#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PTCHD2	57540	broad.mit.edu	37	1	11591064	11591064	+	Missense_Mutation	SNP	C	C	T	rs528432088		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:11591064C>T	ENST00000294484.6	+	16	3341	c.3203C>T	c.(3202-3204)cCg>cTg	p.P1068L	PTCHD2_ENST00000304391.6_5'Flank|PTCHD2_ENST00000389575.3_Missense_Mutation_p.P1068L	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1068					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CTGGTGAAGCCGGGTGGGGCC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15688	0.0		0.0	False		,,,				2504	0.0						uc001ash.3		NA																	0				skin(3)|ovary(2)|pancreas(1)|breast(1)	7						c.(3202-3204)CCG>CTG		patched domain containing 2							70.0	82.0	78.0					1																	11591064		2051	4201	6252	SO:0001583	missense	57540				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity	g.chr1:11591064C>T	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3203C>T	1.37:g.11591064C>T	ENSP00000294484:p.Pro1068Leu		Somatic					p.P1068L	NM_020780	NP_065831	WXS	Illumina HiSeq	Unspecified	Q9P2K9	PTHD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)	16	3341	+	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	1068			Extracellular (Potential).		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	c.3203C>T	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833967	0.71373	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.91011	-2.77;-2.73	4.98	4.98	0.66077	.	0.072979	0.53938	D	0.000041	D	0.87977	0.6314	L	0.27053	0.805	0.80722	D	1	D	0.64830	0.994	P	0.50270	0.636	D	0.89228	0.3575	10	0.66056	D	0.02	-16.1553	13.0526	0.58962	0.0:0.8385:0.1614:0.0	.	1068	Q9P2K9	PTHD2_HUMAN	L	1068	ENSP00000294484:P1068L;ENSP00000374226:P1068L	ENSP00000294484:P1068L	P	+	2	0	PTCHD2	11513651	1.000000	0.71417	0.958000	0.39756	0.460000	0.32559	5.806000	0.69150	2.316000	0.78162	0.591000	0.81541	CCG		0.622	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561		41	75	0	0	0	0.007835	0	41	75				
EYA3	2140	broad.mit.edu	37	1	28316211	28316211	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:28316211G>C	ENST00000373871.3	-	15	1655	c.1415C>G	c.(1414-1416)tCc>tGc	p.S472C	EYA3_ENST00000436342.2_Missense_Mutation_p.S346C|EYA3_ENST00000545175.1_Missense_Mutation_p.S419C|EYA3_ENST00000373864.1_Missense_Mutation_p.S315C|EYA3_ENST00000373863.3_Missense_Mutation_p.S426C|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000540618.1_Missense_Mutation_p.S426C	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	472					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		TCCATACCTGGACTGGATGAG	0.423																																							uc001bpi.1		NA																	0				ovary(2)|skin(1)	3						c.(1414-1416)TCC>TGC		eyes absent 3							184.0	184.0	184.0					1																	28316211		2203	4300	6503	SO:0001583	missense	2140				anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity	g.chr1:28316211G>C	U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.1415C>G	1.37:g.28316211G>C	ENSP00000362978:p.Ser472Cys		Somatic				EYA3_uc010ofs.1_Missense_Mutation_p.S419C|EYA3_uc010oft.1_Missense_Mutation_p.S426C|EYA3_uc001bpj.2_Missense_Mutation_p.S426C|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	p.S472C	NM_001990	NP_001981	WXS	Illumina HiSeq	Unspecified	Q99504	EYA3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)	15	1580	-		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	472					A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Missense_Mutation	SNP	ENST00000373871.3	37	c.1415C>G	CCDS316.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005020	0.93287	.	.	ENSG00000158161	ENST00000373871;ENST00000436342;ENST00000373864;ENST00000540618;ENST00000545175;ENST00000373863	D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	6.17	6.17	0.99709	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.991;0.982;0.997	D	0.91184	0.4978	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	426;426;472	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	C	472;346;315;426;419;426	ENSP00000362978:S472C;ENSP00000405587:S346C;ENSP00000362971:S315C;ENSP00000442558:S426C;ENSP00000442280:S419C;ENSP00000362970:S426C	ENSP00000362970:S426C	S	-	2	0	EYA3	28188798	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.804000	0.99143	2.941000	0.99782	0.655000	0.94253	TCC		0.423	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1	NM_001990		43	65	0	0	0	0.00361	0	43	65				
DLGAP3	58512	broad.mit.edu	37	1	35370403	35370403	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:35370403G>T	ENST00000373347.1	-	3	850	c.582C>A	c.(580-582)gaC>gaA	p.D194E	DLGAP3_ENST00000495979.1_5'Flank|DLGAP3_ENST00000235180.4_Missense_Mutation_p.D194E			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	194					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GCCCATTATAGTCCCGCTTCC	0.647																																							uc001byc.2		NA																	0				ovary(3)	3						c.(580-582)GAC>GAA		discs, large (Drosophila) homolog-associated							26.0	28.0	27.0					1																	35370403		2203	4297	6500	SO:0001583	missense	58512				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		g.chr1:35370403G>T	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.582C>A	1.37:g.35370403G>T	ENSP00000362444:p.Asp194Glu		Somatic					p.D194E	NM_001080418	NP_001073887	WXS	Illumina HiSeq	Unspecified	O95886	DLGP3_HUMAN			1	582	-		Myeloproliferative disorder(586;0.0393)	194					Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	c.582C>A	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	G	5.093	0.202863	0.09704	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.23552	1.9;1.9	4.47	2.29	0.28610	.	0.126216	0.53938	D	0.000043	T	0.11793	0.0287	N	0.11927	0.2	0.31210	N	0.698711	B	0.13594	0.008	B	0.10450	0.005	T	0.12811	-1.0533	10	0.23891	T	0.37	-12.827	6.8141	0.23820	0.1842:0.3212:0.4945:0.0	.	194	O95886	DLGP3_HUMAN	E	194	ENSP00000362444:D194E;ENSP00000235180:D194E	ENSP00000235180:D194E	D	-	3	2	DLGAP3	35142990	0.948000	0.32251	1.000000	0.80357	0.957000	0.61999	0.087000	0.14958	0.959000	0.37980	0.448000	0.29417	GAC		0.647	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		18	22	1	0	2.94398e-08	0.007413	4.16858e-08	18	22				
RLF	6018	broad.mit.edu	37	1	40705790	40705790	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:40705790A>T	ENST00000372771.4	+	8	5443	c.5416A>T	c.(5416-5418)Aat>Tat	p.N1806Y		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1806					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			ACAGTCCAGTAATGATTTAAC	0.353																																							uc001cfc.3		NA																	0				ovary(2)|pancreas(1)	3						c.(5416-5418)AAT>TAT		rearranged L-myc fusion							106.0	104.0	105.0					1																	40705790		2203	4300	6503	SO:0001583	missense	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40705790A>T		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.5416A>T	1.37:g.40705790A>T	ENSP00000361857:p.Asn1806Tyr		Somatic				RLF_uc001cfd.3_Missense_Mutation_p.N1497Y	p.N1806Y	NM_012421	NP_036553	WXS	Illumina HiSeq	Unspecified	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		8	5447	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	1806					Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	c.5416A>T	CCDS448.1	.	.	.	.	.	.	.	.	.	.	A	7.146	0.582812	0.13749	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.14640	2.49	5.35	3.04	0.35103	.	0.612464	0.18584	N	0.136935	T	0.08891	0.0220	N	0.22421	0.69	0.33638	D	0.606966	B;B	0.24483	0.104;0.018	B;B	0.24006	0.05;0.023	T	0.09100	-1.0690	10	0.54805	T	0.06	-13.9876	6.5447	0.22400	0.7573:0.1594:0.0833:0.0	.	1499;1806	F5H2M5;Q13129	.;RLF_HUMAN	Y	1806;1499	ENSP00000361857:N1806Y	ENSP00000361857:N1806Y	N	+	1	0	RLF	40478377	0.991000	0.36638	1.000000	0.80357	0.830000	0.47004	0.663000	0.25053	1.123000	0.41961	0.533000	0.62120	AAT		0.353	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		6	35	0	0	0	0.001168	0	6	35				
ZSWIM5	57643	broad.mit.edu	37	1	45501863	45501863	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:45501863C>A	ENST00000359600.5	-	9	2208	c.2003G>T	c.(2002-2004)gGc>gTc	p.G668V	AL359473.1_ENST00000583502.1_RNA	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	668						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TTGACCCAGGCCCATCAGTGC	0.567																																							uc001cnd.2		NA																	0					0						c.(2002-2004)GGC>GTC		zinc finger, SWIM domain containing 5							73.0	71.0	71.0					1																	45501863		2012	4169	6181	SO:0001583	missense	57643						zinc ion binding	g.chr1:45501863C>A	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.2003G>T	1.37:g.45501863C>A	ENSP00000352614:p.Gly668Val		Somatic					p.G668V	NM_020883	NP_065934	WXS	Illumina HiSeq	Unspecified	Q9P217	ZSWM5_HUMAN			9	2231	-	Acute lymphoblastic leukemia(166;0.155)		668					Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	c.2003G>T	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	c	26.9	4.782983	0.90282	.	.	ENSG00000162415	ENST00000359600	T	0.58210	0.35	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.74696	0.3750	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.77186	-0.2680	10	0.87932	D	0	-15.2488	19.6294	0.95694	0.0:1.0:0.0:0.0	.	668	Q9P217	ZSWM5_HUMAN	V	668	ENSP00000352614:G668V	ENSP00000352614:G668V	G	-	2	0	ZSWIM5	45274450	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.750000	0.85110	2.822000	0.97130	0.650000	0.86243	GGC		0.567	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581		24	36	1	0	7.87624e-14	0.00278	1.23456e-13	24	36				
EPS8L3	79574	broad.mit.edu	37	1	110293370	110293370	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:110293370C>T	ENST00000361965.4	-	18	1788	c.1682G>A	c.(1681-1683)cGc>cAc	p.R561H	EPS8L3_ENST00000361852.4_Missense_Mutation_p.R531H|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Missense_Mutation_p.R562H	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	561						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		AGGTCTTATGCGAAGTAGCTG	0.607																																							uc001dyr.1		NA																	0				ovary(2)|skin(1)	3						c.(1681-1683)CGC>CAC		epidermal growth factor receptor pathway							73.0	55.0	61.0					1																	110293370		2203	4300	6503	SO:0001583	missense	79574					cytoplasm	protein binding	g.chr1:110293370C>T	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1682G>A	1.37:g.110293370C>T	ENSP00000355255:p.Arg561His		Somatic				EPS8L3_uc001dys.1_Missense_Mutation_p.R531H|EPS8L3_uc001dyq.1_Missense_Mutation_p.R562H|EPS8L3_uc009wfm.1_Missense_Mutation_p.R498H	p.R561H	NM_133181	NP_573444	WXS	Illumina HiSeq	Unspecified	Q8TE67	ES8L3_HUMAN		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)	18	1827	-		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)	561					A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	c.1682G>A	CCDS814.1	.	.	.	.	.	.	.	.	.	.	C	3.321	-0.138654	0.06669	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.17691	2.26;2.26;2.26	5.64	-4.37	0.03633	.	0.632046	0.18247	N	0.147058	T	0.01558	0.0050	N	0.01817	-0.705	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.37888	-0.9686	10	0.31617	T	0.26	-5.1502	12.5002	0.55952	0.0:0.5334:0.0:0.4666	.	531;561;562	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	H	531;562;561	ENSP00000354551:R531H;ENSP00000358820:R562H;ENSP00000355255:R561H	ENSP00000354551:R531H	R	-	2	0	EPS8L3	110094893	0.789000	0.28775	0.152000	0.22495	0.484000	0.33280	-0.197000	0.09518	-1.180000	0.02734	-2.069000	0.00389	CGC		0.607	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		16	19	0	0	0	0.00499	0	16	19				
SLC16A1	6566	broad.mit.edu	37	1	113460446	113460446	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:113460446G>A	ENST00000538576.1	-	4	1413	c.582C>T	c.(580-582)ctC>ctT	p.L194L	SLC16A1_ENST00000433570.4_Silent_p.L194L|SLC16A1_ENST00000369626.3_Silent_p.L194L	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	194					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TTGGTCGCATGAGGGCTCCAG	0.488																																							uc001ecx.2		NA																	0				central_nervous_system(1)	1						c.(580-582)CTC>CTT		solute carrier family 16, member 1	Pyruvic acid(DB00119)						79.0	79.0	79.0					1																	113460446		2203	4300	6503	SO:0001819	synonymous_variant	6566				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr1:113460446G>A	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.582C>T	1.37:g.113460446G>A			Somatic				SLC16A1_uc001ecy.2_Silent_p.L194L|SLC16A1_uc001ecz.2_Silent_p.L194L	p.L194L	NM_003051	NP_003042	WXS	Illumina HiSeq	Unspecified	P53985	MOT1_HUMAN		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	4	1414	-	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)	194			Cytoplasmic (Potential).		Q49A45|Q5T8R6|Q9NSJ9	Silent	SNP	ENST00000538576.1	37	c.582C>T	CCDS858.1																																																																																				0.488	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051		29	27	0	0	0	0.008361	0	29	27				
ZNF697	90874	broad.mit.edu	37	1	120165529	120165529	+	Silent	SNP	C	C	T	rs189746277	byFrequency	TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:120165529C>T	ENST00000421812.2	-	3	1556	c.1437G>A	c.(1435-1437)acG>acA	p.T479T		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GCTGCGTGAGCGTGGAGAAGT	0.652																																							uc001ehy.1		NA																	0				ovary(1)	1						c.(1435-1437)ACG>ACA		zinc finger protein 697							25.0	29.0	27.0					1																	120165529		2203	4300	6503	SO:0001819	synonymous_variant	90874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:120165529C>T	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1437G>A	1.37:g.120165529C>T			Somatic					p.T479T	NM_001080470	NP_001073939	WXS	Illumina HiSeq	Unspecified	Q5TEC3	ZN697_HUMAN		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)	3	1551	-	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)	479			C2H2-type 9.		Q96IT2	Silent	SNP	ENST00000421812.2	37	c.1437G>A	CCDS44202.1																																																																																				0.652	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286		10	4	0	0	0	0.006214	0	10	4				
PHGDH	26227	broad.mit.edu	37	1	120266064	120266064	+	Splice_Site	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:120266064G>T	ENST00000369409.4	+	3	492	c.356G>T	c.(355-357)aGg>aTg	p.R119M	PHGDH_ENST00000369407.3_Splice_Site_p.R85M	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	119					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		TGCCTGGCCAGGTAAGTCCCT	0.473																																							uc001ehz.2		NA																	0				ovary(1)	1						c.(355-357)AGG>ATG		phosphoglycerate dehydrogenase	NADH(DB00157)						160.0	143.0	149.0					1																	120266064		2203	4300	6503	SO:0001630	splice_region_variant	26227				brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity	g.chr1:120266064G>T	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.356+1G>T	1.37:g.120266064G>T			Somatic				PHGDH_uc009whl.2_Translation_Start_Site|PHGDH_uc009whm.2_Translation_Start_Site|PHGDH_uc001eia.2_Missense_Mutation_p.R119M|PHGDH_uc009whn.2_Missense_Mutation_p.R119M|PHGDH_uc001eib.2_Missense_Mutation_p.R85M	p.R119M	NM_006623	NP_006614	WXS	Illumina HiSeq	Unspecified	O43175	SERA_HUMAN		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	3	583	+	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)	119					B2RD08|Q5SZU3|Q9BQ01	Missense_Mutation	SNP	ENST00000369409.4	37	c.356G>T	CCDS904.1	.	.	.	.	.	.	.	.	.	.	G	33	5.227312	0.95173	.	.	ENSG00000092621	ENST00000369409;ENST00000369407	D;D	0.86230	-2.09;-2.09	5.83	5.83	0.93111	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96565	0.8879	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97815	1.0253	10	0.87932	D	0	-17.6347	18.6822	0.91549	0.0:0.0:1.0:0.0	.	85;119	Q5SZU1;O43175	.;SERA_HUMAN	M	119;85	ENSP00000358417:R119M;ENSP00000358415:R85M	ENSP00000358415:R85M	R	+	2	0	PHGDH	120067587	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.316000	0.96319	2.769000	0.95229	0.655000	0.94253	AGG		0.473	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623	Missense_Mutation	22	39	1	0	8.04996e-18	0.001882	1.29801e-17	22	39				
LCE3D	84648	broad.mit.edu	37	1	152552345	152552345	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:152552345G>T	ENST00000368787.3	-	2	124	c.68C>A	c.(67-69)cCa>cAa	p.P23Q		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	23					keratinization (GO:0031424)					breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		TGGGCTCTTTGGGGGACACTT	0.612																																							uc001fab.2		NA																	0					0						c.(67-69)CCA>CAA		late cornified envelope 3D							101.0	109.0	106.0					1																	152552345		2203	4300	6503	SO:0001583	missense	84648				keratinization			g.chr1:152552345G>T	BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	Standard	NM_032563		Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.68C>A	1.37:g.152552345G>T	ENSP00000357776:p.Pro23Gln		Somatic					p.P23Q	NM_032563	NP_115952	WXS	Illumina HiSeq	Unspecified	Q9BYE3	LCE3D_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)	2	125	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		23					Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	37	c.68C>A	CCDS1014.1	.	.	.	.	.	.	.	.	.	.	G	9.833	1.188962	0.21954	.	.	ENSG00000163202	ENST00000368787	T	0.13089	2.62	3.8	2.84	0.33178	.	.	.	.	.	T	0.04272	0.0118	.	.	.	0.32389	N	0.553569	P	0.35107	0.484	B	0.30179	0.112	T	0.24835	-1.0149	8	0.72032	D	0.01	.	8.4793	0.33032	0.0:0.0:0.7679:0.2321	.	23	Q9BYE3	LCE3D_HUMAN	Q	23	ENSP00000357776:P23Q	ENSP00000357776:P23Q	P	-	2	0	LCE3D	150818969	0.988000	0.35896	0.987000	0.45799	0.976000	0.68499	2.451000	0.44952	0.879000	0.35944	0.655000	0.94253	CCA		0.612	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1	NM_032563		8	145	1	0	0.00307968	0.00308	0.00348272	8	145				
LCE2B	26239	broad.mit.edu	37	1	152659578	152659578	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:152659578C>T	ENST00000368780.3	+	2	313	c.259C>T	c.(259-261)Cag>Tag	p.Q87*	LCE2B_ENST00000417924.2_Nonsense_Mutation_p.Q87*	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	87	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGCCGGCACCAGAGCCCCGA	0.667																																							uc001fai.2		NA																	0				ovary(1)|skin(1)	2						c.(259-261)CAG>TAG		late cornified envelope 2B							39.0	51.0	47.0					1																	152659578		2201	4293	6494	SO:0001587	stop_gained	26239				keratinization			g.chr1:152659578C>T	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.259C>T	1.37:g.152659578C>T	ENSP00000357769:p.Gln87*		Somatic					p.Q87*	NM_014357	NP_055172	WXS	Illumina HiSeq	Unspecified	O14633	LCE2B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	313	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		87			Cys-rich.		Q5TA80	Nonsense_Mutation	SNP	ENST00000368780.3	37	c.259C>T	CCDS1020.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036181	0.35893	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	.	.	.	2.46	1.51	0.23008	.	.	.	.	.	.	.	.	.	.	.	0.23787	N	0.996843	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.0639	0.14572	0.0:0.8171:0.0:0.1829	.	.	.	.	X	87	.	ENSP00000357769:Q87X	Q	+	1	0	LCE2B	150926202	0.000000	0.05858	0.004000	0.12327	0.240000	0.25518	0.530000	0.23036	0.345000	0.23873	0.313000	0.20887	CAG		0.667	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034524.1	NM_014357		45	116	0	0	0	0.00874	0	45	116				
LELP1	149018	broad.mit.edu	37	1	153177365	153177365	+	Missense_Mutation	SNP	G	G	A	rs200747820		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:153177365G>A	ENST00000368747.1	+	2	292	c.182G>A	c.(181-183)tGc>tAc	p.C61Y		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	61	Cys/Pro-rich.									NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCTGCCCTGCCCCTCGCAG	0.592																																							uc001fbl.2		NA																	0				ovary(1)	1						c.(181-183)TGC>TAC		late cornified envelope-like proline-rich 1		G	TYR/CYS	1,4405	2.1+/-5.4	0,1,2202	155.0	124.0	134.0		182	5.4	1.0	1		134	0,8600		0,0,4300	no	missense	LELP1	NM_001010857.1	194	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	61/99	153177365	1,13005	2203	4300	6503	SO:0001583	missense	149018							g.chr1:153177365G>A		CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.182G>A	1.37:g.153177365G>A	ENSP00000357736:p.Cys61Tyr		Somatic					p.C61Y	NM_001010857	NP_001010857	WXS	Illumina HiSeq	Unspecified	Q5T871	LELP1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	292	+	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		61			Cys/Pro-rich.		A1L4E1	Missense_Mutation	SNP	ENST00000368747.1	37	c.182G>A	CCDS30869.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454292	0.26161	2.27E-4	0.0	ENSG00000203784	ENST00000368747	.	.	.	5.41	5.41	0.78517	.	0.000000	0.48767	D	0.000161	T	0.75133	0.3808	.	.	.	0.37320	D	0.909522	D	0.89917	1.0	D	0.87578	0.998	T	0.78401	-0.2218	8	0.87932	D	0	-0.7481	14.5727	0.68224	0.0:0.0:1.0:0.0	.	61	Q5T871	LELP1_HUMAN	Y	61	.	ENSP00000357736:C61Y	C	+	2	0	LELP1	151443989	0.522000	0.26266	0.995000	0.50966	0.657000	0.38888	2.570000	0.45981	2.816000	0.96949	0.561000	0.74099	TGC		0.592	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039104.1	NM_001010857		25	46	0	0	0	0.003954	0	25	46				
BCAN	63827	broad.mit.edu	37	1	156622210	156622210	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:156622210G>A	ENST00000329117.5	+	8	1804	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	BCAN_ENST00000361588.5_Missense_Mutation_p.G490S|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	490					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCAGCCCGGGCCCTGAGGC	0.607																																							uc001fpp.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1468-1470)GGC>AGC		brevican isoform 1							13.0	13.0	13.0					1																	156622210		2202	4297	6499	SO:0001583	missense	63827				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding	g.chr1:156622210G>A	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1468G>A	1.37:g.156622210G>A	ENSP00000331210:p.Gly490Ser		Somatic				BCAN_uc001fpo.2_Missense_Mutation_p.G490S	p.G490S	NM_021948	NP_068767	WXS	Illumina HiSeq	Unspecified	Q96GW7	PGCB_HUMAN			8	1804	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		490					D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	c.1468G>A	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	0.889	-0.726175	0.03158	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.13196	2.61;3.33	4.24	3.25	0.37280	.	0.749750	0.11161	N	0.593077	T	0.02380	0.0073	N	0.19112	0.55	0.09310	N	1	B;B	0.17465	0.003;0.022	B;B	0.18871	0.004;0.023	T	0.41395	-0.9511	10	0.08381	T	0.77	-0.8248	9.1507	0.36962	0.0:0.2238:0.7762:0.0	.	490;490	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	S	429;490;490	ENSP00000331210:G490S;ENSP00000354925:G490S	ENSP00000255029:G429S	G	+	1	0	BCAN	154888834	0.013000	0.17824	0.054000	0.19295	0.865000	0.49528	1.226000	0.32563	1.907000	0.55213	0.555000	0.69702	GGC		0.607	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		3	16	0	0	0	0.004672	0	3	16				
ARHGEF11	9826	broad.mit.edu	37	1	156912554	156912554	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:156912554A>G	ENST00000361409.2	-	32	3876	c.3134T>C	c.(3133-3135)aTc>aCc	p.I1045T	ARHGEF11_ENST00000315174.8_Missense_Mutation_p.I461T|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.I1085T	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1045	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTGCAGATGATGAAGAAGGC	0.537																																							uc001fqo.2		NA																	0				ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(3133-3135)ATC>ACC		Rho guanine nucleotide exchange factor (GEF) 11							178.0	143.0	155.0					1																	156912554		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156912554A>G	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3134T>C	1.37:g.156912554A>G	ENSP00000354644:p.Ile1045Thr		Somatic				ARHGEF11_uc010phu.1_Missense_Mutation_p.I461T|ARHGEF11_uc001fqn.2_Missense_Mutation_p.I1085T	p.I1045T	NM_014784	NP_055599	WXS	Illumina HiSeq	Unspecified	O15085	ARHGB_HUMAN			32	4174	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1045			PH.		D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.3134T>C	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137567	0.56936	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.66995	-0.24;-0.24;-0.24	4.9	3.78	0.43462	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.107337	0.41294	N	0.000909	T	0.55847	0.1946	L	0.43923	1.385	0.42377	D	0.992479	B;B;B	0.15141	0.004;0.012;0.01	B;B;B	0.42995	0.326;0.291;0.404	T	0.61917	-0.6964	10	0.87932	D	0	-12.8264	10.0614	0.42277	0.9207:0.0:0.0793:0.0	.	461;1045;1085	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	T	1085;1045;461	ENSP00000357177:I1085T;ENSP00000354644:I1045T;ENSP00000313470:I461T	ENSP00000313470:I461T	I	-	2	0	ARHGEF11	155179178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.976000	0.63785	0.913000	0.36797	0.533000	0.62120	ATC		0.537	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		3	98	0	0	0	0.000248	0	3	98				
CD1E	913	broad.mit.edu	37	1	158326366	158326366	+	Missense_Mutation	SNP	G	G	A	rs201409041		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:158326366G>A	ENST00000368167.3	+	5	1222	c.983G>A	c.(982-984)cGg>cAg	p.R328Q	CD1E_ENST00000368164.3_3'UTR|CD1E_ENST00000368161.3_3'UTR|CD1E_ENST00000368166.3_Missense_Mutation_p.R139Q|CD1E_ENST00000368157.1_Missense_Mutation_p.R84Q|CD1E_ENST00000368154.1_Missense_Mutation_p.R84Q|CD1E_ENST00000368155.3_Missense_Mutation_p.R183Q|CD1E_ENST00000368156.1_Missense_Mutation_p.R238Q|CD1E_ENST00000452291.2_Missense_Mutation_p.R139Q|CD1E_ENST00000368163.3_Missense_Mutation_p.R273Q|CD1E_ENST00000368160.3_Missense_Mutation_p.R328Q|CD1E_ENST00000368165.3_Missense_Mutation_p.R238Q|CD1E_ENST00000444681.2_Missense_Mutation_p.R229Q|CD1E_ENST00000434258.1_3'UTR	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	328					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GTTGACTCACGGTTAAAAAAA	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		18667	0.001		0.0	False		,,,				2504	0.0						uc001fse.2		NA																	0				skin(3)	3						c.(982-984)CGG>CAG		CD1E antigen isoform a precursor							89.0	81.0	84.0					1																	158326366		1830	4091	5921	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158326366G>A	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.983G>A	1.37:g.158326366G>A	ENSP00000357149:p.Arg328Gln		Somatic				CD1E_uc010pid.1_3'UTR|CD1E_uc010pie.1_3'UTR|CD1E_uc010pif.1_3'UTR|CD1E_uc001fsd.2_3'UTR|CD1E_uc001fsk.2_Missense_Mutation_p.R238Q|CD1E_uc001fsj.2_Missense_Mutation_p.R183Q|CD1E_uc001fsc.2_Missense_Mutation_p.R139Q|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.R84Q|CD1E_uc001fsf.2_Missense_Mutation_p.R328Q|CD1E_uc001fry.2_Missense_Mutation_p.R273Q|CD1E_uc001fsg.2_3'UTR|CD1E_uc001fsh.2_Missense_Mutation_p.R139Q|CD1E_uc001fsi.2_3'UTR|CD1E_uc009wsv.2_Missense_Mutation_p.R229Q|CD1E_uc001frz.2_Missense_Mutation_p.R238Q|CD1E_uc009wsw.2_Intron	p.R328Q	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			5	1222	+	all_hematologic(112;0.0378)		328					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.983G>A	CCDS41417.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	14.00	2.405451	0.42715	.	.	ENSG00000158488	ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368157;ENST00000368160;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T	0.49139	5.2;4.65;3.41;3.43;3.62;3.33;0.79;4.75;3.64;3.52;0.79	4.61	0.373	0.16178	.	1.918670	0.02438	N	0.084261	T	0.32823	0.0842	L	0.40543	1.245	0.09310	N	1	P;D;P;P;P;P;D;D;D;P	0.71674	0.934;0.996;0.53;0.898;0.938;0.667;0.978;0.998;0.988;0.53	B;P;B;B;B;B;B;P;B;B	0.56563	0.187;0.577;0.064;0.197;0.129;0.042;0.345;0.801;0.388;0.043	T	0.08472	-1.0720	10	0.56958	D	0.05	0.8068	3.3757	0.07237	0.0943:0.3161:0.4274:0.1622	.	229;238;183;139;328;328;139;84;238;273	E7EP01;P15812-5;P15812-7;P15812-9;P15812-2;P15812;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;CD1E_HUMAN;.;.;.;.	Q	229;328;139;238;139;273;84;328;238;183;84	ENSP00000402906:R229Q;ENSP00000357149:R328Q;ENSP00000416228:R139Q;ENSP00000357147:R238Q;ENSP00000357148:R139Q;ENSP00000357145:R273Q;ENSP00000357139:R84Q;ENSP00000357142:R328Q;ENSP00000357138:R238Q;ENSP00000357137:R183Q;ENSP00000357136:R84Q	ENSP00000357136:R84Q	R	+	2	0	CD1E	156592990	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.090000	0.11163	0.170000	0.19704	0.655000	0.94253	CGG		0.368	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		6	22	0	0	0	0.001168	0	6	22				
