-type 10.			Missense_Mutation	SNP	ENST00000331162.4	37	c.1313A>C	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.944203	0.00479	.	.	ENSG00000185177	ENST00000331162	T	0.58060	0.36	0.955	-1.91	0.07641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32133	0.0819	N	0.20574	0.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10497	-1.0627	9	0.59425	D	0.04	.	4.2411	0.10648	0.1773:0.0:0.4807:0.342	.	438	Q96JC4	ZN479_HUMAN	T	438	ENSP00000333776:K438T	ENSP00000333776:K438T	K	-	2	0	ZNF479	57191751	0.000000	0.05858	0.013000	0.15412	0.012000	0.07955	-1.673000	0.01951	-4.325000	0.00056	-4.471000	0.00005	AAA		0.453	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		4	73	0	0	0	0.021553	0	4	73				
AP4M1	9179	broad.mit.edu	37	7	99700336	99700336	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr7:99700336C>T	ENST00000359593.4	+	3	344	c.186C>T	c.(184-186)agC>agT	p.S62S	AP4M1_ENST00000421755.1_Silent_p.S62S|AP4M1_ENST00000422582.1_5'UTR|MCM7_ENST00000343023.6_5'Flank|MCM7_ENST00000354230.3_5'Flank|MCM7_ENST00000303887.5_5'Flank|AP4M1_ENST00000478501.1_3'UTR|AP4M1_ENST00000429084.1_Silent_p.S69S	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	62					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAGACACAGCGGCCTCTATT	0.527																																					Pancreas(174;1182 2812 29595 49511)	Pancreas(174;1182 2812 29595 49511)	uc003utb.3		NA																	0					0						c.(184-186)AGC>AGT		adaptor-related protein complex 4, mu 1 subunit							149.0	135.0	139.0					7																	99700336		2203	4300	6503	SO:0001819	synonymous_variant	9179				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity	g.chr7:99700336C>T	Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.186C>T	7.37:g.99700336C>T			Somatic				MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Silent_p.S62S|AP4M1_uc010lgl.1_Silent_p.S62S|AP4M1_uc003utc.3_Silent_p.S69S|AP4M1_uc010lgm.2_5'UTR|AP4M1_uc003utd.2_Silent_p.S62S|AP4M1_uc011kjh.1_Silent_p.S14S|AP4M1_uc003ute.3_5'UTR|AP4M1_uc003utf.3_5'UTR	p.S62S	NM_004722	NP_004713	WXS	Illumina HiSeq	Unspecified	O00189	AP4M1_HUMAN			3	394	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		62					D6W5U1|Q8WV65|Q9UHK9	Silent	SNP	ENST00000359593.4	37	c.186C>T	CCDS5685.1																																																																																				0.527	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4	NM_004722		7	67	0	0	0	0.02938	0	7	67				
EBF2	64641	broad.mit.edu	37	8	25745399	25745399	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:25745399C>T	ENST00000520164.1	-	9	1378	c.841G>A	c.(841-843)Ggt>Agt	p.G281S	EBF2_ENST00000535548.1_Missense_Mutation_p.G12S|EBF2_ENST00000408929.3_Missense_Mutation_p.G133S	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	281	IPT/TIG.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		ACTTGGAGACCATCAAAGAAG	0.493																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	uc003xes.1		NA																	0				ovary(3)|skin(1)	4						c.(841-843)GGT>AGT		early B-cell factor 2							119.0	114.0	116.0					8																	25745399		2027	4224	6251	SO:0001583	missense	64641				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding	g.chr8:25745399C>T	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.841G>A	8.37:g.25745399C>T	ENSP00000430241:p.Gly281Ser		Somatic				PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	p.G281S	NM_022659	NP_073150	WXS	Illumina HiSeq	Unspecified	Q9HAK2	COE2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)	9	858	-		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)	281			IPT/TIG.		A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	c.841G>A	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	C	36	5.808135	0.96967	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.40225	1.04;1.04;1.04	6.08	6.08	0.98989	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	M	0.85630	2.765	0.80722	D	1	D	0.53619	0.961	P	0.56751	0.805	T	0.70245	-0.4925	10	0.87932	D	0	-1.4851	20.6634	0.99662	0.0:1.0:0.0:0.0	.	281	Q9HAK2	COE2_HUMAN	S	281;133;12	ENSP00000430241:G281S;ENSP00000386178:G133S;ENSP00000437909:G12S	ENSP00000386178:G133S	G	-	1	0	EBF2	25801316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.894000	0.99253	0.655000	0.94253	GGT		0.493	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659		3	68	0	0	0	0.014758	0	3	68				
ZMAT4	79698	broad.mit.edu	37	8	40438694	40438694	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:40438694G>T	ENST00000297737.6	-	6	810	c.664C>A	c.(664-666)Cac>Aac	p.H222N	ZMAT4_ENST00000315769.7_Missense_Mutation_p.H146N	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	222						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			TTGGTCTGGTGTTTAGATCCT	0.388																																							uc003xnr.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(664-666)CAC>AAC		zinc finger, matrin type 4 isoform a							204.0	163.0	177.0					8																	40438694		2203	4300	6503	SO:0001583	missense	79698					nucleus	DNA binding|zinc ion binding	g.chr8:40438694G>T	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.664C>A	8.37:g.40438694G>T	ENSP00000297737:p.His222Asn		Somatic				ZMAT4_uc003xns.2_Missense_Mutation_p.H146N	p.H222N	NM_024645	NP_078921	WXS	Illumina HiSeq	Unspecified	Q9H898	ZMAT4_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.00722)		6	810	-	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	222			Matrin-type 4.		Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	37	c.664C>A	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632212	0.87660	.	.	ENSG00000165061	ENST00000315769;ENST00000297737	D;D	0.93604	-3.25;-3.25	5.65	5.65	0.86999	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	D	0.96756	0.8941	M	0.81802	2.56	0.51482	D	0.999922	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.945	D	0.97096	0.9794	10	0.87932	D	0	-30.6337	17.2157	0.86943	0.0:0.0:1.0:0.0	.	146;222	Q9H898-2;Q9H898	.;ZMAT4_HUMAN	N	146;222	ENSP00000319785:H146N;ENSP00000297737:H222N	ENSP00000297737:H222N	H	-	1	0	ZMAT4	40557851	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	7.536000	0.82023	2.648000	0.89879	0.655000	0.94253	CAC		0.388	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645		27	42	1	0	8.88839e-20	0.045705	1.22119e-19	27	42				
KAT6A	7994	broad.mit.edu	37	8	41792289	41792289	+	Missense_Mutation	SNP	T	T	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:41792289T>C	ENST00000396930.3	-	18	3992	c.3449A>G	c.(3448-3450)aAg>aGg	p.K1150R	KAT6A_ENST00000406337.1_Missense_Mutation_p.K1150R|KAT6A_ENST00000265713.2_Missense_Mutation_p.K1150R	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1150	Poly-Lys.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K1150T(1)									GGGCCATCCCTTTTTCTTTTT	0.433																																							uc010lxb.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(3448-3450)AAG>AGG		MYST histone acetyltransferase (monocytic							176.0	188.0	184.0					8																	41792289		2203	4300	6503	SO:0001583	missense	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41792289T>C	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3449A>G	8.37:g.41792289T>C	ENSP00000380136:p.Lys1150Arg		Somatic				MYST3_uc010lxc.2_Missense_Mutation_p.K1150R|MYST3_uc003xon.3_Missense_Mutation_p.K1150R	p.K1150R	NM_001099412	NP_001092882	WXS	Illumina HiSeq	Unspecified	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		18	3993	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	1150			Poly-Lys.		Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	c.3449A>G	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855812	0.51376	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.63913	-0.07;-0.07;-0.07	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	L	0.61218	1.895	0.50467	D	0.999877	D	0.69078	0.997	D	0.75020	0.985	T	0.78280	-0.2265	10	0.59425	D	0.04	-35.1012	16.17	0.81801	0.0:0.0:0.0:1.0	.	1150	Q92794	KAT6A_HUMAN	R	1150	ENSP00000265713:K1150R;ENSP00000385888:K1150R;ENSP00000380136:K1150R	ENSP00000265713:K1150R	K	-	2	0	KAT6A	41911446	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	2.279000	0.76181	0.533000	0.62120	AAG		0.433	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		3	131	0	0	0	0.009096	0	3	131				
