#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ZMYM6	9204	broad.mit.edu	37	1	35476084	35476084	+	Nonsense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr1:35476084G>A	ENST00000357182.4	-	10	1683	c.1456C>T	c.(1456-1458)Cga>Tga	p.R486*	ZMYM6_ENST00000487874.1_Nonsense_Mutation_p.R486*|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Nonsense_Mutation_p.R486*	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	486					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R486*(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				CCTGAGAATCGCACAGTCTCC	0.373																																							uc001byh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1456-1458)CGA>TGA		zinc finger protein 258							146.0	142.0	144.0					1																	35476084		2203	4300	6503	SO:0001587	stop_gained	9204				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chr1:35476084G>A	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1456C>T	1.37:g.35476084G>A	ENSP00000349708:p.Arg486*		Somatic				ZMYM6_uc001byf.1_Nonsense_Mutation_p.R486*|ZMYM6_uc010oht.1_Nonsense_Mutation_p.R389*|ZMYM6_uc009vup.2_Nonsense_Mutation_p.R292*|ZMYM6_uc009vuq.1_Nonsense_Mutation_p.R486*|ZMYM6_uc009vur.1_Nonsense_Mutation_p.R292*	p.R486*	NM_007167	NP_009098	WXS	Illumina HiSeq	Unspecified	O95789	ZMYM6_HUMAN			10	1684	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)	486					B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Nonsense_Mutation	SNP	ENST00000357182.4	37	c.1456C>T	CCDS387.2	.	.	.	.	.	.	.	.	.	.	G	37	6.501852	0.97620	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	.	.	.	5.03	2.08	0.27032	.	0.065726	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9043	8.3323	0.32193	0.0732:0.0:0.4218:0.505	.	.	.	.	X	486	.	ENSP00000349708:R486X	R	-	1	2	ZMYM6	35248671	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.060000	0.41394	0.373000	0.24621	-0.188000	0.12872	CGA		0.373	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167		7	126	0	0	0	0.038147	0	7	126				
RLF	6018	broad.mit.edu	37	1	40703541	40703541	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr1:40703541C>G	ENST00000372771.4	+	8	3194	c.3167C>G	c.(3166-3168)aCa>aGa	p.T1056R		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1056					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T1056R(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AGGCCCTGTACAGAGGATACC	0.398																																							uc001cfc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(3166-3168)ACA>AGA		rearranged L-myc fusion							78.0	78.0	78.0					1																	40703541		2203	4300	6503	SO:0001583	missense	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40703541C>G		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.3167C>G	1.37:g.40703541C>G	ENSP00000361857:p.Thr1056Arg		Somatic				RLF_uc001cfd.3_Missense_Mutation_p.T747R	p.T1056R	NM_012421	NP_036553	WXS	Illumina HiSeq	Unspecified	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		8	3198	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	1056					Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	c.3167C>G	CCDS448.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989646	0.35131	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.14893	2.47	5.85	5.85	0.93711	.	0.290888	0.37809	N	0.001938	T	0.24005	0.0581	L	0.43152	1.355	0.37417	D	0.91346	D;D	0.60160	0.987;0.969	P;P	0.52217	0.693;0.505	T	0.02004	-1.1231	10	0.49607	T	0.09	-14.1678	12.037	0.53431	0.0:0.9147:0.0:0.0853	.	749;1056	F5H2M5;Q13129	.;RLF_HUMAN	R	1056;749	ENSP00000361857:T1056R	ENSP00000361857:T1056R	T	+	2	0	RLF	40476128	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.826000	0.48104	2.768000	0.95171	0.655000	0.94253	ACA		0.398	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		7	70	0	0	0	0.038147	0	7	70				
TNNT2	7139	broad.mit.edu	37	1	201333427	201333427	+	Splice_Site	SNP	G	G	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr1:201333427G>C	ENST00000509001.1	-	10	744	c.458C>G	c.(457-459)gCt>gGt	p.A153G	TNNT2_ENST00000458432.2_Splice_Site_p.A165G|TNNT2_ENST00000367317.4_Splice_Site_p.A153G|TNNT2_ENST00000421663.2_Splice_Site_p.A155G|TNNT2_ENST00000460780.1_5'Flank|TNNT2_ENST00000367315.2_Splice_Site_p.A153G|TNNT2_ENST00000367320.2_Splice_Site_p.A123G|TNNT2_ENST00000236918.7_Splice_Site_p.A158G|TNNT2_ENST00000367318.5_Splice_Site_p.A153G|TNNT2_ENST00000360372.4_Splice_Site_p.A148G|TNNT2_ENST00000367322.1_Splice_Site_p.A153G	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	163					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)	p.A153G(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						GTCACTCACAGCCAGGCGGTT	0.637																																							uc001gwf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(487-489)GCT>GGT		troponin T type 2, cardiac isoform 1							41.0	37.0	38.0					1																	201333427		2203	4300	6503	SO:0001630	splice_region_variant	7139				ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding	g.chr1:201333427G>C	X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.459+1C>G	1.37:g.201333427G>C			Somatic				TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_5'Flank|TNNT2_uc001gwg.2_Missense_Mutation_p.A153G|TNNT2_uc001gwh.2_Missense_Mutation_p.A148G|TNNT2_uc001gwi.2_Missense_Mutation_p.A123G|TNNT2_uc009wzr.2_Missense_Mutation_p.A94G|TNNT2_uc001gwj.1_5'Flank|TNNT2_uc009wzs.1_Missense_Mutation_p.A128G|TNNT2_uc001gwk.1_Missense_Mutation_p.A94G|TNNT2_uc009wzt.1_Missense_Mutation_p.A153G	p.A163G	NM_000364	NP_000355	WXS	Illumina HiSeq	Unspecified	P45379	TNNT2_HUMAN			11	557	-			163					A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Missense_Mutation	SNP	ENST00000509001.1	37	c.488C>G	CCDS30969.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602154	0.87055	.	.	ENSG00000118194	ENST00000367322;ENST00000367318;ENST00000458432;ENST00000421663;ENST00000236918;ENST00000367317;ENST00000367315;ENST00000360372;ENST00000357848;ENST00000367319;ENST00000367320;ENST00000509001;ENST00000438742;ENST00000455702	D;D;D;D;D;D;D;D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09	4.28	4.28	0.50868	.	0.121499	0.56097	D	0.000033	D	0.96194	0.8759	M	0.88377	2.95	0.54753	D	0.999981	D;D;D;D;D;D	0.56287	0.975;0.968;0.968;0.974;0.974;0.968	P;P;P;D;D;P	0.65140	0.836;0.889;0.889;0.932;0.91;0.889	D	0.97130	0.9817	10	0.87932	D	0	-12.1791	15.2601	0.73615	0.0:0.0:1.0:0.0	.	148;165;162;163;153;163	E7EPW4;F8WAF6;P45379-3;P45379;Q9BUF6;P45379-10	.;.;.;TNNT2_HUMAN;.;.	G	153;153;165;155;158;153;153;148;149;94;123;153;148;163	ENSP00000356291:A153G;ENSP00000356287:A153G;ENSP00000387874:A165G;ENSP00000404134:A155G;ENSP00000236918:A158G;ENSP00000356286:A153G;ENSP00000356284:A153G;ENSP00000353535:A148G;ENSP00000356289:A123G;ENSP00000422031:A153G;ENSP00000414036:A148G;ENSP00000402238:A163G	ENSP00000236918:A158G	A	-	2	0	TNNT2	199600050	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.830000	0.75319	1.926000	0.55796	0.491000	0.48974	GCT		0.637	TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360358.1	NM_000364	Missense_Mutation	2	7	0	0	0	0.004672	0	2	7				
ZNF678	339500	broad.mit.edu	37	1	227843479	227843479	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr1:227843479A>C	ENST00000343776.5	+	4	1873	c.1528A>C	c.(1528-1530)Att>Ctt	p.I510L	ZNF678_ENST00000397097.3_Missense_Mutation_p.I565L|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	510					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I565L(1)|p.I510L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				GTATAAGAGAATTTATACTGG	0.323																																							uc001hqw.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1528-1530)ATT>CTT		zinc finger protein 678							43.0	47.0	46.0					1																	227843479		2201	4295	6496	SO:0001583	missense	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227843479A>C	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1528A>C	1.37:g.227843479A>C	ENSP00000344828:p.Ile510Leu		Somatic				ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	p.I510L	NM_178549	NP_848644	WXS	Illumina HiSeq	Unspecified	F5GXA7	F5GXA7_HUMAN			4	1873	+		Prostate(94;0.0885)	565					Q8IVQ9	Missense_Mutation	SNP	ENST00000343776.5	37	c.1528A>C		.	.	.	.	.	.	.	.	.	.	A	9.721	1.159658	0.21454	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.05258	3.47;3.55	1.08	1.08	0.20341	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08582	0.0213	L	0.58510	1.815	0.19300	N	0.999978	P	0.35700	0.516	B	0.39068	0.289	T	0.25047	-1.0143	9	0.62326	D	0.03	.	6.2121	0.20636	1.0:0.0:0.0:0.0	.	510	Q5SXM1	ZN678_HUMAN	L	510;565	ENSP00000344828:I510L;ENSP00000440403:I565L	ENSP00000344828:I510L	I	+	1	0	ZNF678	225910102	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	1.359000	0.34113	0.338000	0.23692	0.329000	0.21502	ATT		0.323	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		6	41	0	0	0	0.038147	0	6	41				
ZNF33A	7581	broad.mit.edu	37	10	38345409	38345409	+	Missense_Mutation	SNP	A	A	G	rs71491230	byFrequency	TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr10:38345409A>G	ENST00000458705.2	+	5	2512	c.2354A>G	c.(2353-2355)cAg>cGg	p.Q785R	ZNF33A_ENST00000374618.3_Missense_Mutation_p.Q786R|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Missense_Mutation_p.Q792R|ZNF33A_ENST00000307441.9_Missense_Mutation_p.Q785R			Q06730	ZN33A_HUMAN	zinc finger protein 33A	785					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q785R(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						AGAAATTTCCAGCCACAAGTC	0.383													A|||	3	0.000599042	0.0	0.0	5008	,	,		18653	0.0		0.003	False		,,,				2504	0.0						uc001izh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2353-2355)CAG>CGG		zinc finger protein 33A isoform b		A	ARG/GLN,ARG/GLN	2,4404	4.2+/-10.8	0,2,2201	61.0	61.0	61.0		2357,2354	0.6	0.0	10	dbSNP_130	61	25,8575	17.3+/-56.4	0,25,4275	yes	missense,missense	ZNF33A	NM_006954.1,NM_006974.2	43,43	0,27,6476	GG,GA,AA		0.2907,0.0454,0.2076	benign,benign	786/812,785/811	38345409	27,12979	2203	4300	6503	SO:0001583	missense	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38345409A>G	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.2354A>G	10.37:g.38345409A>G	ENSP00000387713:p.Gln785Arg		Somatic				ZNF33A_uc001izg.2_Missense_Mutation_p.Q786R|ZNF33A_uc010qev.1_Missense_Mutation_p.Q792R|ZNF33A_uc001izi.1_Intron	p.Q785R	NM_006974	NP_008905	WXS	Illumina HiSeq	Unspecified	Q06730	ZN33A_HUMAN			5	2532	+			785					A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	c.2354A>G	CCDS31182.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	A	7.459	0.644218	0.14451	4.54E-4	0.002907	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.07327	3.2;3.46;3.2;3.2	1.92	0.561	0.17285	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B;B;B	0.15141	0.012;0.007;0.012	B;B;B	0.09377	0.004;0.002;0.004	T	0.40961	-0.9535	9	0.87932	D	0	.	2.6079	0.04883	0.4659:0.2692:0.0:0.2649	.	792;785;786	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	R	786;792;785;785	ENSP00000363747:Q786R;ENSP00000402467:Q792R;ENSP00000387713:Q785R;ENSP00000304268:Q785R	ENSP00000304268:Q785R	Q	+	2	0	ZNF33A	38385415	0.000000	0.05858	0.007000	0.13788	0.142000	0.21351	-0.152000	0.10159	-0.018000	0.14079	0.260000	0.18958	CAG		0.383	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		4	75	0	0	0	0.009096	0	4	75				
SFTPA2	729238	broad.mit.edu	37	10	81319085	81319085	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr10:81319085C>T	ENST00000372325.2	-	3	239	c.155G>A	c.(154-156)gGa>gAa	p.G52E	SFTPA2_ENST00000372327.5_Missense_Mutation_p.G52E	NM_001098668.2	NP_001092138.1	Q8IWL1	SFPA2_HUMAN	surfactant protein A2	52	Collagen-like.				respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)	p.G52E(1)		endometrium(1)|kidney(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GCCAGGGTCTCCTTTGACACC	0.632									Pulmonary Fibrosis, Idiopathic																														uc001kal.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(154-156)GGA>GAA		RecName: Full=Pulmonary surfactant-associated protein A2;          Short=SP-A2;          Short=SP-A;          Short=PSP-A;          Short=PSPA; AltName: Full=Alveolar proteinosis protein; AltName: Full=35 kDa pulmonary surfactant-associated protein; Flags: Precursor;							134.0	126.0	129.0					10																	81319085		2203	4295	6498	SO:0001583	missense	729238	Pulmonary_Fibrosis_Idiopathic	Familial Cancer Database	Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia	cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	sugar binding	g.chr10:81319085C>T		CCDS41540.1	10q22.3	2012-11-02	2008-08-26			ENSG00000185303		"""Collectins"""	10799	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A2A"""	178642	"""surfactant, pulmonary-associated protein A2"""				Standard	NM_001098668		Approved	SP-A2, COLEC5	uc001kal.4	Q8IWL1		ENST00000372325.2:c.155G>A	10.37:g.81319085C>T	ENSP00000361400:p.Gly52Glu		Somatic				SFTPA2_uc001kan.3_Missense_Mutation_p.G52E|SFTPA2_uc001kam.2_RNA	p.G52E	NM_006926	NP_008857	WXS	Illumina HiSeq	Unspecified	Q8IWL1	SFPA2_HUMAN	Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)		3	252	-	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		52			Collagen-like.		A4QPA7|B2RXI6|B2RXK9|C9J9I7|E3VLC6|E3VLC7|E3VLC8|E3VLC9|P07714|Q14DV3|Q5RIR8|Q5RIR9	Missense_Mutation	SNP	ENST00000372325.2	37	c.155G>A	CCDS41540.1	.	.	.	.	.	.	.	.	.	.	N	17.04	3.288445	0.59976	.	.	ENSG00000185303	ENST00000372325;ENST00000372327;ENST00000417041	D;D;D	0.99353	-5.77;-5.77;-5.77	2.91	2.91	0.33838	.	0.000000	0.53938	D	0.000055	D	0.99609	0.9858	H	0.98525	4.255	0.36919	D	0.891291	D	0.89917	1.0	D	0.97110	1.0	D	0.97943	1.0327	10	0.87932	D	0	-5.2183	11.5617	0.50780	0.0:1.0:0.0:0.0	.	52	E3VLC8	.	E	52	ENSP00000361400:G52E;ENSP00000361402:G52E;ENSP00000397375:G52E	ENSP00000361400:G52E	G	-	2	0	SFTPA2	80989091	1.000000	0.71417	0.966000	0.40874	0.915000	0.54546	3.052000	0.49893	1.334000	0.45468	0.430000	0.28490	GGA		0.632	SFTPA2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048961.1	NM_001098668		5	77	0	0	0	0.021553	0	5	77				