CD1E	913	broad.mit.edu	37	1	158326382	158326382	+	Splice_Site	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:158326382G>C	ENST00000368167.3	+	5	1237		c.e5+1		CD1E_ENST00000368164.3_Splice_Site|CD1E_ENST00000368161.3_Splice_Site|CD1E_ENST00000368166.3_Splice_Site|CD1E_ENST00000368157.1_Splice_Site|CD1E_ENST00000368154.1_Splice_Site|CD1E_ENST00000368155.3_Splice_Site|CD1E_ENST00000368156.1_Splice_Site|CD1E_ENST00000452291.2_Splice_Site|CD1E_ENST00000368163.3_Splice_Site|CD1E_ENST00000368160.3_Splice_Site|CD1E_ENST00000368165.3_Splice_Site|CD1E_ENST00000444681.2_Splice_Site|CD1E_ENST00000434258.1_3'UTR	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule						antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.?(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AAAAACAGAGGTGAGCTTTTT	0.368																																							uc001fse.2		NA																	1	Unknown(1)		lung(1)	skin(3)	3						c.e5+1		CD1E antigen isoform a precursor							88.0	79.0	82.0					1																	158326382		1828	4091	5919	SO:0001630	splice_region_variant	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158326382G>C	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.998+1G>C	1.37:g.158326382G>C			Somatic				CD1E_uc010pid.1_3'UTR|CD1E_uc010pie.1_3'UTR|CD1E_uc010pif.1_3'UTR|CD1E_uc001fsd.2_Splice_Site|CD1E_uc001fsk.2_Splice_Site_p.S243_splice|CD1E_uc001fsj.2_Splice_Site_p.S188_splice|CD1E_uc001fsc.2_Splice_Site_p.S144_splice|CD1E_uc010pig.1_Splice_Site|CD1E_uc001fsa.2_Splice_Site_p.S89_splice|CD1E_uc001fsf.2_Splice_Site_p.S333_splice|CD1E_uc001fry.2_Splice_Site_p.S278_splice|CD1E_uc001fsg.2_Splice_Site|CD1E_uc001fsh.2_Splice_Site_p.S144_splice|CD1E_uc001fsi.2_Splice_Site|CD1E_uc009wsv.2_Splice_Site_p.S234_splice|CD1E_uc001frz.2_Splice_Site_p.S243_splice|CD1E_uc009wsw.2_Intron	p.S333_splice	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			5	1237	+	all_hematologic(112;0.0378)							B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Splice_Site	SNP	ENST00000368167.3	37	c.998_splice	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601769	0.28534	.	.	ENSG00000158488	ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368157;ENST00000368160;ENST00000368156;ENST00000368155;ENST00000368154	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8091	0.57629	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD1E	156593006	0.998000	0.40836	0.679000	0.29978	0.028000	0.11728	3.482000	0.53186	2.401000	0.81631	0.655000	0.94253	.		0.368	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	Intron	5	20	0	0	0	0.000602	0	5	20				
SPTA1	6708	broad.mit.edu	37	1	158590209	158590209	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:158590209G>C	ENST00000368147.4	-	44	6348	c.6168C>G	c.(6166-6168)aaC>aaG	p.N2056K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2056					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACACCAGTTGTTCAAAGCTG	0.458																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(6166-6168)AAC>AAG		spectrin, alpha, erythrocytic 1							74.0	68.0	70.0					1																	158590209		1899	4121	6020	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158590209G>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6168C>G	1.37:g.158590209G>C	ENSP00000357129:p.Asn2056Lys		Somatic					p.N2056K	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			44	6367	-	all_hematologic(112;0.0378)		2056			Spectrin 20.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.6168C>G	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013405	0.75161	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.50001	0.76;0.76	4.88	3.95	0.45737	.	0.000000	0.35096	N	0.003456	T	0.53514	0.1801	M	0.83384	2.64	0.51767	D	0.999936	D	0.89917	1.0	D	0.91635	0.999	T	0.62286	-0.6886	10	0.06099	T	0.92	.	12.5211	0.56060	0.0843:0.0:0.9157:0.0	.	2056	P02549	SPTA1_HUMAN	K	2056;2053	ENSP00000357130:N2056K;ENSP00000357129:N2053K	ENSP00000357129:N2053K	N	-	3	2	SPTA1	156856833	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.525000	0.53502	2.537000	0.85549	0.460000	0.39030	AAC		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		12	30	0	0	0	0.00245	0	12	30				
LMX1A	4009	broad.mit.edu	37	1	165182882	165182882	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:165182882C>A	ENST00000342310.3	-	5	1047	c.665G>T	c.(664-666)aGg>aTg	p.R222M	LMX1A_ENST00000367893.4_Missense_Mutation_p.R222M|LMX1A_ENST00000294816.2_Missense_Mutation_p.R222M|RP11-38C18.2_ENST00000457106.1_RNA|RP11-38C18.3_ENST00000441773.1_RNA|LMX1A_ENST00000489443.2_5'Flank	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	222					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CTATACCTTCCTGCAGGGCTT	0.562																																							uc001gcy.1		NA																	0				central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(664-666)AGG>ATG		LIM homeobox transcription factor 1, alpha							147.0	136.0	139.0					1																	165182882		2203	4300	6503	SO:0001583	missense	4009					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:165182882C>A	AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.665G>T	1.37:g.165182882C>A	ENSP00000340226:p.Arg222Met		Somatic				LMX1A_uc001gcz.1_Missense_Mutation_p.R222M|LMX1A_uc001gcw.1_5'Flank|LMX1A_uc001gcx.1_5'Flank	p.R222M	NM_177398	NP_796372	WXS	Illumina HiSeq	Unspecified	Q8TE12	LMX1A_HUMAN			4	886	-	all_hematologic(923;0.248)		222			Homeobox.		B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Missense_Mutation	SNP	ENST00000342310.3	37	c.665G>T	CCDS1247.1	.	.	.	.	.	.	.	.	.	.	C	32	5.144254	0.94603	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	D;D;D	0.96427	-4.01;-4.01;-4.01	5.76	5.76	0.90799	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97854	0.9295	M	0.70595	2.14	0.80722	D	1.000000	D	0.89917	1.0	D	0.91635	0.999	D	0.98254	1.0495	9	0.72032	D	0.01	.	19.571	0.95419	0.0:1.0:0.0:0.0	.	222	Q8TE12	LMX1A_HUMAN	M	222	ENSP00000340226:R222M;ENSP00000294816:R222M;ENSP00000356868:R222M	ENSP00000294816:R222M	R	-	2	0	LMX1A	163449506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.288000	0.78691	2.713000	0.92767	0.655000	0.94253	AGG		0.562	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398		37	104	1	0	1.90571e-15	0.004289	3.02936e-15	37	104				
MROH9	80133	broad.mit.edu	37	1	170955788	170955788	+	Silent	SNP	C	C	A	rs374921240		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:170955788C>A	ENST00000367758.3	+	10	915	c.816C>A	c.(814-816)atC>atA	p.I272I	MROH9_ENST00000367759.4_Silent_p.I272I	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	272								p.I272I(1)									ATGATAAAATCGCATCTGATG	0.453																																							uc001ghg.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	pancreas(1)	1						c.(814-816)ATC>ATA		hypothetical protein LOC80133 isoform 2		C	,	0,3974		0,0,1987	162.0	147.0	152.0		816,816	-2.9	0.0	1		152	1,8355		0,1,4177	no	coding-synonymous,coding-synonymous	C1orf129	NM_001163629.1,NM_025063.2	,	0,1,6164	AA,AC,CC		0.012,0.0,0.0081	,	272/862,272/574	170955788	1,12329	1987	4178	6165	SO:0001819	synonymous_variant	80133						binding	g.chr1:170955788C>A	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.816C>A	1.37:g.170955788C>A			Somatic				C1orf129_uc009wvy.2_Silent_p.I79I|C1orf129_uc010plz.1_Silent_p.I272I	p.I272I	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			10	946	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		272					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	ENST00000367758.3	37	c.816C>A	CCDS41436.1																																																																																				0.453	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		22	55	1	0	4.35082e-09	0.001523	6.3473e-09	22	55				
TNR	7143	broad.mit.edu	37	1	175365760	175365760	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:175365760G>T	ENST00000367674.2	-	5	1868	c.1160C>A	c.(1159-1161)cCa>cAa	p.P387Q	TNR_ENST00000263525.2_Missense_Mutation_p.P387Q			Q92752	TENR_HUMAN	tenascin R	387	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGTGAGACCTGGCTCCAGCTC	0.592																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1159-1161)CCA>CAA		tenascin R precursor							141.0	114.0	123.0					1																	175365760		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175365760G>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1160C>A	1.37:g.175365760G>T	ENSP00000356646:p.Pro387Gln		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.P387Q|TNR_uc010pmz.1_Silent_p.A352A	p.P387Q	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			3	1241	-	Renal(580;0.146)		387			Fibronectin type-III 1.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.1160C>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955067	0.92726	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.68624	-0.34;-0.34	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.125664	0.53938	D	0.000051	T	0.74275	0.3695	M	0.80616	2.505	0.80722	D	1	B	0.30763	0.294	B	0.35770	0.21	T	0.73547	-0.3948	10	0.56958	D	0.05	.	19.9958	0.97383	0.0:0.0:1.0:0.0	.	387	Q92752	TENR_HUMAN	Q	387	ENSP00000356646:P387Q;ENSP00000263525:P387Q	ENSP00000263525:P387Q	P	-	2	0	TNR	173632383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.327000	0.96396	2.826000	0.97356	0.655000	0.94253	CCA		0.592	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		21	48	1	0	1.00905e-13	0.008871	1.5743e-13	21	48				
RALGPS2	55103	broad.mit.edu	37	1	178861370	178861370	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:178861370G>T	ENST00000367635.3	+	15	1591	c.1253G>T	c.(1252-1254)aGa>aTa	p.R418I	RALGPS2_ENST00000477383.1_Intron|RALGPS2_ENST00000367634.2_Intron	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	418					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						AACAGGAACAGATTATACCAT	0.393																																							uc001glz.2		NA																	0					0						c.(1252-1254)AGA>ATA		Ral GEF with PH domain and SH3 binding motif 2							68.0	73.0	71.0					1																	178861370		2203	4300	6503	SO:0001583	missense	55103				small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding	g.chr1:178861370G>T	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1253G>T	1.37:g.178861370G>T	ENSP00000356607:p.Arg418Ile		Somatic				RALGPS2_uc010pnb.1_Intron	p.R418I	NM_152663	NP_689876	WXS	Illumina HiSeq	Unspecified	Q86X27	RGPS2_HUMAN			15	1591	+			418					B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	ENST00000367635.3	37	c.1253G>T	CCDS1325.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351442	0.61183	.	.	ENSG00000116191	ENST00000367635;ENST00000324778;ENST00000535251	T;T	0.26810	1.81;1.71	5.52	5.52	0.82312	.	0.120463	0.56097	D	0.000038	T	0.27798	0.0684	L	0.36672	1.1	0.80722	D	1	P	0.51057	0.941	P	0.44860	0.462	T	0.01039	-1.1472	10	0.38643	T	0.18	.	19.0251	0.92929	0.0:0.0:1.0:0.0	.	418	Q86X27	RGPS2_HUMAN	I	418;383;67	ENSP00000356607:R418I;ENSP00000313613:R383I	ENSP00000313613:R383I	R	+	2	0	RALGPS2	177127993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.363000	0.79516	2.589000	0.87451	0.591000	0.81541	AGA		0.393	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084926.2	NM_152663		11	28	1	0	3.07112e-06	0.000978	4.07467e-06	11	28				
BRINP3	339479	broad.mit.edu	37	1	190067160	190067160	+	Silent	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:190067160T>C	ENST00000367462.3	-	8	2520	c.2289A>G	c.(2287-2289)aaA>aaG	p.K763K	BRINP3_ENST00000534846.1_Silent_p.K661K	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	763					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AACTACATAATTTGGTCGTGT	0.378																																							uc001gse.1		NA																	0				lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2287-2289)AAA>AAG		family with sequence similarity 5, member C							145.0	144.0	145.0					1																	190067160		2203	4300	6503	SO:0001819	synonymous_variant	339479					extracellular region		g.chr1:190067160T>C	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2289A>G	1.37:g.190067160T>C			Somatic				FAM5C_uc010pot.1_Silent_p.K661K	p.K763K	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2521	-	Prostate(682;0.198)		763					B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	c.2289A>G	CCDS1373.1																																																																																				0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		7	89	0	0	0	0.004482	0	7	89				
KDM5B	10765	broad.mit.edu	37	1	202702680	202702680	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:202702680C>T	ENST00000367265.3	-	23	4922	c.3758G>A	c.(3757-3759)cGa>cAa	p.R1253Q	KDM5B_ENST00000367264.2_Missense_Mutation_p.R1289Q	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1253					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R1253Q(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						AATCATATATCGAAGTGCATC	0.507																																							uc001gyf.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|breast(2)|urinary_tract(1)	5						c.(3757-3759)CGA>CAA		jumonji, AT rich interactive domain 1B							98.0	97.0	97.0					1																	202702680		2203	4300	6503	SO:0001583	missense	10765				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr1:202702680C>T	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3758G>A	1.37:g.202702680C>T	ENSP00000356234:p.Arg1253Gln		Somatic				KDM5B_uc009xag.2_Missense_Mutation_p.R1289Q|KDM5B_uc001gyg.1_Missense_Mutation_p.R1095Q	p.R1253Q	NM_006618	NP_006609	WXS	Illumina HiSeq	Unspecified	Q9UGL1	KDM5B_HUMAN			23	3874	-			1253					O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	c.3758G>A	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467295	0.43839	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.00864	5.6;5.6;5.6	6.09	6.09	0.99107	.	0.267618	0.39341	N	0.001400	T	0.01905	0.0060	N	0.16743	0.435	0.54753	D	0.999989	D;B	0.89917	1.0;0.111	P;B	0.62885	0.908;0.02	T	0.66520	-0.5903	10	0.02654	T	1	-16.4572	20.6935	0.99705	0.0:1.0:0.0:0.0	.	1289;1253	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	Q	1253;1095;1289;1095	ENSP00000356234:R1253Q;ENSP00000356233:R1289Q;ENSP00000235790:R1095Q	ENSP00000235790:R1095Q	R	-	2	0	KDM5B	200969303	1.000000	0.71417	0.969000	0.41365	0.999000	0.98932	4.515000	0.60489	2.897000	0.99335	0.643000	0.83706	CGA		0.507	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		7	85	0	0	0	0.001984	0	7	85				
TMEM81	388730	broad.mit.edu	37	1	205053413	205053413	+	Missense_Mutation	SNP	G	G	C	rs201987281		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:205053413G>C	ENST00000367167.3	-	1	232	c.36C>G	c.(34-36)agC>agG	p.S12R		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	12						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCAACCCCAGGCTCCCAAGGA	0.507																																							uc001hbt.2		NA																	0					0						c.(34-36)AGC>AGG		transmembrane protein 81 precursor							78.0	77.0	78.0					1																	205053413		2203	4300	6503	SO:0001583	missense	388730					integral to membrane		g.chr1:205053413G>C	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.36C>G	1.37:g.205053413G>C	ENSP00000356135:p.Ser12Arg		Somatic					p.S12R	NM_203376	NP_976310	WXS	Illumina HiSeq	Unspecified	Q6P7N7	TMM81_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0923)		1	176	-	all_cancers(21;0.144)|Breast(84;0.0437)		12					Q6UVZ4	Missense_Mutation	SNP	ENST00000367167.3	37	c.36C>G	CCDS1450.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786172	0.49997	.	.	ENSG00000174529	ENST00000367167	T	0.32515	1.45	5.49	1.3	0.21679	.	0.355168	0.26400	N	0.024586	T	0.22437	0.0541	M	0.63428	1.95	0.09310	N	1	P	0.36837	0.571	B	0.34385	0.181	T	0.21930	-1.0231	10	0.54805	T	0.06	-6.0078	0.8866	0.01246	0.2473:0.1284:0.4031:0.2212	.	12	Q6P7N7	TMM81_HUMAN	R	12	ENSP00000356135:S12R	ENSP00000356135:S12R	S	-	3	2	TMEM81	203320036	0.000000	0.05858	0.356000	0.25785	0.443000	0.32047	-0.340000	0.07821	0.791000	0.33826	0.557000	0.71058	AGC		0.507	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376		18	70	0	0	0	0.008871	0	18	70				
USH2A	7399	broad.mit.edu	37	1	216390757	216390757	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:216390757A>T	ENST00000307340.3	-	15	3515	c.3129T>A	c.(3127-3129)gaT>gaA	p.D1043E	USH2A_ENST00000366943.2_Missense_Mutation_p.D1043E|USH2A_ENST00000366942.3_Missense_Mutation_p.D1043E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1043	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATTGTTGACATCCAAGTGGC	0.448										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3127-3129)GAT>GAA		usherin isoform B							110.0	92.0	98.0					1																	216390757		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216390757A>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3129T>A	1.37:g.216390757A>T	ENSP00000305941:p.Asp1043Glu	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.D1043E	p.D1043E	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	15	3516	-			1043			Laminin EGF-like 10.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3129T>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563418	0.65651	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.54675	0.56;0.56;0.56	5.22	0.0268	0.14151	EGF-like, laminin (2);	0.000000	0.42053	U	0.000764	T	0.55146	0.1902	L	0.49640	1.575	0.39661	D	0.970615	B;D	0.71674	0.383;0.998	B;D	0.67725	0.444;0.953	T	0.52586	-0.8556	10	0.23891	T	0.37	.	5.3291	0.15922	0.5614:0.1415:0.2971:0.0	.	1043;1043	O75445-2;O75445	.;USH2A_HUMAN	E	1043	ENSP00000305941:D1043E;ENSP00000355910:D1043E;ENSP00000355909:D1043E	ENSP00000305941:D1043E	D	-	3	2	USH2A	214457380	0.999000	0.42202	0.883000	0.34634	0.991000	0.79684	1.009000	0.29886	-0.019000	0.14055	0.482000	0.46254	GAT		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		9	22	0	0	0	0.006214	0	9	22				
DISP1	84976	broad.mit.edu	37	1	223178804	223178804	+	Silent	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:223178804T>C	ENST00000284476.6	+	8	4229	c.4065T>C	c.(4063-4065)ttT>ttC	p.F1355F		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1355					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		CTAGGAATTTTTTCCTCCACC	0.512																																							uc001hnu.1		NA																	0					0						c.(4063-4065)TTT>TTC		dispatched A							45.0	46.0	46.0					1																	223178804		2203	4300	6503	SO:0001819	synonymous_variant	84976				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity	g.chr1:223178804T>C	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.4065T>C	1.37:g.223178804T>C			Somatic					p.F1355F	NM_032890	NP_116279	WXS	Illumina HiSeq	Unspecified	Q96F81	DISP1_HUMAN		GBM - Glioblastoma multiforme(131;0.102)	8	4212	+			1355					Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	ENST00000284476.6	37	c.4065T>C	CCDS1536.1																																																																																				0.512	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890		24	48	0	0	0	0.00278	0	24	48				
TARBP1	6894	broad.mit.edu	37	1	234606997	234606997	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:234606997C>T	ENST00000040877.1	-	3	1035	c.1036G>A	c.(1036-1038)Gtt>Att	p.V346I		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	346					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GGCTTTATAACATGTATCTAA	0.279																																							uc001hwd.2		NA																	0				ovary(2)|skin(1)	3						c.(1036-1038)GTT>ATT		TAR RNA binding protein 1							49.0	52.0	51.0					1																	234606997		2201	4288	6489	SO:0001583	missense	6894				regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity	g.chr1:234606997C>T		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.1036G>A	1.37:g.234606997C>T	ENSP00000040877:p.Val346Ile		Somatic					p.V346I	NM_005646	NP_005637	WXS	Illumina HiSeq	Unspecified	Q13395	TARB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000263)		3	1036	-	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	346					Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	c.1036G>A	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904359	0.72868	.	.	ENSG00000059588	ENST00000040877	T	0.07114	3.22	5.94	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	L	0.52759	1.655	0.50039	D	0.999844	D	0.76494	0.999	D	0.76071	0.987	T	0.01725	-1.1287	10	0.25751	T	0.34	-18.0106	17.1342	0.86735	0.0:0.8734:0.1266:0.0	.	346	Q13395	TARB1_HUMAN	I	346	ENSP00000040877:V346I	ENSP00000040877:V346I	V	-	1	0	TARBP1	232673620	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.136000	0.64783	1.497000	0.48584	0.557000	0.71058	GTT		0.279	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		7	10	0	0	0	0.004482	0	7	10				
ACTN2	88	broad.mit.edu	37	1	236902780	236902780	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:236902780T>A	ENST00000366578.4	+	10	1221	c.1055T>A	c.(1054-1056)cTg>cAg	p.L352Q	ACTN2_ENST00000542672.1_Missense_Mutation_p.L352Q|ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	352					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CAGACCAAGCTGCGGATCAGC	0.607																																							uc001hyf.2		NA																	0				ovary(4)|skin(1)	5						c.(1054-1056)CTG>CAG		actinin, alpha 2							127.0	100.0	109.0					1																	236902780		2203	4300	6503	SO:0001583	missense	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236902780T>A	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1055T>A	1.37:g.236902780T>A	ENSP00000355537:p.Leu352Gln		Somatic				ACTN2_uc001hyg.2_Missense_Mutation_p.L144Q|ACTN2_uc009xgi.1_Missense_Mutation_p.L352Q|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Missense_Mutation_p.L40Q	p.L352Q	NM_001103	NP_001094	WXS	Illumina HiSeq	Unspecified	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		10	1259	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	352			Spectrin 1.		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	c.1055T>A	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.561399	0.86335	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.65732	-0.17;-0.17	5.51	5.51	0.81932	.	0.063715	0.64402	D	0.000006	T	0.81640	0.4865	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	0.995;0.999;1.0	D;D;D	0.97110	0.97;0.993;1.0	D	0.84248	0.0476	10	0.52906	T	0.07	.	15.6112	0.76721	0.0:0.0:0.0:1.0	.	352;122;352	B2RCS5;Q59FD9;P35609	.;.;ACTN2_HUMAN	Q	352;352;121	ENSP00000443495:L352Q;ENSP00000355537:L352Q	ENSP00000355537:L352Q	L	+	2	0	ACTN2	234969403	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.001000	0.88508	2.089000	0.63090	0.454000	0.30748	CTG		0.607	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		13	44	0	0	0	0.001368	0	13	44				
RYR2	6262	broad.mit.edu	37	1	237947539	237947539	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:237947539T>C	ENST00000366574.2	+	90	12844	c.12527T>C	c.(12526-12528)gTg>gCg	p.V4176A	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.V4182A|RYR2_ENST00000542537.1_Missense_Mutation_p.V4160A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4176					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATATTTGACGTGGTCAACGAA	0.502																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12526-12528)GTG>GCG		cardiac muscle ryanodine receptor							91.0	95.0	94.0					1																	237947539		1969	4173	6142	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947539T>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12527T>C	1.37:g.237947539T>C	ENSP00000355533:p.Val4176Ala		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.V591A	p.V4176A	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12647	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4176					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12527T>C	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420306	0.62622	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.98012	-4.66;-4.66;-4.66	5.54	5.54	0.83059	.	0.000000	0.56097	D	0.000029	D	0.97867	0.9299	M	0.86651	2.83	0.80722	D	1	P;P	0.46395	0.877;0.589	P;B	0.45913	0.497;0.222	D	0.98581	1.0650	10	0.87932	D	0	.	15.6781	0.77344	0.0:0.0:0.0:1.0	.	1150;4176	B4DGV4;Q92736	.;RYR2_HUMAN	A	4176;4182;4160;1150	ENSP00000355533:V4176A;ENSP00000353174:V4182A;ENSP00000443798:V4160A	ENSP00000353174:V4182A	V	+	2	0	RYR2	236014162	1.000000	0.71417	0.998000	0.56505	0.449000	0.32228	7.997000	0.88414	2.109000	0.64355	0.533000	0.62120	GTG		0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		27	73	0	0	0	0.00632	0	27	73				
NLRP3	114548	broad.mit.edu	37	1	247593036	247593036	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:247593036G>C	ENST00000336119.3	+	4	3052	c.2306G>C	c.(2305-2307)gGc>gCc	p.G769A	NLRP3_ENST00000391828.3_Missense_Mutation_p.G769A|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000366496.2_Missense_Mutation_p.G769A|NLRP3_ENST00000366497.2_Missense_Mutation_p.G769A|NLRP3_ENST00000391827.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	769					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAGCATCCTGGCTGTAACATT	0.498																																							uc001icr.2		NA																	0				lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2305-2307)GGC>GCC		NLR family, pyrin domain containing 3 isoform a							91.0	84.0	87.0					1																	247593036		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247593036G>C	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2306G>C	1.37:g.247593036G>C	ENSP00000337383:p.Gly769Ala		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.G769A|NLRP3_uc001icu.2_Missense_Mutation_p.G769A|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Missense_Mutation_p.G767A	p.G769A	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		6	2444	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	769					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.2306G>C	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	0.893	-0.724728	0.03158	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000366496	D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29	4.21	3.3	0.37823	.	0.319517	0.23033	N	0.052704	T	0.76557	0.4004	L	0.33189	0.99	0.20638	N	0.999876	B;B;B	0.21309	0.0;0.0;0.054	B;B;B	0.20577	0.005;0.007;0.03	T	0.57046	-0.7878	10	0.08179	T	0.78	.	9.0466	0.36349	0.1038:0.0:0.8962:0.0	.	769;769;769	B7ZKS9;Q96P20-5;Q96P20	.;.;NALP3_HUMAN	A	769	ENSP00000375704:G769A;ENSP00000355453:G769A;ENSP00000337383:G769A;ENSP00000355452:G769A	ENSP00000337383:G769A	G	+	2	0	NLRP3	245659659	0.000000	0.05858	0.705000	0.30386	0.148000	0.21650	-0.156000	0.10100	1.112000	0.41740	-0.440000	0.05779	GGC		0.498	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		4	71	0	0	0	0.000248	0	4	71				
OR6F1	343169	broad.mit.edu	37	1	247875407	247875407	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:247875407G>T	ENST00000302084.2	-	1	698	c.651C>A	c.(649-651)tcC>tcA	p.S217S	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGTACACATAGGAGACAAAGG	0.542																																							uc001idj.1		NA																	0					0						c.(649-651)TCC>TCA		olfactory receptor, family 6, subfamily F,							132.0	116.0	121.0					1																	247875407		2203	4300	6503	SO:0001819	synonymous_variant	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875407G>T	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.651C>A	1.37:g.247875407G>T			Somatic					p.S217S	NM_001005286	NP_001005286	WXS	Illumina HiSeq	Unspecified	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	651	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		217			Helical; Name=5; (Potential).		B2RNV6|Q6IF02|Q96R39	Silent	SNP	ENST00000302084.2	37	c.651C>A	CCDS31095.1																																																																																				0.542	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		35	63	1	0	4.31634e-10	0.002445	6.40795e-10	35	63				