DNAJC5B	85479	broad.mit.edu	37	8	66988902	66988902	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:66988902G>T	ENST00000276570.5	+	4	414	c.127G>T	c.(127-129)Gcc>Tcc	p.A43S	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	43	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.			KLAL -> LENP (in Ref. 3; CAB63773). {ECO:0000305}.		membrane (GO:0016020)				endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			AAGAAAATTGGCCCTGAAACA	0.368																																							uc003xvs.1		NA																	0					0						c.(127-129)GCC>TCC		DnaJ (Hsp40) homolog, subfamily C, member 5							96.0	102.0	100.0					8																	66988902		2203	4300	6503	SO:0001583	missense	85479				protein folding	membrane	heat shock protein binding|unfolded protein binding	g.chr8:66988902G>T	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.127G>T	8.37:g.66988902G>T	ENSP00000276570:p.Ala43Ser		Somatic				DNAJC5B_uc003xvt.1_RNA	p.A43S	NM_033105	NP_149096	WXS	Illumina HiSeq	Unspecified	Q9UF47	DNJ5B_HUMAN	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)		4	418	+		Lung NSC(129;0.114)|all_lung(136;0.188)	43	KLAL -> LENP (in Ref. 3; CAB63773).		J.		Q969Y8	Missense_Mutation	SNP	ENST00000276570.5	37	c.127G>T	CCDS6183.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198209	0.94997	.	.	ENSG00000147570	ENST00000276570;ENST00000522619	T;T	0.36878	1.23;1.23	5.73	5.73	0.89815	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	N	0.16130	0.375	0.80722	D	1	D	0.65815	0.995	D	0.79108	0.992	T	0.53927	-0.8369	10	0.87932	D	0	.	19.8961	0.96958	0.0:0.0:1.0:0.0	.	43	Q9UF47	DNJ5B_HUMAN	S	43	ENSP00000276570:A43S;ENSP00000430196:A43S	ENSP00000276570:A43S	A	+	1	0	DNAJC5B	67151456	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	GCC		0.368	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378915.1	NM_033105		30	115	1	0	2.52637e-11	0.023175	3.09432e-11	30	115				
ZFHX4	79776	broad.mit.edu	37	8	77764153	77764153	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:77764153G>T	ENST00000521891.2	+	10	5444	c.4996G>T	c.(4996-4998)Gat>Tat	p.D1666Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D1621Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D1640Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D1621Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1621	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCCATTTAGATGCCAAAGA	0.448										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4861-4863)GAT>TAT		zinc finger homeodomain 4							89.0	87.0	88.0					8																	77764153		1937	4133	6070	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764153G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4996G>T	8.37:g.77764153G>T	ENSP00000430497:p.Asp1666Tyr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.D1666Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.D1621Y	p.D1621Y	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5248	+			1621					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4861G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391899	0.42410	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51071	0.72;0.76;0.73;0.72	4.41	4.41	0.53225	.	0.000000	0.45867	U	0.000325	T	0.64681	0.2620	L	0.56769	1.78	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	P;D;D	0.66979	0.888;0.912;0.948	T	0.69105	-0.5233	10	0.87932	D	0	.	17.537	0.87834	0.0:0.0:1.0:0.0	.	1621;1621;1666	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	1666;1666;1621;1621;1640	ENSP00000430497:D1666Y;ENSP00000399605:D1621Y;ENSP00000050961:D1621Y;ENSP00000430848:D1640Y	ENSP00000050961:D1621Y	D	+	1	0	ZFHX4	77926708	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.119000	0.94362	2.456000	0.83038	0.542000	0.68232	GAT		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		30	50	1	0	1.71298e-08	0.017118	2.05039e-08	30	50				
FBXO43	286151	broad.mit.edu	37	8	101152954	101152954	+	Missense_Mutation	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:101152954G>C	ENST00000428847.2	-	2	1844	c.1528C>G	c.(1528-1530)Ctt>Gtt	p.L510V		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	510	F-box.				meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			ACCATAGCAAGAATATGCTTT	0.328																																							uc003yjd.2		NA																	0				kidney(1)|skin(1)	2						c.(1528-1530)CTT>GTT		F-box protein 43 isoform b							68.0	65.0	66.0					8																	101152954		1806	4075	5881	SO:0001583	missense	286151				meiosis		zinc ion binding	g.chr8:101152954G>C	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1528C>G	8.37:g.101152954G>C	ENSP00000403293:p.Leu510Val		Somatic				FBXO43_uc003yje.2_Missense_Mutation_p.L476V|FBXO43_uc010mbp.1_Missense_Mutation_p.L510V	p.L510V	NM_001029860	NP_001025031	WXS	Illumina HiSeq	Unspecified	Q4G163	FBX43_HUMAN	Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)		2	2241	-	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		510			F-box.			Missense_Mutation	SNP	ENST00000428847.2	37	c.1528C>G	CCDS47904.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342150	0.61073	.	.	ENSG00000156509	ENST00000428847	T	0.61040	0.14	4.86	4.86	0.63082	.	0.070636	0.56097	D	0.000040	T	0.67804	0.2932	L	0.61387	1.9	0.48288	D	0.999624	D;D	0.67145	0.996;0.996	P;P	0.57283	0.817;0.817	T	0.71563	-0.4555	10	0.72032	D	0.01	-12.0621	13.3503	0.60597	0.0:0.0:0.8422:0.1577	.	476;510	C9J908;Q4G163	.;FBX43_HUMAN	V	510	ENSP00000403293:L510V	ENSP00000403293:L510V	L	-	1	0	FBXO43	101222130	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.889000	0.56212	2.398000	0.81561	0.655000	0.94253	CTT		0.328	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918		25	99	0	0	0	0.021523	0	25	99				
ZHX2	22882	broad.mit.edu	37	8	123964468	123964468	+	Missense_Mutation	SNP	G	G	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:123964468G>A	ENST00000314393.4	+	3	1553	c.718G>A	c.(718-720)Gga>Aga	p.G240R		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	240	Required for homodimerization.				mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AGACACATTAGGACACGTCAT	0.562																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	Esophageal Squamous(94;1056 1388 11767 13799 49639)	uc003ypk.1		NA																	0				ovary(1)|skin(1)	2						c.(718-720)GGA>AGA		zinc fingers and homeoboxes 2							148.0	154.0	152.0					8																	123964468		2203	4300	6503	SO:0001583	missense	22882					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:123964468G>A	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.718G>A	8.37:g.123964468G>A	ENSP00000314709:p.Gly240Arg		Somatic					p.G240R	NM_014943	NP_055758	WXS	Illumina HiSeq	Unspecified	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	1285	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		240			Required for homodimerization.			Missense_Mutation	SNP	ENST00000314393.4	37	c.718G>A	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884731	0.72410	.	.	ENSG00000178764	ENST00000314393	T	0.18338	2.22	5.63	5.63	0.86233	.	0.112322	0.64402	D	0.000015	T	0.30916	0.0780	L	0.36672	1.1	0.38219	D	0.940695	D	0.63880	0.993	P	0.58721	0.844	T	0.01532	-1.1331	10	0.54805	T	0.06	-18.4391	20.047	0.97613	0.0:0.0:1.0:0.0	.	240	Q9Y6X8	ZHX2_HUMAN	R	240	ENSP00000314709:G240R	ENSP00000314709:G240R	G	+	1	0	ZHX2	124033649	1.000000	0.71417	0.971000	0.41717	0.996000	0.88848	6.948000	0.75965	2.821000	0.97095	0.555000	0.69702	GGA		0.562	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943		44	179	0	0	0	0.048971	0	44	179				
C8orf76	84933	broad.mit.edu	37	8	124253515	124253515	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:124253515C>T	ENST00000276704.4	-	1	123	c.72G>A	c.(70-72)cgG>cgA	p.R24R	ZHX1-C8ORF76_ENST00000357082.4_Intron|C8orf76_ENST00000521310.1_5'UTR	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	24										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GCGGTCCTGACCGCCGCTCCG	0.711																																							uc003yqc.1		NA																	0				ovary(2)	2						c.(70-72)CGG>CGA		hypothetical protein LOC84933							9.0	10.0	10.0					8																	124253515		2124	4216	6340	SO:0001819	synonymous_variant	84933						binding	g.chr8:124253515C>T	AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.72G>A	8.37:g.124253515C>T			Somatic				C8orf76_uc003yqd.2_Intron	p.R24R	NM_032847	NP_116236	WXS	Illumina HiSeq	Unspecified	Q96K31	CH076_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		1	103	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		24					Q53HC1	Silent	SNP	ENST00000276704.4	37	c.72G>A	CCDS6341.1																																																																																				0.711	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847		7	22	0	0	0	0.047766	0	7	22				