PSTK	118672	broad.mit.edu	37	10	124742438	124742438	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr10:124742438C>G	ENST00000368887.3	+	2	846	c.406C>G	c.(406-408)Ctc>Gtc	p.L136V	PSTK_ENST00000405485.1_Missense_Mutation_p.L136V|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	136					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)	p.L136V(1)		endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		GTCTTGCTACCTCTTAACAAA	0.403																																							uc001lgy.1		NA																	1	Substitution - Missense(1)		lung(1)	liver(1)	1						c.(406-408)CTC>GTC		phosphoseryl-tRNA kinase							134.0	132.0	133.0					10																	124742438		2203	4300	6503	SO:0001583	missense	118672						ATP binding|kinase activity	g.chr10:124742438C>G	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.406C>G	10.37:g.124742438C>G	ENSP00000357882:p.Leu136Val		Somatic					p.L136V	NM_153336	NP_699167	WXS	Illumina HiSeq	Unspecified	Q8IV42	PSTK_HUMAN		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)	2	846	+		all_neural(114;0.169)|Glioma(114;0.222)	136					Q6ZSS9	Missense_Mutation	SNP	ENST00000368887.3	37	c.406C>G	CCDS7633.1	.	.	.	.	.	.	.	.	.	.	C	3.811	-0.039708	0.07497	.	.	ENSG00000179988	ENST00000368887;ENST00000405485	T;T	0.48836	0.87;0.8	5.08	3.03	0.35002	.	1.023250	0.07763	N	0.950443	T	0.41673	0.1169	M	0.68317	2.08	0.09310	N	1	B	0.21688	0.059	B	0.16722	0.016	T	0.36040	-0.9764	10	0.16896	T	0.51	-5.5203	4.2541	0.10708	0.0:0.6103:0.2345:0.1552	.	136	Q8IV42	PSTK_HUMAN	V	136	ENSP00000357882:L136V;ENSP00000384764:L136V	ENSP00000357882:L136V	L	+	1	0	PSTK	124732428	0.000000	0.05858	0.061000	0.19648	0.949000	0.60115	0.553000	0.23391	1.318000	0.45170	0.655000	0.94253	CTC		0.403	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	NM_153336		13	123	0	0	0	0.028581	0	13	123				
OR51B5	282763	broad.mit.edu	37	11	5363849	5363849	+	Silent	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr11:5363849A>G	ENST00000300773.2	-	1	960	c.906T>C	c.(904-906)ctT>ctC	p.L302L	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	302					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L302L(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAAAAAGGTGAAGAATGGCAT	0.378																																							uc001map.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(904-906)CTT>CTC		olfactory receptor, family 51, subfamily B,							96.0	98.0	97.0					11																	5363849		2201	4297	6498	SO:0001819	synonymous_variant	282763				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5363849A>G	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.906T>C	11.37:g.5363849A>G			Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	p.L302L	NM_001005567	NP_001005567	WXS	Illumina HiSeq	Unspecified	Q9H339	O51B5_HUMAN		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	906	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	302			Cytoplasmic (Potential).		B2RN59	Silent	SNP	ENST00000300773.2	37	c.906T>C	CCDS31378.1																																																																																				0.378	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		8	75	0	0	0	0.038147	0	8	75				
ATG13	9776	broad.mit.edu	37	11	46686502	46686502	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr11:46686502C>T	ENST00000434074.1	+	11	1582	c.893C>T	c.(892-894)cCt>cTt	p.P298L	ATG13_ENST00000312040.4_Missense_Mutation_p.P298L|ATG13_ENST00000529655.1_Intron|ATG13_ENST00000530500.1_Intron|ATG13_ENST00000526508.1_Missense_Mutation_p.P298L|ATG13_ENST00000528494.1_Missense_Mutation_p.P331L|ATG13_ENST00000524625.1_Intron|ATG13_ENST00000359513.4_Missense_Mutation_p.P298L|ATG13_ENST00000451945.1_Intron	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	298					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)	p.P331L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						GCTACACACCCTCACCAGGTA	0.542																																							uc009yld.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(892-894)CCT>CTT		autophagy-related protein 13 isoform 1							141.0	125.0	130.0					11																	46686502		1566	3581	5147	SO:0001583	missense	9776				autophagic vacuole assembly	cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding	g.chr11:46686502C>T	AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.893C>T	11.37:g.46686502C>T	ENSP00000400642:p.Pro298Leu		Somatic				KIAA0652_uc001nda.2_Missense_Mutation_p.P331L|KIAA0652_uc001ndb.2_Missense_Mutation_p.P298L|KIAA0652_uc001ncz.2_Intron|KIAA0652_uc001ndc.2_Intron|KIAA0652_uc010rgv.1_Intron	p.P298L	NM_001142673	NP_001136145	WXS	Illumina HiSeq	Unspecified	O75143	ATG13_HUMAN		GBM - Glioblastoma multiforme(35;0.226)	12	1577	+			298					B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Missense_Mutation	SNP	ENST00000434074.1	37	c.893C>T	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372998	0.61624	.	.	ENSG00000175224	ENST00000434074;ENST00000312040;ENST00000526508;ENST00000359513;ENST00000528494	.	.	.	5.57	4.66	0.58398	.	0.214143	0.49916	N	0.000137	T	0.57666	0.2069	L	0.53249	1.67	0.80722	D	1	B;B	0.25904	0.137;0.0	B;B	0.30855	0.121;0.001	T	0.52668	-0.8545	9	0.15066	T	0.55	-8.9003	14.7173	0.69280	0.0:0.9305:0.0:0.0695	.	298;331	O75143;E9PQZ8	ATG13_HUMAN;.	L	298;298;298;298;331	.	ENSP00000310321:P298L	P	+	2	0	ATG13	46643078	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.405000	0.59741	1.361000	0.45981	-0.222000	0.12452	CCT		0.542	ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741		8	153	0	0	0	0.038147	0	8	153				
ZBTB3	79842	broad.mit.edu	37	11	62519814	62519814	+	Silent	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr11:62519814G>A	ENST00000394807.3	-	2	1598	c.1473C>T	c.(1471-1473)gcC>gcT	p.A491A		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A491A(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						TGTGCACCGTGGCATGTCGCC	0.567																																							uc001nuz.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(1471-1473)GCC>GCT		zinc finger and BTB domain containing 3							87.0	77.0	80.0					11																	62519814		2202	4299	6501	SO:0001819	synonymous_variant	79842				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:62519814G>A	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1473C>T	11.37:g.62519814G>A			Somatic					p.A491A	NM_024784	NP_079060	WXS	Illumina HiSeq	Unspecified	Q9H5J0	ZBTB3_HUMAN			2	1595	-			491			C2H2-type 1.			Silent	SNP	ENST00000394807.3	37	c.1473C>T	CCDS8034.1																																																																																				0.567	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395342.1	NM_024784		4	34	0	0	0	0.014758	0	4	34				
DDX12P	440081	broad.mit.edu	37	12	9573223	9573223	+	IGR	SNP	C	C	A	rs4763936	byFrequency	TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr12:9573223C>A								RP13-735L24.1 (23010 upstream) : SNORA75 (24430 downstream)																							AGAAACCACACCGCACAGGTT	0.612																																							uc010sgs.1		NA																	0					0						c.(2089-2091)GGT>GTT		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12							125.0	129.0	128.0					12																	9573223		692	1591	2283	SO:0001628	intergenic_variant	440081							g.chr12:9573223C>A																													12.37:g.9573223C>A			Somatic				DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	p.G697V	NM_004400	NP_004391	WXS	Illumina HiSeq	Unspecified					21	2285	-									Missense_Mutation	SNP		37	c.2090G>T																																																																																				0	0.612									6	22	1	0	0.00198382	0.02938	0.00212969	6	22				
DENND5B	160518	broad.mit.edu	37	12	31566417	31566417	+	Silent	SNP	G	G	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr12:31566417G>T	ENST00000389082.5	-	13	2898	c.2634C>A	c.(2632-2634)ctC>ctA	p.L878L	DENND5B_ENST00000306833.6_Silent_p.L913L|DENND5B_ENST00000536562.1_Silent_p.L913L	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	878	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L878L(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GCTGGGACAAGAGCTTCTTTT	0.403																																							uc001rki.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2632-2634)CTC>CTA		DENN/MADD domain containing 5B							146.0	137.0	140.0					12																	31566417		1900	4130	6030	SO:0001819	synonymous_variant	160518					integral to membrane		g.chr12:31566417G>T	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2634C>A	12.37:g.31566417G>T			Somatic				DENND5B_uc001rkh.1_Silent_p.L913L|DENND5B_uc009zjq.1_Intron	p.L878L	NM_144973	NP_659410	WXS	Illumina HiSeq	Unspecified	Q6ZUT9	DEN5B_HUMAN			13	2820	-			878			RUN 1.		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	ENST00000389082.5	37	c.2634C>A	CCDS44857.1																																																																																				0.403	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973		6	67	1	0	0.00198382	0.02938	0.00212969	6	67				
OR6C68	403284	broad.mit.edu	37	12	55886450	55886450	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr12:55886450A>G	ENST00000548615.1	+	1	289	c.289A>G	c.(289-291)Att>Gtt	p.I97V	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|OR6C68_ENST00000379662.1_Missense_Mutation_p.I102V|RP11-110A12.2_ENST00000554049.1_RNA	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I102V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						TGCATGTGTCATTCAGCTATT	0.358																																							uc010spo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(304-306)ATT>GTT		olfactory receptor, family 6, subfamily C,							165.0	157.0	160.0					12																	55886450		2203	4300	6503	SO:0001583	missense	403284				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55886450A>G		CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.289A>G	12.37:g.55886450A>G	ENSP00000448811:p.Ile97Val		Somatic					p.I102V	NM_001005519	NP_001005519	WXS	Illumina HiSeq	Unspecified	A6NDL8	O6C68_HUMAN			1	304	+			97			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000548615.1	37	c.304A>G	CCDS31826.2	.	.	.	.	.	.	.	.	.	.	A	9.347	1.064597	0.20067	.	.	ENSG00000205327	ENST00000379662;ENST00000548615	T;T	0.02974	4.09;4.09	4.77	-0.922	0.10468	GPCR, rhodopsin-like superfamily (1);	1.617030	0.03658	N	0.242111	T	0.02083	0.0065	N	0.10972	0.075	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.46414	-0.9193	10	0.52906	T	0.07	.	4.8797	0.13674	0.5464:0.0:0.3022:0.1515	.	97	A6NDL8	O6C68_HUMAN	V	102;97	ENSP00000368983:I102V;ENSP00000448811:I97V	ENSP00000368983:I102V	I	+	1	0	OR6C68	54172717	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.870000	0.00721	-0.230000	0.09840	0.491000	0.48974	ATT		0.358	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406677.1			7	146	0	0	0	0.038147	0	7	146				
RBMS2	5939	broad.mit.edu	37	12	56975221	56975221	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr12:56975221G>A	ENST00000262031.5	+	7	756	c.661G>A	c.(661-663)Ggg>Agg	p.G221R	RBMS2_ENST00000552247.2_Missense_Mutation_p.G221R|RBMS2_ENST00000550726.1_Missense_Mutation_p.G96R|RBMS2_ENST00000542360.1_Missense_Mutation_p.G76R	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2	221					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G221R(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						TGCTGATGGCGGGCCAAAGAA	0.537																																							uc001sln.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(661-663)GGG>AGG		RNA binding motif, single stranded interacting							50.0	49.0	49.0					12																	56975221		2203	4300	6503	SO:0001583	missense	5939				RNA processing	nucleus	nucleotide binding|RNA binding	g.chr12:56975221G>A	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.661G>A	12.37:g.56975221G>A	ENSP00000262031:p.Gly221Arg		Somatic				RBMS2_uc010sqp.1_Missense_Mutation_p.G76R|RBMS2_uc010sqq.1_Missense_Mutation_p.G96R|RBMS2_uc009zou.2_5'UTR	p.G221R	NM_002898	NP_002889	WXS	Illumina HiSeq	Unspecified	Q15434	RBMS2_HUMAN			7	860	+			221						Missense_Mutation	SNP	ENST00000262031.5	37	c.661G>A	CCDS8923.1	.	.	.	.	.	.	.	.	.	.	G	33	5.197196	0.94960	.	.	ENSG00000076067	ENST00000262031;ENST00000552247;ENST00000550726;ENST00000542360	T;T;T	0.72942	2.65;-0.7;-0.7	5.21	5.21	0.72293	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.85071	0.5613	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.97110	1.0;0.905	D	0.86342	0.1705	10	0.59425	D	0.04	.	17.9318	0.88999	0.0:0.0:1.0:0.0	.	76;221	F5H5C8;Q15434	.;RBMS2_HUMAN	R	221;221;96;76	ENSP00000262031:G221R;ENSP00000447426:G221R;ENSP00000449678:G96R	ENSP00000262031:G221R	G	+	1	0	RBMS2	55261488	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.150000	0.94667	2.605000	0.88082	0.655000	0.94253	GGG		0.537	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	NM_002898		3	32	0	0	0	0.004672	0	3	32				