TAF3	83860	broad.mit.edu	37	10	8007139	8007139	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:8007139A>G	ENST00000344293.5	+	3	1872	c.1666A>G	c.(1666-1668)Aag>Gag	p.K556E		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	556	Lys-rich.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						aagtaaggagaaggataaagt	0.378																																							uc010qbd.1		NA																	0				ovary(1)	1						c.(1666-1668)AAG>GAG		RNA polymerase II transcription factor TAFII140							28.0	28.0	28.0					10																	8007139		1832	4092	5924	SO:0001583	missense	83860				maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding	g.chr10:8007139A>G	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1666A>G	10.37:g.8007139A>G	ENSP00000340271:p.Lys556Glu		Somatic					p.K556E	NM_031923	NP_114129	WXS	Illumina HiSeq	Unspecified	Q5VWG9	TAF3_HUMAN			3	1666	+			556			Lys-rich.		Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	c.1666A>G	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	A	18.57	3.652892	0.67472	.	.	ENSG00000165632	ENST00000344293	T	0.27104	1.69	5.67	4.5	0.54988	.	0.103551	0.40222	N	0.001147	T	0.34164	0.0888	M	0.83223	2.63	0.54753	D	0.999985	P	0.52463	0.953	P	0.45195	0.473	T	0.31806	-0.9930	10	0.15066	T	0.55	-18.9024	12.4417	0.55629	0.8597:0.1403:0.0:0.0	.	556	Q5VWG9	TAF3_HUMAN	E	556	ENSP00000340271:K556E	ENSP00000340271:K556E	K	+	1	0	TAF3	8047145	1.000000	0.71417	0.997000	0.53966	0.895000	0.52256	6.807000	0.75201	0.938000	0.37419	0.528000	0.53228	AAG		0.378	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923		12	18	0	0	0	0.000978	0	12	18				
SLC39A12	221074	broad.mit.edu	37	10	18266839	18266839	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:18266839C>A	ENST00000377369.2	+	5	1033	c.760C>A	c.(760-762)Caa>Aaa	p.Q254K	SLC39A12_ENST00000377371.3_Missense_Mutation_p.Q254K|SLC39A12_ENST00000377374.4_Missense_Mutation_p.Q254K|SLC39A12_ENST00000539911.1_Missense_Mutation_p.Q120K	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	254					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AGAACTAGACCAACTCCTCAA	0.338																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(760-762)CAA>AAA		solute carrier family 39 (zinc transporter),							165.0	178.0	174.0					10																	18266839		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18266839C>A		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.760C>A	10.37:g.18266839C>A	ENSP00000366586:p.Gln254Lys		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.Q254K|SLC39A12_uc001ipp.2_Missense_Mutation_p.Q254K|SLC39A12_uc010qck.1_Missense_Mutation_p.Q120K	p.Q254K	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			5	1033	+			254			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.760C>A	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.275077	0.23307	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.61274	0.24;0.12;0.24;0.14	4.93	3.03	0.35002	.	0.461486	0.24904	N	0.034667	T	0.46268	0.1384	L	0.47716	1.5	0.32958	D	0.520639	B;B;B	0.13594	0.001;0.0;0.008	B;B;B	0.13407	0.003;0.001;0.009	T	0.50285	-0.8846	10	0.18276	T	0.48	-0.6962	10.3905	0.44166	0.1513:0.7032:0.1455:0.0	.	254;254;254	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	K	254;254;254;120;174	ENSP00000366586:Q254K;ENSP00000366591:Q254K;ENSP00000366588:Q254K;ENSP00000440445:Q120K	ENSP00000366586:Q254K	Q	+	1	0	SLC39A12	18306845	0.734000	0.28142	0.969000	0.41365	0.908000	0.53690	1.198000	0.32223	0.757000	0.33036	0.650000	0.86243	CAA		0.338	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		25	100	1	0	1.5548e-18	0.005443	2.51907e-18	25	100				
MAP3K8	1326	broad.mit.edu	37	10	30728114	30728114	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:30728114G>T	ENST00000263056.1	+	3	943	c.247G>T	c.(247-249)Gat>Tat	p.D83Y	MAP3K8_ENST00000375321.1_Missense_Mutation_p.D83Y|MAP3K8_ENST00000542547.1_Missense_Mutation_p.D83Y|MAP3K8_ENST00000375322.2_Missense_Mutation_p.D83Y	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	83					cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				AACTGTGGAGGATTTGCTTGC	0.408																																							uc001ivi.1		NA																	0				breast(3)|central_nervous_system(1)	4						c.(247-249)GAT>TAT		mitogen-activated protein kinase kinase kinase							128.0	112.0	118.0					10																	30728114		2203	4300	6503	SO:0001583	missense	1326				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr10:30728114G>T	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.247G>T	10.37:g.30728114G>T	ENSP00000263056:p.Asp83Tyr		Somatic				MAP3K8_uc009xlf.1_Missense_Mutation_p.D83Y|MAP3K8_uc001ivj.1_Missense_Mutation_p.D83Y	p.D83Y	NM_005204	NP_005195	WXS	Illumina HiSeq	Unspecified	P41279	M3K8_HUMAN			3	943	+		Prostate(175;0.151)	83					A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	ENST00000263056.1	37	c.247G>T	CCDS7166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.205292|4.205292	0.79127|0.79127	.|.	.|.	ENSG00000107968|ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000415139;ENST00000375322;ENST00000413724;ENST00000375321|ENST00000430603	T;T;T;T;T|.	0.71341|.	-0.56;-0.56;4.23;0.98;-0.56|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.087792|.	0.85682|.	D|.	0.000000|.	T|T	0.58623|0.58623	0.2135|0.2135	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	P|.	0.60789|.	0.879|.	T|T	0.52540|0.52540	-0.8562|-0.8562	10|5	0.87932|.	D|.	0|.	.|.	19.3198|19.3198	0.94233|0.94233	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	83|.	P41279|.	M3K8_HUMAN|.	Y|S	83|3	ENSP00000263056:D83Y;ENSP00000443610:D83Y;ENSP00000409653:D83Y;ENSP00000391275:D83Y;ENSP00000364470:D83Y|.	ENSP00000263056:D83Y|.	D|R	+|+	1|3	0|2	MAP3K8|MAP3K8	30768120|30768120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.887000|0.887000	0.51463|0.51463	7.916000|7.916000	0.87491|0.87491	2.638000|2.638000	0.89438|0.89438	0.655000|0.655000	0.94253|0.94253	GAT|AGG		0.408	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204		19	46	1	0	5.26018e-13	0.001882	8.16903e-13	19	46				
HSD17B7P2	158160	broad.mit.edu	37	10	38651210	38651210	+	RNA	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:38651210G>A	ENST00000494540.1	+	0	357					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TAAATGCTGGGATCATGCCTA	0.363																																							uc010qex.1		NA																	0					0						c.(280-282)GGG>GGA		SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);																																						158160							g.chr10:38651210G>A			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38651210G>A			Somatic				HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Silent_p.G92G	p.G94G			WXS	Illumina HiSeq	Unspecified					3	357	+									Silent	SNP	ENST00000494540.1	37	c.282G>A																																																																																					0.363	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086		14	33	0	0	0	0.00245	0	14	33				
RBP3	5949	broad.mit.edu	37	10	48388863	48388863	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:48388863G>A	ENST00000224600.4	-	1	2128	c.2015C>T	c.(2014-2016)gCc>gTc	p.A672V	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	672	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TGTGCGGTAGGCGCCCTGGGC	0.662																																							uc001jez.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(2014-2016)GCC>GTC		retinol-binding protein 3 precursor	Vitamin A(DB00162)						25.0	29.0	27.0					10																	48388863		2197	4290	6487	SO:0001583	missense	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48388863G>A	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2015C>T	10.37:g.48388863G>A	ENSP00000224600:p.Ala672Val		Somatic					p.A672V	NM_002900	NP_002891	WXS	Illumina HiSeq	Unspecified	P10745	RET3_HUMAN			1	2129	-			672			4 X approximate tandem repeats.|3.		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	c.2015C>T	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902836	0.33628	.	.	ENSG00000107618	ENST00000224600	T	0.63255	-0.03	5.53	4.6	0.57074	.	0.390290	0.26133	N	0.026160	T	0.52964	0.1767	L	0.52573	1.65	0.26816	N	0.968889	P	0.35077	0.483	B	0.24974	0.057	T	0.50355	-0.8838	10	0.44086	T	0.13	-27.0484	14.1123	0.65129	0.0:0.4238:0.5762:0.0	.	672	P10745	RET3_HUMAN	V	672	ENSP00000224600:A672V	ENSP00000224600:A672V	A	-	2	0	RBP3	48008869	0.650000	0.27331	0.985000	0.45067	0.844000	0.47949	2.163000	0.42377	1.299000	0.44798	0.561000	0.74099	GCC		0.662	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		14	25	0	0	0	0.001855	0	14	25				
FRMPD2	143162	broad.mit.edu	37	10	49452849	49452849	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:49452849C>A	ENST00000374201.3	-	4	655	c.353G>T	c.(352-354)gGg>gTg	p.G118V	FRMPD2_ENST00000305531.3_Intron|FRMPD2_ENST00000407470.4_Intron	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	118	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		AACATGAAACCCTGCTGACCA	0.453																																							uc001jgi.2		NA																	0				large_intestine(1)	1						c.(352-354)GGG>GTG		FERM and PDZ domain containing 2 isoform 3							128.0	112.0	118.0					10																	49452849		2203	4300	6503	SO:0001583	missense	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49452849C>A	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.353G>T	10.37:g.49452849C>A	ENSP00000363317:p.Gly118Val		Somatic				FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	p.G118V	NM_001018071	NP_001018081	WXS	Illumina HiSeq	Unspecified	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	4	460	-			118			KIND.		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	c.353G>T	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146103	0.57044	.	.	ENSG00000170324	ENST00000374201	T	0.39997	1.05	5.1	1.7	0.24286	KIND (2);	.	.	.	.	T	0.48714	0.1515	M	0.63428	1.95	0.58432	D	0.999999	D	0.69078	0.997	P	0.59115	0.852	T	0.48210	-0.9055	9	0.72032	D	0.01	.	3.1887	0.06609	0.0:0.4944:0.2283:0.2773	.	118	Q68DX3	FRPD2_HUMAN	V	118	ENSP00000363317:G118V	ENSP00000363317:G118V	G	-	2	0	FRMPD2	49122855	0.572000	0.26668	0.600000	0.28864	0.960000	0.62799	1.247000	0.32815	0.511000	0.28236	0.467000	0.42956	GGG		0.453	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		13	19	1	0	1.61879e-10	0.001368	2.42459e-10	13	19				
GRID1	2894	broad.mit.edu	37	10	87406989	87406989	+	Missense_Mutation	SNP	G	G	C	rs374077562	byFrequency	TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:87406989G>C	ENST00000327946.7	-	13	2248	c.2163C>G	c.(2161-2163)tgC>tgG	p.C721W	RP11-93H12.4_ENST00000474115.2_RNA|RN7SKP238_ENST00000516483.1_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.C292W	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	721					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GACTGGACACGCAGTTGTCAG	0.617										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(2161-2163)TGC>TGG		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						233.0	214.0	220.0					10																	87406989		2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87406989G>C	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2163C>G	10.37:g.87406989G>C	ENSP00000330148:p.Cys721Trp	Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.C292W|uc001kdm.1_RNA	p.C721W	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			13	2264	-			721			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.2163C>G	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360771	0.24598	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.23754	1.89;1.89	5.7	-7.15	0.01521	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.046716	0.85682	D	0.000000	T	0.35248	0.0925	L	0.43152	1.355	0.50632	D	0.999886	D	0.63880	0.993	D	0.64506	0.926	T	0.48801	-0.9003	10	0.72032	D	0.01	.	17.931	0.88998	0.6642:0.0:0.3358:0.0	.	721	Q9ULK0	GRID1_HUMAN	W	721;292	ENSP00000330148:C721W;ENSP00000444455:C292W	ENSP00000330148:C721W	C	-	3	2	GRID1	87396969	0.000000	0.05858	0.739000	0.30968	0.956000	0.61745	-2.043000	0.01413	-1.439000	0.01962	-1.756000	0.00673	TGC		0.617	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		62	214	0	0	0	0.00361	0	62	214				
PLCE1	51196	broad.mit.edu	37	10	95931199	95931199	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:95931199C>T	ENST00000371380.3	+	3	1990	c.1755C>T	c.(1753-1755)acC>acT	p.T585T	PLCE1_ENST00000371385.3_Silent_p.T277T|PLCE1_ENST00000371375.1_Silent_p.T277T|PLCE1_ENST00000260766.3_Silent_p.T585T			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	585	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CGATTCTTACCACTCAGAATG	0.483																																							uc001kjk.2		NA																	0				ovary(2)|skin(1)	3						c.(1753-1755)ACC>ACT		phospholipase C, epsilon 1 isoform 1							123.0	120.0	121.0					10																	95931199		2026	4197	6223	SO:0001819	synonymous_variant	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95931199C>T		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1755C>T	10.37:g.95931199C>T			Somatic				PLCE1_uc010qnx.1_Silent_p.T585T|PLCE1_uc001kjm.2_Silent_p.T277T	p.T585T	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			4	2389	+		Colorectal(252;0.0458)	585			Ras-GEF.		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	c.1755C>T	CCDS41552.1																																																																																				0.483	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		24	58	0	0	0	0.00333	0	24	58				
R3HCC1L	27291	broad.mit.edu	37	10	99968469	99968469	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:99968469G>T	ENST00000298999.3	+	5	901	c.598G>T	c.(598-600)Gac>Tac	p.D200Y	R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.D200Y	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	200							nucleotide binding (GO:0000166)										AGCATTTGAAGACAAAGATTT	0.388																																							uc001kow.3		NA																	0				large_intestine(1)|skin(1)	2						c.(598-600)GAC>TAC		growth inhibition and differentiation related							67.0	67.0	67.0					10																	99968469		2203	4300	6503	SO:0001583	missense	27291						nucleotide binding	g.chr10:99968469G>T	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.598G>T	10.37:g.99968469G>T	ENSP00000298999:p.Asp200Tyr		Somatic				C10orf28_uc001kox.3_Missense_Mutation_p.D200Y|C10orf28_uc001koy.3_Missense_Mutation_p.D200Y|C10orf28_uc009xvx.2_Missense_Mutation_p.D200Y|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	p.D200Y	NM_014472	NP_055287	WXS	Illumina HiSeq	Unspecified	Q4KMY3	Q4KMY3_HUMAN		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)	4	893	+		Colorectal(252;0.234)	200					O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	c.598G>T	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	G	0.895	-0.724230	0.03158	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.09255	3.0;3.0	5.44	0.854	0.19007	.	0.996712	0.08134	N	0.992725	T	0.10723	0.0262	L	0.51422	1.61	0.09310	N	0.999997	B;B	0.33212	0.402;0.156	B;B	0.32724	0.151;0.151	T	0.36016	-0.9765	9	.	.	.	0.4244	6.6199	0.22798	0.2852:0.1289:0.586:0.0	.	200;200	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	Y	200	ENSP00000359616:D200Y;ENSP00000298999:D200Y	.	D	+	1	0	C10orf28	99958459	0.072000	0.21174	0.008000	0.14137	0.002000	0.02628	0.257000	0.18369	-0.251000	0.09542	-1.886000	0.00541	GAC		0.388	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472		10	33	1	0	1.76689e-08	0.006214	2.5338e-08	10	33				
C10orf76	79591	broad.mit.edu	37	10	103773783	103773783	+	Splice_Site	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:103773783T>A	ENST00000370033.4	-	9	789		c.e9-2			NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76							integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		ATTCACAGACTGTTAAATAAG	0.393																																							uc009xwy.1		NA																	0					0						c.e9-1		hypothetical protein LOC79591							152.0	143.0	145.0					10																	103773783		1898	4122	6020	SO:0001630	splice_region_variant	79591					integral to membrane		g.chr10:103773783T>A	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.670-2A>T	10.37:g.103773783T>A			Somatic					p.S224_splice	NM_024541	NP_078817	WXS	Illumina HiSeq	Unspecified	Q5T2E6	CJ076_HUMAN		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)	9	772	-		Colorectal(252;0.123)						Q2TB87|Q9H8Z9	Splice_Site	SNP	ENST00000370033.4	37	c.670_splice	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498773	0.85069	.	.	ENSG00000120029	ENST00000370033	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7164	0.62700	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	C10orf76	103763773	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.179000	0.77665	1.987000	0.57996	0.533000	0.62120	.		0.393	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	Intron	5	65	0	0	0	0.000602	0	5	65				
GBF1	8729	broad.mit.edu	37	10	104103885	104103885	+	Missense_Mutation	SNP	A	A	T	rs541613143		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:104103885A>T	ENST00000369983.3	+	4	501	c.241A>T	c.(241-243)Atc>Ttc	p.I81F		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	81					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CACTGGCCCTATCACTGGACT	0.458																																							uc001kux.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(241-243)ATC>TTC		golgi-specific brefeldin A resistant guanine							190.0	154.0	166.0					10																	104103885		2203	4300	6503	SO:0001583	missense	8729				COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding	g.chr10:104103885A>T	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.241A>T	10.37:g.104103885A>T	ENSP00000359000:p.Ile81Phe		Somatic				GBF1_uc001kuw.2_Missense_Mutation_p.I81F|GBF1_uc001kuy.1_Missense_Mutation_p.I81F|GBF1_uc001kuz.1_Missense_Mutation_p.I81F	p.I81F	NM_004193	NP_004184	WXS	Illumina HiSeq	Unspecified	Q92538	GBF1_HUMAN		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)	4	481	+		Colorectal(252;0.0236)	81					Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	c.241A>T	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	A	31	5.101574	0.94245	.	.	ENSG00000107862	ENST00000369983	T	0.70631	-0.5	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.87253	0.6131	M	0.89904	3.07	0.80722	D	1	D;D;D;D	0.76494	0.992;0.985;0.999;0.999	P;P;D;D	0.75484	0.798;0.858;0.986;0.974	D	0.89579	0.3819	10	0.87932	D	0	-18.5773	16.8222	0.85835	1.0:0.0:0.0:0.0	.	81;81;81;81	Q149P1;Q149P0;Q92538;Q504U7	.;.;GBF1_HUMAN;.	F	81	ENSP00000359000:I81F	ENSP00000359000:I81F	I	+	1	0	GBF1	104093875	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.194000	0.94962	2.371000	0.80710	0.533000	0.62120	ATC		0.458	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1			46	60	0	0	0	0.002522	0	46	60				
CALHM2	51063	broad.mit.edu	37	10	105209508	105209508	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:105209508G>T	ENST00000260743.5	-	3	714	c.191C>A	c.(190-192)cCc>cAc	p.P64H	CALHM2_ENST00000369788.3_Missense_Mutation_p.P64H|CALHM2_ENST00000494180.1_5'UTR|CALHM2_ENST00000393235.1_Missense_Mutation_p.P64H|RP11-225H22.7_ENST00000608063.1_RNA	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	64					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						CACCAGGGCGGGCACGCCGAT	0.667																																							uc001kwz.2		NA																	0				skin(1)	1						c.(190-192)CCC>CAC		calcium homeostasis modulator 2							44.0	51.0	48.0					10																	105209508		2203	4300	6503	SO:0001583	missense	51063					integral to membrane		g.chr10:105209508G>T	BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.191C>A	10.37:g.105209508G>T	ENSP00000260743:p.Pro64His		Somatic				CALHM2_uc001kxa.2_Missense_Mutation_p.P64H|CALHM2_uc001kxc.2_Missense_Mutation_p.P64H|CALHM2_uc001kxb.2_Missense_Mutation_p.P64H|CALHM2_uc001kxd.1_Missense_Mutation_p.P64H	p.P64H	NM_015916	NP_057000	WXS	Illumina HiSeq	Unspecified	Q9HA72	CAHM2_HUMAN			2	577	-			64			Helical; (Potential).		D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	ENST00000260743.5	37	c.191C>A	CCDS7549.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675228	0.67928	.	.	ENSG00000138172	ENST00000369788;ENST00000260743;ENST00000393235	T;T;T	0.70045	-0.45;-0.45;-0.45	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.84615	0.5511	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.86638	0.1890	10	0.87932	D	0	-53.7139	19.4958	0.95072	0.0:0.0:1.0:0.0	.	64;64;64	Q9HA72-2;Q9HA72-3;Q9HA72	.;.;CAHM2_HUMAN	H	64	ENSP00000358803:P64H;ENSP00000260743:P64H;ENSP00000376927:P64H	ENSP00000260743:P64H	P	-	2	0	CALHM2	105199498	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	8.746000	0.91604	2.590000	0.87494	0.561000	0.74099	CCC		0.667	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050159.1	NM_015916		6	75	1	0	3.59834e-05	0.001168	4.47468e-05	6	75				
PLEKHS1	79949	broad.mit.edu	37	10	115540429	115540429	+	Silent	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:115540429C>G	ENST00000354462.3	+	6	644	c.486C>G	c.(484-486)ccC>ccG	p.P162P	PLEKHS1_ENST00000369312.4_Silent_p.P330P|PLEKHS1_ENST00000361048.1_3'UTR|PLEKHS1_ENST00000369309.1_Silent_p.P246P			Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	426																	GTATGTGTCCCTCAAAATGCC	0.453																																							uc009xyc.1		NA																	0				central_nervous_system(1)	1						c.(988-990)CCC>CCG		RecName: Full=PH domain-containing protein C10orf81;							79.0	66.0	70.0					10																	115540429		692	1591	2283	SO:0001819	synonymous_variant	79949							g.chr10:115540429C>G	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000354462.3:c.486C>G	10.37:g.115540429C>G			Somatic				C10orf81_uc001lar.1_3'UTR|C10orf81_uc001las.1_Silent_p.P330P|C10orf81_uc001lau.1_Silent_p.P246P|C10orf81_uc001lav.2_5'Flank	p.P330P			WXS	Illumina HiSeq	Unspecified	Q5SXH7	CJ081_HUMAN		Epithelial(162;0.0181)|all cancers(201;0.0204)	13	1681	+		Colorectal(252;0.175)	426					A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Silent	SNP	ENST00000354462.3	37	c.990C>G																																																																																					0.453	PLEKHS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050431.2	NM_024889		15	20	0	0	0	0.003163	0	15	20				
MKI67	4288	broad.mit.edu	37	10	129913665	129913665	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:129913665C>A	ENST00000368654.3	-	7	1382	c.1007G>T	c.(1006-1008)aGc>aTc	p.S336I	MKI67_ENST00000368653.3_Intron|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	336					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GAGAGGAAAGCTGGCGCCCAC	0.483																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(1006-1008)AGC>ATC		antigen identified by monoclonal antibody Ki-67							73.0	80.0	78.0					10																	129913665		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129913665C>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1007G>T	10.37:g.129913665C>A	ENSP00000357643:p.Ser336Ile		Somatic				MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	p.S336I	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			7	1202	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	336					Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.1007G>T	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.479172	0.44044	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.01484	4.84	3.22	2.3	0.28687	.	1.431740	0.04584	N	0.395423	T	0.01661	0.0053	N	0.24115	0.695	0.09310	N	0.999999	P	0.38827	0.649	B	0.29176	0.099	T	0.47289	-0.9129	10	0.87932	D	0	.	7.8089	0.29219	0.2475:0.7525:0.0:0.0	.	336	P46013	KI67_HUMAN	I	336	ENSP00000357643:S336I	ENSP00000357643:S336I	S	-	2	0	MKI67	129803655	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.168000	0.16622	0.924000	0.37069	0.655000	0.94253	AGC		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		49	61	1	0	6.08268e-21	0.00361	9.95079e-21	49	61				
OR52A4	390053	broad.mit.edu	37	11	5142144	5142144	+	RNA	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:5142144G>T	ENST00000498233.1	-	0	1014							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTGAATATAGGAGAGGGTGAT	0.373																																							uc001lzz.1		NA																	0				ovary(2)	2						c.(664-666)TCC>TAC		olfactory receptor, family 52, subfamily A,							47.0	51.0	50.0					11																	5142144		2200	4297	6497			390053							g.chr11:5142144G>T			11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142144G>T			Somatic					p.S222Y	NM_001005222	NP_001005222	WXS	Illumina HiSeq	Unspecified				Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)	1	665	-		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)							Missense_Mutation	SNP	ENST00000498233.1	37	c.665C>A		.	.	.	.	.	.	.	.	.	.	G	1.639	-0.517011	0.04171	.	.	ENSG00000248953	ENST00000380369	.	.	.	3.94	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.78786	0.4338	.	.	.	0.23754	N	0.996937	D	0.89917	1.0	D	0.97110	1.0	D	0.84862	0.0820	6	0.87932	D	0	.	15.0388	0.71770	0.0:0.0:1.0:0.0	.	222	A6NMU1	O52A4_HUMAN	Y	222	.	ENSP00000369727:S222Y	S	-	2	0	OR52A4	5098720	1.000000	0.71417	0.013000	0.15412	0.026000	0.11368	4.724000	0.61972	2.172000	0.68678	0.655000	0.94253	TCC		0.373	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1	NG_029079		8	16	1	0	0.00307968	0.00308	0.00348272	8	16				
DCHS1	8642	broad.mit.edu	37	11	6648581	6648581	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:6648581C>A	ENST00000299441.3	-	14	6100	c.5689G>T	c.(5689-5691)Ggt>Tgt	p.G1897C		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1897	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTGCTGTACCGGCGCCCAGG	0.607																																							uc001mem.1		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(5689-5691)GGT>TGT		dachsous 1 precursor							33.0	31.0	32.0					11																	6648581		2201	4294	6495	SO:0001583	missense	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6648581C>A	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5689G>T	11.37:g.6648581C>A	ENSP00000299441:p.Gly1897Cys		Somatic					p.G1897C	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	14	6099	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	1897			Cadherin 18.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	c.5689G>T	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963304	0.53507	.	.	ENSG00000166341	ENST00000299441	T	0.64260	-0.09	5.31	5.31	0.75309	Cadherin (4);Cadherin-like (1);	0.000000	0.48286	D	0.000200	T	0.81264	0.4786	M	0.87547	2.89	0.33990	D	0.649043	D	0.76494	0.999	D	0.64410	0.925	D	0.87459	0.2406	10	0.62326	D	0.03	.	18.1355	0.89618	0.0:1.0:0.0:0.0	.	1897	Q96JQ0	PCD16_HUMAN	C	1897	ENSP00000299441:G1897C	ENSP00000299441:G1897C	G	-	1	0	DCHS1	6605157	1.000000	0.71417	0.997000	0.53966	0.564000	0.35744	5.866000	0.69590	2.764000	0.94973	0.557000	0.71058	GGT		0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		5	10	1	0	0.000602214	0.000602	0.000709602	5	10				