KLHL38	340359	broad.mit.edu	37	8	124658139	124658139	+	Missense_Mutation	SNP	C	C	T	rs376622136		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:124658139C>T	ENST00000325995.7	-	3	1609	c.1586G>A	c.(1585-1587)cGg>cAg	p.R529Q	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	529										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						GGTCAGCCGCCGCCCGCCCGT	0.582																																							uc003yqs.1		NA																	0					0						c.(1585-1587)CGG>CAG		kelch-like 38		C	GLN/ARG	0,4196		0,0,2098	96.0	112.0	106.0		1586	5.0	1.0	8		106	1,8441		0,1,4220	no	missense	KLHL38	NM_001081675.2	43	0,1,6318	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	529/582	124658139	1,12637	2098	4221	6319	SO:0001583	missense	340359							g.chr8:124658139C>T		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1586G>A	8.37:g.124658139C>T	ENSP00000321475:p.Arg529Gln		Somatic					p.R529Q	NM_001081675	NP_001075144	WXS	Illumina HiSeq	Unspecified	Q2WGJ6	KLH38_HUMAN			3	1610	-			529			Kelch 6.		A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	c.1586G>A	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	C	36	5.614955	0.96649	0.0	1.18E-4	ENSG00000175946	ENST00000325995	T	0.78816	-1.21	5.0	5.0	0.66597	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.86285	0.5896	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.83639	0.0149	10	0.23302	T	0.38	.	18.2916	0.90133	0.0:1.0:0.0:0.0	.	529	Q2WGJ6	KLH38_HUMAN	Q	529	ENSP00000321475:R529Q	ENSP00000321475:R529Q	R	-	2	0	KLHL38	124727320	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	7.818000	0.86416	2.323000	0.78572	0.455000	0.32223	CGG		0.582	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1			27	115	0	0	0	0.037714	0	27	115				
CCIN	881	broad.mit.edu	37	9	36170349	36170349	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr9:36170349C>T	ENST00000335119.2	+	1	961	c.850C>T	c.(850-852)Ctc>Ttc	p.L284F		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	284					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			CGTGGTCATCCTCGGTGGCCA	0.572																																							uc003zzb.3		NA																	0				ovary(1)|skin(1)	2						c.(850-852)CTC>TTC		calicin							71.0	64.0	67.0					9																	36170349		2203	4300	6503	SO:0001583	missense	881				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:36170349C>T	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.850C>T	9.37:g.36170349C>T	ENSP00000334996:p.Leu284Phe		Somatic					p.L284F	NM_005893	NP_005884	WXS	Illumina HiSeq	Unspecified	Q13939	CALI_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		1	961	+			284			Kelch 1.		Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	c.850C>T	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743139	0.49151	.	.	ENSG00000185972	ENST00000335119	T	0.64085	-0.08	5.97	5.07	0.68467	Kelch-type beta propeller (1);	0.000000	0.46758	D	0.000274	T	0.66528	0.2798	L	0.29908	0.895	0.35013	D	0.757128	D	0.65815	0.995	D	0.72982	0.979	T	0.74121	-0.3767	10	0.87932	D	0	.	10.1109	0.42561	0.0:0.9116:0.0:0.0884	.	284	Q13939	CALI_HUMAN	F	284	ENSP00000334996:L284F	ENSP00000334996:L284F	L	+	1	0	CCIN	36160349	0.995000	0.38212	0.998000	0.56505	0.885000	0.51271	1.285000	0.33261	2.839000	0.97877	0.655000	0.94253	CTC		0.572	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893		31	56	0	0	0	0.023175	0	31	56				
ROR2	4920	broad.mit.edu	37	9	94487237	94487237	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr9:94487237C>A	ENST00000375708.3	-	9	1737	c.1539G>T	c.(1537-1539)gcG>gcT	p.A513A	ROR2_ENST00000375715.1_Silent_p.A373A|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	513	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGGGCCCCTCCGCTTTGTCCT	0.642																																							uc004arj.1		NA																	0				lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						c.(1537-1539)GCG>GCT		receptor tyrosine kinase-like orphan receptor 2							86.0	100.0	95.0					9																	94487237		2203	4300	6503	SO:0001819	synonymous_variant	4920				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding	g.chr9:94487237C>A	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1539G>T	9.37:g.94487237C>A			Somatic				ROR2_uc004ari.1_Silent_p.A373A	p.A513A	NM_004560	NP_004551	WXS	Illumina HiSeq	Unspecified	Q01974	ROR2_HUMAN			9	1738	-			513			Cytoplasmic (Potential).|Protein kinase.		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	37	c.1539G>T	CCDS6691.1																																																																																				0.642	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			42	88	1	0	1.61863e-15	0.048971	2.13119e-15	42	88				
ABL1	25	broad.mit.edu	37	9	133760830	133760830	+	Silent	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr9:133760830C>T	ENST00000318560.5	+	11	3534	c.3153C>T	c.(3151-3153)gcC>gcT	p.A1051A		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	1051	F-actin-binding.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	AGCAGATGGCCAGCCACAGCG	0.607			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																		uc004bzw.2		NA		Dom	yes		9	9q34.1	25	T|Mis	v-abl Abelson murine leukemia viral oncogene homolog 1			L	BCR|ETV6|NUP214		CML|ALL|T-ALL		0				haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817						c.(3151-3153)GCC>GCT		c-abl oncogene 1, receptor tyrosine kinase	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)						58.0	61.0	60.0					9																	133760830		2203	4300	6503	SO:0001819	synonymous_variant	25				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding	g.chr9:133760830C>T	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.3153C>T	9.37:g.133760830C>T			Somatic				ABL1_uc004bzv.2_Silent_p.A1070A	p.A1051A	NM_005157	NP_005148	WXS	Illumina HiSeq	Unspecified	P00519	ABL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	11	3156	+		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)	1051			F-actin-binding.		A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	37	c.3153C>T	CCDS35166.1																																																																																				0.607	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313		8	63	0	0	0	0.047766	0	8	63				
NUP214	8021	broad.mit.edu	37	9	134107673	134107673	+	Missense_Mutation	SNP	T	T	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr9:134107673T>G	ENST00000359428.5	+	35	6361	c.6217T>G	c.(6217-6219)Ttc>Gtc	p.F2073V	NUP214_ENST00000451030.1_Missense_Mutation_p.F2074V|NUP214_ENST00000411637.2_Missense_Mutation_p.F2063V|NUP214_ENST00000483497.2_Missense_Mutation_p.F899V			P35658	NU214_HUMAN	nucleoporin 214kDa	2073	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CTTTTCAGGGTTCAGCTTTGG	0.433			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		0				breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(6217-6219)TTC>GTC		nucleoporin 214kDa							197.0	170.0	179.0					9																	134107673		2203	4300	6503	SO:0001583	missense	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134107673T>G	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.6217T>G	9.37:g.134107673T>G	ENSP00000352400:p.Phe2073Val		Somatic				NUP214_uc004cah.2_Missense_Mutation_p.F2063V|NUP214_uc004cai.2_Missense_Mutation_p.F1503V|NUP214_uc010mzg.2_RNA|NUP214_uc011mcg.1_Missense_Mutation_p.F899V	p.F2073V	NM_005085	NP_005076	WXS	Illumina HiSeq	Unspecified	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	35	6328	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	2073			Pro/Ser/Thr-rich.|11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	c.6217T>G	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866309	0.32977	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000540899;ENST00000438605;ENST00000483497;ENST00000528406	T;T;T;T	0.52526	1.21;1.22;1.21;0.66	5.05	5.05	0.67936	.	.	.	.	.	T	0.47875	0.1469	N	0.08118	0	0.41624	D	0.988988	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.994;0.994;0.994	T	0.57923	-0.7727	9	0.62326	D	0.03	.	12.4555	0.55702	0.0:0.0:0.0:1.0	.	899;1667;2063;2073	B7ZAV2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	V	2073;2063;2074;1667;1502;899;61	ENSP00000352400:F2073V;ENSP00000396576:F2063V;ENSP00000405014:F2074V;ENSP00000436793:F899V	ENSP00000352400:F2073V	F	+	1	0	NUP214	133097494	0.998000	0.40836	0.754000	0.31244	0.012000	0.07955	4.259000	0.58828	2.021000	0.59480	0.383000	0.25322	TTC		0.433	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		16	69	0	0	0	0.055883	0	16	69				