NTN4	59277	broad.mit.edu	37	12	96059736	96059736	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr12:96059736A>G	ENST00000343702.4	-	9	2048	c.1600T>C	c.(1600-1602)Tca>Cca	p.S534P	NTN4_ENST00000553059.1_Missense_Mutation_p.S511P|NTN4_ENST00000538383.1_Missense_Mutation_p.S497P|NTN4_ENST00000344911.4_Missense_Mutation_p.S497P|PGAM1P5_ENST00000552554.1_RNA	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	534	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)		p.S534P(1)		NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TCATGAGCTGATAAAATCTTT	0.303																																							uc001tei.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1600-1602)TCA>CCA		netrin 4 precursor							72.0	69.0	70.0					12																	96059736		2203	4300	6503	SO:0001583	missense	59277				axon guidance	basement membrane|plasma membrane		g.chr12:96059736A>G	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1600T>C	12.37:g.96059736A>G	ENSP00000340998:p.Ser534Pro		Somatic				NTN4_uc009ztf.2_Missense_Mutation_p.S511P|NTN4_uc009ztg.2_Missense_Mutation_p.S497P	p.S534P	NM_021229	NP_067052	WXS	Illumina HiSeq	Unspecified	Q9HB63	NET4_HUMAN			9	2049	-			534			NTR.		B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Missense_Mutation	SNP	ENST00000343702.4	37	c.1600T>C	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982247	0.74474	.	.	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.91	4.74	0.60224	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.274126	0.37348	N	0.002133	T	0.55768	0.1941	M	0.71036	2.16	0.46678	D	0.999153	P;P	0.51147	0.942;0.917	P;D	0.64144	0.872;0.922	T	0.55503	-0.8131	10	0.48119	T	0.1	.	12.2835	0.54779	0.8728:0.0:0.0:0.1272	.	511;534	Q9HB63-2;Q9HB63	.;NET4_HUMAN	P	534;497;497;511	ENSP00000340998:S534P;ENSP00000339436:S497P;ENSP00000444432:S497P;ENSP00000447292:S511P	ENSP00000340998:S534P	S	-	1	0	NTN4	94583867	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.412000	0.66392	1.006000	0.39211	0.533000	0.62120	TCA		0.303	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229		6	60	0	0	0	0.02938	0	6	60				
TEX26	122046	broad.mit.edu	37	13	31540436	31540436	+	Nonsense_Mutation	SNP	C	C	T	rs193234818	byFrequency	TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr13:31540436C>T	ENST00000380473.3	+	5	560	c.547C>T	c.(547-549)Cga>Tga	p.R183*	TEX26_ENST00000530916.1_Intron	NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	183								p.R183*(2)									CACTGAATTCCGAAGGAATTA	0.423													C|||	3	0.000599042	0.0	0.0014	5008	,	,		17160	0.0		0.0	False		,,,				2504	0.002						uc001uti.2		NA																	2	Substitution - Nonsense(2)	p.R183*(1)	ovary(1)|lung(1)	ovary(2)|skin(1)	3						c.(547-549)CGA>TGA		hypothetical protein LOC122046							80.0	77.0	78.0					13																	31540436		2203	4300	6503	SO:0001587	stop_gained	122046							g.chr13:31540436C>T	BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.547C>T	13.37:g.31540436C>T	ENSP00000369840:p.Arg183*		Somatic					p.R183*	NM_152325	NP_689538	WXS	Illumina HiSeq	Unspecified	Q8N6G2	CM026_HUMAN		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)	5	566	+		Lung SC(185;0.0281)	183						Nonsense_Mutation	SNP	ENST00000380473.3	37	c.547C>T	CCDS9339.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	25.2	4.615390	0.87359	.	.	ENSG00000175664	ENST00000380473	.	.	.	5.41	3.58	0.41010	.	0.100459	0.42821	D	0.000658	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9032	7.5701	0.27902	0.1625:0.7485:0.0:0.089	.	.	.	.	X	183	.	ENSP00000369840:R183X	R	+	1	2	C13orf26	30438436	1.000000	0.71417	0.988000	0.46212	0.709000	0.40893	1.359000	0.34113	1.410000	0.46936	0.650000	0.86243	CGA		0.423	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325		7	54	0	0	0	0.02938	0	7	54				
SYNDIG1L	646658	broad.mit.edu	37	14	74876105	74876105	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr14:74876105C>G	ENST00000554823.1	-	1	404	c.343G>C	c.(343-345)Gtc>Ctc	p.V115L	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.V115L			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	115					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.V115L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						TGGATGGTGACATTCTCTGCA	0.597																																							uc001xpx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(343-345)GTC>CTC		transmembrane protein 90A							83.0	87.0	86.0					14																	74876105		2040	4203	6243	SO:0001583	missense	646658				response to biotic stimulus	Golgi apparatus|integral to membrane		g.chr14:74876105C>G		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.343G>C	14.37:g.74876105C>G	ENSP00000450439:p.Val115Leu		Somatic					p.V115L	NM_001105579	NP_001099049	WXS	Illumina HiSeq	Unspecified	A6NDD5	SYN1L_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00159)	2	591	-			115						Missense_Mutation	SNP	ENST00000554823.1	37	c.343G>C	CCDS41970.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348602	0.24426	.	.	ENSG00000183379	ENST00000331628;ENST00000554823	D;D	0.95272	-3.66;-3.66	4.63	1.85	0.25348	.	0.638978	0.14945	N	0.289268	D	0.89382	0.6699	L	0.39898	1.24	0.32959	D	0.520798	B	0.19073	0.033	B	0.20577	0.03	D	0.83676	0.0169	10	0.33141	T	0.24	-9.7004	6.5577	0.22469	0.0:0.5505:0.0:0.4495	.	115	A6NDD5	SYN1L_HUMAN	L	115	ENSP00000331474:V115L;ENSP00000450439:V115L	ENSP00000331474:V115L	V	-	1	0	SYNDIG1L	73945858	0.790000	0.28787	0.649000	0.29536	0.641000	0.38312	1.113000	0.31184	0.213000	0.20722	-0.363000	0.07495	GTC		0.597	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412341.1	XM_938515		16	114	0	0	0	0.024245	0	16	114				
CASC5	57082	broad.mit.edu	37	15	40913729	40913729	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr15:40913729C>G	ENST00000346991.5	+	11	1735	c.1345C>G	c.(1345-1347)Caa>Gaa	p.Q449E	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Missense_Mutation_p.Q423E			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	449	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Q449E(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TCCATCTATTCAAGGTTGTAA	0.363																																							uc010bbs.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|central_nervous_system(1)|skin(1)	5						c.(1345-1347)CAA>GAA		cancer susceptibility candidate 5 isoform 1							104.0	102.0	103.0					15																	40913729		1807	4073	5880	SO:0001583	missense	57082				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding	g.chr15:40913729C>G	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1345C>G	15.37:g.40913729C>G	ENSP00000335463:p.Gln449Glu		Somatic				CASC5_uc010ucq.1_Missense_Mutation_p.Q273E|CASC5_uc001zme.2_Missense_Mutation_p.Q423E|CASC5_uc010bbt.1_Missense_Mutation_p.Q423E	p.Q449E	NM_170589	NP_733468	WXS	Illumina HiSeq	Unspecified	Q8NG31	CASC5_HUMAN		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)	11	1506	+		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	449			Interaction with BUB1 and BUB1B.		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	c.1345C>G	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.977931	0.00452	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.05513	3.43;3.44	5.7	2.66	0.31614	.	0.495500	0.18817	N	0.130353	T	0.06872	0.0175	L	0.52364	1.645	0.09310	N	1	B;B;B	0.24721	0.11;0.023;0.11	B;B;B	0.21151	0.018;0.018;0.033	T	0.34825	-0.9813	10	0.22109	T	0.4	.	10.8272	0.46640	0.2419:0.5241:0.234:0.0	.	423;449;423	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	E	449;423;423	ENSP00000335463:Q449E;ENSP00000382576:Q423E	ENSP00000260369:Q423E	Q	+	1	0	CASC5	38701021	0.004000	0.15560	0.129000	0.21949	0.250000	0.25880	0.673000	0.25203	0.279000	0.22186	0.460000	0.39030	CAA		0.363	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508		10	153	0	0	0	0.069234	0	10	153				
CD2BP2	10421	broad.mit.edu	37	16	30365563	30365563	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr16:30365563C>A	ENST00000305596.3	-	3	334	c.159G>T	c.(157-159)gaG>gaT	p.E53D	RP11-347C12.10_ENST00000563252.1_lincRNA|CD2BP2_ENST00000569466.1_Missense_Mutation_p.E53D	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	53					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)	p.E53D(2)		breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CATCATCATCCTCCTCCTCAT	0.517																																							uc002dxr.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)	1						c.(157-159)GAG>GAT		CD2 antigen (cytoplasmic tail) binding protein							233.0	224.0	227.0					16																	30365563		2197	4300	6497	SO:0001583	missense	10421				assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding	g.chr16:30365563C>A	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.159G>T	16.37:g.30365563C>A	ENSP00000304903:p.Glu53Asp		Somatic				CD2BP2_uc002dxs.2_Missense_Mutation_p.E53D	p.E53D	NM_006110	NP_006101	WXS	Illumina HiSeq	Unspecified	O95400	CD2B2_HUMAN			2	412	-			53					B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	37	c.159G>T	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	A	0.034	-1.315750	0.01331	.	.	ENSG00000169217	ENST00000305596	T	0.26660	1.72	0.0465	0.0465	0.14256	.	0.149066	0.64402	N	0.000019	T	0.11067	0.0270	N	0.00869	-1.13	0.19300	N	0.99997	D	0.89917	1.0	D	0.80764	0.994	T	0.40572	-0.9556	9	0.02654	T	1	.	.	.	.	.	53	O95400	CD2B2_HUMAN	D	53	ENSP00000304903:E53D	ENSP00000304903:E53D	E	-	3	2	CD2BP2	30273064	0.876000	0.30132	0.875000	0.34327	0.570000	0.35934	-2.388000	0.01059	-1.589000	0.01625	-1.596000	0.00833	GAG		0.517	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110		41	205	1	0	6.2361e-21	0.09836	7.34251e-21	41	205				
NGFR	4804	broad.mit.edu	37	17	47587854	47587854	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr17:47587854G>T	ENST00000172229.3	+	4	774	c.649G>T	c.(649-651)Gca>Tca	p.A217S	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.A123S	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	217	Ser/Thr-rich.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.A217S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GGAGCCTGAGGCACCTCCAGA	0.642																																							uc002ioz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(649-651)GCA>TCA		nerve growth factor receptor precursor							79.0	77.0	77.0					17																	47587854		2203	4300	6503	SO:0001583	missense	4804				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm		g.chr17:47587854G>T	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.649G>T	17.37:g.47587854G>T	ENSP00000172229:p.Ala217Ser		Somatic					p.A217S	NM_002507	NP_002498	WXS	Illumina HiSeq	Unspecified	P08138	TNR16_HUMAN			4	774	+	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)		217			Ser/Thr-rich.|Extracellular (Potential).		B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	c.649G>T	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	4.605	0.112392	0.08831	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.90504	-2.55;-2.68	4.32	1.13	0.20643	.	4.475220	0.00397	N	0.000052	T	0.78972	0.4368	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.67933	-0.5542	10	0.14656	T	0.56	5.8447	2.8571	0.05575	0.1014:0.1817:0.5293:0.1877	.	217	P08138	TNR16_HUMAN	S	217;123	ENSP00000172229:A217S;ENSP00000421731:A123S	ENSP00000172229:A217S	A	+	1	0	NGFR	44942853	0.030000	0.19436	0.062000	0.19696	0.196000	0.23810	0.474000	0.22148	0.180000	0.19960	-0.188000	0.12872	GCA		0.642	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1			5	43	1	0	0.00116845	0.021553	0.00129237	5	43				
DLGAP1	9229	broad.mit.edu	37	18	3567562	3567562	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr18:3567562T>A	ENST00000315677.3	-	9	2578	c.1983A>T	c.(1981-1983)gaA>gaT	p.E661D	DLGAP1_ENST00000581699.1_Missense_Mutation_p.E367D|DLGAP1_ENST00000515196.2_Missense_Mutation_p.E661D|DLGAP1_ENST00000584874.1_Missense_Mutation_p.E661D|DLGAP1_ENST00000400155.1_Missense_Mutation_p.E367D|DLGAP1_ENST00000400145.2_Missense_Mutation_p.E359D|DLGAP1_ENST00000534970.1_Missense_Mutation_p.E345D|DLGAP1_ENST00000400149.3_Missense_Mutation_p.E351D|DLGAP1_ENST00000400150.3_Missense_Mutation_p.E377D|DLGAP1_ENST00000400147.2_Missense_Mutation_p.E359D|DLGAP1_ENST00000581527.1_Missense_Mutation_p.E661D|DLGAP1_ENST00000539435.1_Missense_Mutation_p.E369D	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	661	Interaction with DYL2. {ECO:0000250}.				synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.E369D(1)|p.E661D(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTTTGTCAGGTTCTTCAGCAT	0.403																																							uc002kmf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1981-1983)GAA>GAT		discs large homolog-associated protein 1 isoform							243.0	190.0	208.0					18																	3567562		2203	4300	6503	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3567562T>A	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1983A>T	18.37:g.3567562T>A	ENSP00000316377:p.Glu661Asp		Somatic				DLGAP1_uc010wyz.1_Missense_Mutation_p.E661D|DLGAP1_uc002kme.1_Missense_Mutation_p.E359D|DLGAP1_uc010dkn.2_Missense_Mutation_p.E369D|DLGAP1_uc010wyw.1_Missense_Mutation_p.E367D|DLGAP1_uc010wyx.1_Missense_Mutation_p.E383D|DLGAP1_uc010wyy.1_Missense_Mutation_p.E345D|DLGAP1_uc002kmg.2_Missense_Mutation_p.E359D	p.E661D	NM_004746	NP_004737	WXS	Illumina HiSeq	Unspecified	O14490	DLGP1_HUMAN			6	2050	-		Colorectal(8;0.0257)	661			Interaction with DYL2 (By similarity).		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.1983A>T	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	T	5.243	0.230285	0.09969	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.77	0.63	0.17693	.	0.489229	0.22560	N	0.058479	T	0.15565	0.0375	N	0.12443	0.215	0.39421	D	0.966929	B;B;B;B;D;B;B;B	0.57257	0.001;0.001;0.0;0.0;0.979;0.0;0.0;0.002	B;B;B;B;D;B;B;B	0.71414	0.002;0.002;0.002;0.002;0.973;0.001;0.001;0.012	T	0.15665	-1.0429	10	0.07644	T	0.81	-19.8025	8.0784	0.30731	0.0:0.37:0.0:0.63	.	661;345;357;367;369;359;661;359	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490-3;O14490;O14490-2	.;.;.;.;.;.;DLGP1_HUMAN;.	D	661;359;377;351;367;345;369;359;661	ENSP00000316377:E661D;ENSP00000383011:E359D;ENSP00000383014:E377D;ENSP00000383013:E351D;ENSP00000383019:E367D;ENSP00000437817:E345D;ENSP00000446312:E369D;ENSP00000383010:E359D;ENSP00000445973:E661D	ENSP00000316377:E661D	E	-	3	2	DLGAP1	3557562	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	0.529000	0.23019	-0.094000	0.12374	0.533000	0.62120	GAA		0.403	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			10	94	0	0	0	0.080935	0	10	94				