INSC	387755	broad.mit.edu	37	11	15212246	15212246	+	Splice_Site	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:15212246G>T	ENST00000379554.3	+	6	766		c.e6-1		INSC_ENST00000525218.1_Splice_Site|INSC_ENST00000379556.3_Splice_Site|INSC_ENST00000424273.1_Splice_Site|INSC_ENST00000447214.2_Splice_Site|INSC_ENST00000528567.1_Splice_Site|INSC_ENST00000530161.1_Splice_Site	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)						establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TCTCTTCTTAGGCACTGGTGA	0.512																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.e6-1		inscuteable isoform a							129.0	135.0	133.0					11																	15212246		1964	4150	6114	SO:0001630	splice_region_variant	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15212246G>T	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.721-1G>T	11.37:g.15212246G>T			Somatic				INSC_uc001mlz.2_Splice_Site_p.A194_splice|INSC_uc001mma.2_Splice_Site_p.A194_splice|INSC_uc010rcs.1_Splice_Site_p.A229_splice|INSC_uc001mmb.2_Splice_Site_p.A194_splice|INSC_uc001mmc.2_Splice_Site_p.A194_splice	p.A241_splice	NM_001031853	NP_001027024	WXS	Illumina HiSeq	Unspecified	Q1MX18	INSC_HUMAN			6	767	+								A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Splice_Site	SNP	ENST00000379554.3	37	c.721_splice	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113640	0.56398	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	.	.	.	6.16	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4736	0.44652	0.0853:0.0:0.9147:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INSC	15168822	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.767000	0.68850	2.937000	0.99478	0.650000	0.86243	.		0.512	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853	Intron	37	87	1	0	4.62619e-21	0.004289	7.605e-21	37	87				
DCDC1	341019	broad.mit.edu	37	11	30953443	30953443	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:30953443T>A	ENST00000597505.1	-	20	2771	c.2772A>T	c.(2770-2772)aaA>aaT	p.K924N	DCDC1_ENST00000339794.5_Missense_Mutation_p.K3N|DCDC1_ENST00000437348.1_5'UTR|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	277					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TACAGATGGGTTTCTTCATGG	0.413																																							uc009yjk.1		NA																	0					NA						c.(1114-1116)AAA>AAT		RecName: Full=Doublecortin domain-containing protein 5;							80.0	79.0	79.0					11																	30953443		2202	4299	6501	SO:0001583	missense	0							g.chr11:30953443T>A	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2772A>T	11.37:g.30953443T>A	ENSP00000472625:p.Lys924Asn		Somatic				uc009yjl.1_3'UTR	p.K372N			WXS	Illumina HiSeq	Unspecified					10	1185	-								A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37	c.1116A>T		.	.	.	.	.	.	.	.	.	.	T	14.15	2.449832	0.43531	.	.	ENSG00000170959	ENST00000339794;ENST00000437348	D	0.93247	-3.19	4.62	2.28	0.28536	.	0.324866	0.26023	N	0.026813	D	0.90356	0.6982	L	0.54323	1.7	0.23478	N	0.997594	P	0.50443	0.935	P	0.44990	0.466	D	0.83615	0.0136	10	0.66056	D	0.02	-10.658	6.8263	0.23885	0.0:0.2022:0.0:0.7978	.	3	Q6ZRR9	DCDC5_HUMAN	N	3	ENSP00000341700:K3N	ENSP00000341700:K3N	K	-	3	2	DCDC5	30910019	0.989000	0.36119	0.477000	0.27303	0.652000	0.38707	0.466000	0.22019	0.361000	0.24292	0.374000	0.22700	AAA		0.413	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807		13	26	0	0	0	0.001368	0	13	26				
OR4P4	81300	broad.mit.edu	37	11	55406128	55406128	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:55406128C>G	ENST00000314612.2	+	1	295	c.295C>G	c.(295-297)Ctc>Gtc	p.L99V		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						TATGATACAACTCTTTACCAC	0.443																																							uc010rij.1		NA																	0				central_nervous_system(1)	1						c.(295-297)CTC>GTC		olfactory receptor, family 4, subfamily P,							116.0	100.0	106.0					11																	55406128		2178	4018	6196	SO:0001583	missense	81300				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55406128C>G	AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.295C>G	11.37:g.55406128C>G	ENSP00000324831:p.Leu99Val		Somatic					p.L99V	NM_001004124	NP_001004124	WXS	Illumina HiSeq	Unspecified	Q8NGL7	OR4P4_HUMAN			1	295	+			99			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000314612.2	37	c.295C>G	CCDS31504.1	.	.	.	.	.	.	.	.	.	.	C	1.501	-0.551981	0.03996	.	.	ENSG00000181927	ENST00000314612	T	0.00414	7.52	5.18	-0.816	0.10839	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36972	N	0.002318	T	0.00241	0.0007	L	0.40543	1.245	0.09310	N	1	P	0.46621	0.881	B	0.41917	0.37	T	0.50541	-0.8816	10	0.18710	T	0.47	-14.7007	3.4903	0.07636	0.1268:0.3549:0.371:0.1473	.	99	Q8NGL7	OR4P4_HUMAN	V	99	ENSP00000324831:L99V	ENSP00000324831:L99V	L	+	1	0	OR4P4	55162704	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-3.284000	0.00527	0.185000	0.20105	-0.185000	0.12909	CTC		0.443	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383356.1	NM_001004124		16	76	0	0	0	0.003163	0	16	76				
OR9G1	390174	broad.mit.edu	37	11	56468651	56468651	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:56468651C>A	ENST00000312153.1	+	1	788	c.788C>A	c.(787-789)tCt>tAt	p.S263Y		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						CTCCCCAGATCTAGCTATTCT	0.433																																							uc010rjn.1		NA																	0					0						c.(787-789)TCT>TAT		olfactory receptor, family 9, subfamily G,							206.0	217.0	213.0					11																	56468651		2201	4296	6497	SO:0001583	missense	504191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56468651C>A	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.788C>A	11.37:g.56468651C>A	ENSP00000309012:p.Ser263Tyr		Somatic					p.S263Y	NM_001013358	NP_001013376	WXS	Illumina HiSeq	Unspecified	P0C7N8	OR9G9_HUMAN			1	788	+			263			Extracellular (Potential).		Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	37	c.788C>A	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492767	0.26774	.	.	ENSG00000174914	ENST00000312153	T	0.00274	8.35	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.122713	0.37715	N	0.001974	T	0.00998	0.0033	H	0.94771	3.58	0.09310	N	1	D	0.64830	0.994	D	0.68483	0.958	T	0.18429	-1.0337	10	0.72032	D	0.01	-13.6821	15.7588	0.78058	0.0:1.0:0.0:0.0	.	263	Q8NH87	OR9G1_HUMAN	Y	263	ENSP00000309012:S263Y	ENSP00000309012:S263Y	S	+	2	0	OR9G1	56225227	0.002000	0.14202	0.006000	0.13384	0.065000	0.16274	1.572000	0.36461	2.528000	0.85240	0.637000	0.83480	TCT		0.433	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213		15	178	1	0	1.3612e-06	0.003163	1.82759e-06	15	178				
MEN1	4221	broad.mit.edu	37	11	64575538	64575538	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:64575538G>T	ENST00000337652.1	-	3	997	c.494C>A	c.(493-495)gCt>gAt	p.A165D	MEN1_ENST00000478548.1_5'Flank|MEN1_ENST00000377326.3_Missense_Mutation_p.A160D|MEN1_ENST00000315422.4_Missense_Mutation_p.A160D|MEN1_ENST00000377321.1_Missense_Mutation_p.A160D|MEN1_ENST00000394376.1_Missense_Mutation_p.A165D|MEN1_ENST00000443283.1_Missense_Mutation_p.A165D|MEN1_ENST00000377316.2_Missense_Mutation_p.A160D|MEN1_ENST00000312049.6_Missense_Mutation_p.A160D|MEN1_ENST00000394374.2_Missense_Mutation_p.A165D|MEN1_ENST00000377313.1_Missense_Mutation_p.A165D	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	165			A -> P (in MEN1; strong decrease in JUND- binding). {ECO:0000269|PubMed:12112656, ECO:0000269|PubMed:9463336, ECO:0000269|PubMed:9989505}.|A -> T (in MEN1). {ECO:0000269|PubMed:12112656}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						CCCAACCACAGCAAAGGCCAC	0.602			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	uc001obj.2		NA	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	D|Mis|N|F|S	multiple endocrine neoplasia type 1 gene			E		parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid	parathyroid tumors|Pancreatic neuroendocrine tumors		0				parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						c.(493-495)GCT>GAT		menin isoform 1							34.0	37.0	36.0					11																	64575538		2201	4297	6498	SO:0001583	missense	4221	Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	g.chr11:64575538G>T	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.494C>A	11.37:g.64575538G>T	ENSP00000337088:p.Ala165Asp		Somatic				MEN1_uc001obk.2_Missense_Mutation_p.A165D|MEN1_uc001obl.2_Missense_Mutation_p.A160D|MEN1_uc001obm.2_Missense_Mutation_p.A160D|MEN1_uc001obn.2_Missense_Mutation_p.A165D|MEN1_uc001obo.2_Missense_Mutation_p.A165D|MEN1_uc001obp.2_Missense_Mutation_p.A160D|MEN1_uc001obq.2_Missense_Mutation_p.A165D|MEN1_uc001obr.2_Missense_Mutation_p.A165D	p.A165D	NM_130800	NP_570712	WXS	Illumina HiSeq	Unspecified	O00255	MEN1_HUMAN			3	567	-			165		A -> T (in MEN1).|A -> P (in MEN1; strong decrease in JUND- binding).			A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000337652.1	37	c.494C>A	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841397	0.91197	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626	D;D;D;D;D;D;D;D;D;D;D;D;D	0.99674	-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36;-6.36	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.99573	0.9846	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.982;0.996;0.989	D	0.97850	1.0274	10	0.87932	D	0	-15.3851	15.7433	0.77920	0.0:0.0:1.0:0.0	.	160;160;165	O00255-2;O00255-3;O00255	.;.;MEN1_HUMAN	D	160;160;160;160;160;165;165;165;165;165;160;160;160	ENSP00000366533:A160D;ENSP00000366538:A160D;ENSP00000366543:A160D;ENSP00000308975:A160D;ENSP00000323747:A160D;ENSP00000337088:A165D;ENSP00000377901:A165D;ENSP00000377899:A165D;ENSP00000396940:A165D;ENSP00000366530:A165D;ENSP00000413944:A160D;ENSP00000394933:A160D;ENSP00000411218:A160D	ENSP00000308975:A160D	A	-	2	0	MEN1	64332114	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	8.735000	0.91549	2.386000	0.81285	0.462000	0.41574	GCT		0.602	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1			8	9	1	0	1.12685e-05	0.004482	1.44391e-05	8	9				
CD248	57124	broad.mit.edu	37	11	66082510	66082510	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:66082510A>G	ENST00000311330.3	-	1	2005	c.1989T>C	c.(1987-1989)gcT>gcC	p.A663A	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	663	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CTGCTGTGGGAGCTGGTGAGG	0.647																																							uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1987-1989)GCT>GCC		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						29.0	31.0	31.0					11																	66082510		2198	4290	6488	SO:0001819	synonymous_variant	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66082510A>G	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1989T>C	11.37:g.66082510A>G			Somatic					p.A663A	NM_020404	NP_065137	WXS	Illumina HiSeq	Unspecified	Q9HCU0	CD248_HUMAN			1	2006	-			663			Pro-rich.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Silent	SNP	ENST00000311330.3	37	c.1989T>C	CCDS8134.1																																																																																				0.647	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		10	76	0	0	0	0.006214	0	10	76				
KRTAP5-9	3846	broad.mit.edu	37	11	71259973	71259973	+	Silent	SNP	A	A	T	rs35547146		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:71259973A>T	ENST00000528743.2	+	1	508	c.270A>T	c.(268-270)tcA>tcT	p.S90S		NM_005553.3	NP_005544.4	P26371	KRA59_HUMAN	keratin associated protein 5-9	90	8 X 4 AA repeats of C-C-X-P.				epidermis development (GO:0008544)	keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(6)|prostate(3)	11						GTTGCTCTTCAGGCTGTGGGT	0.632																																							uc001oqs.1		NA																	0					0						c.(268-270)TCA>TCT		keratin associated protein 5-9							106.0	120.0	115.0					11																	71259973		2200	4293	6493	SO:0001819	synonymous_variant	3846				epidermis development	keratin filament		g.chr11:71259973A>T	AB126078	CCDS53677.1	11q13.4	2008-02-05				ENSG00000254997		"""Keratin associated proteins"""	23604	protein-coding gene	gene with protein product		148021		KRN1		15144888	Standard	NM_005553		Approved	KRTAP5.9, KRTAP5-1	uc001oqs.1	P26371		ENST00000528743.2:c.270A>T	11.37:g.71259973A>T			Somatic					p.S90S	NM_005553	NP_005544	WXS	Illumina HiSeq	Unspecified	P26371	KRA59_HUMAN			1	508	+			90			8 X 4 AA repeats of C-C-X-P.		Q14564|Q3MIP8	Silent	SNP	ENST00000528743.2	37	c.270A>T	CCDS53677.1																																																																																				0.632	KRTAP5-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393901.2			140	191	0	0	0	0.00361	0	140	191				
LRRC32	2615	broad.mit.edu	37	11	76372307	76372307	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:76372307C>T	ENST00000407242.2	-	3	572	c.330G>A	c.(328-330)gcG>gcA	p.A110A	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Silent_p.A110A|LRRC32_ENST00000404995.1_Silent_p.A110A|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	110					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CAGTGGCCATCGCCAGCCGGT	0.672																																							uc001oxq.3		NA																	0					0						c.(328-330)GCG>GCA		leucine rich repeat containing 32 precursor							42.0	43.0	43.0					11																	76372307		2200	4292	6492	SO:0001819	synonymous_variant	2615					integral to plasma membrane		g.chr11:76372307C>T	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.330G>A	11.37:g.76372307C>T			Somatic				LRRC32_uc001oxr.3_Silent_p.A110A|LRRC32_uc010rsf.1_Silent_p.A110A	p.A110A	NM_005512	NP_005503	WXS	Illumina HiSeq	Unspecified	Q14392	LRC32_HUMAN			3	573	-			110			LRR 3.|Extracellular (Potential).		Q86V06	Silent	SNP	ENST00000407242.2	37	c.330G>A	CCDS8245.1																																																																																				0.672	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512		23	99	0	0	0	0.001882	0	23	99				
KCTD14	65987	broad.mit.edu	37	11	77727957	77727957	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:77727957C>A	ENST00000353172.5	-	2	494	c.450G>T	c.(448-450)gaG>gaT	p.E150D	KCTD14_ENST00000533144.1_Missense_Mutation_p.E120D|RP11-7I15.3_ENST00000533697.1_RNA	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	150					protein homooligomerization (GO:0051260)					endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			GCACCATGAGCTCCAGGTTCT	0.552																																					NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	uc001oyw.3		NA																	0				ovary(2)	2						c.(448-450)GAG>GAT		potassium channel tetramerisation domain							74.0	72.0	73.0					11																	77727957		2200	4292	6492	SO:0001583	missense	65987					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:77727957C>A	BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.450G>T	11.37:g.77727957C>A	ENSP00000316482:p.Glu150Asp		Somatic					p.E150D	NM_023930	NP_076419	WXS	Illumina HiSeq	Unspecified	Q9BQ13	KCD14_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1e-24)		2	475	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		150					B2R9R8	Missense_Mutation	SNP	ENST00000353172.5	37	c.450G>T	CCDS8255.2	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834605	0.71373	.	.	ENSG00000151364	ENST00000353172;ENST00000533144	T;T	0.68025	-0.3;-0.27	4.52	3.61	0.41365	.	0.109455	0.64402	D	0.000009	T	0.76321	0.3971	M	0.79926	2.475	0.58432	D	0.999992	D	0.58268	0.982	P	0.57502	0.822	T	0.76534	-0.2924	10	0.42905	T	0.14	.	10.252	0.43375	0.0:0.8337:0.0:0.1663	.	150	Q9BQ13	KCD14_HUMAN	D	150;120	ENSP00000316482:E150D;ENSP00000431155:E120D	ENSP00000316482:E150D	E	-	3	2	KCTD14	77405605	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	2.583000	0.46094	1.138000	0.42230	-0.254000	0.11334	GAG		0.552	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316888.1	NM_023930		5	124	1	0	1.23904e-05	0.000602	1.57568e-05	5	124				
GRM5	2915	broad.mit.edu	37	11	88337921	88337921	+	Silent	SNP	C	C	A	rs369401136		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:88337921C>A	ENST00000305447.4	-	4	1508	c.1359G>T	c.(1357-1359)acG>acT	p.T453T	GRM5_ENST00000455756.2_Silent_p.T453T|GRM5_ENST00000418177.2_Silent_p.T453T|GRM5_ENST00000305432.5_Silent_p.T453T|GRM5_ENST00000393297.1_Silent_p.T453T	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	453					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	CGAATAGGATCGTATCTCCAG	0.443																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(1357-1359)ACG>ACT		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						58.0	60.0	59.0					11																	88337921		2201	4299	6500	SO:0001819	synonymous_variant	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88337921C>A	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1359G>T	11.37:g.88337921C>A			Somatic				GRM5_uc009yvm.2_Silent_p.T453T	p.T453T	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			4	1559	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	453			Extracellular (Potential).		Q6J164	Silent	SNP	ENST00000305447.4	37	c.1359G>T	CCDS44694.1																																																																																				0.443	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		26	21	1	0	7.92952e-12	0.003954	1.21466e-11	26	21				
GRM5	2915	broad.mit.edu	37	11	88338052	88338052	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:88338052C>A	ENST00000305447.4	-	4	1377	c.1228G>T	c.(1228-1230)Ggg>Tgg	p.G410W	GRM5_ENST00000455756.2_Missense_Mutation_p.G410W|GRM5_ENST00000418177.2_Missense_Mutation_p.G410W|GRM5_ENST00000305432.5_Missense_Mutation_p.G410W|GRM5_ENST00000393297.1_Missense_Mutation_p.G410W	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	410					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	TTGTGGAGCCCATAGGCCATC	0.463																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(1228-1230)GGG>TGG		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						98.0	84.0	89.0					11																	88338052		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88338052C>A	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1228G>T	11.37:g.88338052C>A	ENSP00000306138:p.Gly410Trp		Somatic				GRM5_uc009yvm.2_Missense_Mutation_p.G410W	p.G410W	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			4	1428	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	410			Extracellular (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.1228G>T	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854707	0.91355	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2	5.89	5.89	0.94794	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92813	0.6266	9	.	.	.	.	20.2637	0.98458	0.0:1.0:0.0:0.0	.	410;410	P41594-2;P41594	.;GRM5_HUMAN	W	410	ENSP00000402912:G410W;ENSP00000405690:G410W;ENSP00000305905:G410W;ENSP00000306138:G410W;ENSP00000376975:G410W	.	G	-	1	0	GRM5	87977700	1.000000	0.71417	0.921000	0.36526	0.986000	0.74619	7.818000	0.86416	2.798000	0.96311	0.544000	0.68410	GGG		0.463	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		38	30	1	0	2.75727e-19	0.004878	4.48889e-19	38	30				
FAT3	120114	broad.mit.edu	37	11	92534237	92534237	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:92534237A>G	ENST00000298047.6	+	9	8075	c.8058A>G	c.(8056-8058)ccA>ccG	p.P2686P	FAT3_ENST00000409404.2_Silent_p.P2686P|FAT3_ENST00000525166.1_Silent_p.P2536P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2686	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGGCATCCCAGTAAAGCACT	0.458										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(8056-8058)CCA>CCG		FAT tumor suppressor homolog 3							59.0	56.0	57.0					11																	92534237		1939	4133	6072	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534237A>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8058A>G	11.37:g.92534237A>G		TCGA Ovarian(4;0.039)	Somatic					p.P2686P	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	8075	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2686			Cadherin 24.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.8058A>G																																																																																					0.458	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		3	31	0	0	0	0.004672	0	3	31				
DDI1	414301	broad.mit.edu	37	11	103907872	103907872	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:103907872C>G	ENST00000302259.3	+	1	565	c.322C>G	c.(322-324)Cgt>Ggt	p.R108G	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	108							aspartic-type endopeptidase activity (GO:0004190)	p.R108C(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GTCCAGCTCCCGTCCACAGCA	0.667																																							uc001phr.2		NA																	2	Substitution - Missense(2)		large_intestine(2)	large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(322-324)CGT>GGT		DDI1, DNA-damage inducible 1, homolog 1							93.0	93.0	93.0					11																	103907872		2202	4299	6501	SO:0001583	missense	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103907872C>G		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.322C>G	11.37:g.103907872C>G	ENSP00000302805:p.Arg108Gly		Somatic				PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.R108G	NM_001001711	NP_001001711	WXS	Illumina HiSeq	Unspecified	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	565	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	108					Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	c.322C>G	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.646506	0.29246	.	.	ENSG00000170967	ENST00000302259	T	0.24538	1.85	5.02	3.16	0.36331	.	0.791492	0.11533	N	0.554491	T	0.17365	0.0417	L	0.53249	1.67	0.09310	N	1	P	0.44090	0.826	B	0.32090	0.14	T	0.15694	-1.0428	10	0.30854	T	0.27	-9.7142	4.3768	0.11274	0.1797:0.6379:0.0:0.1823	.	108	Q8WTU0	DDI1_HUMAN	G	108	ENSP00000302805:R108G	ENSP00000302805:R108G	R	+	1	0	DDI1	103413082	0.235000	0.23794	0.176000	0.23000	0.012000	0.07955	1.250000	0.32850	1.502000	0.48669	-0.126000	0.14955	CGT		0.667	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		47	45	0	0	0	0.00361	0	47	45				
SNX19	399979	broad.mit.edu	37	11	130784585	130784585	+	Missense_Mutation	SNP	T	T	A	rs138524806		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:130784585T>A	ENST00000265909.4	-	1	1819	c.1250A>T	c.(1249-1251)gAg>gTg	p.E417V	SNX19_ENST00000533318.1_Intron|SNX19_ENST00000533214.1_Missense_Mutation_p.E417V|SNX19_ENST00000539184.1_Intron|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000528555.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	417					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TTCAGATGCCTCACCATCTTT	0.552																																							uc001qgk.3		NA																	0				ovary(2)|lung(2)	4						c.(1249-1251)GAG>GTG		sorting nexin 19							62.0	59.0	60.0					11																	130784585		2201	4297	6498	SO:0001583	missense	399979				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr11:130784585T>A	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1250A>T	11.37:g.130784585T>A	ENSP00000265909:p.Glu417Val		Somatic				SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Missense_Mutation_p.E417V|SNX19_uc009zcx.1_Intron	p.E417V	NM_014758	NP_055573	WXS	Illumina HiSeq	Unspecified	Q92543	SNX19_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)	1	1798	-	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)	417					E9PKB9|Q8IV55	Missense_Mutation	SNP	ENST00000265909.4	37	c.1250A>T	CCDS31721.1	.	.	.	.	.	.	.	.	.	.	T	6.448	0.450867	0.12223	.	.	ENSG00000120451	ENST00000265909;ENST00000533214	T;T	0.24538	1.85;1.85	5.1	1.54	0.23209	.	0.475966	0.20661	N	0.088040	T	0.16896	0.0406	L	0.29908	0.895	0.09310	N	1	P;B	0.42409	0.779;0.435	B;B	0.39299	0.296;0.221	T	0.08513	-1.0718	10	0.52906	T	0.07	-4.4261	8.1035	0.30872	0.0:0.3453:0.0:0.6547	.	417;417	E9PKB9;Q92543	.;SNX19_HUMAN	V	417	ENSP00000265909:E417V;ENSP00000435390:E417V	ENSP00000265909:E417V	E	-	2	0	SNX19	130289795	0.000000	0.05858	0.001000	0.08648	0.293000	0.27360	0.327000	0.19663	0.103000	0.17682	0.528000	0.53228	GAG		0.552	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		9	17	0	0	0	0.000978	0	9	17				
IGSF9B	22997	broad.mit.edu	37	11	133807324	133807324	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr11:133807324C>G	ENST00000321016.8	-	5	856	c.626G>C	c.(625-627)cGa>cCa	p.R209P	IGSF9B_ENST00000533871.2_Missense_Mutation_p.R209P			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	209	Ig-like 2.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCTGTACGCTCGGCAGGTGTA	0.617																																							uc001qgx.3		NA																	0					0						c.(625-627)CGA>CCA		immunoglobulin superfamily, member 9B							83.0	93.0	90.0					11																	133807324		2118	4213	6331	SO:0001583	missense	22997					integral to membrane|plasma membrane		g.chr11:133807324C>G	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.626G>C	11.37:g.133807324C>G	ENSP00000317980:p.Arg209Pro		Somatic				IGSF9B_uc001qgy.1_Missense_Mutation_p.R51P	p.R209P	NM_014987	NP_055802	WXS	Illumina HiSeq	Unspecified	Q9UPX0	TUTLB_HUMAN		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	5	857	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	209			Ig-like 2.|Extracellular (Potential).		G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37	c.626G>C		.	.	.	.	.	.	.	.	.	.	C	26.4	4.731304	0.89390	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648;ENST00000533160	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82379	0.5024	M	0.81614	2.55	0.58432	D	0.999994	D	0.59767	0.986	D	0.68039	0.955	T	0.81090	-0.1090	9	0.36615	T	0.2	.	19.4704	0.94961	0.0:1.0:0.0:0.0	.	209	Q9UPX0	TUTLB_HUMAN	P	209;51;209;199	ENSP00000317980:R209P;ENSP00000436552:R51P;ENSP00000436576:R209P;ENSP00000434026:R199P	ENSP00000317980:R209P	R	-	2	0	IGSF9B	133312534	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.712000	0.68407	2.597000	0.87782	0.561000	0.74099	CGA		0.617	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		10	8	0	0	0	0.001368	0	10	8				
NTF3	4908	broad.mit.edu	37	12	5604005	5604005	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:5604005G>T	ENST00000331010.6	+	1	708	c.625G>T	c.(625-627)Gat>Tat	p.D209Y	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.D222Y	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	209					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						CAGGGGTATTGATGATAAACA	0.488																																					GBM(194;1104 2182 8339 9578 18493)	GBM(194;1104 2182 8339 9578 18493)	uc001qnl.3		NA																	0				pancreas(1)	1						c.(625-627)GAT>TAT		neurotrophin 3 isoform 2 preproprotein							65.0	58.0	60.0					12																	5604005		2203	4300	6503	SO:0001583	missense	4908				signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding	g.chr12:5604005G>T		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.625G>T	12.37:g.5604005G>T	ENSP00000328738:p.Asp209Tyr		Somatic				NTF3_uc001qnk.3_Missense_Mutation_p.D222Y	p.D209Y	NM_002527	NP_002518	WXS	Illumina HiSeq	Unspecified	P20783	NTF3_HUMAN			1	708	+			209					B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	c.625G>T	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910561	0.72983	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.76186	-1.0;-1.0	5.45	5.45	0.79879	Nerve growth factor-related (5);Nerve growth factor conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88051	0.6333	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89621	0.3848	10	0.87932	D	0	-34.8341	18.2818	0.90101	0.0:0.0:1.0:0.0	.	209;222	P20783;B7Z1T5	NTF3_HUMAN;.	Y	222;209	ENSP00000397297:D222Y;ENSP00000328738:D209Y	ENSP00000328738:D209Y	D	+	1	0	NTF3	5474266	1.000000	0.71417	0.971000	0.41717	0.964000	0.63967	9.869000	0.99810	2.583000	0.87209	0.650000	0.86243	GAT		0.488	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1			4	54	1	0	0.000602214	0.000602	0.000709602	4	54				
NCAPD2	9918	broad.mit.edu	37	12	6624087	6624087	+	Splice_Site	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:6624087G>A	ENST00000315579.5	+	9	1786		c.e9+1		NCAPD2_ENST00000545962.1_Splice_Site	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GGATGGAGAAGTAGGTGGTCC	0.458																																							uc001qoo.2		NA																	0				ovary(2)|lung(1)|breast(1)|kidney(1)	5						c.e9+1		non-SMC condensin I complex, subunit D2							112.0	93.0	100.0					12																	6624087		2203	4300	6503	SO:0001630	splice_region_variant	9918				cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding	g.chr12:6624087G>A	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.987+1G>A	12.37:g.6624087G>A			Somatic				NCAPD2_uc009zen.1_Splice_Site_p.E201_splice|NCAPD2_uc010sfd.1_Splice_Site_p.E284_splice	p.E329_splice	NM_014865	NP_055680	WXS	Illumina HiSeq	Unspecified	Q15021	CND1_HUMAN			9	1033	+								D3DUR4|Q8N6U3	Splice_Site	SNP	ENST00000315579.5	37	c.987_splice	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836109	0.71373	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCAPD2	6494348	1.000000	0.71417	0.996000	0.52242	0.658000	0.38924	8.754000	0.91642	2.652000	0.90054	0.655000	0.94253	.		0.458	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	Intron	29	49	0	0	0	0.002445	0	29	49				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	8	1	0	5.4927e-09	0.004482	7.97862e-09	8	8				