SHOX	6473	broad.mit.edu	37	X	595519	595519	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:595519G>T	ENST00000554971.1	+	2	535	c.444G>T	c.(442-444)gaG>gaT	p.E148D	SHOX_ENST00000381578.1_Missense_Mutation_p.E148D|SHOX_ENST00000381575.1_Missense_Mutation_p.E148D|SHOX_ENST00000334060.3_Missense_Mutation_p.E148D			O15266	SHOX_HUMAN	short stature homeobox	148					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCATGCGCGAGGAGCTCAGCC	0.701																																					Ovarian(95;18 1419 12424 14056 28266)	Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NA																	0					0						c.(442-444)GAG>GAT		short stature homeobox isoform SHOXa							46.0	45.0	45.0					X																	595519		2193	4288	6481	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:595519G>T	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.444G>T	X.37:g.595519G>T	ENSP00000452016:p.Glu148Asp		Somatic				SHOX_uc004cpi.2_Missense_Mutation_p.E148D	p.E148D	NM_000451	NP_000442	WXS	Illumina HiSeq	Unspecified	O15266	SHOX_HUMAN			3	1135	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	148			Homeobox.		O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.444G>T	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166417	0.78339	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14	2.03	2.03	0.26663	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	U	0.000000	D	0.96867	0.8977	M	0.66506	2.035	0.19300	N	0.999978	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	D	0.90931	0.4790	10	0.87932	D	0	.	7.093	0.25295	0.1416:0.0:0.8584:0.0	.	148;148	O15266-2;O15266	.;SHOX_HUMAN	D	148	ENSP00000335505:E148D;ENSP00000370990:E148D;ENSP00000452016:E148D;ENSP00000370987:E148D	ENSP00000335505:E148D	E	+	3	2	SHOX	515519	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.507000	0.45442	0.798000	0.33994	0.426000	0.28351	GAG		0.701	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451		2	3	1	0	0.004672	0.004672	0.00485642	2	3				
WWC3	55841	broad.mit.edu	37	X	10085253	10085253	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:10085253C>T	ENST00000380861.4	+	11	1545	c.1154C>T	c.(1153-1155)tCc>tTc	p.S385F	WWC3_ENST00000454666.1_Missense_Mutation_p.S385F	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	385	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						AGCCGGGGCTCCCTGAGCTCG	0.657																																							uc004csx.3		NA																	0				ovary(4)	4						c.(1153-1155)TCC>TTC		WWC family member 3							46.0	51.0	49.0					X																	10085253		2203	4300	6503	SO:0001583	missense	55841							g.chrX:10085253C>T	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1154C>T	X.37:g.10085253C>T	ENSP00000370242:p.Ser385Phe		Somatic				WWC3_uc010nds.2_Missense_Mutation_p.S49F|WWC3_uc010ndt.2_RNA	p.S385F	NM_015691	NP_056506	WXS	Illumina HiSeq	Unspecified	Q9ULE0	WWC3_HUMAN			11	1352	+			385			Ser-rich.		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	c.1154C>T	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628824	0.87560	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543293;ENST00000398613	T;T	0.60672	0.17;0.17	5.53	5.53	0.82687	.	0.273192	0.43260	D	0.000588	T	0.77909	0.4201	M	0.87038	2.855	0.80722	D	1	D	0.63046	0.992	P	0.59643	0.861	T	0.82497	-0.0428	10	0.87932	D	0	-7.5997	18.6465	0.91411	0.0:1.0:0.0:0.0	.	385	Q9ULE0	WWC3_HUMAN	F	385;385;49;385	ENSP00000370242:S385F;ENSP00000399584:S385F	ENSP00000370242:S385F	S	+	2	0	WWC3	10045253	1.000000	0.71417	0.614000	0.29051	0.708000	0.40852	7.623000	0.83113	2.348000	0.79779	0.464000	0.42555	TCC		0.657	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		31	89	0	0	0	0.054565	0	31	89				
WWC3	55841	broad.mit.edu	37	X	10094316	10094316	+	Silent	SNP	A	A	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:10094316A>G	ENST00000380861.4	+	15	2467	c.2076A>G	c.(2074-2076)tcA>tcG	p.S692S	WWC3_ENST00000454666.1_Silent_p.S692S	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	692	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						ACGTGTGTTCAGTGACTCCGC	0.547																																							uc004csx.3		NA																	0				ovary(4)	4						c.(2074-2076)TCA>TCG		WWC family member 3							105.0	87.0	93.0					X																	10094316		2203	4300	6503	SO:0001819	synonymous_variant	55841							g.chrX:10094316A>G	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2076A>G	X.37:g.10094316A>G			Somatic				WWC3_uc010nds.2_Silent_p.S356S|WWC3_uc010ndt.2_RNA	p.S692S	NM_015691	NP_056506	WXS	Illumina HiSeq	Unspecified	Q9ULE0	WWC3_HUMAN			15	2274	+			692			C2.		A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	c.2076A>G	CCDS14136.1																																																																																				0.547	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		26	89	0	0	0	0.017118	0	26	89				
ATXN3L	92552	broad.mit.edu	37	X	13337381	13337381	+	Missense_Mutation	SNP	C	C	G			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:13337381C>G	ENST00000380622.2	-	1	1137	c.673G>C	c.(673-675)Gat>Cat	p.D225H	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	225					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TCCTCCTCATCTTGGTCTGAT	0.383																																							uc010ned.2		NA																	0				lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(673-675)GAT>CAT		ataxin 3-like							252.0	232.0	238.0					X																	13337381		1568	3582	5150	SO:0001583	missense	92552				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity	g.chrX:13337381C>G		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.673G>C	X.37:g.13337381C>G	ENSP00000369996:p.Asp225His		Somatic					p.D225H	NM_001135995	NP_001129467	WXS	Illumina HiSeq	Unspecified	Q9H3M9	ATX3L_HUMAN			1	1138	-			225			UIM 1.		B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	c.673G>C	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	c	13.37	2.215584	0.39102	.	.	ENSG00000123594	ENST00000380622	T	0.25749	1.78	0.652	0.652	0.17823	Ubiquitin interacting motif (3);	0.294123	0.41605	D	0.000854	T	0.34803	0.0910	L	0.47190	1.495	0.44627	D	0.997608	D	0.56746	0.977	D	0.65233	0.933	T	0.10177	-1.0641	10	0.87932	D	0	.	6.9243	0.24405	0.0:0.9999:0.0:1.0E-4	.	225	Q9H3M9	ATX3L_HUMAN	H	225	ENSP00000369996:D225H	ENSP00000369996:D225H	D	-	1	0	ATXN3L	13247302	1.000000	0.71417	0.004000	0.12327	0.004000	0.04260	2.768000	0.47645	0.575000	0.29434	0.417000	0.27973	GAT		0.383	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995		102	205	0	0	0	0.048971	0	102	205				