ZNF229	7772	broad.mit.edu	37	19	44933924	44933924	+	Silent	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr19:44933924C>G	ENST00000588931.1	-	6	1465	c.1032G>C	c.(1030-1032)gtG>gtC	p.V344V	ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Silent_p.V338V	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V344V(1)		breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GCATGTCTCCCACAGGGGCTC	0.498																																							uc002oze.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(1030-1032)GTG>GTC		zinc finger protein 229							71.0	70.0	70.0					19																	44933924		1957	4161	6118	SO:0001819	synonymous_variant	7772				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44933924C>G	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1032G>C	19.37:g.44933924C>G			Somatic				ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Silent_p.V338V	p.V344V	NM_014518	NP_055333	WXS	Illumina HiSeq	Unspecified	Q9UJW7	ZN229_HUMAN			6	1466	-		Prostate(69;0.0352)	344					B2RWN3|Q59FV2|Q86WL9	Silent	SNP	ENST00000588931.1	37	c.1032G>C	CCDS42574.1																																																																																				0.498	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518		6	82	0	0	0	0.021553	0	6	82				
ZNF766	90321	broad.mit.edu	37	19	52794138	52794138	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr19:52794138G>A	ENST00000439461.1	+	4	1137	c.1094G>A	c.(1093-1095)aGg>aAg	p.R365K	ZNF766_ENST00000593612.1_Missense_Mutation_p.R380K|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000359102.4_Missense_Mutation_p.R380K	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R365K(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AAAGCTTTTAGGCACAAGTTC	0.393																																							uc002pyr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1093-1095)AGG>AAG		zinc finger protein 766							38.0	42.0	41.0					19																	52794138		2172	4282	6454	SO:0001583	missense	90321				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52794138G>A	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1094G>A	19.37:g.52794138G>A	ENSP00000409652:p.Arg365Lys		Somatic				ZNF766_uc002pys.1_3'UTR|ZNF766_uc002pyt.1_Missense_Mutation_p.R380K	p.R365K	NM_001010851	NP_001010851	WXS	Illumina HiSeq	Unspecified	Q5HY98	ZN766_HUMAN		GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)	4	1137	+			365			C2H2-type 7.		B2RNE0|Q7Z326	Missense_Mutation	SNP	ENST00000439461.1	37	c.1094G>A	CCDS46163.1	.	.	.	.	.	.	.	.	.	.	G	2.065	-0.414413	0.04766	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	T;T	0.07327	3.2;3.2	2.27	-4.55	0.03441	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03390	0.0098	N	0.12663	0.25	0.09310	N	1	B;B	0.31485	0.278;0.325	B;B	0.31390	0.079;0.129	T	0.33085	-0.9882	9	0.41790	T	0.15	.	0.7182	0.00936	0.2149:0.2826:0.2764:0.2261	.	380;365	G3XAE0;Q5HY98	.;ZN766_HUMAN	K	365;380	ENSP00000409652:R365K;ENSP00000352005:R380K	ENSP00000352005:R380K	R	+	2	0	ZNF766	57485950	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.524000	0.00062	-1.943000	0.01039	-0.912000	0.02778	AGG		0.393	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851		5	21	0	0	0	0.014758	0	5	21				
ZNF347	84671	broad.mit.edu	37	19	53644080	53644080	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr19:53644080G>C	ENST00000334197.7	-	5	2069	c.2001C>G	c.(1999-2001)caC>caG	p.H667Q	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.H668Q|ZNF347_ENST00000452676.2_Missense_Mutation_p.H668Q	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	667					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H667Q(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GTCTTGCAAGGTGTGAATTCT	0.413																																					Melanoma(64;205 1597 17324 45721)	Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1999-2001)CAC>CAG		zinc finger protein 347							172.0	155.0	161.0					19																	53644080		2203	4300	6503	SO:0001583	missense	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53644080G>C	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2001C>G	19.37:g.53644080G>C	ENSP00000334146:p.His667Gln		Somatic				ZNF347_uc010eql.1_Missense_Mutation_p.H668Q|ZNF347_uc002qbc.1_Missense_Mutation_p.H668Q	p.H667Q	NM_032584	NP_115973	WXS	Illumina HiSeq	Unspecified	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	2070	-			667			C2H2-type 15.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	c.2001C>G	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	G	6.504	0.461232	0.12342	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.13196	2.61;2.61	2.71	-2.07	0.07276	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07324	0.0185	N	0.16368	0.405	0.09310	N	1	P;B	0.45986	0.87;0.258	B;B	0.42361	0.385;0.056	T	0.36817	-0.9732	9	0.15066	T	0.55	.	7.9442	0.29976	0.5656:0.0:0.4344:0.0	.	668;667	G5E9N4;Q96SE7	.;ZN347_HUMAN	Q	667;668	ENSP00000334146:H667Q;ENSP00000405218:H668Q	ENSP00000334146:H667Q	H	-	3	2	ZNF347	58335892	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.426000	0.01027	-0.219000	0.10003	-0.793000	0.03317	CAC		0.413	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		17	140	0	0	0	0.043863	0	17	140				
ZNF544	27300	broad.mit.edu	37	19	58757682	58757682	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr19:58757682G>A	ENST00000596652.1	+	4	283	c.49G>A	c.(49-51)Gag>Aag	p.E17K	ZNF544_ENST00000333581.5_Missense_Mutation_p.E17K|ZNF544_ENST00000596597.1_3'UTR|ZNF544_ENST00000415203.2_Missense_Mutation_p.E17K|ZNF544_ENST00000600220.1_Missense_Mutation_p.E17K|ZNF544_ENST00000600044.1_Missense_Mutation_p.E17K|ZNF544_ENST00000599953.1_Intron|ZNF544_ENST00000594384.1_Missense_Mutation_p.E17K|ZNF544_ENST00000269829.4_Missense_Mutation_p.E17K|ZNF544_ENST00000599227.1_Missense_Mutation_p.E17K|ZNF544_ENST00000596929.1_Missense_Mutation_p.E17K|CTD-3138B18.4_ENST00000600029.1_Missense_Mutation_p.E17K|ZNF544_ENST00000596825.1_Missense_Mutation_p.E17K|ZNF544_ENST00000595981.1_Missense_Mutation_p.E17K			Q6NX49	ZN544_HUMAN	zinc finger protein 544	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E17K(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TGTGTGCTTCGAGGATGTGGC	0.552																																							uc010euo.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(49-51)GAG>AAG		zinc finger protein 544							225.0	203.0	210.0					19																	58757682		2203	4300	6503	SO:0001583	missense	27300				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58757682G>A	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.49G>A	19.37:g.58757682G>A	ENSP00000469635:p.Glu17Lys		Somatic				ZNF544_uc010eun.1_RNA|ZNF544_uc010yhw.1_RNA|ZNF544_uc010yhx.1_Missense_Mutation_p.E17K|ZNF544_uc010yhy.1_Missense_Mutation_p.E17K|ZNF544_uc002qrt.3_5'UTR|ZNF544_uc002qru.3_5'UTR|ZNF544_uc002qrv.2_RNA	p.E17K	NM_014480	NP_055295	WXS	Illumina HiSeq	Unspecified	Q6NX49	ZN544_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)	5	523	+		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)	17			KRAB.		A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	37	c.49G>A	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	G	1.061	-0.672940	0.03403	.	.	ENSG00000198131	ENST00000269829;ENST00000333581;ENST00000415203	T;T;T	0.01685	4.69;4.69;4.69	2.49	-2.18	0.07037	Krueppel-associated box (4);	.	.	.	.	T	0.00845	0.0028	N	0.10809	0.05	0.09310	N	1	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.10450	0.005;0.005;0.005	T	0.46816	-0.9164	9	0.02654	T	1	.	4.1746	0.10346	0.3816:0.1949:0.4235:0.0	.	17;17;17	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	K	17	ENSP00000269829:E17K;ENSP00000329320:E17K;ENSP00000394341:E17K	ENSP00000269829:E17K	E	+	1	0	ZNF544	63449494	0.014000	0.17966	0.065000	0.19835	0.360000	0.29518	0.023000	0.13533	-0.537000	0.06290	0.511000	0.50034	GAG		0.552	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480		13	223	0	0	0	0.105934	0	13	223				
ZNF8	7554	broad.mit.edu	37	19	58805974	58805974	+	Missense_Mutation	SNP	A	A	G	rs202096304		TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr19:58805974A>G	ENST00000196548.5	+	4	931	c.800A>G	c.(799-801)aAc>aGc	p.N267S	AC010642.1_ENST00000591325.1_3'UTR|ZNF8_ENST00000608843.1_Missense_Mutation_p.N267S			P17098	ZNF8_HUMAN	zinc finger protein 8	267					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.N267S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		AAGTCGTTTAACCATAACGCA	0.488																																							uc002qry.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(799-801)AAC>AGC		zinc finger protein 8		A	SER/ASN	0,4406		0,0,2203	89.0	83.0	85.0		800	4.3	1.0	19		85	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF8	NM_021089.2	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	267/576	58805974	1,13005	2203	4300	6503	SO:0001583	missense	7554				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58805974A>G	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.800A>G	19.37:g.58805974A>G	ENSP00000196548:p.Asn267Ser		Somatic				ZNF8_uc002qrz.2_RNA	p.N267S	NM_021089	NP_066575	WXS	Illumina HiSeq	Unspecified	P17098	ZNF8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)	4	930	+		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)	267			C2H2-type 1.		Q6PI99	Missense_Mutation	SNP	ENST00000196548.5	37	c.800A>G	CCDS12974.1	.	.	.	.	.	.	.	.	.	.	A	7.641	0.680842	0.14907	0.0	1.16E-4	ENSG00000083842	ENST00000196548	T	0.07216	3.21	4.26	4.26	0.50523	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000053	T	0.04272	0.0118	N	0.01197	-0.965	0.29136	N	0.879298	D	0.57257	0.979	P	0.54664	0.758	T	0.26608	-1.0098	10	0.02654	T	1	-29.5913	10.101	0.42504	1.0:0.0:0.0:0.0	.	267	P17098	ZNF8_HUMAN	S	267	ENSP00000196548:N267S	ENSP00000196548:N267S	N	+	2	0	ZNF8	63497786	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	-1.135000	0.03225	2.157000	0.67596	0.524000	0.50904	AAC		0.488	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000459135.1	NM_021089		7	29	0	0	0	0.02938	0	7	29				
SNTG2	54221	broad.mit.edu	37	2	1263181	1263181	+	Missense_Mutation	SNP	C	C	T	rs145354756		TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr2:1263181C>T	ENST00000308624.5	+	13	1174	c.1045C>T	c.(1045-1047)Cac>Tac	p.H349Y	SNTG2_ENST00000407292.1_Missense_Mutation_p.H222Y	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	349	PH.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.H349Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AAGGACCTATCACCTCTGTGA	0.413																																							uc002qwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)	3						c.(1045-1047)CAC>TAC		syntrophin, gamma 2							105.0	101.0	103.0					2																	1263181		1877	4116	5993	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1263181C>T	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1045C>T	2.37:g.1263181C>T	ENSP00000311837:p.His349Tyr		Somatic				SNTG2_uc010ewi.2_Missense_Mutation_p.H222Y	p.H349Y	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	13	1173	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	349			PH.		Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.1045C>T	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	C	3.370	-0.128560	0.06753	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.68765	1.59;-0.35	4.76	-2.44	0.06502	Pleckstrin homology domain (1);	0.217298	0.46442	N	0.000298	T	0.38799	0.1054	N	0.14661	0.345	0.24205	N	0.995496	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.11567	-1.0582	10	0.66056	D	0.02	.	2.3334	0.04241	0.4513:0.2483:0.0687:0.2316	.	222;349	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	Y	349;222	ENSP00000311837:H349Y;ENSP00000385020:H222Y	ENSP00000311837:H349Y	H	+	1	0	SNTG2	1245781	1.000000	0.71417	0.108000	0.21378	0.012000	0.07955	2.069000	0.41481	-0.781000	0.04548	-2.607000	0.00160	CAC		0.413	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		4	72	0	0	0	0.009096	0	4	72				
NLRC4	58484	broad.mit.edu	37	2	32475459	32475459	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr2:32475459G>A	ENST00000404025.2	-	5	1962	c.1474C>T	c.(1474-1476)Cgg>Tgg	p.R492W	NLRC4_ENST00000402280.1_Missense_Mutation_p.R492W|NLRC4_ENST00000360906.5_Missense_Mutation_p.R492W|NLRC4_ENST00000342905.6_Intron			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	492					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.R492W(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CAGGTGTACCGGAGCAGGCTG	0.517																																							uc002roi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|lung(1)|skin(1)	6						c.(1474-1476)CGG>TGG		caspase recruitment domain protein 12							66.0	64.0	65.0					2																	32475459		2203	4300	6503	SO:0001583	missense	58484				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity	g.chr2:32475459G>A	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1474C>T	2.37:g.32475459G>A	ENSP00000385090:p.Arg492Trp		Somatic				NLRC4_uc002roj.1_Missense_Mutation_p.R492W|NLRC4_uc010ezt.1_Intron	p.R492W	NM_021209	NP_067032	WXS	Illumina HiSeq	Unspecified	Q9NPP4	NLRC4_HUMAN			4	1720	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		492					A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	c.1474C>T	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	G	5.814	0.334415	0.11013	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.12147	2.71;2.71;2.71	3.4	0.181	0.15073	.	0.186489	0.23702	N	0.045417	T	0.05135	0.0137	N	0.14661	0.345	0.25237	N	0.989786	P	0.46277	0.875	B	0.34452	0.183	T	0.30446	-0.9978	9	0.56958	D	0.05	.	4.5846	0.12277	0.3189:0.1661:0.515:0.0	.	492	Q9NPP4	NLRC4_HUMAN	W	492	ENSP00000354159:R492W;ENSP00000385428:R492W;ENSP00000385090:R492W	ENSP00000354159:R492W	R	-	1	2	NLRC4	32328963	0.961000	0.32948	0.954000	0.39281	0.177000	0.22998	0.529000	0.23019	0.268000	0.21939	0.543000	0.68304	CGG		0.517	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		4	44	0	0	0	0.009096	0	4	44				