TMEM117	84216	broad.mit.edu	37	12	44781917	44781917	+	Missense_Mutation	SNP	C	C	T	rs141562455		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:44781917C>T	ENST00000266534.3	+	8	1134	c.1007C>T	c.(1006-1008)cCg>cTg	p.P336L	TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000536799.1_Missense_Mutation_p.P232L|TMEM117_ENST00000551577.1_3'UTR	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	336						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		TATATCGGCCCGGGGCAGAAG	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		17324	0.0		0.0	False		,,,				2504	0.001						uc001rod.2		NA																	0					0						c.(1006-1008)CCG>CTG		transmembrane protein 117		C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	50.0	50.0	50.0		1007	5.7	1.0	12	dbSNP_134	50	2,8596	2.2+/-6.3	0,2,4297	yes	missense	TMEM117	NM_032256.1	98	0,3,6499	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	336/515	44781917	3,13001	2203	4299	6502	SO:0001583	missense	84216					endoplasmic reticulum|integral to membrane		g.chr12:44781917C>T	BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1007C>T	12.37:g.44781917C>T	ENSP00000266534:p.Pro336Leu		Somatic				TMEM117_uc001roe.2_Missense_Mutation_p.P232L|TMEM117_uc009zkc.2_3'UTR	p.P336L	NM_032256	NP_115632	WXS	Illumina HiSeq	Unspecified	Q9H0C3	TM117_HUMAN		GBM - Glioblastoma multiforme(48;0.124)	8	1073	+	Lung SC(27;0.192)		336						Missense_Mutation	SNP	ENST00000266534.3	37	c.1007C>T	CCDS8745.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308495	0.81247	2.27E-4	2.33E-4	ENSG00000139173	ENST00000266534;ENST00000536799;ENST00000417623	T;T	0.48201	0.82;0.82	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.69566	0.3125	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.70586	-0.4831	10	0.72032	D	0.01	-12.5349	19.9155	0.97058	0.0:1.0:0.0:0.0	.	232;336	F5H3Q2;Q9H0C3	.;TM117_HUMAN	L	336;232;84	ENSP00000266534:P336L;ENSP00000445243:P232L	ENSP00000266534:P336L	P	+	2	0	TMEM117	43068184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.699000	0.92147	0.650000	0.86243	CCG		0.378	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1	NM_032256		4	32	0	0	0	0.000248	0	4	32				
WNT10B	7480	broad.mit.edu	37	12	49359933	49359933	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:49359933C>A	ENST00000301061.4	-	5	1463	c.1115G>T	c.(1114-1116)tGc>tTc	p.C372F	WNT10B_ENST00000403957.1_3'UTR|WNT10B_ENST00000407467.1_3'UTR	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	372					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						CAGCACATAGCAGCACCAGTG	0.592																																							uc001rss.2		NA																	0				skin(4)|lung(3)	7						c.(1114-1116)TGC>TTC		wingless-type MMTV integration site family,							89.0	67.0	74.0					12																	49359933		2203	4300	6503	SO:0001583	missense	7480				axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr12:49359933C>A	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.1115G>T	12.37:g.49359933C>A	ENSP00000301061:p.Cys372Phe		Somatic				WNT10B_uc001rst.2_3'UTR	p.C372F	NM_003394	NP_003385	WXS	Illumina HiSeq	Unspecified	O00744	WN10B_HUMAN			5	1461	-			372					B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	ENST00000301061.4	37	c.1115G>T	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.207159	0.79127	.	.	ENSG00000169884	ENST00000301061	D	0.82711	-1.64	4.14	4.14	0.48551	.	0.114760	0.64402	D	0.000014	D	0.92567	0.7639	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94306	0.7541	10	0.87932	D	0	.	15.7181	0.77685	0.0:1.0:0.0:0.0	.	372	O00744	WN10B_HUMAN	F	372	ENSP00000301061:C372F	ENSP00000301061:C372F	C	-	2	0	WNT10B	47646200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.647000	0.83462	2.303000	0.77524	0.561000	0.74099	TGC		0.592	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394		18	53	1	0	9.7654e-05	0.007413	0.000118807	18	53				
KMT2D	8085	broad.mit.edu	37	12	49444044	49444044	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:49444044G>A	ENST00000301067.7	-	11	3326	c.3327C>T	c.(3325-3327)gcC>gcT	p.A1109A		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1109	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCAGGGCTGGGGCAGGGCTGG	0.622																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(3325-3327)GCC>GCT		myeloid/lymphoid or mixed-lineage leukemia 2							14.0	16.0	15.0					12																	49444044		1886	4091	5977	SO:0001819	synonymous_variant	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49444044G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3327C>T	12.37:g.49444044G>A		HNSCC(34;0.089)	Somatic					p.A1109A	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			11	3327	-			1109			Pro-rich.		O14687	Silent	SNP	ENST00000301067.7	37	c.3327C>T	CCDS44873.1																																																																																				0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			3	19	0	0	0	0.000248	0	3	19				
MMP19	4327	broad.mit.edu	37	12	56236185	56236185	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:56236185A>G	ENST00000322569.4	-	2	216	c.125T>C	c.(124-126)cTa>cCa	p.L42P	MMP19_ENST00000547487.1_5'UTR|MMP19_ENST00000548629.1_Missense_Mutation_p.L42P|MMP19_ENST00000409200.3_Missense_Mutation_p.L42P	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	42					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	AGATCCTTCTAGAGGCTTCTG	0.453																																							uc001sib.2		NA																	0				ovary(1)	1						c.(124-126)CTA>CCA		matrix metalloproteinase 19 isoform rasi-1							156.0	133.0	140.0					12																	56236185		2203	4300	6503	SO:0001583	missense	4327				angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr12:56236185A>G	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.125T>C	12.37:g.56236185A>G	ENSP00000313437:p.Leu42Pro		Somatic				MMP19_uc001sia.2_5'Flank|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Missense_Mutation_p.L42P	p.L42P	NM_002429	NP_002420	WXS	Illumina HiSeq	Unspecified	Q99542	MMP19_HUMAN			2	246	-			42					B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	c.125T>C	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.233107	0.79688	.	.	ENSG00000123342	ENST00000322569;ENST00000548629;ENST00000409200	T;T;T	0.32988	1.43;1.43;1.43	6.08	6.08	0.98989	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.672299	0.14356	N	0.324791	T	0.47967	0.1474	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.972	T	0.11665	-1.0578	10	0.23302	T	0.38	.	15.6264	0.76863	1.0:0.0:0.0:0.0	.	42;42	B4E030;Q99542	.;MMP19_HUMAN	P	42	ENSP00000313437:L42P;ENSP00000446979:L42P;ENSP00000386625:L42P	ENSP00000313437:L42P	L	-	2	0	MMP19	54522452	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.158000	0.58150	2.333000	0.79357	0.533000	0.62120	CTA		0.453	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429		7	110	0	0	0	0.004482	0	7	110				
NUP107	57122	broad.mit.edu	37	12	69115750	69115750	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:69115750G>C	ENST00000229179.4	+	16	1773	c.1441G>C	c.(1441-1443)Gaa>Caa	p.E481Q	NUP107_ENST00000378905.2_Missense_Mutation_p.E330Q|NUP107_ENST00000539906.1_Missense_Mutation_p.E452Q	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	481					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			ACTCCCTAGAGAATATCTGGG	0.428																																							uc001suf.2		NA																	0				skin(1)	1						c.(1441-1443)GAA>CAA		nucleoporin 107kDa							112.0	115.0	114.0					12																	69115750		2203	4300	6503	SO:0001583	missense	57122				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding	g.chr12:69115750G>C	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.1441G>C	12.37:g.69115750G>C	ENSP00000229179:p.Glu481Gln		Somatic				NUP107_uc001sug.2_Missense_Mutation_p.E328Q|NUP107_uc010stj.1_Missense_Mutation_p.E452Q	p.E481Q	NM_020401	NP_065134	WXS	Illumina HiSeq	Unspecified	P57740	NU107_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)		16	1556	+	Breast(13;6.25e-06)		481					B4DZ67|Q6PJE1	Missense_Mutation	SNP	ENST00000229179.4	37	c.1441G>C	CCDS8985.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683799	0.47991	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.27	4.38	0.52667	.	0.092240	0.64402	D	0.000001	T	0.73257	0.3564	M	0.75777	2.31	0.58432	D	0.999999	B;B;B	0.30033	0.266;0.152;0.266	B;B;B	0.42882	0.401;0.232;0.305	T	0.71550	-0.4559	8	.	.	.	-15.5424	14.3385	0.66608	0.0718:0.0:0.9282:0.0	.	452;330;481	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	Q	481;330;452	.	.	E	+	1	0	NUP107	67402017	1.000000	0.71417	0.987000	0.45799	0.642000	0.38348	7.425000	0.80255	1.376000	0.46267	0.557000	0.71058	GAA		0.428	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	NM_020401		24	34	0	0	0	0.004656	0	24	34				
KERA	11081	broad.mit.edu	37	12	91449763	91449763	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:91449763C>G	ENST00000266719.3	-	2	543	c.296G>C	c.(295-297)tGg>tCg	p.W99S		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	99					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TAGATTTATCCATCTTAGCTG	0.368																																							uc001tbl.2		NA																	0				skin(1)	1						c.(295-297)TGG>TCG		keratocan precursor							149.0	137.0	141.0					12																	91449763		2203	4299	6502	SO:0001583	missense	11081				response to stimulus|visual perception	proteinaceous extracellular matrix		g.chr12:91449763C>G	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.296G>C	12.37:g.91449763C>G	ENSP00000266719:p.Trp99Ser		Somatic					p.W99S	NM_007035	NP_008966	WXS	Illumina HiSeq	Unspecified	O60938	KERA_HUMAN			2	915	-			99			LRR 2.			Missense_Mutation	SNP	ENST00000266719.3	37	c.296G>C	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964694	0.74131	.	.	ENSG00000139330	ENST00000266719	T	0.54866	0.55	6.04	6.04	0.98038	.	0.150167	0.64402	D	0.000004	T	0.63988	0.2558	L	0.33137	0.985	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.54111	-0.8342	10	0.21540	T	0.41	-6.629	20.6439	0.99570	0.0:1.0:0.0:0.0	.	99	O60938	KERA_HUMAN	S	99	ENSP00000266719:W99S	ENSP00000266719:W99S	W	-	2	0	KERA	89973894	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.484000	0.81180	2.890000	0.99128	0.650000	0.86243	TGG		0.368	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035		27	56	0	0	0	0.003954	0	27	56				
SSH1	54434	broad.mit.edu	37	12	109182463	109182463	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:109182463C>T	ENST00000326495.5	-	15	2544	c.2451G>A	c.(2449-2451)caG>caA	p.Q817Q	SSH1_ENST00000360239.3_Silent_p.Q505Q	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	817					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGCCTGCCTTCTGCAGCTGAA	0.587																																							uc001tnm.2		NA																	0				ovary(4)	4						c.(2449-2451)CAG>CAA		slingshot 1 isoform 1							71.0	67.0	68.0					12																	109182463		2203	4300	6503	SO:0001819	synonymous_variant	54434				actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr12:109182463C>T	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2451G>A	12.37:g.109182463C>T			Somatic				SSH1_uc001tnl.2_Silent_p.Q505Q	p.Q817Q	NM_018984	NP_061857	WXS	Illumina HiSeq	Unspecified	Q8WYL5	SSH1_HUMAN			15	2538	-			817					Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	ENST00000326495.5	37	c.2451G>A	CCDS9121.1																																																																																				0.587	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984		10	71	0	0	0	0.008291	0	10	71				
OAS2	4939	broad.mit.edu	37	12	113445593	113445593	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:113445593G>T	ENST00000342315.4	+	9	1954	c.1740G>T	c.(1738-1740)ggG>ggT	p.G580G	OAS2_ENST00000392583.2_Silent_p.G580G|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	580	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGGAGCAGGGGAGTGGAGTGC	0.517																																					Pancreas(199;709 2232 18410 33584 35052)	Pancreas(199;709 2232 18410 33584 35052)	uc001tuj.2		NA																	0				ovary(1)	1						c.(1738-1740)GGG>GGT		2'-5'-oligoadenylate synthetase 2 isoform 1							124.0	110.0	115.0					12																	113445593		2203	4300	6503	SO:0001819	synonymous_variant	4939				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113445593G>T	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1740G>T	12.37:g.113445593G>T			Somatic				OAS2_uc001tui.1_Silent_p.G580G	p.G580G	NM_016817	NP_058197	WXS	Illumina HiSeq	Unspecified	P29728	OAS2_HUMAN			9	1880	+			580			OAS domain 2.		A8K9T1|Q6PJ33|Q86XX8	Silent	SNP	ENST00000342315.4	37	c.1740G>T	CCDS31906.1																																																																																				0.517	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			8	126	1	0	1.12685e-05	0.004482	1.44391e-05	8	126				
RNFT2	84900	broad.mit.edu	37	12	117271635	117271635	+	Silent	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:117271635G>C	ENST00000257575.4	+	8	1154	c.921G>C	c.(919-921)ctG>ctC	p.L307L	RNFT2_ENST00000407967.3_Silent_p.L307L|RNFT2_ENST00000392549.2_Silent_p.L307L|RNFT2_ENST00000319176.7_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	307						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TGAGCCAGCTGTTCCGATCCC	0.512																																							uc009zwn.2		NA																	0					0						c.(919-921)CTG>CTC		transmembrane protein 118 isoform 1							103.0	82.0	89.0					12																	117271635		2203	4300	6503	SO:0001819	synonymous_variant	84900					integral to membrane	zinc ion binding	g.chr12:117271635G>C	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.921G>C	12.37:g.117271635G>C			Somatic				RNFT2_uc001twb.3_Silent_p.L307L|RNFT2_uc001twa.3_Silent_p.L217L|RNFT2_uc001twc.3_Silent_p.L55L	p.L307L	NM_001109903	NP_001103373	WXS	Illumina HiSeq	Unspecified	Q96EX2	RNFT2_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.034)	8	1154	+	all_neural(191;0.117)|Medulloblastoma(191;0.163)		307			Cytoplasmic (Potential).		E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	c.921G>C	CCDS44987.1																																																																																				0.512	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814		19	29	0	0	0	0.008871	0	19	29				
ANAPC5	51433	broad.mit.edu	37	12	121758194	121758194	+	Silent	SNP	G	G	A	rs191042943		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr12:121758194G>A	ENST00000261819.3	-	12	1630	c.1509C>T	c.(1507-1509)caC>caT	p.H503H	ANAPC5_ENST00000541887.1_Silent_p.H490H|ANAPC5_ENST00000344395.4_Silent_p.H391H|ANAPC5_ENST00000535482.1_Silent_p.H169H|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000441917.2_Silent_p.H391H	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	503					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTACCTGGGCGTGCTGACTAT	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		16767	0.001		0.0	False		,,,				2504	0.0						uc001uag.2		NA																	0				skin(3)|breast(2)|kidney(1)	6						c.(1507-1509)CAC>CAT		anaphase-promoting complex subunit 5 isoform a							87.0	83.0	85.0					12																	121758194		2203	4300	6503	SO:0001819	synonymous_variant	51433				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity	g.chr12:121758194G>A	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1509C>T	12.37:g.121758194G>A			Somatic				ANAPC5_uc010szu.1_Silent_p.H169H|ANAPC5_uc001uae.2_Silent_p.H67H|ANAPC5_uc010szv.1_Silent_p.H105H|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Silent_p.H391H|ANAPC5_uc001uai.1_Silent_p.H105H	p.H503H	NM_016237	NP_057321	WXS	Illumina HiSeq	Unspecified	Q9UJX4	APC5_HUMAN			12	1631	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		503					E9PFB2|Q8N4H7|Q9BQD4	Silent	SNP	ENST00000261819.3	37	c.1509C>T	CCDS9220.1																																																																																				0.368	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1			6	44	0	0	0	0.001984	0	6	44				
RNF17	56163	broad.mit.edu	37	13	25433215	25433215	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr13:25433215G>A	ENST00000255324.5	+	26	3739	c.3687G>A	c.(3685-3687)tgG>tgA	p.W1229*	RNF17_ENST00000339524.3_Nonsense_Mutation_p.W281*|RNF17_ENST00000381921.1_Nonsense_Mutation_p.W1229*	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1229	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CTTATTTCTGGAAAAAAGGAG	0.373																																							uc001upr.2		NA																	0				ovary(1)|skin(1)	2						c.(3685-3687)TGG>TGA		ring finger protein 17							93.0	91.0	92.0					13																	25433215		2203	4300	6503	SO:0001587	stop_gained	56163				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding	g.chr13:25433215G>A	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3687G>A	13.37:g.25433215G>A	ENSP00000255324:p.Trp1229*		Somatic				RNF17_uc010tdd.1_Nonsense_Mutation_p.W1088*|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Nonsense_Mutation_p.W1225*|RNF17_uc001ups.2_Nonsense_Mutation_p.W1168*|RNF17_uc010aac.2_Nonsense_Mutation_p.W427*|RNF17_uc010aad.2_Nonsense_Mutation_p.W281*	p.W1229*	NM_031277	NP_112567	WXS	Illumina HiSeq	Unspecified	Q9BXT8	RNF17_HUMAN		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)	26	3728	+		Lung SC(185;0.0225)|Breast(139;0.077)	1229			Tudor 3.		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Nonsense_Mutation	SNP	ENST00000255324.5	37	c.3687G>A	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	42	9.411246	0.99163	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000418120;ENST00000339524	.	.	.	5.13	5.13	0.70059	.	0.076157	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-6.9535	17.8725	0.88815	0.0:0.0:1.0:0.0	.	.	.	.	X	1229;1229;553;281	.	ENSP00000255324:W1229X	W	+	3	0	RNF17	24331215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.028000	0.76470	2.827000	0.97445	0.650000	0.86243	TGG		0.373	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994		6	32	0	0	0	0.001168	0	6	32				
SMAD9	4093	broad.mit.edu	37	13	37427691	37427691	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr13:37427691C>A	ENST00000399275.2	-	5	1264	c.1125G>T	c.(1123-1125)aaG>aaT	p.K375N	SMAD9_ENST00000350148.5_Missense_Mutation_p.K338N|SMAD9_ENST00000379826.4_Missense_Mutation_p.K375N			O15198	SMAD9_HUMAN	SMAD family member 9	375	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		CGCTGGGGATCTTGCAGACGG	0.567																																							uc001uvw.2		NA																	0					0						c.(1123-1125)AAG>AAT		SMAD family member 9 isoform a							142.0	91.0	108.0					13																	37427691		2203	4300	6503	SO:0001583	missense	4093				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity	g.chr13:37427691C>A		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.1125G>T	13.37:g.37427691C>A	ENSP00000382216:p.Lys375Asn		Somatic				SMAD9_uc001uvx.2_Missense_Mutation_p.K338N|SMAD9_uc010tep.1_Missense_Mutation_p.K168N	p.K375N	NM_001127217	NP_001120689	WXS	Illumina HiSeq	Unspecified	O15198	SMAD9_HUMAN		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)	6	1468	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	375			MH2.		A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	37	c.1125G>T	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631581	0.87660	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	D;D;D	0.99338	-5.76;-5.76;-5.76	5.42	5.42	0.78866	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99616	0.9860	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.985;0.994	D	0.97849	1.0273	10	0.87932	D	0	.	18.203	0.89844	0.0:1.0:0.0:0.0	.	338;375	O15198-2;O15198	.;SMAD9_HUMAN	N	375;338;375	ENSP00000382216:K375N;ENSP00000239885:K338N;ENSP00000369154:K375N	ENSP00000239885:K338N	K	-	3	2	SMAD9	36325691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.715000	0.61909	2.535000	0.85469	0.655000	0.94253	AAG		0.567	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905		13	34	1	0	4.3838e-07	0.001855	5.95702e-07	13	34				
MYCBP2	23077	broad.mit.edu	37	13	77831856	77831856	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr13:77831856T>C	ENST00000544440.2	-	14	2029	c.2012A>G	c.(2011-2013)aAt>aGt	p.N671S	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.N671S|MYCBP2_ENST00000407578.2_Missense_Mutation_p.N709S					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTGTCCTTTATTATTTACACC	0.383																																							uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(2011-2013)AAT>AGT		MYC binding protein 2							224.0	217.0	219.0					13																	77831856		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77831856T>C	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2012A>G	13.37:g.77831856T>C	ENSP00000444596:p.Asn671Ser		Somatic				MYCBP2_uc010aev.2_Missense_Mutation_p.N75S	p.N671S	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	15	2103	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	671			RCC1 2.			Missense_Mutation	SNP	ENST00000544440.2	37	c.2012A>G		.	.	.	.	.	.	.	.	.	.	T	27.7	4.858243	0.91433	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.80123	-1.34;-1.34;-1.34	5.84	5.84	0.93424	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	N	0.21097	0.63	0.58432	D	0.999999	D	0.57257	0.979	D	0.74023	0.982	D	0.85611	0.1258	10	0.62326	D	0.03	.	16.226	0.82293	0.0:0.0:0.0:1.0	.	671	O75592	MYCB2_HUMAN	S	671;709;671	ENSP00000349892:N671S;ENSP00000384288:N709S;ENSP00000444596:N671S	ENSP00000349892:N671S	N	-	2	0	MYCBP2	76729857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.230000	0.72887	0.528000	0.53228	AAT		0.383	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		48	79	0	0	0	0.00361	0	48	79				
RNF113B	140432	broad.mit.edu	37	13	98829015	98829015	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr13:98829015G>C	ENST00000267291.6	-	1	504	c.476C>G	c.(475-477)cCc>cGc	p.P159R	FARP1_ENST00000376581.5_Intron|FARP1_ENST00000319562.6_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	159							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CGTGTCCTTGGGCTTCAGGTA	0.647																																							uc001vnk.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(475-477)CCC>CGC		ring finger protein 113B							90.0	76.0	80.0					13																	98829015		2203	4300	6503	SO:0001583	missense	140432						nucleic acid binding|zinc ion binding	g.chr13:98829015G>C	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.476C>G	13.37:g.98829015G>C	ENSP00000267291:p.Pro159Arg		Somatic				FARP1_uc001vnh.2_Intron|FARP1_uc001vni.2_Intron|FARP1_uc001vnj.2_Intron	p.P159R	NM_178861	NP_849192	WXS	Illumina HiSeq	Unspecified	Q8IZP6	R113B_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.13)		1	507	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		159					Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	c.476C>G	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	G	5.965	0.361956	0.11296	.	.	ENSG00000139797	ENST00000267291	T	0.28895	1.59	1.16	1.16	0.20824	.	0.000000	0.85682	U	0.000000	T	0.24586	0.0596	L	0.60455	1.87	0.47214	D	0.999357	P	0.34462	0.454	B	0.33690	0.168	T	0.04005	-1.0985	10	0.22109	T	0.4	.	8.184	0.31328	0.0:0.0:1.0:0.0	.	159	Q8IZP6	R113B_HUMAN	R	159	ENSP00000267291:P159R	ENSP00000267291:P159R	P	-	2	0	RNF113B	97627016	1.000000	0.71417	0.988000	0.46212	0.108000	0.19459	6.310000	0.72830	0.936000	0.37367	0.484000	0.47621	CCC		0.647	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3	NM_178861		19	54	0	0	0	0.006122	0	19	54				
OR4K2	390431	broad.mit.edu	37	14	20345265	20345265	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:20345265C>A	ENST00000298642.2	+	1	875	c.839C>A	c.(838-840)cCc>cAc	p.P280H		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCTTTACTCCCACTCTGAAC	0.378																																							uc001vwh.1		NA																	0				ovary(2)|skin(2)	4						c.(838-840)CCC>CAC		olfactory receptor, family 4, subfamily K,							115.0	120.0	119.0					14																	20345265		2203	4300	6503	SO:0001583	missense	390431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20345265C>A		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.839C>A	14.37:g.20345265C>A	ENSP00000298642:p.Pro280His		Somatic					p.P280H	NM_001005501	NP_001005501	WXS	Illumina HiSeq	Unspecified	Q8NGD2	OR4K2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	839	+	all_cancers(95;0.00108)		280			Helical; Name=7; (Potential).		B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	37	c.839C>A	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	12.70	2.015898	0.35606	.	.	ENSG00000165762	ENST00000298642	T	0.00349	7.99	5.16	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000151	T	0.01353	0.0044	H	0.98218	4.175	0.38485	D	0.947826	D	0.89917	1.0	D	0.87578	0.998	T	0.18116	-1.0347	10	0.87932	D	0	.	9.7719	0.40595	0.0:0.8312:0.0:0.1688	.	280	Q8NGD2	OR4K2_HUMAN	H	280	ENSP00000298642:P280H	ENSP00000298642:P280H	P	+	2	0	OR4K2	19415105	0.995000	0.38212	0.776000	0.31678	0.240000	0.25518	4.452000	0.60054	0.765000	0.33221	0.591000	0.81541	CCC		0.378	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1			29	56	1	0	8.58068e-18	0.007291	1.377e-17	29	56				
SLC7A8	23428	broad.mit.edu	37	14	23598917	23598917	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:23598917G>A	ENST00000316902.7	-	9	1930	c.1205C>T	c.(1204-1206)aCg>aTg	p.T402M	SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000453702.1_Missense_Mutation_p.T199M|SLC7A8_ENST00000529705.2_Missense_Mutation_p.T297M|SLC7A8_ENST00000422941.2_Missense_Mutation_p.T178M	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	402					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TCCAGCAACCGTGACCCCATA	0.542																																							uc001wiz.2		NA																	0				ovary(1)	1						c.(1204-1206)ACG>ATG		solute carrier family 7 (cationic amino acid	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)						230.0	199.0	210.0					14																	23598917		2203	4300	6503	SO:0001583	missense	23428				blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity	g.chr14:23598917G>A	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.1205C>T	14.37:g.23598917G>A	ENSP00000320378:p.Thr402Met		Somatic				SLC7A8_uc001wiw.2_Missense_Mutation_p.T19M|SLC7A8_uc001wix.2_Missense_Mutation_p.T199M|SLC7A8_uc010tnk.1_Missense_Mutation_p.T178M|SLC7A8_uc010tnl.1_Missense_Mutation_p.T297M|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_Intron	p.T402M	NM_012244	NP_036376	WXS	Illumina HiSeq	Unspecified	Q9UHI5	LAT2_HUMAN		GBM - Glioblastoma multiforme(265;0.00809)	9	1931	-	all_cancers(95;4.6e-05)		402			Helical; (Potential).		B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	c.1205C>T	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	G	31	5.098824	0.94197	.	.	ENSG00000092068	ENST00000316902;ENST00000453702;ENST00000529705;ENST00000422941;ENST00000206514	D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56	5.86	5.86	0.93980	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.95373	0.8498	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.988;0.989	D	0.95530	0.8602	10	0.87932	D	0	.	18.958	0.92668	0.0:0.0:1.0:0.0	.	297;178;402	B4DKT4;B4DTV6;Q9UHI5	.;.;LAT2_HUMAN	M	402;199;297;178;199	ENSP00000320378:T402M;ENSP00000391577:T199M;ENSP00000434345:T297M;ENSP00000416398:T178M	ENSP00000206514:T199M	T	-	2	0	SLC7A8	22668757	1.000000	0.71417	0.980000	0.43619	0.975000	0.68041	9.518000	0.98022	2.775000	0.95449	0.655000	0.94253	ACG		0.542	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3			22	149	0	0	0	0.00278	0	22	149				