PHEX	5251	broad.mit.edu	37	X	22132589	22132589	+	Missense_Mutation	SNP	C	C	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:22132589C>T	ENST00000379374.4	+	11	1752	c.1187C>T	c.(1186-1188)aCc>aTc	p.T396I	PHEX_ENST00000418858.3_Missense_Mutation_p.T99I|PHEX_ENST00000535894.1_Missense_Mutation_p.T299I|PHEX_ENST00000537599.1_Missense_Mutation_p.T396I	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	396					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						ATCCAGGGGACCACAACTTTG	0.393																																							uc004dah.2		NA																	0				ovary(2)|lung(1)	3						c.(1186-1188)ACC>ATC		phosphate-regulating neutral endopeptidase							157.0	135.0	142.0					X																	22132589		2203	4300	6503	SO:0001583	missense	5251				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding	g.chrX:22132589C>T	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1187C>T	X.37:g.22132589C>T	ENSP00000368682:p.Thr396Ile		Somatic				PHEX_uc011mjr.1_Missense_Mutation_p.T396I|PHEX_uc011mjs.1_Missense_Mutation_p.T299I	p.T396I	NM_000444	NP_000435	WXS	Illumina HiSeq	Unspecified	P78562	PHEX_HUMAN			11	1390	+			396			Extracellular (Potential).		O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	c.1187C>T	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745620	0.49151	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82	5.22	5.22	0.72569	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81489	0.4833	L	0.43646	1.37	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.68483	0.929;0.958	T	0.80721	-0.1256	10	0.38643	T	0.18	.	17.8989	0.88897	0.0:1.0:0.0:0.0	.	396;396	F5GXU4;P78562	.;PHEX_HUMAN	I	396;396;299;99	ENSP00000368682:T396I;ENSP00000440362:T396I;ENSP00000439418:T299I;ENSP00000443531:T99I	ENSP00000368682:T396I	T	+	2	0	PHEX	22042510	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.714000	0.74692	2.159000	0.67721	0.513000	0.50165	ACC		0.393	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444		40	124	0	0	0	0.045515	0	40	124				
POLA1	5422	broad.mit.edu	37	X	24753519	24753519	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:24753519G>T	ENST00000379059.3	+	18	1834	c.1819G>T	c.(1819-1821)Gtg>Ttg	p.V607L	POLA1_ENST00000379068.3_Missense_Mutation_p.V613L	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	607					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CTAACAGAATGTGAAGGTTGA	0.388																																							uc004dbl.2		NA																	0				ovary(2)|skin(1)	3						c.(1819-1821)GTG>TTG		DNA-directed DNA polymerase alpha 1	Clofarabine(DB00631)|Fludarabine(DB01073)						167.0	146.0	153.0					X																	24753519		2203	4300	6503	SO:0001583	missense	5422				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding	g.chrX:24753519G>T		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1819G>T	X.37:g.24753519G>T	ENSP00000368349:p.Val607Leu		Somatic					p.V607L	NM_016937	NP_058633	WXS	Illumina HiSeq	Unspecified	P09884	DPOLA_HUMAN			18	1842	+			607					Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	c.1819G>T	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192563	0.21954	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.11277	2.79;2.79	4.55	1.67	0.24075	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.376555	0.29551	N	0.011821	T	0.05181	0.0138	N	0.14661	0.345	0.27123	N	0.962091	B	0.02656	0.0	B	0.06405	0.002	T	0.40459	-0.9562	10	0.20519	T	0.43	-1.4812	6.5686	0.22525	0.1727:0.1453:0.682:0.0	.	607	P09884	DPOLA_HUMAN	L	613;607	ENSP00000368358:V613L;ENSP00000368349:V607L	ENSP00000368349:V607L	V	+	1	0	POLA1	24663440	0.999000	0.42202	0.993000	0.49108	0.985000	0.73830	2.821000	0.48065	0.097000	0.17492	0.513000	0.50165	GTG		0.388	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		30	68	1	0	3.21399e-22	0.021022	4.4939e-22	30	68				
DCAF8L1	139425	broad.mit.edu	37	X	27999395	27999395	+	Silent	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:27999395C>A	ENST00000441525.1	-	1	171	c.57G>T	c.(55-57)ctG>ctT	p.L19L		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	19										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GGCTGCTGAACAGGCTTTCAG	0.562																																							uc004dbx.1		NA																	0				ovary(3)|skin(1)	4						c.(55-57)CTG>CTT		DDB1 and CUL4 associated factor 8-like 1							60.0	49.0	53.0					X																	27999395		2202	4300	6502	SO:0001819	synonymous_variant	139425							g.chrX:27999395C>A		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.57G>T	X.37:g.27999395C>A			Somatic					p.L19L	NM_001017930	NP_001017930	WXS	Illumina HiSeq	Unspecified	A6NGE4	DC8L1_HUMAN			1	172	-			19					B3KXX1	Silent	SNP	ENST00000441525.1	37	c.57G>T	CCDS35222.1																																																																																				0.562	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		11	46	1	0	3.27435e-08	0.020292	3.88983e-08	11	46				
RBM10	8241	broad.mit.edu	37	X	47039816	47039816	+	Splice_Site	SNP	A	A	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:47039816A>T	ENST00000377604.3	+	12	1902		c.e12-1		RBM10_ENST00000345781.6_Splice_Site|RBM10_ENST00000329236.7_Splice_Site|RBM10_ENST00000478410.1_Splice_Site	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10						3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CATCCTCCTCAGGGACATGGC	0.632																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.e12-2		RNA binding motif protein 10 isoform 1							46.0	35.0	39.0					X																	47039816		2203	4300	6503	SO:0001630	splice_region_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47039816A>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1161-1A>T	X.37:g.47039816A>T			Somatic				RBM10_uc004dhg.2_Splice_Site_p.R309_splice|RBM10_uc004dhh.2_Splice_Site_p.R386_splice|RBM10_uc010nhq.2_Splice_Site_p.R310_splice|RBM10_uc004dhi.2_Splice_Site_p.R452_splice	p.R387_splice	NM_005676	NP_005667	WXS	Illumina HiSeq	Unspecified	P98175	RBM10_HUMAN			12	1540	+								C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Splice_Site	SNP	ENST00000377604.3	37	c.1161_splice	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	A	13.99	2.401671	0.42613	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	2.92	2.92	0.33932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7326	0.23390	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM10	46924760	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.585000	0.90802	1.391000	0.46566	0.427000	0.28365	.		0.632	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	Intron	7	37	0	0	0	0.047766	0	7	37				
ZNF81	347344	broad.mit.edu	37	X	47774812	47774812	+	Missense_Mutation	SNP	G	G	C			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:47774812G>C	ENST00000376954.1	+	6	1135	c.767G>C	c.(766-768)aGc>aCc	p.S256T	ZNF81_ENST00000338637.7_Missense_Mutation_p.S256T			P51508	ZNF81_HUMAN	zinc finger protein 81	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				AAAGTCCTCAGCCTCAAACAC	0.403																																							uc010nhy.1		NA																	0					0						c.(766-768)AGC>ACC		zinc finger protein 81							59.0	54.0	56.0					X																	47774812		1938	4116	6054	SO:0001583	missense	347344					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47774812G>C	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.767G>C	X.37:g.47774812G>C	ENSP00000366153:p.Ser256Thr		Somatic					p.S256T	NM_007137	NP_009068	WXS	Illumina HiSeq	Unspecified	P51508	ZNF81_HUMAN			6	1135	+		all_lung(315;0.0973)	256					Q6RX22|Q96QH6	Missense_Mutation	SNP	ENST00000376954.1	37	c.767G>C	CCDS43933.1	.	.	.	.	.	.	.	.	.	.	G	1.183	-0.637641	0.03557	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.15372	2.43;2.43	3.8	0.914	0.19360	.	1.543180	0.03961	N	0.290074	T	0.11836	0.0288	N	0.25201	0.72	0.09310	N	1	B	0.19817	0.039	B	0.17433	0.018	T	0.32561	-0.9902	10	0.18276	T	0.48	.	6.6737	0.23082	0.3827:0.0:0.6173:0.0	.	256	P51508	ZNF81_HUMAN	T	256	ENSP00000366153:S256T;ENSP00000341151:S256T	ENSP00000341151:S256T	S	+	2	0	ZNF81	47659756	0.000000	0.05858	0.006000	0.13384	0.871000	0.50021	-0.384000	0.07389	0.063000	0.16370	0.600000	0.82982	AGC		0.403	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056455.2	NM_007137		19	43	0	0	0	0.021523	0	19	43				