CEBPZ	10153	broad.mit.edu	37	2	37430153	37430153	+	Splice_Site	SNP	T	T	A	rs375852685		TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr2:37430153T>A	ENST00000234170.5	-	14	3030		c.e14-2		AC007390.5_ENST00000402297.1_3'UTR|AC007390.5_ENST00000406711.1_Intron|AC007390.5_ENST00000392061.2_Intron|AC007390.5_ENST00000397064.2_Intron	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(1)		breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TTCTTGGCCCTAAAAAAAATT	0.269																																							uc002rpz.2		NA																	1	Unknown(1)		lung(1)	pancreas(1)	1						c.e14-1		CCAAT/enhancer binding protein zeta							36.0	40.0	39.0					2																	37430153		2197	4283	6480	SO:0001630	splice_region_variant	10153				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr2:37430153T>A	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.2885-2A>T	2.37:g.37430153T>A			Somatic					p.G962_splice	NM_005760	NP_005751	WXS	Illumina HiSeq	Unspecified	Q03701	CEBPZ_HUMAN			14	2915	-		all_hematologic(82;0.21)						Q8NE75	Splice_Site	SNP	ENST00000234170.5	37	c.2885_splice	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.963398	0.34659	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	.	.	.	5.23	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2215	0.48857	0.0:0.0725:0.0:0.9275	.	.	.	.	.	-1	.	.	.	-	.	.	CEBPZ	37283657	1.000000	0.71417	0.587000	0.28692	0.452000	0.32318	4.279000	0.58953	0.923000	0.37045	0.460000	0.39030	.		0.269	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	Intron	3	47	0	0	0	0.009096	0	3	47				
STK36	27148	broad.mit.edu	37	2	219563892	219563892	+	Missense_Mutation	SNP	C	C	T	rs142956585		TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr2:219563892C>T	ENST00000295709.3	+	26	3904	c.3625C>T	c.(3625-3627)Cgg>Tgg	p.R1209W	STK36_ENST00000392105.3_Missense_Mutation_p.R1188W|STK36_ENST00000392106.2_Missense_Mutation_p.R1188W|STK36_ENST00000440309.1_Missense_Mutation_p.R1209W	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.R1209W(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GGCTGGTATCCGGCGCAATGT	0.592																																							uc002viu.2		NA																	1	Substitution - Missense(1)	p.R1209P(1)	lung(1)	ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(3625-3627)CGG>TGG		serine/threonine kinase 36		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	49.0	46.0	47.0		3625	5.0	1.0	2	dbSNP_134	47	2,8598	2.2+/-6.3	0,2,4298	no	missense	STK36	NM_015690.4	101	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	1209/1316	219563892	3,13003	2203	4300	6503	SO:0001583	missense	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219563892C>T	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3625C>T	2.37:g.219563892C>T	ENSP00000295709:p.Arg1209Trp		Somatic				STK36_uc002viv.2_Missense_Mutation_p.R1188W|STK36_uc002viw.2_Missense_Mutation_p.R387W|STK36_uc002vix.2_Missense_Mutation_p.R254W	p.R1209W	NM_015690	NP_056505	WXS	Illumina HiSeq	Unspecified	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	26	3891	+		Renal(207;0.0915)	1209						Missense_Mutation	SNP	ENST00000295709.3	37	c.3625C>T	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978917	0.74360	2.27E-4	2.33E-4	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.91	5.02	0.67125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.41194	D	0.000938	T	0.61800	0.2376	M	0.85041	2.73	0.51012	D	0.999903	P;D;D	0.89917	0.952;1.0;1.0	P;D;D	0.91635	0.563;0.999;0.999	T	0.66101	-0.6007	10	0.87932	D	0	-23.2499	11.0941	0.48134	0.0:0.8618:0.0:0.1382	.	1188;1188;1209	A8MU99;Q9NRP7-2;Q9NRP7	.;.;STK36_HUMAN	W	1209;1188;1188;1209	ENSP00000295709:R1209W;ENSP00000375955:R1188W;ENSP00000375954:R1188W;ENSP00000394095:R1209W	ENSP00000295709:R1209W	R	+	1	2	STK36	219272136	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	1.310000	0.33551	2.793000	0.96121	0.655000	0.94253	CGG		0.592	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			4	38	0	0	0	0.009096	0	4	38				
PPP1R16B	26051	broad.mit.edu	37	20	37546833	37546833	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr20:37546833G>A	ENST00000299824.1	+	11	1417	c.1228G>A	c.(1228-1230)Gaa>Aaa	p.E410K	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.E368K	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	410					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.E410K(2)		biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				GCTACTCTCCGAATTTCCTAC	0.567																																							uc002xje.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3						c.(1228-1230)GAA>AAA		protein phosphatase 1 regulatory inhibitor							121.0	128.0	126.0					20																	37546833		2203	4300	6503	SO:0001583	missense	26051				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding	g.chr20:37546833G>A	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1228G>A	20.37:g.37546833G>A	ENSP00000299824:p.Glu410Lys		Somatic				PPP1R16B_uc010ggc.2_Missense_Mutation_p.E368K	p.E410K	NM_015568	NP_056383	WXS	Illumina HiSeq	Unspecified	Q96T49	PP16B_HUMAN			11	1417	+		Myeloproliferative disorder(115;0.00878)	410					A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	ENST00000299824.1	37	c.1228G>A	CCDS13309.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126680	0.37533	.	.	ENSG00000101445	ENST00000299824;ENST00000373331	T;T	0.70869	-0.31;-0.52	5.44	5.44	0.79542	.	0.227351	0.44902	D	0.000414	T	0.56601	0.1996	L	0.40543	1.245	0.37825	D	0.928511	P;B	0.35628	0.513;0.342	B;B	0.20384	0.029;0.016	T	0.60209	-0.7308	10	0.10377	T	0.69	.	17.4517	0.87594	0.0:0.0:1.0:0.0	.	368;410	E9PFS8;Q96T49	.;PP16B_HUMAN	K	410;368	ENSP00000299824:E410K;ENSP00000362428:E368K	ENSP00000299824:E410K	E	+	1	0	PPP1R16B	36980247	1.000000	0.71417	0.922000	0.36590	0.542000	0.35054	4.352000	0.59404	2.555000	0.86185	0.655000	0.94253	GAA		0.567	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568		12	148	0	0	0	0.020292	0	12	148				
TOP1	7150	broad.mit.edu	37	20	39725971	39725971	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr20:39725971A>G	ENST00000361337.2	+	10	1092	c.842A>G	c.(841-843)gAc>gGc	p.D281G	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	281					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)	p.D281G(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	TTCTTTAAAGACTGGAGAAAG	0.348			T	NUP98	AML*																																		uc002xjl.2		NA		Dom	yes		20	20q12-q13.1	7150	T	topoisomerase (DNA) I			L	NUP98		AML*		1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7						c.(841-843)GAC>GGC		DNA topoisomerase I	Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)						67.0	73.0	71.0					20																	39725971		2203	4300	6503	SO:0001583	missense	7150				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding	g.chr20:39725971A>G		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.842A>G	20.37:g.39725971A>G	ENSP00000354522:p.Asp281Gly		Somatic				TOP1_uc010gge.1_RNA	p.D281G	NM_003286	NP_003277	WXS	Illumina HiSeq	Unspecified	P11387	TOP1_HUMAN			10	1088	+		Myeloproliferative disorder(115;0.00878)	281					A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	ENST00000361337.2	37	c.842A>G	CCDS13312.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.508894	0.85282	.	.	ENSG00000198900	ENST00000361337	T	0.35236	1.32	5.52	5.52	0.82312	DNA topoisomerase I, domain 1 (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.041183	0.85682	D	0.000000	T	0.64148	0.2572	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70219	-0.4932	10	0.87932	D	0	-21.043	15.6418	0.77009	1.0:0.0:0.0:0.0	.	281	P11387	TOP1_HUMAN	G	281	ENSP00000354522:D281G	ENSP00000354522:D281G	D	+	2	0	TOP1	39159385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.103000	0.63969	0.533000	0.62120	GAC		0.348	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			7	97	0	0	0	0.038147	0	7	97				
IQCB1	9657	broad.mit.edu	37	3	121544968	121544968	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr3:121544968A>C	ENST00000310864.6	-	5	537	c.323T>G	c.(322-324)cTt>cGt	p.L108R	IQCB1_ENST00000349820.6_Missense_Mutation_p.L108R	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	108					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)	p.L108R(1)		NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		AGCTGATGGAAGTAATTCATT	0.363																																							uc010hre.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(322-324)CTT>CGT		IQ motif containing B1 isoform a							71.0	69.0	69.0					3																	121544968		2203	4300	6503	SO:0001583	missense	9657				cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding	g.chr3:121544968A>C	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.323T>G	3.37:g.121544968A>C	ENSP00000311505:p.Leu108Arg		Somatic				IQCB1_uc003eek.2_Missense_Mutation_p.L108R|IQCB1_uc010hrf.1_RNA	p.L108R	NM_001023570	NP_001018864	WXS	Illumina HiSeq	Unspecified	Q15051	IQCB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0983)	5	538	-			108					Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	37	c.323T>G	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626009	0.66901	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.12672	2.66;2.66	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	L	0.36672	1.1	0.29887	N	0.825522	D;D	0.76494	0.995;0.999	D;D	0.85130	0.986;0.997	T	0.03443	-1.1036	10	0.87932	D	0	-9.6822	11.6502	0.51284	1.0:0.0:0.0:0.0	.	108;108	Q15051;Q15051-2	IQCB1_HUMAN;.	R	108	ENSP00000311505:L108R;ENSP00000323756:L108R	ENSP00000311505:L108R	L	-	2	0	IQCB1	123027658	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	5.610000	0.67668	2.313000	0.78055	0.455000	0.32223	CTT		0.363	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642		14	27	0	0	0	0.105934	0	14	27				
THAP6	152815	broad.mit.edu	37	4	76442122	76442122	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr4:76442122G>C	ENST00000311638.3	+	3	289	c.221G>C	c.(220-222)aGt>aCt	p.S74T	THAP6_ENST00000507557.1_Missense_Mutation_p.S33T|THAP6_ENST00000507885.1_Missense_Mutation_p.S33T|THAP6_ENST00000508105.1_Missense_Mutation_p.S33T|RCHY1_ENST00000514021.1_5'Flank|THAP6_ENST00000514480.1_Missense_Mutation_p.S74T|RCHY1_ENST00000513257.1_5'Flank|THAP6_ENST00000380837.3_Missense_Mutation_p.S74T|RCHY1_ENST00000512706.1_5'Flank|RCHY1_ENST00000451788.1_5'Flank|RCHY1_ENST00000380840.2_5'Flank|RCHY1_ENST00000324439.5_5'Flank|THAP6_ENST00000504190.1_Missense_Mutation_p.S33T|THAP6_ENST00000507556.1_Missense_Mutation_p.S74T|THAP6_ENST00000502620.1_Missense_Mutation_p.S33T	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	74						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S74T(1)		lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTTGACAGAAGTGCTCCAAAT	0.393																																							uc003him.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(220-222)AGT>ACT		THAP domain containing 6							121.0	126.0	125.0					4																	76442122		2203	4300	6503	SO:0001583	missense	152815					microtubule cytoskeleton	DNA binding|metal ion binding	g.chr4:76442122G>C	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.221G>C	4.37:g.76442122G>C	ENSP00000309007:p.Ser74Thr		Somatic				RCHY1_uc003hij.2_5'Flank|RCHY1_uc003hik.2_5'Flank|RCHY1_uc003hil.2_5'Flank|RCHY1_uc010iip.2_5'Flank|RCHY1_uc010iiq.2_5'Flank|RCHY1_uc010iir.2_5'Flank|THAP6_uc010iis.1_Missense_Mutation_p.S33T|THAP6_uc003hin.2_Missense_Mutation_p.S74T|THAP6_uc011cbm.1_Missense_Mutation_p.S74T|THAP6_uc010iiu.1_RNA|THAP6_uc003hio.1_RNA|THAP6_uc010iiv.2_Missense_Mutation_p.S74T	p.S74T	NM_144721	NP_653322	WXS	Illumina HiSeq	Unspecified	Q8TBB0	THAP6_HUMAN	Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)		3	318	+			74			THAP-type.		B4E146|Q5HYJ7|Q5JPC6	Missense_Mutation	SNP	ENST00000311638.3	37	c.221G>C	CCDS3568.1	.	.	.	.	.	.	.	.	.	.	G	3.106	-0.183675	0.06340	.	.	ENSG00000174796	ENST00000506261;ENST00000507557;ENST00000311638;ENST00000380837;ENST00000508105;ENST00000504190;ENST00000507556;ENST00000507885;ENST00000502620;ENST00000514480	D;D;D;D;D;D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95	5.09	4.22	0.49857	Zinc finger, C2CH-type (4);	0.080856	0.52532	N	0.000064	D	0.89608	0.6764	N	0.12502	0.225	0.24140	N	0.995738	B;B;B;B	0.16802	0.019;0.004;0.0;0.001	B;B;B;B	0.19666	0.026;0.019;0.001;0.004	T	0.75022	-0.3464	10	0.09084	T	0.74	-1.8163	12.0615	0.53564	0.0:0.1742:0.8258:0.0	.	74;33;74;74	B4E146;D6REL7;Q8TBB0-2;Q8TBB0	.;.;.;THAP6_HUMAN	T	74;33;74;74;33;33;74;33;33;74	ENSP00000422402:S74T;ENSP00000424949:S33T;ENSP00000309007:S74T;ENSP00000370217:S74T;ENSP00000426760:S33T;ENSP00000426581:S33T;ENSP00000427651:S74T;ENSP00000424255:S33T;ENSP00000426698:S33T;ENSP00000423720:S74T	ENSP00000309007:S74T	S	+	2	0	THAP6	76661146	0.987000	0.35691	0.998000	0.56505	0.992000	0.81027	1.802000	0.38853	1.423000	0.47198	0.561000	0.74099	AGT		0.393	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721		5	73	0	0	0	0.014758	0	5	73				
ADAMTS6	11174	broad.mit.edu	37	5	64748738	64748738	+	Silent	SNP	T	T	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr5:64748738T>G	ENST00000536360.1	-	5	1452	c.639A>C	c.(637-639)acA>acC	p.T213T				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	213						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T213T(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		TGCCACTTCTTGTGAAATCTA	0.348																																							uc003jtp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(637-639)ACA>ACC		ADAM metallopeptidase with thrombospondin type 1							113.0	103.0	107.0					5																	64748738		2203	4300	6503	SO:0001819	synonymous_variant	11174				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:64748738T>G	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.639A>C	5.37:g.64748738T>G			Somatic				ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_5'UTR	p.T213T	NM_197941	NP_922932	WXS	Illumina HiSeq	Unspecified	Q9UKP5	ATS6_HUMAN		Lung(70;0.00942)	5	1453	-		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)	213					Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Silent	SNP	ENST00000536360.1	37	c.639A>C																																																																																					0.348	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941		6	105	0	0	0	0.02938	0	6	105				