MYH7	4625	broad.mit.edu	37	14	23884616	23884616	+	Nonsense_Mutation	SNP	C	C	A	rs545585809		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:23884616C>A	ENST00000355349.3	-	36	5419	c.5257G>T	c.(5257-5259)Gag>Tag	p.E1753*	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1753			E -> K (in CMH1). {ECO:0000269|PubMed:15483641}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTGGCCTTCTCCTCAGCATTC	0.577																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4	GRCh37	CM050715	MYH7	M		c.(5257-5259)GAG>TAG		myosin, heavy chain 7, cardiac muscle, beta							200.0	161.0	175.0					14																	23884616		2203	4300	6503	SO:0001587	stop_gained	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23884616C>A	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5257G>T	14.37:g.23884616C>A	ENSP00000347507:p.Glu1753*		Somatic					p.E1753*	NM_000257	NP_000248	WXS	Illumina HiSeq	Unspecified	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	36	5363	-	all_cancers(95;2.54e-05)		1753		E -> K (in CMH1).	Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Nonsense_Mutation	SNP	ENST00000355349.3	37	c.5257G>T	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	47	13.174949	0.99725	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.3757	0.94508	0.0:1.0:0.0:0.0	.	.	.	.	X	1753;1758	.	ENSP00000347507:E1753X	E	-	1	0	MYH7	22954456	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.504000	0.66968	2.814000	0.96858	0.655000	0.94253	GAG		0.577	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		51	81	1	0	3.10996e-30	0.00361	5.32009e-30	51	81				
SLC8A3	6547	broad.mit.edu	37	14	70634870	70634870	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:70634870C>T	ENST00000381269.2	-	2	1023	c.270G>A	c.(268-270)ggG>ggA	p.G90G	SLC8A3_ENST00000534137.1_Silent_p.G90G|SLC8A3_ENST00000528359.1_Silent_p.G90G|SLC8A3_ENST00000356921.2_Silent_p.G90G|SLC8A3_ENST00000357887.3_Silent_p.G90G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	90					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TGATGGACACCCCAAGGAACA	0.488																																							uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(268-270)GGG>GGA		solute carrier family 8 (sodium/calcium							82.0	73.0	76.0					14																	70634870		2203	4300	6503	SO:0001819	synonymous_variant	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70634870C>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.270G>A	14.37:g.70634870C>T			Somatic				SLC8A3_uc001xlw.2_Silent_p.G90G|SLC8A3_uc001xlx.2_Silent_p.G90G|SLC8A3_uc001xlz.2_Silent_p.G90G|SLC8A3_uc010ara.2_RNA	p.G90G	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	1024	-			90			Helical; (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	c.270G>A	CCDS35498.1																																																																																				0.488	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			4	41	0	0	0	0.000248	0	4	41				
EML5	161436	broad.mit.edu	37	14	89087624	89087624	+	Silent	SNP	T	T	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:89087624T>G	ENST00000380664.5	-	36	5010	c.5011A>C	c.(5011-5013)Agg>Cgg	p.R1671R	EML5_ENST00000352093.5_Silent_p.R1633R|EML5_ENST00000553320.1_5'UTR|EML5_ENST00000554922.1_Silent_p.R1679R			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1671						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TCAGCATTCCTTGTCCCAACA	0.398																																							uc001xxg.2		NA																	0				ovary(3)	3						c.(5035-5037)AGG>CGG		echinoderm microtubule associated protein like							148.0	143.0	145.0					14																	89087624		1883	4112	5995	SO:0001819	synonymous_variant	161436					cytoplasm|microtubule		g.chr14:89087624T>G	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.5011A>C	14.37:g.89087624T>G			Somatic				EML5_uc001xxf.2_Silent_p.R466R|EML5_uc001xxd.2_5'Flank|EML5_uc001xxe.2_Silent_p.R28R	p.R1679R	NM_183387	NP_899243	WXS	Illumina HiSeq	Unspecified	Q05BV3	EMAL5_HUMAN			38	5221	-			1671					B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	ENST00000380664.5	37	c.5035A>C	CCDS45148.1																																																																																				0.398	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1			51	73	0	0	0	0.00361	0	51	73				
FAM181A	90050	broad.mit.edu	37	14	94394694	94394694	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr14:94394694C>T	ENST00000267594.5	+	3	556	c.249C>T	c.(247-249)atC>atT	p.I83I	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Silent_p.I21I|FAM181A_ENST00000556222.1_Silent_p.I21I|FAM181A_ENST00000557719.1_Silent_p.I21I	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	83										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						CCAGCGACATCAAGGCAGCCC	0.597																																							uc001ybz.1		NA																	0					0						c.(247-249)ATC>ATT		hypothetical protein LOC90050							74.0	64.0	68.0					14																	94394694		2203	4300	6503	SO:0001819	synonymous_variant	90050							g.chr14:94394694C>T	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.249C>T	14.37:g.94394694C>T			Somatic				C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.I21I|FAM181A_uc001yca.1_Silent_p.I21I	p.I83I	NM_138344	NP_612353	WXS	Illumina HiSeq	Unspecified	Q8N9Y4	F181A_HUMAN			3	556	+			83					B2RD39|Q96GY1	Silent	SNP	ENST00000267594.5	37	c.249C>T	CCDS9914.1																																																																																				0.597	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344		12	37	0	0	0	0.001368	0	12	37				
OCA2	4948	broad.mit.edu	37	15	28231765	28231765	+	Missense_Mutation	SNP	C	C	G	rs140703213		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:28231765C>G	ENST00000354638.3	-	12	1362	c.1207G>C	c.(1207-1209)Gaa>Caa	p.E403Q	OCA2_ENST00000353809.5_Missense_Mutation_p.E379Q|OCA2_ENST00000382996.2_Missense_Mutation_p.E403Q	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	403					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AATCCCGTTTCTGAAAATATG	0.313									Oculocutaneous Albinism																														uc001zbh.3		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(1207-1209)GAA>CAA		oculocutaneous albinism II							90.0	99.0	96.0					15																	28231765		2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28231765C>G		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1207G>C	15.37:g.28231765C>G	ENSP00000346659:p.Glu403Gln		Somatic				OCA2_uc010ayv.2_Missense_Mutation_p.E379Q	p.E403Q	NM_000275	NP_000266	WXS	Illumina HiSeq	Unspecified	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	12	1317	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	403			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1207G>C	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538205	0.85917	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.91843	-2.92;-2.92;-2.92	5.57	5.57	0.84162	Divalent ion symporter (1);	0.052546	0.85682	D	0.000000	D	0.92221	0.7533	L	0.33710	1.025	0.47476	D	0.999437	P;P	0.49559	0.892;0.925	B;P	0.53518	0.437;0.728	D	0.93026	0.6444	10	0.72032	D	0.01	-18.9055	18.5465	0.91048	0.0:1.0:0.0:0.0	.	379;403	Q04671-2;Q04671	.;P_HUMAN	Q	403;379;403	ENSP00000346659:E403Q;ENSP00000261276:E379Q;ENSP00000372457:E403Q	ENSP00000261276:E379Q	E	-	1	0	OCA2	25905360	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.677000	0.74503	2.616000	0.88540	0.557000	0.71058	GAA		0.313	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		34	61	0	0	0	0.00623	0	34	61				
RYR3	6263	broad.mit.edu	37	15	33962744	33962744	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:33962744G>A	ENST00000389232.4	+	38	5917	c.5847G>A	c.(5845-5847)gaG>gaA	p.E1949E	RYR3_ENST00000415757.3_Silent_p.E1949E	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1949	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGGAGGAGGAGGAGAGATGCC	0.443																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(5845-5847)GAG>GAA		ryanodine receptor 3							77.0	92.0	87.0					15																	33962744		1961	4139	6100	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33962744G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5847G>A	15.37:g.33962744G>A			Somatic				RYR3_uc010bar.2_Silent_p.E1949E	p.E1949E	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	38	5917	+		all_lung(180;7.18e-09)	1949			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.5847G>A	CCDS45210.1																																																																																				0.443	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			23	55	0	0	0	0.003954	0	23	55				
SLC12A6	9990	broad.mit.edu	37	15	34546597	34546597	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:34546597G>A	ENST00000354181.3	-	9	1562	c.1070C>T	c.(1069-1071)gCc>gTc	p.A357V	SLC12A6_ENST00000560611.1_Missense_Mutation_p.A357V|SLC12A6_ENST00000290209.5_Missense_Mutation_p.A306V|SLC12A6_ENST00000558667.1_Missense_Mutation_p.A357V|SLC12A6_ENST00000397707.2_Missense_Mutation_p.A342V|SLC12A6_ENST00000560164.1_Missense_Mutation_p.A169V|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000558589.1_Missense_Mutation_p.A348V|SLC12A6_ENST00000451844.2_Missense_Mutation_p.A169V|SLC12A6_ENST00000397702.2_Missense_Mutation_p.A298V|SLC12A6_ENST00000458406.2_Missense_Mutation_p.A298V			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	357					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	AGCATAGATGGCCAAGATGGA	0.458																																							uc001zhw.2		NA																	0				central_nervous_system(5)|ovary(1)|skin(1)	7						c.(1069-1071)GCC>GTC		solute carrier family 12, member 6 isoform a	Potassium Chloride(DB00761)						144.0	126.0	132.0					15																	34546597		2201	4298	6499	SO:0001583	missense	9990				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity	g.chr15:34546597G>A	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1070C>T	15.37:g.34546597G>A	ENSP00000346112:p.Ala357Val		Somatic				SLC12A6_uc001zhv.2_Missense_Mutation_p.A306V|SLC12A6_uc001zhx.2_Missense_Mutation_p.A342V|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.A298V|SLC12A6_uc001zib.2_Missense_Mutation_p.A348V|SLC12A6_uc001zic.2_Missense_Mutation_p.A357V|SLC12A6_uc010bau.2_Missense_Mutation_p.A357V|SLC12A6_uc001zid.2_Missense_Mutation_p.A298V|SLC12A6_uc001zhu.2_Missense_Mutation_p.A169V	p.A357V	NM_133647	NP_598408	WXS	Illumina HiSeq	Unspecified	Q9UHW9	S12A6_HUMAN		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	8	1234	-		all_lung(180;2.78e-08)	357			Helical; (Potential).		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	c.1070C>T	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	G	36	5.637892	0.96693	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.98937	-5.25;-5.25;-5.25;-5.25;-5.25	5.03	5.03	0.67393	Amino acid permease domain (1);	0.070348	0.64402	D	0.000017	D	0.98645	0.9546	M	0.80616	2.505	0.58432	D	0.999999	P;P;P;B	0.50066	0.816;0.741;0.931;0.379	P;B;P;P	0.51516	0.452;0.403;0.588;0.672	D	0.99831	1.1054	10	0.87932	D	0	.	17.3067	0.87197	0.0:0.0:1.0:0.0	.	342;357;306;169	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	V	306;342;348;298;298;169	ENSP00000290209:A306V;ENSP00000380819:A342V;ENSP00000380814:A298V;ENSP00000387725:A298V;ENSP00000390199:A169V	ENSP00000290209:A306V	A	-	2	0	SLC12A6	32333889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.599000	0.87857	0.655000	0.94253	GCC		0.458	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		27	42	0	0	0	0.004656	0	27	42				
ZNF106	64397	broad.mit.edu	37	15	42714782	42714782	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:42714782G>A	ENST00000263805.4	-	15	5547	c.5221C>T	c.(5221-5223)Cat>Tat	p.H1741Y	ZNF106_ENST00000565660.1_5'UTR|ZNF106_ENST00000565380.1_Missense_Mutation_p.H969Y|ZNF106_ENST00000565611.1_Missense_Mutation_p.H926Y	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1741					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GTCACTGCATGATTGTGACCT	0.418																																							uc001zpw.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(5221-5223)CAT>TAT		zinc finger protein 106 homolog							107.0	95.0	99.0					15																	42714782		2203	4299	6502	SO:0001583	missense	64397					nucleolus	zinc ion binding	g.chr15:42714782G>A	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.5221C>T	15.37:g.42714782G>A	ENSP00000263805:p.His1741Tyr		Somatic				ZFP106_uc001zpu.2_Missense_Mutation_p.H839Y|ZFP106_uc001zpv.2_Missense_Mutation_p.H926Y|ZFP106_uc001zpx.2_Missense_Mutation_p.H969Y	p.H1741Y	NM_022473	NP_071918	WXS	Illumina HiSeq	Unspecified	Q9H2Y7	ZF106_HUMAN		GBM - Glioblastoma multiforme(94;8.6e-07)	15	5556	-		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)	1741			WD 5.		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	c.5221C>T	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025332	0.75390	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.60672	0.17	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71264	0.3319	L	0.44542	1.39	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.998	T	0.71464	-0.4585	10	0.59425	D	0.04	-17.3265	19.3609	0.94438	0.0:0.0:1.0:0.0	.	969;1741;969	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	Y	1741;969	ENSP00000263805:H1741Y	ENSP00000263805:H1741Y	H	-	1	0	ZFP106	40502074	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.232000	0.95325	2.814000	0.96858	0.655000	0.94253	CAT		0.418	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473		14	31	0	0	0	0.001855	0	14	31				
GABPB1	2553	broad.mit.edu	37	15	50595319	50595319	+	Splice_Site	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:50595319T>C	ENST00000220429.8	-	4	446	c.278A>G	c.(277-279)cAt>cGt	p.H93R	GABPB1_ENST00000396464.3_Splice_Site_p.H93R|GABPB1_ENST00000543881.1_Splice_Site_p.H17R|GABPB1_ENST00000560825.1_Splice_Site_p.H93R|GABPB1_ENST00000429662.2_Splice_Site_p.H93R|GABPB1_ENST00000380877.3_Splice_Site_p.H93R|GABPB1_ENST00000359031.4_Splice_Site_p.H93R			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	93					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						ATCAGCACCATGCTACAAAAA	0.318																																							uc001zyb.2		NA																	0				large_intestine(1)	1						c.(277-279)CAT>CGT		GA binding protein transcription factor, beta							92.0	81.0	84.0					15																	50595319		2196	4295	6491	SO:0001630	splice_region_variant	2553				positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr15:50595319T>C	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.277-1A>G	15.37:g.50595319T>C			Somatic				GABPB1_uc001zya.2_Missense_Mutation_p.H93R|GABPB1_uc010ufg.1_Missense_Mutation_p.H17R|GABPB1_uc001zyc.2_Missense_Mutation_p.H93R|GABPB1_uc001zyd.2_Missense_Mutation_p.H93R|GABPB1_uc001zye.2_Missense_Mutation_p.H93R|GABPB1_uc001zyf.2_Missense_Mutation_p.H93R	p.H93R	NM_005254	NP_005245	WXS	Illumina HiSeq	Unspecified	Q06547	GABP1_HUMAN			4	702	-			93			ANK 3.		A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense_Mutation	SNP	ENST00000220429.8	37	c.278A>G	CCDS32239.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.969973	0.53614	.	.	ENSG00000104064	ENST00000220429;ENST00000380877;ENST00000543881;ENST00000396464;ENST00000429662;ENST00000359031	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.97	4.84	0.62591	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	L	0.41415	1.275	0.47949	D	0.999557	D;B;B;B;B	0.56521	0.976;0.022;0.023;0.028;0.023	D;B;B;B;B	0.70016	0.967;0.017;0.003;0.007;0.004	T	0.72802	-0.4183	10	0.72032	D	0.01	-12.2523	13.3574	0.60635	0.0:0.0:0.1316:0.8683	.	93;93;93;93;93	B7Z726;Q06547-3;Q06547-4;Q06547;Q06547-2	.;.;.;GABP1_HUMAN;.	R	93;93;17;93;93;93	ENSP00000220429:H93R;ENSP00000370259:H93R;ENSP00000442500:H17R;ENSP00000379728:H93R;ENSP00000395771:H93R;ENSP00000351923:H93R	ENSP00000220429:H93R	H	-	2	0	GABPB1	48382611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.242000	0.51384	1.061000	0.40601	0.533000	0.62120	CAT		0.318	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1		Missense_Mutation	17	16	0	0	0	0.006122	0	17	16				
PAQR5	54852	broad.mit.edu	37	15	69692415	69692415	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:69692415C>T	ENST00000340965.3	+	8	1380	c.712C>T	c.(712-714)Ctg>Ttg	p.L238L	RP11-253M7.1_ENST00000560539.1_RNA|PAQR5_ENST00000561153.1_Silent_p.L238L|PAQR5_ENST00000395407.2_Silent_p.L238L|RP11-253M7.1_ENST00000558617.1_RNA	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	238					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						CTCTGCACATCTGCCAGAACG	0.567																																							uc002arz.2		NA																	0				ovary(2)	2						c.(712-714)CTG>TTG		progestin and adipoQ receptor family member V							216.0	174.0	188.0					15																	69692415		2199	4298	6497	SO:0001819	synonymous_variant	54852				cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding	g.chr15:69692415C>T		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.712C>T	15.37:g.69692415C>T			Somatic				PAQR5_uc002asa.2_Silent_p.L238L	p.L238L	NM_017705	NP_060175	WXS	Illumina HiSeq	Unspecified	Q9NXK6	MPRG_HUMAN			8	1090	+			238			Extracellular (Potential).		Q8IXU2	Silent	SNP	ENST00000340965.3	37	c.712C>T	CCDS10232.1																																																																																				0.567	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705		19	136	0	0	0	0.007413	0	19	136				
GOLGA6A	342096	broad.mit.edu	37	15	74364587	74364587	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:74364587G>T	ENST00000290438.3	-	14	1605	c.1565C>A	c.(1564-1566)cCa>cAa	p.P522Q	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	522						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						CAGGTCCTCTGGGATGTTTGG	0.637																																							uc002axa.1		NA																	0					0						c.(1564-1566)CCA>CAA		golgi autoantigen, golgin subfamily a, 6							31.0	57.0	48.0					15																	74364587		1389	2515	3904	SO:0001583	missense	342096							g.chr15:74364587G>T	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.1565C>A	15.37:g.74364587G>T	ENSP00000290438:p.Pro522Gln		Somatic				uc010ulg.1_5'Flank	p.P522Q	NM_001038640	NP_001033729	WXS	Illumina HiSeq	Unspecified	Q9NYA3	GOG6A_HUMAN			14	1606	-			522			Potential.		A8K959|Q9NYA7	Missense_Mutation	SNP	ENST00000290438.3	37	c.1565C>A	CCDS32290.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652369	0.47362	.	.	ENSG00000159289	ENST00000290438	T	0.46451	0.87	1.55	1.55	0.23275	.	.	.	.	.	T	0.62036	0.2395	M	0.86028	2.79	0.40524	D	0.980868	D	0.76494	0.999	D	0.79784	0.993	T	0.63821	-0.6550	9	0.38643	T	0.18	.	9.1131	0.36741	0.0:0.0:1.0:0.0	.	522	Q9NYA3	GOG6A_HUMAN	Q	522	ENSP00000290438:P522Q	ENSP00000290438:P522Q	P	-	2	0	GOLGA6A	72151640	1.000000	0.71417	0.007000	0.13788	0.018000	0.09664	7.469000	0.80959	1.182000	0.42928	0.162000	0.16502	CCA		0.637	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357		6	146	1	0	3.99206e-14	0.007413	6.28656e-14	6	146				
CHRNB4	1143	broad.mit.edu	37	15	78921352	78921352	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:78921352C>T	ENST00000261751.3	-	5	1406	c.1295G>A	c.(1294-1296)aGc>aAc	p.S432N	CHRNB4_ENST00000412074.2_Intron|CHRNB4_ENST00000560511.1_5'Flank|RP11-335K5.2_ENST00000559120.1_RNA	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	432					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	GGCGATGAAGCTGACACCTTC	0.572																																							uc002bed.1		NA																	0					0						c.(1294-1296)AGC>AAC		cholinergic receptor, nicotinic, beta 4							81.0	71.0	74.0					15																	78921352		2196	4293	6489	SO:0001583	missense	1143				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr15:78921352C>T	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1295G>A	15.37:g.78921352C>T	ENSP00000261751:p.Ser432Asn		Somatic				CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.S250N	p.S432N	NM_000750	NP_000741	WXS	Illumina HiSeq	Unspecified	P30926	ACHB4_HUMAN			5	1407	-			432			Cytoplasmic (Potential).		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	37	c.1295G>A	CCDS10306.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813294	0.50527	.	.	ENSG00000117971	ENST00000261751	D	0.85773	-2.03	5.17	3.28	0.37604	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.048704	0.85682	D	0.000000	T	0.78207	0.4247	L	0.35249	1.045	0.80722	D	1	B	0.33345	0.409	B	0.38755	0.281	T	0.71695	-0.4515	10	0.38643	T	0.18	.	8.6558	0.34062	0.0:0.7624:0.0:0.2376	.	432	P30926	ACHB4_HUMAN	N	432	ENSP00000261751:S432N	ENSP00000261751:S432N	S	-	2	0	CHRNB4	76708407	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.784000	0.38674	0.579000	0.29504	0.561000	0.74099	AGC		0.572	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1			14	39	0	0	0	0.001855	0	14	39				
AKAP13	11214	broad.mit.edu	37	15	86122780	86122780	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:86122780G>T	ENST00000394518.2	+	7	1576	c.1481G>T	c.(1480-1482)tGg>tTg	p.W494L	AKAP13_ENST00000361243.2_Missense_Mutation_p.W494L|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	494	RII-binding.		W -> R (in dbSNP:rs2061822). {ECO:0000269|Ref.3}.		apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCCACTGTTTGGAAGAATGTG	0.488																																					Melanoma(94;603 1453 3280 32295 32951)	Melanoma(94;603 1453 3280 32295 32951)	uc002blv.1		NA																	0				central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						c.(1480-1482)TGG>TTG		A-kinase anchor protein 13 isoform 2							71.0	77.0	75.0					15																	86122780		2202	4299	6501	SO:0001583	missense	11214				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr15:86122780G>T	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1481G>T	15.37:g.86122780G>T	ENSP00000378026:p.Trp494Leu		Somatic				AKAP13_uc002blt.1_Missense_Mutation_p.W494L|AKAP13_uc002blu.1_Missense_Mutation_p.W494L	p.W494L	NM_007200	NP_009131	WXS	Illumina HiSeq	Unspecified	Q12802	AKP13_HUMAN			7	1651	+			494			RII-binding.		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	c.1481G>T	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746743	0.30955	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.08546	3.08;3.08	5.15	-1.8	0.07907	.	.	.	.	.	T	0.02767	0.0083	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46748	-0.9169	9	0.14656	T	0.56	.	0.1702	0.00112	0.3616:0.1571:0.1769:0.3044	.	494;494	Q12802;Q12802-2	AKP13_HUMAN;.	L	494;494;493;493	ENSP00000354718:W494L;ENSP00000378026:W494L	ENSP00000354718:W494L	W	+	2	0	AKAP13	83923784	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.011000	0.12721	-0.082000	0.12640	-0.238000	0.12139	TGG		0.488	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		32	53	1	0	3.57733e-08	0.001786	5.04418e-08	32	53				
AGBL1	123624	broad.mit.edu	37	15	86702217	86702217	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:86702217G>C	ENST00000441037.2	+	4	405	c.310G>C	c.(310-312)Gtt>Ctt	p.V104L	AGBL1_ENST00000421325.2_Missense_Mutation_p.V104L	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	104					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GCTTTTCAAGGTTATTACTCC	0.448																																							uc002blz.1		NA																	0					0						c.(310-312)GTT>CTT		ATP/GTP binding protein-like 1							149.0	135.0	140.0					15																	86702217		1912	4122	6034	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86702217G>C	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.310G>C	15.37:g.86702217G>C	ENSP00000413001:p.Val104Leu		Somatic					p.V104L	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			4	390	+			104					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.310G>C	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797629	0.31777	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.47528	0.84	5.01	4.04	0.47022	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.40694	0.1127	L	0.53249	1.67	0.80722	D	1	B	0.28880	0.226	B	0.28784	0.094	T	0.24799	-1.0150	9	0.36615	T	0.2	-18.8382	8.807	0.34943	0.1137:0.0:0.8863:0.0	.	104	Q96MI9	CBPC4_HUMAN	L	133;104	ENSP00000397173:V104L	ENSP00000397173:V104L	V	+	1	0	AGBL1	84503221	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	2.881000	0.48538	1.142000	0.42291	-0.345000	0.07892	GTT		0.448	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		27	72	0	0	0	0.004656	0	27	72				
ACAN	176	broad.mit.edu	37	15	89398733	89398733	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:89398733C>A	ENST00000561243.1	+	11	2917	c.2917C>A	c.(2917-2919)Ctc>Atc	p.L973I	ACAN_ENST00000559004.1_Missense_Mutation_p.L973I|ACAN_ENST00000439576.2_Missense_Mutation_p.L973I|ACAN_ENST00000352105.7_Missense_Mutation_p.L973I			P16112	PGCA_HUMAN	aggrecan	972	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGTAGGAGACCTCAGTGGGCT	0.557																																							uc010upo.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2917-2919)CTC>ATC		aggrecan isoform 2 precursor							142.0	146.0	145.0					15																	89398733		1842	4088	5930	SO:0001583	missense	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89398733C>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2917C>A	15.37:g.89398733C>A	ENSP00000453342:p.Leu973Ile		Somatic				ACAN_uc010upp.1_Missense_Mutation_p.L973I|ACAN_uc002bna.2_RNA	p.L973I	NM_013227	NP_037359	WXS	Illumina HiSeq	Unspecified	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		12	3291	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		973					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	c.2917C>A	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.635073	0.00806	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.95788	-3.81;-3.81	4.48	-1.44	0.08856	.	1.458670	0.05162	N	0.497976	D	0.89118	0.6624	N	0.17674	0.51	0.09310	N	1	B;B	0.20887	0.049;0.049	B;B	0.32393	0.109;0.145	T	0.79680	-0.1702	10	0.08599	T	0.76	-2.7456	4.1285	0.10138	0.543:0.2503:0.1224:0.0842	.	973;973	E7ENV9;E7EX88	.;.	I	973	ENSP00000387356:L973I;ENSP00000341615:L973I	ENSP00000268134:L973I	L	+	1	0	ACAN	87199737	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-1.178000	0.03093	-0.158000	0.11040	-0.311000	0.09066	CTC		0.557	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		100	186	1	0	6.51614e-51	0.00361	1.14971e-50	100	186				
LRRC28	123355	broad.mit.edu	37	15	99828072	99828072	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:99828072G>A	ENST00000301981.3	+	5	541	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	LRRC28_ENST00000422500.2_Missense_Mutation_p.E101K|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000442993.2_Missense_Mutation_p.E101K|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000447360.2_Missense_Mutation_p.E101K	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	101										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			CAATGCCTTAGAAATTGTTTG	0.388																																							uc002bva.1		NA																	0					0						c.(301-303)GAA>AAA		leucine rich repeat containing 28							148.0	144.0	145.0					15																	99828072		2197	4297	6494	SO:0001583	missense	123355							g.chr15:99828072G>A	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.301G>A	15.37:g.99828072G>A	ENSP00000304923:p.Glu101Lys		Somatic				LRRC28_uc010urs.1_RNA|LRRC28_uc002bvb.1_5'UTR|LRRC28_uc010urt.1_5'UTR|LRRC28_uc002bvc.1_Missense_Mutation_p.E101K|LRRC28_uc010uru.1_Missense_Mutation_p.E101K|LRRC28_uc002bvd.1_Intron	p.E101K	NM_144598	NP_653199	WXS	Illumina HiSeq	Unspecified	Q86X40	LRC28_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00106)		5	456	+	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		101			LRR 4.		A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	ENST00000301981.3	37	c.301G>A	CCDS10380.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034291	0.35893	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993	T;T;T;T	0.30448	2.25;2.25;1.53;2.01	5.9	4.01	0.46588	.	0.320596	0.38217	N	0.001769	T	0.23410	0.0566	L	0.42487	1.325	0.48696	D	0.999693	B;B;B	0.33694	0.104;0.421;0.012	B;B;B	0.30646	0.029;0.118;0.006	T	0.03025	-1.1081	10	0.22109	T	0.4	.	10.7545	0.46228	0.0715:0.1322:0.7964:0.0	.	101;101;101	B4DHL3;Q86X40-2;Q86X40	.;.;LRC28_HUMAN	K	101	ENSP00000304923:E101K;ENSP00000404520:E101K;ENSP00000398606:E101K;ENSP00000404206:E101K	ENSP00000304923:E101K	E	+	1	0	LRRC28	97645595	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.416000	0.52707	0.817000	0.34445	0.650000	0.86243	GAA		0.388	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	NM_144598		17	53	0	0	0	0.00499	0	17	53				