HUWE1	10075	broad.mit.edu	37	X	53578038	53578038	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:53578038C>A	ENST00000342160.3	-	64	9666	c.9209G>T	c.(9208-9210)cGc>cTc	p.R3070L	HUWE1_ENST00000262854.6_Missense_Mutation_p.R3070L			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3070					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GACACTACGGCGCAGGTCTGA	0.572																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(9208-9210)CGC>CTC		HECT, UBA and WWE domain containing 1							108.0	93.0	98.0					X																	53578038		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53578038C>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9209G>T	X.37:g.53578038C>A	ENSP00000340648:p.Arg3070Leu		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.R1878L	p.R3070L	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			65	9611	-			3070					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.9209G>T	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728284	0.69074	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	D;D	0.81996	-1.56;-1.56	5.88	5.88	0.94601	.	0.133747	0.51477	D	0.000092	D	0.92166	0.7516	M	0.85373	2.75	0.80722	D	1	D;D	0.64830	0.994;0.992	D;D	0.76575	0.988;0.979	D	0.93042	0.6458	10	0.87932	D	0	.	17.8502	0.88744	0.0:1.0:0.0:0.0	.	3070;3054	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	L	3070	ENSP00000340648:R3070L;ENSP00000262854:R3070L	ENSP00000262854:R3070L	R	-	2	0	HUWE1	53594763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.106000	0.77039	2.489000	0.83994	0.600000	0.82982	CGC		0.572	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		28	90	1	0	1.56442e-22	0.050027	2.20695e-22	28	90				
HUWE1	10075	broad.mit.edu	37	X	53578301	53578301	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:53578301C>A	ENST00000342160.3	-	63	9479	c.9022G>T	c.(9022-9024)Gtg>Ttg	p.V3008L	HUWE1_ENST00000262854.6_Missense_Mutation_p.V3008L			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3008					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTCCCCACCACTGCAGGCGCT	0.597																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(9022-9024)GTG>TTG		HECT, UBA and WWE domain containing 1							53.0	50.0	51.0					X																	53578301		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53578301C>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9022G>T	X.37:g.53578301C>A	ENSP00000340648:p.Val3008Leu		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.V1832L	p.V3008L	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			64	9424	-			3008					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.9022G>T	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.85|14.85	2.659879|2.659879	0.47572|0.47572	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.36878	.|1.23;1.23	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.49355|0.49355	0.1552|0.1552	L|L	0.34521|0.34521	1.04|1.04	0.58432|0.58432	D|D	0.999998|0.999998	.|P;P	.|0.49185	.|0.92;0.902	.|D;D	.|0.68192	.|0.956;0.927	T|T	0.30149|0.30149	-0.9988|-0.9988	5|10	.|0.27082	.|T	.|0.32	.|.	17.482|17.482	0.87675|0.87675	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|3008;3008	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	I|L	2041|3008	.|ENSP00000340648:V3008L;ENSP00000262854:V3008L	.|ENSP00000262854:V3008L	S|V	-|-	2|1	0|0	HUWE1|HUWE1	53595026|53595026	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	3.986000|3.986000	0.56937|0.56937	2.398000|2.398000	0.81561|0.81561	0.600000|0.600000	0.82982|0.82982	AGT|GTG		0.597	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		9	24	1	0	2.17888e-05	0.006214	2.44158e-05	9	24				
HUWE1	10075	broad.mit.edu	37	X	53611279	53611279	+	Silent	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:53611279G>T	ENST00000342160.3	-	40	5485	c.5028C>A	c.(5026-5028)cgC>cgA	p.R1676R	HUWE1_ENST00000262854.6_Silent_p.R1676R|HUWE1_ENST00000218328.8_Intron			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1676	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCATCACAGGGCGTCGGTTCC	0.433																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(5026-5028)CGC>CGA		HECT, UBA and WWE domain containing 1							109.0	91.0	97.0					X																	53611279		2203	4300	6503	SO:0001819	synonymous_variant	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53611279G>T	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5028C>A	X.37:g.53611279G>T			Somatic				HUWE1_uc004dsn.2_Silent_p.R501R	p.R1676R	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			41	5430	-			1676			WWE.		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	c.5028C>A	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	9.740	1.164542	0.21538	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.47	0.536	0.17138	.	.	.	.	.	T	0.41026	0.1141	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21381	-1.0247	4	.	.	.	.	0.6025	0.00747	0.2932:0.1223:0.3303:0.2542	.	.	.	.	T	710	.	.	P	-	1	0	HUWE1	53628004	0.203000	0.23435	0.951000	0.38953	0.952000	0.60782	-0.527000	0.06200	-0.362000	0.08113	-0.312000	0.09012	CCC		0.433	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		12	29	1	0	7.03913e-09	0.013537	8.55525e-09	12	29				
DRP2	1821	broad.mit.edu	37	X	100509869	100509869	+	Missense_Mutation	SNP	G	G	T			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:100509869G>T	ENST00000395209.3	+	19	2663	c.2136G>T	c.(2134-2136)tgG>tgT	p.W712C	DRP2_ENST00000538510.1_Missense_Mutation_p.W712C|DRP2_ENST00000402866.1_Missense_Mutation_p.W712C|DRP2_ENST00000541709.1_Missense_Mutation_p.W634C	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	712					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						CCCCGATGTGGCCACACGCCG	0.572																																							uc004egz.2		NA																	0				ovary(2)	2						c.(2134-2136)TGG>TGT		dystrophin related protein 2							127.0	102.0	111.0					X																	100509869		2203	4300	6503	SO:0001583	missense	1821				central nervous system development	cytoplasm|cytoskeleton	zinc ion binding	g.chrX:100509869G>T	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2136G>T	X.37:g.100509869G>T	ENSP00000378635:p.Trp712Cys		Somatic				DRP2_uc011mrh.1_Missense_Mutation_p.W634C	p.W712C	NM_001939	NP_001930	WXS	Illumina HiSeq	Unspecified	Q13474	DRP2_HUMAN			19	2505	+			712					A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	c.2136G>T	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	G	8.052	0.766241	0.15983	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	4.82	2.62	0.31277	.	0.148459	0.46758	D	0.000269	T	0.70228	0.3200	N	0.08118	0	0.32707	N	0.51208	B	0.02656	0.0	B	0.01281	0.0	T	0.65100	-0.6250	10	0.56958	D	0.05	-2.2161	4.3773	0.11277	0.3714:0.1719:0.4567:0.0	.	712	Q13474	DRP2_HUMAN	C	712;712;634;712	ENSP00000385038:W712C;ENSP00000378635:W712C;ENSP00000444752:W634C;ENSP00000441051:W712C	ENSP00000378635:W712C	W	+	3	0	DRP2	100396525	0.992000	0.36948	0.998000	0.56505	0.427000	0.31564	0.281000	0.18810	0.423000	0.26033	0.600000	0.82982	TGG		0.572	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939		17	173	1	0	2.37509e-13	0.055883	3.00212e-13	17	173				
CLDN2	9075	broad.mit.edu	37	X	106171474	106171474	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:106171474C>A	ENST00000541806.1	+	2	535	c.16C>A	c.(16-18)Ctc>Atc	p.L6I	CLDN2_ENST00000540876.1_Missense_Mutation_p.L6I|CLDN2_ENST00000336803.1_Missense_Mutation_p.L6I	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	6					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						CTCTCTTGGCCTCCAACTTGT	0.552																																							uc004emq.1		NA																	0				ovary(1)	1						c.(16-18)CTC>ATC		claudin 2							71.0	62.0	65.0					X																	106171474		2203	4300	6503	SO:0001583	missense	9075				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chrX:106171474C>A	AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.16C>A	X.37:g.106171474C>A	ENSP00000441283:p.Leu6Ile		Somatic				MORC4_uc004emp.3_Intron|CLDN2_uc004emt.1_Missense_Mutation_p.L6I	p.L6I	NM_020384	NP_065117	WXS	Illumina HiSeq	Unspecified	P57739	CLD2_HUMAN			2	535	+			6			Cytoplasmic (Potential).		B2R6B9	Missense_Mutation	SNP	ENST00000541806.1	37	c.16C>A	CCDS14524.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834294	0.32421	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.90004	-2.6;-2.6;-2.6	5.61	-0.86	0.10680	.	0.411457	0.27147	N	0.020715	D	0.84197	0.5419	M	0.72576	2.205	0.34996	D	0.755508	B	0.06786	0.001	B	0.17098	0.017	T	0.71623	-0.4537	10	0.51188	T	0.08	.	4.5688	0.12200	0.2245:0.3048:0.3949:0.0758	.	6	P57739	CLD2_HUMAN	I	6	ENSP00000441283:L6I;ENSP00000443230:L6I;ENSP00000336571:L6I	ENSP00000336571:L6I	L	+	1	0	CLDN2	106058130	0.117000	0.22190	0.169000	0.22859	0.985000	0.73830	0.566000	0.23593	-0.744000	0.04778	-0.229000	0.12294	CTC		0.552	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057815.1			29	50	1	0	1.22384e-17	0.054565	1.63869e-17	29	50				