MAST4	375449	broad.mit.edu	37	5	66400349	66400349	+	Silent	SNP	C	C	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr5:66400349C>T	ENST00000403625.2	+	10	1597	c.1302C>T	c.(1300-1302)atC>atT	p.I434I	MAST4_ENST00000404260.3_Silent_p.I437I|MAST4_ENST00000490016.2_Silent_p.I245I|MAST4_ENST00000261569.7_Silent_p.I240I|MAST4_ENST00000405643.1_Silent_p.I255I|MAST4_ENST00000403666.1_Silent_p.I245I	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	437						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.I437I(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGGGCCTCATCACCTCACGAT	0.413																																							uc003jut.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(733-735)ATC>ATT		microtubule associated serine/threonine kinase							81.0	77.0	78.0					5																	66400349		1903	4124	6027	SO:0001819	synonymous_variant	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66400349C>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1302C>T	5.37:g.66400349C>T			Somatic				MAST4_uc003jus.2_Silent_p.I245I|MAST4_uc003juu.1_Silent_p.I255I|MAST4_uc011cra.1_Silent_p.I228I|MAST4_uc010ixa.2_RNA|MAST4_uc003juv.2_Silent_p.I240I|MAST4_uc003juw.2_Silent_p.I240I	p.I245I	NM_015183	NP_055998	WXS	Illumina HiSeq	Unspecified	O15021	MAST4_HUMAN		Lung(70;0.011)	9	803	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	437					A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	c.735C>T	CCDS54861.1																																																																																				0.413	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			4	36	0	0	0	0.014758	0	4	36				
RIOK2	55781	broad.mit.edu	37	5	96503577	96503577	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr5:96503577C>T	ENST00000283109.3	-	8	1059	c.991G>A	c.(991-993)Gga>Aga	p.G331R	RIOK2_ENST00000508447.1_Missense_Mutation_p.G331R|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	331	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G331R(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		AATTCAGATCCCTCTTTTGTT	0.418																																							uc003kmz.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(991-993)GGA>AGA		RIO kinase 2 isoform 1							131.0	138.0	135.0					5																	96503577		2203	4300	6503	SO:0001583	missense	55781						ATP binding|protein serine/threonine kinase activity	g.chr5:96503577C>T	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.991G>A	5.37:g.96503577C>T	ENSP00000283109:p.Gly331Arg		Somatic				RIOK2_uc003kna.3_Missense_Mutation_p.G331R	p.G331R	NM_018343	NP_060813	WXS	Illumina HiSeq	Unspecified	Q9BVS4	RIOK2_HUMAN		COAD - Colon adenocarcinoma(37;0.0657)	8	1101	-		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)	331			Protein kinase.		D6RDI3|Q9NUT0	Missense_Mutation	SNP	ENST00000283109.3	37	c.991G>A	CCDS4089.1	.	.	.	.	.	.	.	.	.	.	C	4.856	0.159158	0.09236	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.17213	2.29;2.29	5.65	0.71	0.18157	.	1.538640	0.03103	N	0.161390	T	0.05960	0.0155	N	0.00707	-1.245	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.33929	-0.9849	10	0.17832	T	0.49	-4.8812	9.4123	0.38500	0.0:0.6594:0.0974:0.2432	.	331;331	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	R	331	ENSP00000283109:G331R;ENSP00000420932:G331R	ENSP00000283109:G331R	G	-	1	0	RIOK2	96529333	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.151000	0.10175	-0.131000	0.11578	-1.641000	0.00772	GGA		0.418	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343		12	250	0	0	0	0.105934	0	12	250				
RELL2	285613	broad.mit.edu	37	5	141018407	141018407	+	Missense_Mutation	SNP	G	G	C	rs189638154	byFrequency	TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr5:141018407G>C	ENST00000297164.3	+	2	1430	c.230G>C	c.(229-231)cGc>cCc	p.R77P	HDAC3_ENST00000305264.3_5'Flank|FCHSD1_ENST00000523856.1_5'Flank|RELL2_ENST00000444782.1_Missense_Mutation_p.R77P|RELL2_ENST00000518856.1_Missense_Mutation_p.R11P|RELL2_ENST00000521367.1_Missense_Mutation_p.R11P|RELL2_ENST00000518025.1_3'UTR	NM_173828.4	NP_776189.3	Q8NC24	RELL2_HUMAN	RELT-like 2	77					positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R77P(1)		large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGATTGTTCGCTGCATCATC	0.507																																							uc003lli.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(229-231)CGC>CCC		RELT-like 2							188.0	187.0	188.0					5																	141018407		2203	4300	6503	SO:0001583	missense	285613					integral to membrane|plasma membrane		g.chr5:141018407G>C	AK054889	CCDS4265.1	5q31.3	2011-10-11	2007-06-15	2007-06-15	ENSG00000164620	ENSG00000164620			26902	protein-coding gene	gene with protein product		611213	"""chromosome 5 open reading frame 16"""	C5orf16		12975309, 16389068	Standard	NM_173828		Approved	FLJ90583	uc003lli.3	Q8NC24	OTTHUMG00000129612	ENST00000297164.3:c.230G>C	5.37:g.141018407G>C	ENSP00000297164:p.Arg77Pro		Somatic				HDAC3_uc003llf.2_5'Flank|HDAC3_uc010jgd.1_5'Flank|HDAC3_uc010jge.1_5'Flank|RELL2_uc003llh.2_Missense_Mutation_p.R77P|RELL2_uc003llg.2_Missense_Mutation_p.R11P|RELL2_uc010jgf.2_Missense_Mutation_p.R11P	p.R77P	NM_001130029	NP_001123501	WXS	Illumina HiSeq	Unspecified	Q8NC24	RELL2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	1078	+			77					D3DQE2|Q6P4E7|Q6UXY2	Missense_Mutation	SNP	ENST00000297164.3	37	c.230G>C	CCDS4265.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208926	0.58343	.	.	ENSG00000164620	ENST00000444782;ENST00000521367;ENST00000297164;ENST00000518856	T;T;T;T	0.17854	2.25;2.4;2.25;2.43	5.57	2.44	0.29823	.	0.269407	0.30383	N	0.009753	T	0.19208	0.0461	L	0.46157	1.445	0.35799	D	0.822975	D;P	0.53885	0.963;0.876	P;B	0.52672	0.706;0.324	T	0.18023	-1.0350	10	0.56958	D	0.05	-4.9724	2.5998	0.04863	0.3206:0.0:0.4687:0.2108	.	11;77	E5RHA7;Q8NC24	.;RELL2_HUMAN	P	77;11;77;11	ENSP00000409443:R77P;ENSP00000430948:R11P;ENSP00000297164:R77P;ENSP00000427992:R11P	ENSP00000297164:R77P	R	+	2	0	RELL2	140998591	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	1.972000	0.40540	1.340000	0.45581	0.650000	0.86243	CGC		0.507	RELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251807.2	NM_173828		4	85	0	0	0	0.014758	0	4	85				
FAM71B	153745	broad.mit.edu	37	5	156589943	156589943	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr5:156589943G>A	ENST00000302938.4	-	2	1428	c.1333C>T	c.(1333-1335)Cat>Tat	p.H445Y		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	445						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGCGGTGATGAGAACTTTTC	0.502																																							uc003lwn.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(1333-1335)CAT>TAT		family with sequence similarity 71, member B							168.0	160.0	163.0					5																	156589943		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156589943G>A		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1333C>T	5.37:g.156589943G>A	ENSP00000305596:p.His445Tyr		Somatic					p.H445Y	NM_130899	NP_570969	WXS	Illumina HiSeq	Unspecified	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1433	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	445			Bipartite nuclear localization signal (Potential).		Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.1333C>T	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.859226	0.51376	.	.	ENSG00000170613	ENST00000302938	T	0.19394	2.15	4.64	3.68	0.42216	.	0.730266	0.11847	N	0.523663	T	0.29524	0.0736	L	0.58101	1.795	0.18873	N	0.999981	D	0.56521	0.976	P	0.50314	0.637	T	0.08868	-1.0701	10	0.59425	D	0.04	-0.0986	9.3031	0.37858	0.0:0.0:0.786:0.214	.	445	Q8TC56	FA71B_HUMAN	Y	445	ENSP00000305596:H445Y	ENSP00000305596:H445Y	H	-	1	0	FAM71B	156522521	0.900000	0.30661	0.374000	0.26016	0.372000	0.29890	2.651000	0.46674	2.500000	0.84329	0.655000	0.94253	CAT		0.502	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		7	153	0	0	0	0.047766	0	7	153				
FILIP1	27145	broad.mit.edu	37	6	76023514	76023514	+	Silent	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr6:76023514A>G	ENST00000237172.7	-	5	2364	c.2034T>C	c.(2032-2034)tcT>tcC	p.S678S	FILIP1_ENST00000393004.2_Silent_p.S678S|FILIP1_ENST00000370020.1_Silent_p.S579S|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	678								p.S678S(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CTAGTTGTTGAGAGAGGAAGT	0.433																																							uc003pia.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(2032-2034)TCT>TCC		filamin A interacting protein 1							229.0	229.0	229.0					6																	76023514		2203	4300	6503	SO:0001819	synonymous_variant	27145							g.chr6:76023514A>G	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2034T>C	6.37:g.76023514A>G			Somatic				FILIP1_uc003phy.1_Silent_p.S678S|FILIP1_uc003phz.2_Silent_p.S579S|FILIP1_uc010kbe.2_Silent_p.S681S|FILIP1_uc003pib.1_Silent_p.S430S	p.S678S	NM_015687	NP_056502	WXS	Illumina HiSeq	Unspecified	Q7Z7B0	FLIP1_HUMAN			5	2407	-			678			Potential.		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	c.2034T>C	CCDS4984.1																																																																																				0.433	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179		16	248	0	0	0	0.024245	0	16	248				
FGFR1OP	11116	broad.mit.edu	37	6	167417806	167417806	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr6:167417806G>A	ENST00000366847.4	+	5	586	c.355G>A	c.(355-357)Gca>Aca	p.A119T	RP11-517H2.6_ENST00000609590.1_RNA|FGFR1OP_ENST00000349556.4_Missense_Mutation_p.A119T	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	119					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.A119T(1)		large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		TATAATTGAAGCAGAAGGTAC	0.413			T	FGFR1	"""MPD, NHL"""																																		uc003qvj.2		NA		Dom	yes		6	6q27	11116	T	FGFR1 oncogene partner (FOP)			L	FGFR1		MPD|NHL		1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(355-357)GCA>ACA		FGFR1 oncogene partner isoform a							82.0	81.0	81.0					6																	167417806		2203	4300	6503	SO:0001583	missense	11116				G2/M transition of mitotic cell cycle|microtubule anchoring|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation	centrosome|cytosol|nucleus|perinuclear region of cytoplasm	protein homodimerization activity|protein kinase binding|protein tyrosine kinase inhibitor activity	g.chr6:167417806G>A	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.355G>A	6.37:g.167417806G>A	ENSP00000355812:p.Ala119Thr		Somatic				CCR6_uc003qvl.2_5'UTR|FGFR1OP_uc011egp.1_Missense_Mutation_p.A119T|FGFR1OP_uc003qvk.2_Missense_Mutation_p.A119T	p.A119T	NM_007045	NP_008976	WXS	Illumina HiSeq	Unspecified	O95684	FR1OP_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)	5	440	+		Breast(66;1.48e-05)|Ovarian(120;0.0607)	119					A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Missense_Mutation	SNP	ENST00000366847.4	37	c.355G>A	CCDS5296.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.312097	0.60414	.	.	ENSG00000213066	ENST00000366847;ENST00000420493;ENST00000349556	T;T	0.30981	1.51;1.51	5.34	5.34	0.76211	FGFR1 oncogene partner (FOP), N-terminal dimerisation domain (1);	0.191587	0.46442	D	0.000286	T	0.07458	0.0188	N	0.02011	-0.69	0.38495	D	0.948088	P;P;P	0.40282	0.711;0.669;0.587	B;B;B	0.42138	0.377;0.19;0.194	T	0.23190	-1.0195	10	0.16896	T	0.51	-21.2045	16.1494	0.81602	0.0:0.0:1.0:0.0	.	119;119;119	E7ET71;O95684-2;O95684	.;.;FR1OP_HUMAN	T	119	ENSP00000355812:A119T;ENSP00000230248:A119T	ENSP00000230248:A119T	A	+	1	0	FGFR1OP	167337796	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.628000	0.46477	2.656000	0.90262	0.643000	0.83706	GCA		0.413	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045		11	43	0	0	0	0.069234	0	11	43				
MLLT4	4301	broad.mit.edu	37	6	168299086	168299086	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr6:168299086G>A	ENST00000447894.2	+	11	1519	c.1519G>A	c.(1519-1521)Gct>Act	p.A507T	MLLT4_ENST00000392112.1_Missense_Mutation_p.A491T|MLLT4_ENST00000400822.3_Missense_Mutation_p.A506T|MLLT4_ENST00000344191.4_Missense_Mutation_p.A507T|MLLT4_ENST00000366806.2_Missense_Mutation_p.A507T|MLLT4_ENST00000392108.3_Missense_Mutation_p.A507T|MLLT4_ENST00000351017.4_Missense_Mutation_p.A507T			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	507					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.A491T(1)|p.A507T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCAGGATCATGCTCTTGCAAA	0.453			T	MLL	AL																																		uc003qwd.2		NA		Dom	yes		6	6q27	4301	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""			L	MLL		AL		2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5						c.(1516-1518)GCT>ACT		myeloid/lymphoid or mixed-lineage leukemia							66.0	60.0	62.0					6																	168299086		2203	4300	6503	SO:0001583	missense	4301				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding	g.chr6:168299086G>A	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1519G>A	6.37:g.168299086G>A	ENSP00000404595:p.Ala507Thr		Somatic				MLLT4_uc003qwb.1_Missense_Mutation_p.A491T|MLLT4_uc003qwc.1_Missense_Mutation_p.A507T|MLLT4_uc003qwf.2_Missense_Mutation_p.A192T	p.A506T	NM_001040001	NP_001035090	WXS	Illumina HiSeq	Unspecified	P55196	AFAD_HUMAN		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	11	1658	+		Breast(66;1.07e-05)|Ovarian(120;0.024)	507					O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37	c.1516G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.510|9.510	1.105563|1.105563	0.20632|0.20632	.|.	.|.	ENSG00000130396|ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894|ENST00000423229	T;T;T;T;T;T;T|.	0.04758|.	3.75;3.66;3.76;3.76;3.56;3.66;3.66|.	5.14|5.14	-0.534|-0.534	0.11883|0.11883	.|.	1.576220|.	0.03194|.	N|.	0.173680|.	T|T	0.04861|0.04861	0.0131|0.0131	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.08055|.	0.001;0.002;0.003;0.002|.	T|T	0.40440|0.40440	-0.9563|-0.9563	10|5	0.12766|.	T|.	0.61|.	-1.1407|-1.1407	4.8478|4.8478	0.13523|0.13523	0.5944:0.0:0.2374:0.1682|0.5944:0.0:0.2374:0.1682	.|.	205;506;507;491|.	Q96C95;P55196-5;P55196-6;P55196-2|.	.;.;.;.|.	T|Y	507;507;507;507;491;507;506;507|205	ENSP00000341118:A507T;ENSP00000252692:A507T;ENSP00000375956:A507T;ENSP00000355771:A507T;ENSP00000375960:A491T;ENSP00000383623:A506T;ENSP00000404595:A507T|.	ENSP00000345834:A507T|.	A|C	+|+	1|2	0|0	MLLT4|MLLT4	168041935|168041935	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.984000|0.984000	0.73092|0.73092	0.271000|0.271000	0.18626|0.18626	-0.029000|-0.029000	0.13827|0.13827	0.650000|0.650000	0.86243|0.86243	GCT|TGC		0.453	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936		5	33	0	0	0	0.02938	0	5	33				