LRRC28	123355	broad.mit.edu	37	15	99828097	99828097	+	Missense_Mutation	SNP	G	G	T	rs146950856	byFrequency	TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr15:99828097G>T	ENST00000301981.3	+	5	566	c.326G>T	c.(325-327)cGt>cTt	p.R109L	LRRC28_ENST00000422500.2_Missense_Mutation_p.R109L|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000442993.2_Missense_Mutation_p.R109L|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000447360.2_Missense_Mutation_p.R109L	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	109										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			GAAATTGGTCGTCTGAGAGCT	0.398																																							uc002bva.1		NA																	0					0						c.(325-327)CGT>CTT		leucine rich repeat containing 28							157.0	151.0	153.0					15																	99828097		2197	4297	6494	SO:0001583	missense	123355							g.chr15:99828097G>T	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.326G>T	15.37:g.99828097G>T	ENSP00000304923:p.Arg109Leu		Somatic				LRRC28_uc010urs.1_RNA|LRRC28_uc002bvb.1_5'UTR|LRRC28_uc010urt.1_5'UTR|LRRC28_uc002bvc.1_Missense_Mutation_p.R109L|LRRC28_uc010uru.1_Missense_Mutation_p.R109L|LRRC28_uc002bvd.1_Intron	p.R109L	NM_144598	NP_653199	WXS	Illumina HiSeq	Unspecified	Q86X40	LRC28_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00106)		5	481	+	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		109			LRR 4.		A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	ENST00000301981.3	37	c.326G>T	CCDS10380.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567464	0.65651	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993	T;T;T;T	0.46819	0.97;0.86;1.54;2.03	5.9	4.98	0.66077	.	0.221552	0.48286	D	0.000199	T	0.35393	0.0930	L	0.31371	0.925	0.49299	D	0.999773	P;P;B	0.44380	0.709;0.834;0.18	B;B;B	0.38921	0.285;0.237;0.122	T	0.09997	-1.0649	10	0.29301	T	0.29	.	14.0717	0.64863	0.0727:0.0:0.9273:0.0	.	109;109;109	B4DHL3;Q86X40-2;Q86X40	.;.;LRC28_HUMAN	L	109	ENSP00000304923:R109L;ENSP00000404520:R109L;ENSP00000398606:R109L;ENSP00000404206:R109L	ENSP00000304923:R109L	R	+	2	0	LRRC28	97645620	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.986000	0.63851	1.500000	0.48636	0.650000	0.86243	CGT		0.398	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	NM_144598		12	50	1	0	7.03913e-09	0.001368	1.01811e-08	12	50				
HBA2	3040	broad.mit.edu	37	16	223583	223583	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:223583C>T	ENST00000251595.6	+	3	479	c.413C>T	c.(412-414)aCc>aTc	p.T138I	HBA2_ENST00000397806.1_Missense_Mutation_p.T106I	NM_000517.4	NP_000508.1	P69905	HBA_HUMAN	hemoglobin, alpha 2	138					bicarbonate transport (GO:0015701)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of cell death (GO:0010942)|protein heterooligomerization (GO:0051291)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)						all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)			Iron Dextran(DB00893)|Mefloquine(DB00358)	ACCGTGCTGACCTCCAAATAC	0.677											OREG0003686	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									GBM(107;1340 2104 14383 27419)	GBM(107;1340 2104 14383 27419)	uc002cfv.3		NA																	0					0						c.(412-414)ACC>ATC		alpha 2 globin	Amodiaquine(DB00613)|Chloroquine(DB00608)|Iron Dextran(DB00893)|Mefloquine(DB00358)|Primaquine(DB01087)|Quinine(DB00468)						39.0	43.0	42.0					16																	223583		2149	4300	6449	SO:0001583	missense	3040				hydrogen peroxide catabolic process|positive regulation of cell death|protein heterooligomerization	cytosolic small ribosomal subunit|haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity|protein binding	g.chr16:223583C>T	BC008572	CCDS10398.1	16p13.3	2014-05-19			ENSG00000188536	ENSG00000188536			4824	protein-coding gene	gene with protein product		141850				6452630, 2649166	Standard	NM_000517		Approved	HBA-T2	uc002cfv.4	P69905	OTTHUMG00000059924	ENST00000251595.6:c.413C>T	16.37:g.223583C>T	ENSP00000251595:p.Thr138Ile		Somatic	OREG0003686	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	586	HBA2_uc002cfw.2_Intron	p.T138I	NM_000517	NP_000508	WXS	Illumina HiSeq	Unspecified	P69905	HBA_HUMAN			3	479	+		all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)	138					P01922|Q1HDT5|Q3MIF5|Q53F97|Q96KF1|Q9NYR7|Q9UCM0	Missense_Mutation	SNP	ENST00000251595.6	37	c.413C>T	CCDS10398.1	.	.	.	.	.	.	.	.	.	.	c	16.28	3.079907	0.55753	.	.	ENSG00000188536	ENST00000251595;ENST00000534957;ENST00000397806	D;D	0.93712	-3.03;-3.27	4.43	4.43	0.53597	Globin-like (1);Globin, structural domain (1);	0.272978	0.38111	N	0.001818	D	0.93112	0.7807	M	0.80422	2.495	0.53688	D	0.999977	B	0.18610	0.029	B	0.21708	0.036	D	0.92228	0.5790	10	0.87932	D	0	-21.2583	14.2604	0.66080	0.0:1.0:0.0:0.0	.	138	P69905	HBA_HUMAN	I	138;106;106	ENSP00000251595:T138I;ENSP00000380908:T106I	ENSP00000251595:T138I	T	+	2	0	HBA2	163583	0.038000	0.19896	1.000000	0.80357	0.782000	0.44232	2.119000	0.41958	2.028000	0.59812	0.558000	0.71614	ACC		0.677	HBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133194.1	NM_000517		9	28	0	0	0	0.008291	0	9	28				
GRIN2A	2903	broad.mit.edu	37	16	9923360	9923360	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:9923360C>T	ENST00000396573.2	-	10	2236	c.1927G>A	c.(1927-1929)Gct>Act	p.A643T	GRIN2A_ENST00000535259.1_Missense_Mutation_p.A486T|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A643T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A643T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A643T|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A643T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	643					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A643S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGTAGCTAGCCAGGAATATG	0.507																																							uc002czo.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1927-1929)GCT>ACT		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						132.0	111.0	118.0					16																	9923360		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9923360C>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1927G>A	16.37:g.9923360C>T	ENSP00000379818:p.Ala643Thr		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.A643T|GRIN2A_uc010uyn.1_Missense_Mutation_p.A486T|GRIN2A_uc002czr.3_Missense_Mutation_p.A643T	p.A643T	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			9	2475	-			643			Helical; (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.1927G>A	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	33	5.276669	0.95459	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	5.27	5.27	0.74061	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	M	0.90198	3.095	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.997	D;D;D	0.85130	0.995;0.997;0.996	T	0.82822	-0.0267	9	.	.	.	.	17.9016	0.88906	0.0:1.0:0.0:0.0	.	486;643;643	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	643;643;486;643;643	ENSP00000379818:A643T;ENSP00000385872:A643T;ENSP00000441572:A486T;ENSP00000332549:A643T;ENSP00000379820:A643T	.	A	-	1	0	GRIN2A	9830861	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.681000	0.84073	2.465000	0.83290	0.655000	0.94253	GCT		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			18	52	0	0	0	0.006122	0	18	52				
XYLT1	64131	broad.mit.edu	37	16	17294340	17294340	+	Splice_Site	SNP	T	T	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:17294340T>G	ENST00000261381.6	-	4	1169	c.1085A>C	c.(1084-1086)aAg>aCg	p.K362T		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	362					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCCTCTCACCTTGTCCACGTG	0.582																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(1084-1086)AAG>ACG		xylosyltransferase I							162.0	141.0	148.0					16																	17294340		2197	4300	6497	SO:0001630	splice_region_variant	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17294340T>G	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1086+1A>C	16.37:g.17294340T>G			Somatic					p.K362T	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			4	1170	-			362			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.1085A>C	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212124	0.79240	.	.	ENSG00000103489	ENST00000261381	T	0.11385	2.78	5.03	5.03	0.67393	.	0.048124	0.85682	D	0.000000	T	0.21509	0.0518	L	0.52126	1.63	0.80722	D	1	D	0.59357	0.985	P	0.56563	0.801	T	0.00557	-1.1672	10	0.42905	T	0.14	-27.0763	13.9668	0.64213	0.0:0.0:0.0:1.0	.	362	Q86Y38	XYLT1_HUMAN	T	362	ENSP00000261381:K362T	ENSP00000261381:K362T	K	-	2	0	XYLT1	17201841	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.757000	0.85209	1.900000	0.55004	0.533000	0.62120	AAG		0.582	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	Missense_Mutation	6	89	0	0	0	0.001168	0	6	89				
Unknown	0	broad.mit.edu	37	16	21531505	21531505	+	IGR	SNP	A	A	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:21531505A>C								MIR3680-1 (14049 upstream) : SCARNA6 (67442 downstream)																							CATGATGGCGACCACGATGAC	0.736																																							uc002djd.2		NA																	0					0						c.(181-183)GTC>GGC		RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;																																				SO:0001628	intergenic_variant	387254							g.chr16:21531505A>C																													16.37:g.21531505A>C			Somatic				uc002diq.3_Intron|LOC100271836_uc002dja.2_RNA|LOC100271836_uc002djb.2_RNA	p.V61G	NR_002594		WXS	Illumina HiSeq	Unspecified					1	261	-									Missense_Mutation	SNP		37	c.182T>G																																																																																				0	0.736									5	47	0	0	0	0.001984	0	5	47				
ZNF629	23361	broad.mit.edu	37	16	30793208	30793208	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:30793208C>A	ENST00000262525.4	-	3	2648	c.2441G>T	c.(2440-2442)gGt>gTt	p.G814V	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	814					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CTCGCCCTCACCTTCCTGATC	0.612																																							uc002dzs.1		NA																	0					0						c.(2440-2442)GGT>GTT		zinc finger protein 629							74.0	85.0	81.0					16																	30793208		1939	4134	6073	SO:0001583	missense	23361				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30793208C>A	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.2441G>T	16.37:g.30793208C>A	ENSP00000262525:p.Gly814Val		Somatic					p.G814V	NM_001080417	NP_001073886	WXS	Illumina HiSeq	Unspecified	Q9UEG4	ZN629_HUMAN	Colorectal(24;0.198)		3	2649	-			814					Q15938	Missense_Mutation	SNP	ENST00000262525.4	37	c.2441G>T	CCDS45463.1	.	.	.	.	.	.	.	.	.	.	C	3.149	-0.174604	0.06421	.	.	ENSG00000102870	ENST00000262525	T	0.08896	3.04	4.27	-3.85	0.04243	.	1.145540	0.06743	N	0.778724	T	0.03651	0.0104	N	0.08118	0	0.20074	N	0.999939	B	0.02656	0.0	B	0.01281	0.0	T	0.43507	-0.9387	10	0.72032	D	0.01	0.4562	2.3222	0.04213	0.1282:0.2789:0.1258:0.4671	.	814	Q9UEG4	ZN629_HUMAN	V	814	ENSP00000262525:G814V	ENSP00000262525:G814V	G	-	2	0	ZNF629	30700709	0.002000	0.14202	0.187000	0.23214	0.212000	0.24457	-0.128000	0.10531	-0.727000	0.04888	0.561000	0.74099	GGT		0.612	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309		37	86	1	0	2.51541e-25	0.004878	4.23847e-25	37	86				
ZNF423	23090	broad.mit.edu	37	16	49671140	49671140	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:49671140G>C	ENST00000561648.1	-	4	1976	c.1923C>G	c.(1921-1923)ttC>ttG	p.F641L	ZNF423_ENST00000562520.1_Missense_Mutation_p.F581L|ZNF423_ENST00000563137.2_Missense_Mutation_p.F581L|ZNF423_ENST00000567169.1_Missense_Mutation_p.F524L|ZNF423_ENST00000262383.2_Missense_Mutation_p.F641L|ZNF423_ENST00000562871.1_Missense_Mutation_p.F581L|ZNF423_ENST00000535559.1_Missense_Mutation_p.F524L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	641					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CAAAGTTGGAGAACTTGAGGT	0.582																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(1921-1923)TTC>TTG		zinc finger protein 423							61.0	62.0	62.0					16																	49671140		2198	4300	6498	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49671140G>C	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1923C>G	16.37:g.49671140G>C	ENSP00000455426:p.Phe641Leu		Somatic				ZNF423_uc010vgn.1_Missense_Mutation_p.F524L	p.F641L	NM_015069	NP_055884	WXS	Illumina HiSeq	Unspecified	Q2M1K9	ZN423_HUMAN			5	2221	-		all_cancers(37;0.0155)	641			C2H2-type 14.		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.1923C>G	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575752	0.28092	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.38722	1.12;1.12	4.86	3.91	0.45181	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	M	0.82517	2.595	0.46149	D	0.998893	P	0.46784	0.884	P	0.50537	0.643	T	0.61574	-0.7035	9	.	.	.	.	13.3843	0.60787	0.0765:0.0:0.9235:0.0	.	641	Q2M1K9	ZN423_HUMAN	L	641;524	ENSP00000262383:F641L;ENSP00000442321:F524L	.	F	-	3	2	ZNF423	48228641	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.852000	0.48310	1.060000	0.40578	-0.362000	0.07510	TTC		0.582	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		4	44	0	0	0	0.000602	0	4	44				
CX3CL1	6376	broad.mit.edu	37	16	57416636	57416636	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr16:57416636A>T	ENST00000006053.6	+	3	997	c.886A>T	c.(886-888)Acc>Tcc	p.T296S	CX3CL1_ENST00000565912.1_Missense_Mutation_p.T258S|CX3CL1_ENST00000563383.1_Missense_Mutation_p.T302S	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	296	Mucin-like stalk.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CTCAGAAGGGACCCCCAGCAG	0.657																																							uc002eli.2		NA																	0					0						c.(886-888)ACC>TCC		chemokine (C-X3-C motif) ligand 1 precursor							41.0	44.0	43.0					16																	57416636		2198	4299	6497	SO:0001583	missense	6376				cell adhesion|cytokine-mediated signaling pathway|defense response|immune response|leukocyte adhesive activation|positive regulation of calcium-independent cell-cell adhesion|positive regulation of inflammatory response	cell surface|extracellular space|integral to membrane|plasma membrane	chemokine activity	g.chr16:57416636A>T	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.886A>T	16.37:g.57416636A>T	ENSP00000006053:p.Thr296Ser		Somatic					p.T296S	NM_002996	NP_002987	WXS	Illumina HiSeq	Unspecified	P78423	X3CL1_HUMAN			3	953	+			296			Mucin-like stalk.|Extracellular (Potential).		O00672	Missense_Mutation	SNP	ENST00000006053.6	37	c.886A>T	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	A	9.192	1.026253	0.19512	.	.	ENSG00000006210	ENST00000006053	T	0.04015	3.73	4.13	-2.01	0.07410	.	6.226180	0.00695	N	0.000742	T	0.04998	0.0134	L	0.27053	0.805	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.46091	-0.9216	10	0.87932	D	0	-16.9399	8.121	0.30971	0.6453:0.0:0.3547:0.0	.	296	P78423	X3CL1_HUMAN	S	296	ENSP00000006053:T296S	ENSP00000006053:T296S	T	+	1	0	CX3CL1	55974137	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.213000	0.17521	-0.239000	0.09710	0.456000	0.33151	ACC		0.657	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996		7	67	0	0	0	0.004482	0	7	67				
GEMIN4	50628	broad.mit.edu	37	17	650493	650493	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:650493C>T	ENST00000319004.5	-	2	908	c.790G>A	c.(790-792)Gtg>Atg	p.V264M	GEMIN4_ENST00000576778.1_Missense_Mutation_p.V253M|GEMIN4_ENST00000437269.1_Silent_p.P176P	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	264					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCCAGATACACGGTTGCAGAC	0.612																																							uc002frs.1		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(790-792)GTG>ATG		gemin 4							111.0	122.0	118.0					17																	650493		2171	4260	6431	SO:0001583	missense	50628				rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding	g.chr17:650493C>T	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.790G>A	17.37:g.650493C>T	ENSP00000321706:p.Val264Met		Somatic				GEMIN4_uc010vqa.1_Silent_p.P176P	p.V264M	NM_015721	NP_056536	WXS	Illumina HiSeq	Unspecified	P57678	GEMI4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)	2	909	-		Myeloproliferative disorder(207;0.204)	264					Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	37	c.790G>A	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	C	1.846	-0.466137	0.04476	.	.	ENSG00000179409	ENST00000319004	T	0.15487	2.42	5.37	-5.6	0.02497	.	0.824381	0.11210	N	0.587780	T	0.11196	0.0273	L	0.46157	1.445	0.09310	N	0.999999	B	0.22480	0.07	B	0.21546	0.035	T	0.25082	-1.0142	10	0.33141	T	0.24	-7.2753	4.7135	0.12884	0.084:0.5928:0.1672:0.156	.	264	P57678	GEMI4_HUMAN	M	264	ENSP00000321706:V264M	ENSP00000321706:V264M	V	-	1	0	GEMIN4	597243	0.001000	0.12720	0.001000	0.08648	0.237000	0.25408	0.185000	0.16958	-1.393000	0.02079	-2.049000	0.00408	GTG		0.612	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721		6	178	0	0	0	0.001168	0	6	178				
DERL2	51009	broad.mit.edu	37	17	5389496	5389496	+	5'UTR	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:5389496C>A	ENST00000158771.4	-	0	41				MIS12_ENST00000381165.3_5'Flank|DERL2_ENST00000572834.1_5'Flank|DERL2_ENST00000570848.1_5'UTR|DERL2_ENST00000571968.1_Intron|MIS12_ENST00000573759.1_5'Flank	NM_016041.3	NP_057125.2	Q9GZP9	DERL2_HUMAN	derlin 2						endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|retrograde protein transport, ER to cytosol (GO:0030970)|suckling behavior (GO:0001967)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|late endosome (GO:0005770)|membrane (GO:0016020)				large_intestine(3)	3						CCCACCGTCGCCTGCCCCACC	0.706																																							uc002gcc.1		NA																	0					0						c.e1-1		Der1-like domain family, member 2							14.0	11.0	12.0					17																	5389496		2184	4261	6445	SO:0001623	5_prime_UTR_variant	51009				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of cell growth|positive regulation of cell proliferation|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	protein binding	g.chr17:5389496C>A	BC010890	CCDS11073.1	17p13.2	2012-02-01	2012-02-01		ENSG00000072849	ENSG00000072849			17943	protein-coding gene	gene with protein product		610304	"""Der1-like domain family, member 2"""			10810093, 11500051	Standard	NM_016041		Approved	F-LAN-1, FLANa, F-LANa, CGI-101, derlin-2	uc002gcc.1	Q9GZP9	OTTHUMG00000102040	ENST00000158771.4:c.-15G>T	17.37:g.5389496C>A			Somatic				MIS12_uc002gcd.2_5'Flank|MIS12_uc002gce.2_5'Flank		NM_016041	NP_057125	WXS	Illumina HiSeq	Unspecified	Q9GZP9	DERL2_HUMAN			1	4	-								Q9Y3A7	Splice_Site	SNP	ENST00000158771.4	37	c.-12_splice	CCDS11073.1																																																																																				0.706	DERL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219825.1	NM_016041		4	2	1	0	0.000602214	0.000602	0.000709602	4	2				
MYH2	4620	broad.mit.edu	37	17	10427153	10427153	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:10427153G>T	ENST00000245503.5	-	36	5608	c.5224C>A	c.(5224-5226)Caa>Aaa	p.Q1742K	RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.Q1742K|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1742					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCTTGCATTTGGGAAATATCT	0.423																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5224-5226)CAA>AAA		myosin heavy chain IIa							171.0	151.0	158.0					17																	10427153		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10427153G>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5224C>A	17.37:g.10427153G>T	ENSP00000245503:p.Gln1742Lys		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.Q1742K|MYH2_uc010coj.2_Intron	p.Q1742K	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			36	5352	-			1742			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5224C>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304489	0.81136	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.77489	-1.1;-1.1	5.4	5.4	0.78164	Myosin tail (1);	0.000000	0.38005	U	0.001853	D	0.89853	0.6835	H	0.95539	3.685	0.58432	D	0.999997	P	0.38597	0.639	P	0.50708	0.648	D	0.90606	0.4548	10	0.48119	T	0.1	.	18.3409	0.90304	0.0:0.0:1.0:0.0	.	1742	Q9UKX2	MYH2_HUMAN	K	1742	ENSP00000245503:Q1742K;ENSP00000380367:Q1742K	ENSP00000245503:Q1742K	Q	-	1	0	MYH2	10367878	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	9.608000	0.98331	2.805000	0.96524	0.609000	0.83330	CAA		0.423	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		5	79	1	0	0.00116845	0.001168	0.00135315	5	79				
MYH2	4620	broad.mit.edu	37	17	10432354	10432354	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:10432354C>A	ENST00000245503.5	-	27	3781	c.3397G>T	c.(3397-3399)Gcc>Tcc	p.A1133S	RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.A1133S|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1133					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCCCGGGAGGCCCGCTCTGCC	0.602																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(3397-3399)GCC>TCC		myosin heavy chain IIa							35.0	41.0	39.0					17																	10432354		2200	4292	6492	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10432354C>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3397G>T	17.37:g.10432354C>A	ENSP00000245503:p.Ala1133Ser		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A1133S|MYH2_uc010coj.2_Intron	p.A1133S	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			27	3525	-			1133			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.3397G>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219854	0.58560	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.78924	-1.22;-1.22	5.09	5.09	0.68999	Myosin tail (1);	0.187753	0.25634	U	0.029329	D	0.84745	0.5540	M	0.80332	2.49	0.45883	D	0.998737	B	0.30482	0.281	P	0.46825	0.528	D	0.84303	0.0506	10	0.51188	T	0.08	.	12.4798	0.55836	0.0:0.9129:0.0:0.0871	.	1133	Q9UKX2	MYH2_HUMAN	S	1133	ENSP00000245503:A1133S;ENSP00000380367:A1133S	ENSP00000245503:A1133S	A	-	1	0	MYH2	10373079	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	3.452000	0.52971	2.660000	0.90430	0.591000	0.81541	GCC		0.602	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		17	60	1	0	8.10497e-08	0.001523	1.13335e-07	17	60				
MYH3	4621	broad.mit.edu	37	17	10536009	10536009	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:10536009C>A	ENST00000583535.1	-	34	4827	c.4740G>T	c.(4738-4740)aaG>aaT	p.K1580N	MYH3_ENST00000226209.7_Missense_Mutation_p.K1580N	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1580					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCTCTTCATCCTTCTCGGCGA	0.498																																							uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(4738-4740)AAG>AAT		myosin, heavy chain 3, skeletal muscle,							236.0	226.0	229.0					17																	10536009		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10536009C>A		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4740G>T	17.37:g.10536009C>A	ENSP00000464317:p.Lys1580Asn		Somatic					p.K1580N	NM_002470	NP_002461	WXS	Illumina HiSeq	Unspecified	P11055	MYH3_HUMAN			33	4817	-			1580			Potential.		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.4740G>T	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404856	0.42613	.	.	ENSG00000109063	ENST00000226209	D	0.85088	-1.94	5.77	0.0669	0.14363	Myosin tail (1);	.	.	.	.	D	0.92731	0.7689	M	0.93550	3.43	0.35753	D	0.819568	P	0.50443	0.935	D	0.69654	0.965	D	0.92897	0.6336	9	0.87932	D	0	.	9.7027	0.40196	0.0:0.4297:0.0:0.5703	.	1580	P11055	MYH3_HUMAN	N	1580	ENSP00000226209:K1580N	ENSP00000226209:K1580N	K	-	3	2	MYH3	10476734	0.029000	0.19370	0.991000	0.47740	0.208000	0.24298	-0.761000	0.04751	0.055000	0.16094	-0.768000	0.03414	AAG		0.498	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		13	216	1	0	5.50884e-06	0.001368	7.19565e-06	13	216				
CCDC144A	9720	broad.mit.edu	37	17	16593728	16593728	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:16593728G>T	ENST00000360524.8	+	1	90	c.14G>T	c.(13-15)gGt>gTt	p.G5V	CCDC144A_ENST00000340621.5_Missense_Mutation_p.G5V|CCDC144A_ENST00000399273.1_Missense_Mutation_p.G5V|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.G5V|RNU6-405P_ENST00000516637.1_RNA|CCDC144A_ENST00000456009.1_Missense_Mutation_p.G5V|CCDC144A_ENST00000443444.2_Missense_Mutation_p.G5V|CCDC144A_ENST00000436374.1_3'UTR	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	5																	GCCTCCTGGGGTGGAGAAAAG	0.642																																							uc002gqk.1		NA																	0					0						c.(13-15)GGT>GTT		coiled-coil domain containing 144A							11.0	14.0	13.0					17																	16593728		2191	4290	6481	SO:0001583	missense	9720							g.chr17:16593728G>T	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.14G>T	17.37:g.16593728G>T	ENSP00000353717:p.Gly5Val		Somatic					p.G5V	NM_014695	NP_055510	WXS	Illumina HiSeq	Unspecified	A2RUR9	C144A_HUMAN			1	90	+			5					O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	c.14G>T	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	10.36	1.329596	0.24167	.	.	ENSG00000170160	ENST00000420937;ENST00000340621;ENST00000399273;ENST00000436374;ENST00000399264;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495	T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05	0.542	-1.08	0.09936	.	.	.	.	.	T	0.42245	0.1194	N	0.22421	0.69	0.09310	N	1	D	0.64830	0.994	D	0.67725	0.953	T	0.32052	-0.9921	8	0.87932	D	0	.	.	.	.	.	5	A2RUR9	C144A_HUMAN	V	5	ENSP00000344740:G5V;ENSP00000382215:G5V;ENSP00000439262:G5V;ENSP00000440655:G5V;ENSP00000353717:G5V;ENSP00000394201:G5V;ENSP00000353685:G5V	ENSP00000344740:G5V	G	+	2	0	CCDC144A	16534453	0.278000	0.24230	0.001000	0.08648	0.017000	0.09413	0.199000	0.17237	-0.394000	0.07727	0.398000	0.26397	GGT		0.642	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			5	15	1	0	5.9392e-07	0.001168	8.03819e-07	5	15				
KIAA0100	9703	broad.mit.edu	37	17	26966412	26966412	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:26966412C>T	ENST00000528896.2	-	11	1224	c.1150G>A	c.(1150-1152)Gaa>Aaa	p.E384K	KIAA0100_ENST00000544884.1_Missense_Mutation_p.E241K|KIAA0100_ENST00000389003.3_Missense_Mutation_p.E241K	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	384						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TGAGAGAATTCCTGGTGCCGG	0.478																																							uc002hbu.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1150-1152)GAA>AAA		hypothetical protein LOC9703 precursor							89.0	94.0	92.0					17																	26966412		2203	4300	6503	SO:0001583	missense	9703					extracellular region		g.chr17:26966412C>T	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1150G>A	17.37:g.26966412C>T	ENSP00000436773:p.Glu384Lys		Somatic				KIAA0100_uc002hbv.2_Missense_Mutation_p.E384K	p.E384K	NM_014680	NP_055495	WXS	Illumina HiSeq	Unspecified	Q14667	K0100_HUMAN			11	1249	-	Lung NSC(42;0.00431)		384					A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	c.1150G>A	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	36	5.953217	0.97139	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.34275	1.76;1.37	5.93	5.93	0.95920	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.21075	-1.0256	10	0.19590	T	0.45	-0.2105	20.3363	0.98740	0.0:1.0:0.0:0.0	.	384;384	F6XS94;Q14667	.;K0100_HUMAN	K	384;384;384;241	ENSP00000436773:E384K;ENSP00000446443:E241K	ENSP00000005905:E384K	E	-	1	0	KIAA0100	23990539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.978000	0.76147	2.814000	0.96858	0.563000	0.77884	GAA		0.478	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680		20	31	0	0	0	0.007413	0	20	31				