AMMECR1	9949	broad.mit.edu	37	X	109561127	109561127	+	Missense_Mutation	SNP	C	C	A			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chrX:109561127C>A	ENST00000262844.5	-	1	340	c.173G>T	c.(172-174)gGt>gTt	p.G58V	AMMECR1_ENST00000372059.2_Missense_Mutation_p.G58V|AMMECR1_ENST00000372057.1_Intron|AMMECR1_ENST00000496695.1_5'Flank	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	58	Gly/Ser-rich.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						TCCGGTTAGACCTCCCAGCCC	0.736																																							uc004eoo.2		NA																	0					0						c.(172-174)GGT>GTT		AMMECR1 protein isoform 1							11.0	8.0	9.0					X																	109561127		2139	4214	6353	SO:0001583	missense	9949							g.chrX:109561127C>A	AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.173G>T	X.37:g.109561127C>A	ENSP00000262844:p.Gly58Val		Somatic				AMMECR1_uc004eop.2_Missense_Mutation_p.G58V|AMMECR1_uc004eoq.2_Intron	p.G58V	NM_015365	NP_056180	WXS	Illumina HiSeq	Unspecified	Q9Y4X0	AMER1_HUMAN			1	254	-			58			Gly/Ser-rich.		Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	Missense_Mutation	SNP	ENST00000262844.5	37	c.173G>T	CCDS14551.1	.	.	.	.	.	.	.	.	.	.	c	18.16	3.562250	0.65538	.	.	ENSG00000101935	ENST00000262844;ENST00000372059	.	.	.	4.4	3.52	0.40303	.	0.161359	0.53938	D	0.000041	T	0.31979	0.0814	N	0.19112	0.55	0.80722	D	1	D;P	0.53312	0.959;0.878	B;B	0.41813	0.367;0.202	T	0.03212	-1.1060	8	.	.	.	-14.1856	12.8103	0.57635	0.0:0.8378:0.1622:0.0	.	58;58	Q9Y4X0-3;Q9Y4X0	.;AMER1_HUMAN	V	58	.	.	G	-	2	0	AMMECR1	109447783	1.000000	0.71417	0.503000	0.27626	0.954000	0.61252	4.408000	0.59761	0.769000	0.33313	0.271000	0.19318	GGT		0.736	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057907.1			6	14	1	0	0.00621372	0.006214	0.00641678	6	14				
EPHX1	2052	broad.mit.edu	37	1	226026384	226026384	+	Frame_Shift_Del	DEL	C	C	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr1:226026384delC	ENST00000366837.4	+	4	590	c.394delC	c.(394-396)cccfs	p.P133fs	EPHX1_ENST00000272167.5_Frame_Shift_Del_p.P133fs|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	133					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CCACGTGAAGCCCCCCCAGCT	0.627																																							uc001hpk.2		NA																	0				ovary(3)|lung(1)	4						c.(394-396)CCCfs		epoxide hydrolase 1							79.0	90.0	87.0					1																	226026384		2203	4300	6503	SO:0001589	frameshift_variant	2052				aromatic compound catabolic process|response to toxin	endoplasmic reticulum membrane|integral to membrane|microsome	cis-stilbene-oxide hydrolase activity|epoxide hydrolase activity	g.chr1:226026384delC	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.394delC	1.37:g.226026384delC	ENSP00000355802:p.Pro133fs		Somatic				EPHX1_uc001hpl.2_Frame_Shift_Del_p.P132fs	p.P132fs	NM_001136018	NP_001129490	WXS	Illumina HiSeq	Unspecified	P07099	HYEP_HUMAN			4	474	+	Breast(184;0.197)		132					B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Frame_Shift_Del	DEL	ENST00000366837.4	37	c.394delC	CCDS1547.1																																																																																				0.627	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120		7	459	NA	NA	NA	NA	NA	7	459	---	---	---	---
UTP20	27340	broad.mit.edu	37	12	101679641	101679641	+	Frame_Shift_Del	DEL	C	C	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr12:101679641delC	ENST00000261637.4	+	4	482	c.308delC	c.(307-309)gccfs	p.A103fs		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	103					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AACAGTTTTGCCTATCAACCC	0.368																																							uc001tia.1		NA																	0				ovary(2)|breast(2)	4						c.(307-309)GCCfs		down-regulated in metastasis							117.0	117.0	117.0					12																	101679641		2203	4300	6503	SO:0001589	frameshift_variant	27340				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding	g.chr12:101679641delC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.308delC	12.37:g.101679641delC	ENSP00000261637:p.Ala103fs		Somatic				UTP20_uc009ztz.1_Frame_Shift_Del_p.A103fs	p.A103fs	NM_014503	NP_055318	WXS	Illumina HiSeq	Unspecified	O75691	UTP20_HUMAN			4	464	+			103					Q9H3H4	Frame_Shift_Del	DEL	ENST00000261637.4	37	c.308delC	CCDS9081.1																																																																																				0.368	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		50	95	NA	NA	NA	NA	NA	50	95	---	---	---	---
DNAJA4	55466	broad.mit.edu	37	15	78565514	78565514	+	Frame_Shift_Del	DEL	A	A	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr15:78565514delA	ENST00000394852.3	+	3	581	c.391delA	c.(391-393)aaafs	p.K131fs	DNAJA4_ENST00000446172.2_Frame_Shift_Del_p.K104fs|DNAJA4_ENST00000343789.3_Frame_Shift_Del_p.K131fs|DNAJA4_ENST00000394855.3_Frame_Shift_Del_p.K160fs	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	131					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						GGCCCTCCAGAAAAATGTAAT	0.338																																							uc002bdj.1		NA																	0				skin(1)	1						c.(391-393)AAAfs		DnaJ (Hsp40) homolog, subfamily A, member 4							73.0	77.0	75.0					15																	78565514		2196	4293	6489	SO:0001589	frameshift_variant	55466				protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding	g.chr15:78565514delA	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.391delA	15.37:g.78565514delA	ENSP00000378321:p.Lys131fs		Somatic				DNAJA4_uc002bdi.2_Frame_Shift_Del_p.K160fs|DNAJA4_uc002bdk.2_Frame_Shift_Del_p.K104fs|DNAJA4_uc002bdl.2_Frame_Shift_Del_p.K46fs|DNAJA4_uc002bdm.1_5'Flank	p.K131fs	NM_001130182	NP_001123654	WXS	Illumina HiSeq	Unspecified	Q8WW22	DNJA4_HUMAN			3	508	+			131			CR-type.		E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Frame_Shift_Del	DEL	ENST00000394852.3	37	c.391delA	CCDS45316.1																																																																																				0.338	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602		34	91	NA	NA	NA	NA	NA	34	91	---	---	---	---
STAT3	6774	broad.mit.edu	37	17	40481573	40481573	+	Splice_Site	DEL	A	A	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr17:40481573delA	ENST00000264657.5	-	13	1544	c.1232delT	c.(1231-1233)ttg>tg	p.L411fs	STAT3_ENST00000404395.3_Splice_Site_p.L411fs|STAT3_ENST00000588969.1_Splice_Site_p.L411fs|STAT3_ENST00000389272.3_Splice_Site_p.L313fs|STAT3_ENST00000585517.1_Splice_Site_p.L411fs	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	411					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CCCACATACCAAGTGTTTGAA	0.498									Hyperimmunoglobulin E Recurrent Infection Syndrome																														uc002hzl.1		NA																	0				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(1231-1233)TTGfs		signal transducer and activator of transcription							112.0	114.0	113.0					17																	40481573		2203	4300	6503	SO:0001630	splice_region_variant	6774	Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding	g.chr17:40481573delA	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1233+1T>-	17.37:g.40481573delA			Somatic				STAT3_uc002hzk.1_Frame_Shift_Del_p.L411fs|STAT3_uc002hzm.1_Frame_Shift_Del_p.L411fs|STAT3_uc010wgh.1_Frame_Shift_Del_p.L313fs|STAT3_uc002hzn.1_Frame_Shift_Del_p.L411fs	p.L411fs	NM_139276	NP_644805	WXS	Illumina HiSeq	Unspecified	P40763	STAT3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.139)	13	1472	-		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)	411					A8K7B8|K7ENL3|O14916|Q9BW54	Frame_Shift_Del	DEL	ENST00000264657.5	37	c.1232delT	CCDS32656.1																																																																																				0.498	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	Frame_Shift_Del	33	100	NA	NA	NA	NA	NA	33	100	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1207065	1207065	+	Frame_Shift_Del	DEL	G	G	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr19:1207065delG	ENST00000326873.7	+	1	1326	c.153delG	c.(151-153)atgfs	p.M51fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.		Missing (in PJS). {ECO:0000269|PubMed:9837816}.		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.D53fs*11(1)|p.L50_D53del(1)|p.M51fs*14(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTACCTGATGGGGGACCTGC	0.607		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		26	Whole gene deletion(20)|Deletion - Frameshift(2)|Unknown(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	p.0?