KRIT1	889	broad.mit.edu	37	7	91870326	91870326	+	Silent	SNP	A	A	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr7:91870326A>T	ENST00000340022.2	-	5	1261	c.243T>A	c.(241-243)ccT>ccA	p.P81P	KRIT1_ENST00000412043.2_Silent_p.P81P|KRIT1_ENST00000394503.2_Silent_p.P81P|KRIT1_ENST00000394505.2_Silent_p.P81P|KRIT1_ENST00000394507.1_Silent_p.P81P	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	81	N-terminal domain similar to Nudix hydrolase domain.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.P81P(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCTGGTTTGCAGGAGAAATTG	0.313																																							uc003ulq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(241-243)CCT>CCA		krev interaction trapped 1 isoform 1							197.0	178.0	184.0					7																	91870326		2203	4300	6503	SO:0001819	synonymous_variant	889	Familial_Cerebral_Cavernous_Angioma			angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity	g.chr7:91870326A>T	AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.243T>A	7.37:g.91870326A>T			Somatic				KRIT1_uc010lev.1_5'UTR|KRIT1_uc003ulr.1_Silent_p.P81P|KRIT1_uc003uls.1_Silent_p.P81P|KRIT1_uc003ult.1_Silent_p.P81P|KRIT1_uc003ulu.1_Silent_p.P81P|KRIT1_uc003ulv.1_Silent_p.P81P	p.P81P	NM_194456	NP_919438	WXS	Illumina HiSeq	Unspecified	O00522	KRIT1_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		3	414	-	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		81					A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Silent	SNP	ENST00000340022.2	37	c.243T>A	CCDS5624.1																																																																																				0.313	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1			22	65	0	0	0	0.076483	0	22	65				
GIGYF1	64599	broad.mit.edu	37	7	100284038	100284038	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr7:100284038G>C	ENST00000275732.5	-	8	1922	c.713C>G	c.(712-714)gCt>gGt	p.A238G	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	238					insulin-like growth factor receptor signaling pathway (GO:0048009)			p.A238G(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCGCCAGCCAGCAGAGCGGGG	0.637																																							uc003uwg.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(712-714)GCT>GGT		PERQ amino acid rich, with GYF domain 1							39.0	38.0	38.0					7																	100284038		2169	4239	6408	SO:0001583	missense	64599							g.chr7:100284038G>C	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.713C>G	7.37:g.100284038G>C	ENSP00000275732:p.Ala238Gly		Somatic					p.A238G	NM_022574	NP_072096	WXS	Illumina HiSeq	Unspecified	O75420	PERQ1_HUMAN			8	1722	-	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)		238					Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	37	c.713C>G	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	25.7	4.663251	0.88251	.	.	ENSG00000146830	ENST00000275732	D	0.84146	-1.81	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.88573	0.6473	L	0.43152	1.355	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.85080	0.0945	10	0.21014	T	0.42	-8.5094	16.1812	0.81903	0.0:0.0:1.0:0.0	.	238	O75420	PERQ1_HUMAN	G	238	ENSP00000275732:A238G	ENSP00000275732:A238G	A	-	2	0	GIGYF1	100121974	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.604000	0.98317	2.677000	0.91161	0.563000	0.77884	GCT		0.637	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574		3	38	0	0	0	0.004672	0	3	38				
MET	4233	broad.mit.edu	37	7	116412024	116412024	+	Nonsense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr7:116412024C>G	ENST00000318493.6	+	14	3250	c.3063C>G	c.(3061-3063)taC>taG	p.Y1021*	MET_ENST00000397752.3_Nonsense_Mutation_p.Y1003*			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L982_D1028del(3)|p.D981_D1028del(1)|p.982_1028del47(1)|p.?(1)|p.Y1021*(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTGTAGACTACCGAGCTACTT	0.383			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		7	Deletion - In frame(4)|Unknown(2)|Substitution - Nonsense(1)	p.L982_D1028del(3)|p.D981_D1028del(1)|p.982_1028del47(1)|p.?(1)	lung(7)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(3007-3009)TAC>TAG		met proto-oncogene isoform b precursor							75.0	70.0	72.0					7																	116412024		1852	4077	5929	SO:0001587	stop_gained	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116412024C>G	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3063C>G	7.37:g.116412024C>G	ENSP00000317272:p.Tyr1021*		Somatic				MET_uc010lkh.2_Nonsense_Mutation_p.Y1021*|MET_uc011knj.1_Nonsense_Mutation_p.Y573*	p.Y1003*	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		14	3196	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	1003			Cytoplasmic (Potential).		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Nonsense_Mutation	SNP	ENST00000318493.6	37	c.3009C>G	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	42	9.277874	0.99123	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	.	.	.	5.67	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.934	0.52864	0.0:0.86:0.0:0.14	.	.	.	.	X	1003;1021	.	ENSP00000317272:Y1021X	Y	+	3	2	MET	116199260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.259000	0.43259	1.543000	0.49345	0.591000	0.81541	TAC		0.383	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			6	34	0	0	0	0.02938	0	6	34				
ADCY8	114	broad.mit.edu	37	8	132052081	132052081	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr8:132052081C>G	ENST00000286355.5	-	1	2591	c.499G>C	c.(499-501)Gaa>Caa	p.E167Q	ADCY8_ENST00000377928.3_Missense_Mutation_p.E167Q	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	167					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.E167Q(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAGAGGCGTTCCAAATCCCGA	0.527										HNSCC(32;0.087)																													uc003ytd.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(499-501)GAA>CAA		adenylate cyclase 8							65.0	65.0	65.0					8																	132052081		2203	4300	6503	SO:0001583	missense	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:132052081C>G	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.499G>C	8.37:g.132052081C>G	ENSP00000286355:p.Glu167Gln	HNSCC(32;0.087)	Somatic				ADCY8_uc010mds.2_Missense_Mutation_p.E167Q	p.E167Q	NM_001115	NP_001106	WXS	Illumina HiSeq	Unspecified	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		1	755	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		167			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000286355.5	37	c.499G>C	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642295	0.87859	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.65732	-0.17;-0.17	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.77212	0.4097	M	0.62723	1.935	0.49299	D	0.999772	D;D	0.63880	0.993;0.993	D;D	0.70227	0.968;0.968	T	0.79252	-0.1880	10	0.72032	D	0.01	.	17.8484	0.88737	0.0:1.0:0.0:0.0	.	167;167	E7EVL1;P40145	.;ADCY8_HUMAN	Q	167	ENSP00000286355:E167Q;ENSP00000367161:E167Q	ENSP00000286355:E167Q	E	-	1	0	ADCY8	132121263	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.463000	0.80869	2.474000	0.83562	0.462000	0.41574	GAA		0.527	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			13	91	0	0	0	0.024245	0	13	91				
ZNF623	9831	broad.mit.edu	37	8	144733396	144733396	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr8:144733396A>T	ENST00000501748.2	+	1	1443	c.1354A>T	c.(1354-1356)Att>Ttt	p.I452F	ZNF623_ENST00000458270.2_Missense_Mutation_p.I412F|ZNF623_ENST00000526926.1_Missense_Mutation_p.I412F	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I452F(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCACCAGATTATTCACACTGG	0.463																																							uc003yzd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1354-1356)ATT>TTT		zinc finger protein 623 isoform 1							101.0	97.0	98.0					8																	144733396		2203	4300	6503	SO:0001583	missense	9831				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:144733396A>T	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.1354A>T	8.37:g.144733396A>T	ENSP00000445979:p.Ile452Phe		Somatic				ZNF623_uc011lkp.1_Missense_Mutation_p.I412F|ZNF623_uc003yzc.2_Missense_Mutation_p.I412F	p.I452F	NM_014789	NP_055604	WXS	Illumina HiSeq	Unspecified	O75123	ZN623_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		1	1443	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		452			C2H2-type 12.		A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	ENST00000501748.2	37	c.1354A>T	CCDS34957.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.368137	0.42003	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.08807	3.05;3.05;3.05	4.65	0.704	0.18121	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13114	0.0318	M	0.73319	2.225	0.09310	N	1	B	0.33777	0.425	B	0.39805	0.31	T	0.20273	-1.0280	9	0.72032	D	0.01	-5.8452	7.1648	0.25685	0.5722:0.0:0.4278:0.0	.	452	O75123	ZN623_HUMAN	F	412;412;412;452;452	ENSP00000435232:I412F;ENSP00000411139:I412F;ENSP00000445979:I452F	ENSP00000330358:I412F	I	+	1	0	ZNF623	144804539	0.000000	0.05858	0.001000	0.08648	0.736000	0.42039	0.098000	0.15189	-0.072000	0.12864	-0.415000	0.06103	ATT		0.463	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3	NM_014789		5	86	0	0	0	0.014758	0	5	86				
TESK1	7016	broad.mit.edu	37	9	35608495	35608495	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr9:35608495C>T	ENST00000336395.5	+	9	1239	c.989C>T	c.(988-990)aCa>aTa	p.T330I	MIR4667_ENST00000578933.1_RNA|CD72_ENST00000490239.1_5'Flank|TESK1_ENST00000498522.1_3'UTR	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	330					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.T330I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACCGCCCTGACACACAATCAG	0.572																																							uc003zxa.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7						c.(988-990)ACA>ATA		testis-specific protein kinase 1							44.0	45.0	45.0					9																	35608495		2203	4300	6503	SO:0001583	missense	7016				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr9:35608495C>T	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.989C>T	9.37:g.35608495C>T	ENSP00000338127:p.Thr330Ile		Somatic				TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Missense_Mutation_p.T170I	p.T330I	NM_006285	NP_006276	WXS	Illumina HiSeq	Unspecified	Q15569	TESK1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		9	1325	+			330					Q8IXZ8	Missense_Mutation	SNP	ENST00000336395.5	37	c.989C>T	CCDS6580.1	.	.	.	.	.	.	.	.	.	.	C	3.215	-0.160763	0.06502	.	.	ENSG00000107140	ENST00000336395	T	0.65549	-0.16	5.29	0.175	0.15045	Protein kinase-like domain (1);	0.556492	0.15254	N	0.272145	T	0.37128	0.0992	N	0.14661	0.345	0.09310	N	1	B;B	0.21381	0.0;0.055	B;B	0.12837	0.0;0.008	T	0.13522	-1.0506	10	0.38643	T	0.18	1.0565	4.4424	0.11580	0.1466:0.4431:0.0:0.4103	.	248;330	B4DQQ3;Q15569	.;TESK1_HUMAN	I	330	ENSP00000338127:T330I	ENSP00000338127:T330I	T	+	2	0	TESK1	35598495	0.000000	0.05858	0.004000	0.12327	0.055000	0.15305	0.295000	0.19065	-0.255000	0.09486	-0.224000	0.12420	ACA		0.572	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285		4	13	0	0	0	0.021553	0	4	13				
FOXB2	442425	broad.mit.edu	37	9	79634826	79634826	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr9:79634826T>C	ENST00000376708.1	+	1	256	c.256T>C	c.(256-258)Ttc>Ctc	p.F86L		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	86					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F86L(3)		breast(1)|lung(8)|ovary(1)	10						CAAGGGTAGCTTCTGGGCGCT	0.632																																							uc004ako.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(256-258)TTC>CTC		forkhead box B2							47.0	50.0	49.0					9																	79634826		2203	4300	6503	SO:0001583	missense	442425				brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:79634826T>C		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.256T>C	9.37:g.79634826T>C	ENSP00000365898:p.Phe86Leu		Somatic					p.F86L	NM_001013735	NP_001013757	WXS	Illumina HiSeq	Unspecified	Q5VYV0	FOXB2_HUMAN			1	256	+			86			Fork-head.			Missense_Mutation	SNP	ENST00000376708.1	37	c.256T>C	CCDS35045.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013337	0.75161	.	.	ENSG00000204612	ENST00000376708	D	0.95103	-3.61	4.47	4.47	0.54385	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	N	0.04063	-0.285	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.94502	0.7710	10	0.72032	D	0.01	.	13.7503	0.62904	0.0:0.0:0.0:1.0	.	86	Q5VYV0	FOXB2_HUMAN	L	86	ENSP00000365898:F86L	ENSP00000365898:F86L	F	+	1	0	FOXB2	78824646	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.853000	0.86934	1.654000	0.50703	0.379000	0.24179	TTC		0.632	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735		3	24	0	0	0	0.009096	0	3	24				
AKAP4	8852	broad.mit.edu	37	X	49955748	49955748	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:49955748A>G	ENST00000376056.2	-	6	2543	c.2393T>C	c.(2392-2394)gTt>gCt	p.V798A	AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376064.3_Missense_Mutation_p.V798A|AKAP4_ENST00000376058.2_Missense_Mutation_p.V424A|AKAP4_ENST00000358526.2_Missense_Mutation_p.V807A					A kinase (PRKA) anchor protein 4									p.V807A(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTTAGCTGAAACCTGAGGAAG	0.507																																							uc004dow.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8						c.(2419-2421)GTT>GCT		A-kinase anchor protein 4 isoform 1							145.0	127.0	133.0					X																	49955748		2203	4300	6503	SO:0001583	missense	8852				cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding	g.chrX:49955748A>G	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2393T>C	X.37:g.49955748A>G	ENSP00000365224:p.Val798Ala		Somatic				AKAP4_uc004dov.1_Missense_Mutation_p.V424A|AKAP4_uc010njp.1_Missense_Mutation_p.V629A|AKAP4_uc004dou.1_Missense_Mutation_p.V798A	p.V807A	NM_003886	NP_003877	WXS	Illumina HiSeq	Unspecified	Q5JQC9	AKAP4_HUMAN			6	2544	-	Ovarian(276;0.236)		807						Missense_Mutation	SNP	ENST00000376056.2	37	c.2420T>C	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.917502	0.73098	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	4.78	4.78	0.61160	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.47093	D	0.000260	T	0.27629	0.0679	M	0.65975	2.015	0.30320	N	0.787723	D;D	0.76494	0.992;0.999	D;D	0.74348	0.983;0.947	T	0.10177	-1.0641	9	.	.	.	-13.384	9.8846	0.41253	1.0:0.0:0.0:0.0	.	807;424	Q5JQC9;A6ND82	AKAP4_HUMAN;.	A	798;424;807;798	ENSP00000365224:V798A;ENSP00000365226:V424A;ENSP00000351327:V807A;ENSP00000365232:V798A	.	V	-	2	0	AKAP4	49842488	0.847000	0.29606	0.996000	0.52242	0.976000	0.68499	3.557000	0.53741	1.596000	0.50062	0.425000	0.28330	GTT		0.507	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886		7	130	0	0	0	0.038147	0	7	130				
ZC3H12B	340554	broad.mit.edu	37	X	64722914	64722914	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:64722914T>C	ENST00000338957.4	+	5	2403	c.2336T>C	c.(2335-2337)aTg>aCg	p.M779T	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.M768T	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	779							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.M715T(1)|p.M629T(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGGTTGGAATGTGCAATGAT	0.478																																							uc010nko.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|kidney(1)|pancreas(1)	3						c.(2302-2304)ATG>ACG		zinc finger CCCH-type containing 12B							124.0	121.0	122.0					X																	64722914		2115	4211	6326	SO:0001583	missense	340554						endonuclease activity|nucleic acid binding|zinc ion binding	g.chrX:64722914T>C	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.2336T>C	X.37:g.64722914T>C	ENSP00000340839:p.Met779Thr		Somatic					p.M768T	NM_001010888	NP_001010888	WXS	Illumina HiSeq	Unspecified	Q5HYM0	ZC12B_HUMAN			5	2312	+			768					B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	c.2303T>C	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	T	9.207	1.030053	0.19512	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.21932	1.98;1.98	5.94	4.79	0.61399	.	0.421472	0.31809	N	0.007035	T	0.14356	0.0347	L	0.29908	0.895	0.26753	N	0.970163	B	0.20164	0.042	B	0.12156	0.007	T	0.12656	-1.0539	10	0.27785	T	0.31	3.7829	9.4041	0.38451	0.0:0.0842:0.0:0.9158	.	768	Q5HYM0	ZC12B_HUMAN	T	779;768;715	ENSP00000340839:M779T;ENSP00000408077:M768T	ENSP00000218172:M715T	M	+	2	0	ZC3H12B	64639639	1.000000	0.71417	0.995000	0.50966	0.959000	0.62525	3.812000	0.55628	1.991000	0.58162	0.412000	0.27726	ATG		0.478	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		13	76	0	0	0	0.09319	0	13	76				
MAGEE2	139599	broad.mit.edu	37	X	75004327	75004327	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:75004327A>C	ENST00000373359.2	-	1	752	c.560T>G	c.(559-561)aTc>aGc	p.I187S		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	187	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.I187S(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATTCAAGAGGATGTGGCCTAG	0.502																																							uc004ecj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(559-561)ATC>AGC		melanoma antigen family E, 2							53.0	47.0	49.0					X																	75004327		2203	4300	6503	SO:0001583	missense	139599							g.chrX:75004327A>C	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.560T>G	X.37:g.75004327A>C	ENSP00000362457:p.Ile187Ser		Somatic					p.I187S	NM_138703	NP_619648	WXS	Illumina HiSeq	Unspecified	Q8TD90	MAGE2_HUMAN			1	745	-			187			MAGE 1.		Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	c.560T>G	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	A	9.054	0.992925	0.19043	.	.	ENSG00000186675	ENST00000373359	T	0.12879	2.64	3.1	3.1	0.35709	.	.	.	.	.	T	0.40932	0.1137	M	0.92268	3.29	0.09310	N	1	D	0.76494	0.999	D	0.67231	0.95	T	0.22034	-1.0228	9	0.87932	D	0	.	6.97	0.24644	1.0:0.0:0.0:0.0	.	187	Q8TD90	MAGE2_HUMAN	S	187	ENSP00000362457:I187S	ENSP00000362457:I187S	I	-	2	0	MAGEE2	74921052	1.000000	0.71417	0.004000	0.12327	0.088000	0.18126	2.862000	0.48388	1.451000	0.47736	0.345000	0.21793	ATC		0.502	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		5	41	0	0	0	0.014758	0	5	41				
TRMT2B	79979	broad.mit.edu	37	X	100274014	100274014	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:100274014G>A	ENST00000372936.3	-	13	2106	c.1334C>T	c.(1333-1335)aCg>aTg	p.T445M	TRMT2B_ENST00000338687.7_Missense_Mutation_p.T400M|TRMT2B_ENST00000545398.1_Missense_Mutation_p.T445M|TRMT2B_ENST00000372935.1_Missense_Mutation_p.T445M|TRMT2B_ENST00000372931.5_Missense_Mutation_p.T445M|TRMT2B_ENST00000372939.1_Missense_Mutation_p.T400M	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	445						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)	p.T445M(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						AAAAACTAGCGTGTGGATGGC	0.373																																							uc004egq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1333-1335)ACG>ATG		TRM2 tRNA methyltransferase 2 homolog B							166.0	157.0	160.0					X																	100274014		2203	4300	6503	SO:0001583	missense	79979						tRNA (uracil-5-)-methyltransferase activity	g.chrX:100274014G>A	BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.1334C>T	X.37:g.100274014G>A	ENSP00000362027:p.Thr445Met		Somatic				TRMT2B_uc004egp.2_RNA|TRMT2B_uc004egr.2_Missense_Mutation_p.T445M|TRMT2B_uc004egs.2_Missense_Mutation_p.T445M|TRMT2B_uc004egt.2_Missense_Mutation_p.T445M|TRMT2B_uc004egu.2_Missense_Mutation_p.T326M|TRMT2B_uc004egv.2_Missense_Mutation_p.T400M	p.T445M	NM_024917	NP_079193	WXS	Illumina HiSeq	Unspecified	Q96GJ1	TRM2_HUMAN			12	1633	-			445					A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Missense_Mutation	SNP	ENST00000372936.3	37	c.1334C>T	CCDS14477.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255988	0.39896	.	.	ENSG00000188917	ENST00000338687;ENST00000545398;ENST00000372939;ENST00000372935;ENST00000372936;ENST00000372931	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91	5.16	1.14	0.20703	.	0.170189	0.49305	D	0.000145	T	0.36468	0.0968	M	0.77486	2.375	0.09310	N	1	D;D;P	0.58970	0.984;0.984;0.87	P;P;P	0.53062	0.584;0.717;0.601	T	0.19582	-1.0301	10	0.87932	D	0	-3.6585	6.1783	0.20457	0.1735:0.2807:0.5457:0.0	.	400;445;445	Q96GJ1-3;F2Z384;Q96GJ1	.;.;TRM2_HUMAN	M	400;445;400;445;445;445	ENSP00000340970:T400M;ENSP00000438134:T445M;ENSP00000362030:T400M;ENSP00000362026:T445M;ENSP00000362027:T445M;ENSP00000362022:T445M	ENSP00000340970:T400M	T	-	2	0	TRMT2B	100160670	0.608000	0.26966	0.005000	0.12908	0.758000	0.43043	0.555000	0.23422	0.168000	0.19655	-0.302000	0.09304	ACG		0.373	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1	NM_024917		7	136	0	0	0	0.047766	0	7	136				
AMOT	154796	broad.mit.edu	37	X	112024327	112024327	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:112024327G>T	ENST00000524145.1	-	10	2334	c.2260C>A	c.(2260-2262)Cag>Aag	p.Q754K	MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371958.1_Missense_Mutation_p.Q522K|AMOT_ENST00000371962.1_Missense_Mutation_p.Q522K|AMOT_ENST00000304758.1_Missense_Mutation_p.Q345K|AMOT_ENST00000371959.3_Missense_Mutation_p.Q754K			Q4VCS5	AMOT_HUMAN	angiomotin	754					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q345K(1)|p.Q754K(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TCAATAATCTGGGCATGGAGG	0.532																																							uc004epr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2260-2262)CAG>AAG		angiomotin isoform 1							122.0	115.0	118.0					X																	112024327		2203	4300	6503	SO:0001583	missense	154796				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity	g.chrX:112024327G>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2260C>A	X.37:g.112024327G>T	ENSP00000429013:p.Gln754Lys		Somatic				AMOT_uc004eps.2_Missense_Mutation_p.Q345K|AMOT_uc011mtc.1_5'UTR|hsa-mir-4329|MI0015901_5'Flank	p.Q754K	NM_001113490	NP_001106962	WXS	Illumina HiSeq	Unspecified	Q4VCS5	AMOT_HUMAN			9	2260	-			754					Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	c.2260C>A	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993632	0.54041	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.24151	1.9;2.18;2.43;2.18;1.87	5.56	5.56	0.83823	Angiomotin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	L	0.39020	1.185	0.58432	D	0.999998	D	0.76494	0.999	D	0.81914	0.995	T	0.06356	-1.0831	10	0.02654	T	1	-12.98	17.3819	0.87407	0.0:0.0:1.0:0.0	.	754	Q4VCS5	AMOT_HUMAN	K	345;754;522;754;522	ENSP00000305557:Q345K;ENSP00000361027:Q754K;ENSP00000361030:Q522K;ENSP00000429013:Q754K;ENSP00000361026:Q522K	ENSP00000305557:Q345K	Q	-	1	0	AMOT	111910983	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.438000	0.97539	2.318000	0.78349	0.513000	0.50165	CAG		0.532	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265		13	162	1	0	4.36969e-10	0.105934	5.06329e-10	13	162				
VBP1	7411	broad.mit.edu	37	X	154456758	154456758	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chrX:154456758G>T	ENST00000286428.5	+	4	495	c.378G>T	c.(376-378)tgG>tgT	p.W126C	VBP1_ENST00000535916.1_Missense_Mutation_p.W121C	NM_003372.5	NP_003363.1	P61758	PFD3_HUMAN	von Hippel-Lindau binding protein 1	126					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)		p.W126C(1)		NS(1)|endometrium(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGTGTCTGTGGTTGGGGGTAA	0.398																																							uc004fnc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(376-378)TGG>TGT		von Hippel-Lindau binding protein 1							155.0	132.0	140.0					X																	154456758		2203	4300	6503	SO:0001583	missense	7411				'de novo' posttranslational protein folding	nucleus|prefoldin complex	unfolded protein binding	g.chrX:154456758G>T	U56833	CCDS14765.1	Xq28	2008-07-07			ENSG00000155959	ENSG00000155959			12662	protein-coding gene	gene with protein product	"""prefoldin 3"""	300133				8674032, 9339366	Standard	NM_003372		Approved	PFD3, PFDN3	uc004fnc.3	P61758	OTTHUMG00000022666	ENST00000286428.5:c.378G>T	X.37:g.154456758G>T	ENSP00000286428:p.Trp126Cys		Somatic				VBP1_uc004fnd.2_Missense_Mutation_p.W89C	p.W126C	NM_003372	NP_003363	WXS	Illumina HiSeq	Unspecified	P61758	PFD3_HUMAN			4	437	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		126					B2R8L5|O55228|Q15765|Q5JT81|Q86X96	Missense_Mutation	SNP	ENST00000286428.5	37	c.378G>T	CCDS14765.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812746	0.70912	.	.	ENSG00000155959	ENST00000535916;ENST00000286428	T;T	0.47177	0.85;0.85	5.05	5.05	0.67936	Prefoldin (1);Prefoldin subunit (1);	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83330	-0.0013	10	0.87932	D	0	-9.0993	15.1451	0.72643	0.0:0.0:1.0:0.0	.	126	P61758	PFD3_HUMAN	C	121;126	ENSP00000438694:W121C;ENSP00000286428:W126C	ENSP00000286428:W126C	W	+	3	0	VBP1	154109952	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.405000	0.97313	2.252000	0.74401	0.544000	0.68410	TGG		0.398	VBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058806.1			11	155	1	0	6.40141e-05	0.080935	7.30161e-05	11	155				
PHLDA2	7262	broad.mit.edu	37	11	2950237	2950238	+	Frame_Shift_Ins	INS	-	-	G			TCGA-75-6205-01A-11D-1753-08	TCGA-75-6205-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	79c0e183-95aa-4c37-9b15-8567aa87c93a	e5c1b4a8-e9f1-40c0-a1ef-58a184918b2c	g.chr11:2950237_2950238insG	ENST00000314222.4	-	1	447_448	c.357_358insC	c.(355-360)cccgccfs	p.A120fs		NM_003311.3	NP_003302.1	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain, family A, member 2	120					apoptotic process (GO:0006915)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|regulation of gene expression (GO:0010468)|regulation of glycogen metabolic process (GO:0070873)	cytoplasm (GO:0005737)|membrane (GO:0016020)				central_nervous_system(1)	1		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCGGGTGCGGCGGGTGCGGTGC	0.743																																							uc001lxa.1		NA																	0					0						c.(355-360)CCCGCCfs		pleckstrin homology-like domain family A member																																				SO:0001589	frameshift_variant	7262				apoptosis	cytoplasm|membrane		g.chr11:2950237_2950238insG	AF035444	CCDS7741.1	11p15.4	2013-01-10	2003-09-26	2003-10-01	ENSG00000181649	ENSG00000181649		"""Pleckstrin homology (PH) domain containing"""	12385	protein-coding gene	gene with protein product		602131	"""tumor suppressing subtransferable candidate 3"""	TSSC3		9328465, 9403053	Standard	NM_003311		Approved	IPL, BWR1C, HLDA2	uc001lxa.1	Q53GA4	OTTHUMG00000010926	ENST00000314222.4:c.358dupC	11.37:g.2950240_2950240dupG	ENSP00000319231:p.Ala120fs		Somatic					p.P119fs	NM_003311	NP_003302	WXS	Illumina HiSeq	Unspecified	Q53GA4	PHLA2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	413_414	-		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)	119_120					O00496	Frame_Shift_Ins	INS	ENST00000314222.4	37	c.357_358insC	CCDS7741.1																																																																																				0.743	PHLDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030116.1	NM_003311		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