(19)|p.?(3)|p.D53fs*11(1)|p.L50_D53del(1)|p.M51fs*14(1)	cervix(15)|lung(6)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(151-153)ATGfs		serine/threonine protein kinase 11							38.0	43.0	41.0					19																	1207065		2071	4191	6262	SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1207065delG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.153delG	19.37:g.1207065delG	ENSP00000324856:p.Met51fs	TSP Lung(3;<1E-08)	Somatic					p.M51fs	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	1	1268	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	51			Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	c.153delG	CCDS45896.1																																																																																				0.607	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		33	63	NA	NA	NA	NA	NA	33	63	---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45671573	45671575	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr21:45671573_45671575delCTC	ENST00000418993.1	-	9	1183_1185	c.700_702delGAG	c.(700-702)gagdel	p.E234del	DNMT3L_ENST00000270172.3_In_Frame_Del_p.E234del|AP001059.5_ENST00000442785.1_RNA	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	234					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		AGGGTCCCCACTCCTCCACCTGC	0.65																																							uc002zeg.1		NA																	0				skin(2)	2						c.(700-702)GAGdel		cytosine-5-methyltransferase 3-like protein																																				SO:0001651	inframe_deletion	29947				DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding	g.chr21:45671573_45671575delCTC	AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.700_702delGAG	21.37:g.45671576_45671578delCTC	ENSP00000412862:p.Glu234del		Somatic				DNMT3L_uc002zeh.1_In_Frame_Del_p.E234del	p.E234del	NM_175867	NP_787063	WXS	Illumina HiSeq	Unspecified	Q9UJW3	DNM3L_HUMAN		Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)	9	1184_1186	-			234					E9PB42|Q9BUJ4	In_Frame_Del	DEL	ENST00000418993.1	37	c.700_702delGAG	CCDS46650.1																																																																																				0.650	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195820.1	NM_013369		17	39	NA	NA	NA	NA	NA	17	39	---	---	---	---
CCDC96	257236	broad.mit.edu	37	4	7044507	7044509	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:7044507_7044509delCTC	ENST00000310085.4	-	1	219_221	c.157_159delGAG	c.(157-159)gagdel	p.E53del	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	53	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						AAGCCGCTTGCTCCTCCTCCTCC	0.729																																							uc003gjv.2		NA																	0					0						c.(157-159)GAGdel		coiled-coil domain containing 96				5,52,3685		0,0,5,5,42,1819						1.2	0.0			5	3,138,7455		0,0,3,11,116,3668	no	codingComplex	CCDC96	NM_153376.2		0,0,8,16,158,5487	A1A1,A1A2,A1R,A2A2,A2R,RR		1.8562,1.5232,1.7463				8,190,11140				SO:0001651	inframe_deletion	257236							g.chr4:7044507_7044509delCTC	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.157_159delGAG	4.37:g.7044516_7044518delCTC	ENSP00000309285:p.Glu53del		Somatic				TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	p.E53del	NM_153376	NP_699207	WXS	Illumina HiSeq	Unspecified	Q2M329	CCD96_HUMAN			1	220_222	-			53			Glu-rich.		Q8N2I7	In_Frame_Del	DEL	ENST00000310085.4	37	c.157_159delGAG	CCDS3395.1																																																																																				0.729	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376		3	6	NA	NA	NA	NA	NA	3	6	---	---	---	---
CNGA1	1259	broad.mit.edu	37	4	47939653	47939654	+	Frame_Shift_Ins	INS	-	-	T	rs372314713		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr4:47939653_47939654insT	ENST00000514170.1	-	11	1176_1177	c.857_858insA	c.(856-858)cagfs	p.Q286fs	CNGA1_ENST00000402813.3_Frame_Shift_Ins_p.Q355fs|CNGA1_ENST00000358519.4_Frame_Shift_Ins_p.Q286fs|CNGA1_ENST00000544810.1_Frame_Shift_Ins_p.Q286fs|CNGA1_ENST00000420489.2_Frame_Shift_Ins_p.Q286fs			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	286					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TTTCTGTTCTCTGGAAGAACTC	0.371																																							uc003gxt.3		NA																	0				ovary(2)	2						c.(856-858)CAGfs		cyclic nucleotide gated channel alpha 1 isoform																																				SO:0001589	frameshift_variant	1259				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity	g.chr4:47939653_47939654insT	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.858dupA	4.37:g.47939654_47939654dupT	ENSP00000426862:p.Gln286fs		Somatic				uc003gxr.1_Intron|CNGA1_uc003gxu.2_Frame_Shift_Ins_p.Q355fs	p.Q286fs	NM_000087	NP_000078	WXS	Illumina HiSeq	Unspecified	P29973	CNGA1_HUMAN			11	1123_1124	-			286			Extracellular (Potential).		A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Frame_Shift_Ins	INS	ENST00000514170.1	37	c.857_858insA	CCDS43226.1																																																																																				0.371	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087		15	64	NA	NA	NA	NA	NA	15	64	---	---	---	---
POLR3D	661	broad.mit.edu	37	8	22103087	22103087	+	Frame_Shift_Del	DEL	C	C	-			TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr8:22103087delC	ENST00000397802.4	+	1	340	c.125delC	c.(124-126)tccfs	p.S42fs	MIR320A_ENST00000385302.1_RNA|POLR3D_ENST00000306433.4_Frame_Shift_Del_p.S42fs			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	42					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CGCCTTCCCTCCATCCGTTCC	0.677																																							uc003xbl.2		NA																	0					0						c.(124-126)TCCfs		polymerase (RNA) III (DNA directed) polypeptide							3.0	4.0	3.0					8																	22103087		1763	3799	5562	SO:0001589	frameshift_variant	661				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr8:22103087delC	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.125delC	8.37:g.22103087delC	ENSP00000380904:p.Ser42fs		Somatic				uc011kzd.1_5'Flank|MIR320A_hsa-mir-320a|MI0000542_5'Flank|POLR3D_uc003xbm.2_Frame_Shift_Del_p.S42fs|POLR3D_uc011kze.1_RNA	p.S42fs	NM_001722	NP_001713	WXS	Illumina HiSeq	Unspecified	P05423	RPC4_HUMAN		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)	2	208	+			42					Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Frame_Shift_Del	DEL	ENST00000397802.4	37	c.125delC	CCDS34858.1																																																																																				0.677	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137693829	137693829	+	Frame_Shift_Del	DEL	C	C	-	rs377265020		TCGA-73-7498-01A-12D-2184-08	TCGA-73-7498-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a94e7ba6-d27f-4d30-b797-3ecae4a261a2	afd5aa48-8b00-46ce-a6df-16ad4546f282	g.chr9:137693829delC	ENST00000371817.3	+	38	3396	c.2982delC	c.(2980-2982)ggcfs	p.G994fs		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	994	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.G997fs*17(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GCCCTCCAGGCCCCCCCGGCG	0.657																																							uc004cfe.2		NA																	1	Insertion - Frameshift(1)		large_intestine(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(2980-2982)GGCfs		alpha 1 type V collagen preproprotein							67.0	67.0	67.0					9																	137693829		2203	4299	6502	SO:0001589	frameshift_variant	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137693829delC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2982delC	9.37:g.137693829delC	ENSP00000360882:p.Gly994fs		Somatic					p.G994fs	NM_000093	NP_000084	WXS	Illumina HiSeq	Unspecified	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	38	3364	+		Myeloproliferative disorder(178;0.0341)	994			Triple-helical region.		Q15094|Q5SUX4	Frame_Shift_Del	DEL	ENST00000371817.3	37	c.2982delC	CCDS6982.1																																																																																				0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		7	164	NA	NA	NA	NA	NA	7	164	---	---	---	---