CCL23	6368	broad.mit.edu	37	17	34340812	34340812	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:34340812T>A	ENST00000591423.1	-	3	287	c.223A>T	c.(223-225)Aac>Tac	p.N75Y	CCL23_ENST00000293280.2_Missense_Mutation_p.N92Y|RP11-104J23.1_ENST00000588294.1_RNA|RP11-104J23.2_ENST00000590149.1_lincRNA	NM_145898.1	NP_665905.1	P55773	CCL23_HUMAN	chemokine (C-C motif) ligand 23	75					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|negative regulation of C-C chemokine binding (GO:2001264)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			large_intestine(2)|liver(1)|lung(2)|prostate(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CACTCGCTGTTCGTTTCAAAG	0.522																																							uc002hkt.1		NA																	0					0						c.(223-225)AAC>TAC		small inducible cytokine A23 isoform CKbeta8	Treprostinil(DB00374)						114.0	98.0	104.0					17																	34340812		2203	4300	6503	SO:0001583	missense	6368				cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding	g.chr17:34340812T>A	U58913	CCDS11305.1, CCDS59282.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000167236	ENSG00000274736		"""Chemokine ligands"", ""Endogenous ligands"""	10622	protein-coding gene	gene with protein product		602494	"""small inducible cytokine subfamily A (Cys-Cys), member 23"""	SCYA23		9104803, 10409433	Standard	XR_429910		Approved	Ckb-8, MPIF-1, MIP-3, CKb8	uc002hks.1	P55773	OTTHUMG00000188409	ENST00000591423.1:c.223A>T	17.37:g.34340812T>A	ENSP00000465954:p.Asn75Tyr		Somatic				CCL23_uc002hks.1_Missense_Mutation_p.N92Y	p.N75Y	NM_145898	NP_665905	WXS	Illumina HiSeq	Unspecified	P55773	CCL23_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	3	294	-		Ovarian(249;0.17)	75					B7ZKQ3|O00174|O75950|Q52LD4	Missense_Mutation	SNP	ENST00000591423.1	37	c.223A>T	CCDS59282.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.576960	0.45902	.	.	ENSG00000167236	ENST00000293280	T	0.15139	2.45	3.7	3.7	0.42460	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.519208	0.17778	N	0.162338	T	0.18299	0.0439	L	0.46157	1.445	0.09310	N	1	P;P	0.45902	0.866;0.868	P;B	0.44447	0.45;0.419	T	0.08249	-1.0731	10	0.87932	D	0	.	8.9296	0.35661	0.0:0.0:0.0:1.0	.	75;92	P55773;P55773-2	CCL23_HUMAN;.	Y	92	ENSP00000293280:N92Y	ENSP00000293280:N92Y	N	-	1	0	CCL23	31364925	0.017000	0.18338	0.005000	0.12908	0.002000	0.02628	2.299000	0.43611	1.661000	0.50771	0.418000	0.28097	AAC		0.522	CCL23-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450228.1	NM_005064, NM_145898		20	22	0	0	0	0.007413	0	20	22				
PLXDC1	57125	broad.mit.edu	37	17	37296019	37296019	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:37296019G>C	ENST00000315392.4	-	2	354	c.143C>G	c.(142-144)gCc>gGc	p.A48G	PLXDC1_ENST00000394316.2_Missense_Mutation_p.A48G|PLXDC1_ENST00000539608.1_5'UTR|PLXDC1_ENST00000444911.2_Intron	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	48					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCTCTCTCGGGCTCTCCGGTT	0.662																																							uc002hrg.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(142-144)GCC>GGC		plexin domain containing 1 precursor							49.0	50.0	49.0					17																	37296019		2203	4300	6503	SO:0001583	missense	57125				angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction		g.chr17:37296019G>C	AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.143C>G	17.37:g.37296019G>C	ENSP00000323927:p.Ala48Gly		Somatic				PLXDC1_uc002hrh.2_RNA|PLXDC1_uc002hri.2_RNA|PLXDC1_uc002hrj.1_RNA|PLXDC1_uc002hrk.1_RNA	p.A48G	NM_020405	NP_065138	WXS	Illumina HiSeq	Unspecified	Q8IUK5	PXDC1_HUMAN			2	355	-			48			Extracellular (Potential).		B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	c.143C>G	CCDS11333.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.796381	0.31777	.	.	ENSG00000161381	ENST00000315392;ENST00000394316	T	0.24350	1.86	5.39	1.13	0.20643	.	1.103210	0.06798	N	0.788282	T	0.18002	0.0432	L	0.34521	1.04	0.22378	N	0.999153	B	0.26002	0.139	B	0.21917	0.037	T	0.30880	-0.9963	10	0.18276	T	0.48	-8.8668	7.4386	0.27171	0.3447:0.0:0.6553:0.0	.	48	Q8IUK5	PXDC1_HUMAN	G	48	ENSP00000323927:A48G	ENSP00000323927:A48G	A	-	2	0	PLXDC1	34549545	0.221000	0.23642	0.993000	0.49108	0.869000	0.49853	0.045000	0.14013	0.645000	0.30675	0.561000	0.74099	GCC		0.662	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405		33	38	0	0	0	0.003755	0	33	38				
BZRAP1	9256	broad.mit.edu	37	17	56400737	56400737	+	Silent	SNP	C	C	A	rs140181266		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:56400737C>A	ENST00000343736.4	-	7	1189	c.1026G>T	c.(1024-1026)tcG>tcT	p.S342S	BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1_ENST00000355701.3_Silent_p.S342S|BZRAP1_ENST00000268893.6_Silent_p.S282S			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	342						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCTGAGCTCCGATTCCTGAG	0.582																																							uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(1024-1026)TCG>TCT		peripheral benzodiazepine receptor-associated							169.0	168.0	168.0					17																	56400737		2203	4300	6503	SO:0001819	synonymous_variant	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56400737C>A	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1026G>T	17.37:g.56400737C>A			Somatic				BZRAP1_uc010dcs.2_Silent_p.S282S|BZRAP1_uc010wnt.1_Silent_p.S342S	p.S342S	NM_004758	NP_004749	WXS	Illumina HiSeq	Unspecified	O95153	RIMB1_HUMAN			7	1897	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		342					O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	c.1026G>T	CCDS11605.1																																																																																				0.582	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		13	153	1	0	4.3838e-07	0.001855	5.95702e-07	13	153				
FASN	2194	broad.mit.edu	37	17	80042140	80042140	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:80042140G>A	ENST00000306749.2	-	28	5107	c.4889C>T	c.(4888-4890)cCg>cTg	p.P1630L	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1630					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GAGGAAGTCCGGTGACAGCAG	0.652																																					Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	0				central_nervous_system(1)	1						c.(4888-4890)CCG>CTG		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)						63.0	61.0	62.0					17																	80042140		2196	4290	6486	SO:0001583	missense	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80042140G>A	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4889C>T	17.37:g.80042140G>A	ENSP00000304592:p.Pro1630Leu		Somatic				FASN_uc002kdv.1_5'Flank	p.P1630L	NM_004104	NP_004095	WXS	Illumina HiSeq	Unspecified	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		28	5006	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		1630					Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	c.4889C>T	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	6.372	0.436659	0.12104	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.27256	1.68	4.66	0.0835	0.14433	GroES-like (1);Polyketide synthase, enoylreductase (1);	0.838091	0.10710	N	0.643009	T	0.18383	0.0441	L	0.33339	1.005	0.09310	N	1	B	0.28880	0.226	B	0.21917	0.037	T	0.15122	-1.0448	10	0.56958	D	0.05	-7.2252	10.1543	0.42814	0.0:0.0924:0.38:0.5276	.	1630	P49327	FAS_HUMAN	L	1630;595	ENSP00000304592:P1630L	ENSP00000304592:P1630L	P	-	2	0	FASN	77635429	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	0.539000	0.23175	-0.256000	0.09473	0.491000	0.48974	CCG		0.652	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		9	11	0	0	0	0.004482	0	9	11				
FASN	2194	broad.mit.edu	37	17	80051597	80051597	+	Missense_Mutation	SNP	C	C	A	rs145409565		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr17:80051597C>A	ENST00000306749.2	-	4	549	c.331G>T	c.(331-333)Gtg>Ttg	p.V111L		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	111	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GAGCCGCTCACGCCCACCCAG	0.662																																					Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	0				central_nervous_system(1)	1						c.(331-333)GTG>TTG		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)						65.0	61.0	62.0					17																	80051597		2202	4295	6497	SO:0001583	missense	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80051597C>A	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.331G>T	17.37:g.80051597C>A	ENSP00000304592:p.Val111Leu		Somatic					p.V111L	NM_004104	NP_004095	WXS	Illumina HiSeq	Unspecified	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		4	448	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		111			Beta-ketoacyl synthase (By similarity).		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	c.331G>T	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667329	0.47677	.	.	ENSG00000169710	ENST00000306749	T	0.28069	1.63	4.38	3.4	0.38934	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.387052	0.22431	N	0.060146	T	0.19846	0.0477	N	0.20530	0.585	0.47123	D	0.999322	B	0.15473	0.013	B	0.14023	0.01	T	0.03630	-1.1018	10	0.31617	T	0.26	-23.1512	11.9465	0.52930	0.0:0.9132:0.0:0.0868	.	111	P49327	FAS_HUMAN	L	111	ENSP00000304592:V111L	ENSP00000304592:V111L	V	-	1	0	FASN	77644886	1.000000	0.71417	0.833000	0.33012	0.949000	0.60115	5.855000	0.69510	0.844000	0.35094	0.561000	0.74099	GTG		0.662	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		23	61	1	0	1.96895e-08	0.00278	2.81159e-08	23	61				
RBBP8	5932	broad.mit.edu	37	18	20572830	20572830	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr18:20572830C>T	ENST00000399722.2	+	11	1391	c.1040C>T	c.(1039-1041)tCc>tTc	p.S347F	RBBP8_ENST00000399725.2_Missense_Mutation_p.S347F|RBBP8_ENST00000327155.5_Missense_Mutation_p.S347F|RBBP8_ENST00000360790.5_Missense_Mutation_p.S347F	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	347					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			ACAAGTTTGTCCCCTTCTCTT	0.358								Homologous recombination																															uc002ktw.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(1039-1041)TCC>TTC	Direct_reversal_of_damage|Homologous_recombination	retinoblastoma binding protein 8 isoform a							94.0	100.0	98.0					18																	20572830		2203	4300	6503	SO:0001583	missense	5932				cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr18:20572830C>T	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.1040C>T	18.37:g.20572830C>T	ENSP00000382628:p.Ser347Phe		Somatic				RBBP8_uc002kty.2_Missense_Mutation_p.S347F|RBBP8_uc002ktz.2_Missense_Mutation_p.S347F|RBBP8_uc002kua.2_Missense_Mutation_p.S347F|RBBP8_uc002ktx.1_Missense_Mutation_p.S347F	p.S347F	NM_002894	NP_002885	WXS	Illumina HiSeq	Unspecified	Q99708	COM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;0.00196)		11	1371	+	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		347					A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	37	c.1040C>T	CCDS11875.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966907	0.74131	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T;T	0.43294	1.02;0.95;1.02;0.98;1.01	5.99	5.99	0.97316	.	0.272209	0.38897	N	0.001540	T	0.62636	0.2444	M	0.67953	2.075	0.80722	D	1	D;D;D	0.69078	0.997;0.989;0.997	P;P;P	0.62014	0.897;0.817;0.897	T	0.63314	-0.6665	10	0.87932	D	0	-0.3577	18.6582	0.91462	0.0:1.0:0.0:0.0	.	347;347;347	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	F	347	ENSP00000323050:S347F;ENSP00000382630:S347F;ENSP00000382628:S347F;ENSP00000382627:S347F;ENSP00000354024:S347F	ENSP00000323050:S347F	S	+	2	0	RBBP8	18826828	0.376000	0.25098	1.000000	0.80357	0.986000	0.74619	3.779000	0.55379	2.840000	0.97914	0.655000	0.94253	TCC		0.358	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291		15	40	0	0	0	0.004007	0	15	40				
ASXL3	80816	broad.mit.edu	37	18	31323767	31323767	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr18:31323767G>T	ENST00000269197.5	+	12	3955	c.3955G>T	c.(3955-3957)Gat>Tat	p.D1319Y		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1319	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAGCTCCATGGATGATAAGCA	0.453																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3955-3957)GAT>TAT		additional sex combs like 3							156.0	157.0	157.0					18																	31323767		2000	4185	6185	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323767G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3955G>T	18.37:g.31323767G>T	ENSP00000269197:p.Asp1319Tyr		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.D1026Y	p.D1319Y	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	4010	+			1319			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3955G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147241	0.57151	.	.	ENSG00000141431	ENST00000269197	T	0.20881	2.04	5.92	5.05	0.67936	.	.	.	.	.	T	0.30230	0.0758	L	0.29908	0.895	0.43214	D	0.995087	D	0.64830	0.994	P	0.57371	0.819	T	0.05801	-1.0863	9	0.87932	D	0	.	15.1687	0.72850	0.0675:0.0:0.9325:0.0	.	1319	Q9C0F0	ASXL3_HUMAN	Y	1319	ENSP00000269197:D1319Y	ENSP00000269197:D1319Y	D	+	1	0	ASXL3	29577765	0.999000	0.42202	0.197000	0.23402	0.970000	0.65996	3.378000	0.52432	1.513000	0.48852	0.655000	0.94253	GAT		0.453	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			72	132	1	0	4.38816e-42	0.00361	7.70214e-42	72	132				
FHOD3	80206	broad.mit.edu	37	18	34298499	34298499	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr18:34298499A>G	ENST00000359247.4	+	15	2662	c.2662A>G	c.(2662-2664)Act>Gct	p.T888A	FHOD3_ENST00000257209.4_Missense_Mutation_p.T905A|FHOD3_ENST00000591635.1_Missense_Mutation_p.T101A|FHOD3_ENST00000445677.1_Missense_Mutation_p.T867A|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000590592.1_Missense_Mutation_p.T1080A	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	888	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCCCACATTCACTAAGAAAAA	0.507																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(2662-2664)ACT>GCT		formin homology 2 domain containing 3							106.0	97.0	100.0					18																	34298499		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34298499A>G	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2662A>G	18.37:g.34298499A>G	ENSP00000352186:p.Thr888Ala		Somatic				FHOD3_uc002kzs.1_Missense_Mutation_p.T905A|FHOD3_uc010dmz.1_Missense_Mutation_p.T620A|FHOD3_uc010dna.1_Missense_Mutation_p.T208A	p.T888A	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			15	2759	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	888			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.2662A>G		.	.	.	.	.	.	.	.	.	.	A	2.784	-0.252946	0.05829	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.16897	2.31;2.31;2.31	4.46	2.05	0.26809	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.474372	0.23224	N	0.050524	T	0.06050	0.0157	N	0.04880	-0.145	0.25834	N	0.984134	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.41197	-0.9522	10	0.07482	T	0.82	.	6.7492	0.23477	0.7791:0.0:0.2209:0.0	.	867;888;905	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	A	905;888;867	ENSP00000257209:T905A;ENSP00000352186:T888A;ENSP00000411430:T867A	ENSP00000257209:T905A	T	+	1	0	FHOD3	32552497	1.000000	0.71417	0.828000	0.32881	0.856000	0.48823	1.655000	0.37345	0.565000	0.29255	0.454000	0.30748	ACT		0.507	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		25	74	0	0	0	0.003954	0	25	74				
CDH19	28513	broad.mit.edu	37	18	64202248	64202248	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr18:64202248G>T	ENST00000540086.1	-	8	1557	c.1311C>A	c.(1309-1311)aaC>aaA	p.N437K	CDH19_ENST00000262150.2_Missense_Mutation_p.N437K	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	545	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TAATACTTAGGTTGTACCAAG	0.328																																							uc002lkc.1		NA																	0				ovary(1)|skin(1)	2						c.(1309-1311)AAC>AAA		cadherin 19, type 2 preproprotein							143.0	134.0	137.0					18																	64202248		2202	4295	6497	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64202248G>T	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.1311C>A	18.37:g.64202248G>T	ENSP00000439593:p.Asn437Lys		Somatic				CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.N437K|CDH19_uc002lkd.2_Missense_Mutation_p.N437K	p.N437K	NM_021153	NP_066976	WXS	Illumina HiSeq	Unspecified	Q9H159	CAD19_HUMAN			8	1449	-		Esophageal squamous(42;0.0132)	437			Cadherin 4.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000540086.1	37	c.1311C>A	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396049	0.25205	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.51071	0.72;0.72	5.24	4.35	0.52113	Cadherin (5);Cadherin-like (1);	0.102616	0.64402	D	0.000004	T	0.60625	0.2283	L	0.49513	1.565	0.46203	D	0.998923	D;D	0.89917	1.0;0.998	D;D	0.79784	0.993;0.981	T	0.62539	-0.6833	10	0.87932	D	0	.	12.0406	0.53450	0.1387:0.0:0.8613:0.0	.	437;437	F5H1K0;Q9H159	.;CAD19_HUMAN	K	437;437;382	ENSP00000262150:N437K;ENSP00000439593:N437K	ENSP00000262150:N437K	N	-	3	2	CDH19	62353228	1.000000	0.71417	0.992000	0.48379	0.791000	0.44710	2.377000	0.44300	2.616000	0.88540	0.591000	0.81541	AAC		0.328	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153		21	36	1	0	8.10497e-08	0.001523	1.13335e-07	21	36				
C3	718	broad.mit.edu	37	19	6712321	6712321	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:6712321C>G	ENST00000245907.6	-	11	1308	c.1216G>C	c.(1216-1218)Gtg>Ctg	p.V406L		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	406					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGTTTGGCCACGCCATCTCCC	0.617																																							uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(1216-1218)GTG>CTG		complement component 3 precursor							175.0	121.0	139.0					19																	6712321		2203	4300	6503	SO:0001583	missense	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6712321C>G	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1216G>C	19.37:g.6712321C>G	ENSP00000245907:p.Val406Leu		Somatic					p.V406L	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	11	1278	-			406					A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	c.1216G>C	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	1.533	-0.543789	0.04053	.	.	ENSG00000125730	ENST00000245907	T	0.31247	1.5	5.13	0.131	0.14755	.	0.591868	0.17181	N	0.183886	T	0.12902	0.0313	N	0.21324	0.655	0.19775	N	0.999959	B	0.09022	0.002	B	0.09377	0.004	T	0.32052	-0.9921	10	0.02654	T	1	.	4.3327	0.11071	0.0:0.3217:0.3678:0.3105	.	406	P01024	CO3_HUMAN	L	406	ENSP00000245907:V406L	ENSP00000245907:V406L	V	-	1	0	C3	6663321	0.006000	0.16342	0.520000	0.27837	0.007000	0.05969	1.256000	0.32921	0.549000	0.28973	-0.224000	0.12420	GTG		0.617	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		25	19	0	0	0	0.00333	0	25	19				
PDE4A	5141	broad.mit.edu	37	19	10577915	10577915	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:10577915C>T	ENST00000352831.6	+	15	2389	c.2279C>T	c.(2278-2280)tCg>tTg	p.S760L	PDE4A_ENST00000592685.1_Missense_Mutation_p.S738L|PDE4A_ENST00000293683.5_Missense_Mutation_p.S734L|PDE4A_ENST00000344979.3_Missense_Mutation_p.S521L|PDE4A_ENST00000440014.2_Missense_Mutation_p.S699L|PDE4A_ENST00000380702.2_Missense_Mutation_p.S738L	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	760					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)	p.S521L(1)|p.S734L(1)|p.S699L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GCCCAGGAGTCGTTGGAAGTT	0.607																																							uc002moj.2		NA																	3	Substitution - Missense(3)		endometrium(3)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(2278-2280)TCG>TTG		phosphodiesterase 4A isoform 1	Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)						93.0	90.0	91.0					19																	10577915		2203	4300	6503	SO:0001583	missense	5141				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding	g.chr19:10577915C>T		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.2279C>T	19.37:g.10577915C>T	ENSP00000270474:p.Ser760Leu		Somatic				PDE4A_uc002mok.2_Missense_Mutation_p.S734L|PDE4A_uc002mol.2_Missense_Mutation_p.S699L|PDE4A_uc002mom.2_Missense_Mutation_p.S521L|PDE4A_uc002mon.2_Missense_Mutation_p.S215L|PDE4A_uc002moo.2_3'UTR	p.S760L	NM_001111307	NP_001104777	WXS	Illumina HiSeq	Unspecified	P27815	PDE4A_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		15	2387	+			760					O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	c.2279C>T	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	c	9.262	1.043529	0.19748	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979	T;T;T;T;T	0.66995	-0.24;-0.23;-0.24;-0.23;0.07	2.53	-2.8	0.05823	.	1.908110	0.03839	U	0.270373	T	0.43897	0.1268	N	0.08118	0	0.09310	N	1	B;B;B;B	0.11235	0.001;0.001;0.004;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.21690	-1.0238	10	0.27785	T	0.31	.	7.7056	0.28648	0.0:0.6674:0.0:0.3326	.	521;699;734;760	P27815-4;P27815-6;P27815-2;P27815	.;.;.;PDE4A_HUMAN	L	738;760;734;699;521	ENSP00000370078:S738L;ENSP00000270474:S760L;ENSP00000293683:S734L;ENSP00000394754:S699L;ENSP00000341007:S521L	ENSP00000293683:S734L	S	+	2	0	PDE4A	10438915	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.797000	0.01749	-0.706000	0.05028	0.298000	0.19748	TCG		0.607	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1			5	58	0	0	0	0.000602	0	5	58				
SMARCA4	6597	broad.mit.edu	37	19	11141507	11141507	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:11141507G>T	ENST00000429416.3	+	26	3765	c.3484G>T	c.(3484-3486)Ggc>Tgc	p.G1162C	SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1162C|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1162C|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1162C|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1162C|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1162C|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1162C|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1162C|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1162C	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1162	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGGGGGGCTCGGCCTGAACCT	0.607			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		1	Unknown(1)		lung(1)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(3484-3486)GGC>TGC		SWI/SNF-related matrix-associated							24.0	25.0	25.0					19																	11141507		2197	4297	6494	SO:0001583	missense	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11141507G>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3484G>T	19.37:g.11141507G>T	ENSP00000395654:p.Gly1162Cys		Somatic				SMARCA4_uc010dxp.2_Missense_Mutation_p.G1162C|SMARCA4_uc010dxo.2_Missense_Mutation_p.G1162C|SMARCA4_uc002mqg.1_Missense_Mutation_p.G1162C|SMARCA4_uc010dxq.2_Missense_Mutation_p.G1162C|SMARCA4_uc010dxr.2_Missense_Mutation_p.G1162C|SMARCA4_uc002mqj.3_Missense_Mutation_p.G1162C|SMARCA4_uc010dxs.2_Missense_Mutation_p.G1162C|SMARCA4_uc010dxt.1_Missense_Mutation_p.G382C|SMARCA4_uc002mqh.3_Missense_Mutation_p.G285C|SMARCA4_uc002mqi.1_Missense_Mutation_p.G365C	p.G1162C	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			25	3768	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	1162			Helicase C-terminal.		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	c.3484G>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591560	0.86953	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44	4.59	4.59	0.56863	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99193	0.9720	H	0.99336	4.52	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98581	1.0650	10	0.87932	D	0	-37.1265	16.3247	0.82975	0.0:0.0:1.0:0.0	.	1162;1162;1162;1162;1162;382;1162;1162	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	C	1162;1162;1226;1162;1162;1162;1162;1162	ENSP00000395654:G1162C;ENSP00000350720:G1162C;ENSP00000343896:G1162C;ENSP00000445036:G1162C;ENSP00000392837:G1162C;ENSP00000397783:G1162C;ENSP00000414727:G1162C	ENSP00000343896:G1162C	G	+	1	0	SMARCA4	11002507	1.000000	0.71417	0.957000	0.39632	0.994000	0.84299	9.356000	0.97091	2.389000	0.81357	0.563000	0.77884	GGC		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		11	8	1	0	3.86212e-05	0.008291	4.76752e-05	11	8				
FAM129C	199786	broad.mit.edu	37	19	17653058	17653058	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:17653058G>T	ENST00000335393.4	+	11	1515	c.1377G>T	c.(1375-1377)ctG>ctT	p.L459L	FAM129C_ENST00000300971.2_Silent_p.L459L|FAM129C_ENST00000599164.1_Silent_p.L428L|FAM129C_ENST00000332386.5_Silent_p.L459L|FAM129C_ENST00000599124.1_Silent_p.L428L|FAM129C_ENST00000595684.1_Silent_p.L459L|FAM129C_ENST00000601861.1_Silent_p.L428L|FAM129C_ENST00000352727.3_Silent_p.L459L|FAM129C_ENST00000600871.1_Silent_p.L405L|FAM129C_ENST00000449408.2_Silent_p.L185L	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	459										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						TTGGCTTTCTGGGGATGCAGA	0.642																																							uc010xpr.1		NA																	0					0						c.(1375-1377)CTG>CTT		B-cell novel protein 1 isoform a							113.0	117.0	116.0					19																	17653058		2203	4300	6503	SO:0001819	synonymous_variant	199786							g.chr19:17653058G>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1377G>T	19.37:g.17653058G>T			Somatic				FAM129C_uc010xpq.1_Silent_p.L459L|FAM129C_uc002ngy.3_Silent_p.L185L|FAM129C_uc010xpu.1_Silent_p.L185L|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Silent_p.L185L|FAM129C_uc002nhb.2_Silent_p.L58L	p.L459L	NM_173544	NP_775815	WXS	Illumina HiSeq	Unspecified	Q86XR2	NIBL2_HUMAN			11	1515	+			459					B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Silent	SNP	ENST00000335393.4	37	c.1377G>T	CCDS12362.1																																																																																				0.642	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		14	130	1	0	1.49906e-05	0.00245	1.89207e-05	14	130				
ARHGAP33	115703	broad.mit.edu	37	19	36279099	36279099	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:36279099G>A	ENST00000007510.4	+	21	3776	c.3632G>A	c.(3631-3633)cGg>cAg	p.R1211Q	ARHGAP33_ENST00000378944.5_Missense_Mutation_p.R1047Q|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R1050Q			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1211					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CAGAAACAACGGGCACCCTGG	0.697																																							uc002obs.1		NA																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(3148-3150)CGG>CAG		sorting nexin 26																																				SO:0001583	missense	115703				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding	g.chr19:36279099G>A	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3632G>A	19.37:g.36279099G>A	ENSP00000007510:p.Arg1211Gln		Somatic				ARHGAP33_uc002obt.1_Missense_Mutation_p.R1047Q|ARHGAP33_uc010eel.2_Intron|ARHGAP33_uc002obv.1_Missense_Mutation_p.R799Q	p.R1050Q	NM_052948	NP_443180	WXS	Illumina HiSeq	Unspecified	O14559	RHG33_HUMAN			21	3234	+			1211					O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37	c.3149G>A		.	.	.	.	.	.	.	.	.	.	g	19.14	3.769084	0.69992	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.15139	2.96;2.45;2.75	4.41	4.41	0.53225	.	0.000000	0.38492	N	0.001674	T	0.08133	0.0203	N	0.19112	0.55	0.27280	N	0.95813	P;P	0.37997	0.614;0.614	B;B	0.24006	0.05;0.05	T	0.20472	-1.0274	10	0.52906	T	0.07	.	7.2253	0.26012	0.1974:0.0:0.8026:0.0	.	1047;1050	O14559-10;O14559-11	.;.	Q	1211;1050;1047	ENSP00000007510:R1211Q;ENSP00000320038:R1050Q;ENSP00000368227:R1047Q	ENSP00000007510:R1211Q	R	+	2	0	ARHGAP33	40970939	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.062000	0.57492	2.174000	0.68829	0.401000	0.26515	CGG		0.697	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948		5	75	0	0	0	0.001168	0	5	75				
CLIP3	25999	broad.mit.edu	37	19	36508329	36508329	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:36508329G>T	ENST00000360535.4	-	12	1702	c.1475C>A	c.(1474-1476)cCc>cAc	p.P492H	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.P492H	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	492	GoLD.				chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTGTCCCCGGGGGAATCAGT	0.572																																							uc010eeq.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1474-1476)CCC>CAC		CAP-GLY domain containing linker protein 3							123.0	102.0	109.0					19																	36508329		2203	4300	6503	SO:0001583	missense	25999				chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding	g.chr19:36508329G>T	AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.1475C>A	19.37:g.36508329G>T	ENSP00000353732:p.Pro492His		Somatic				uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.P492H	p.P492H	NM_015526	NP_056341	WXS	Illumina HiSeq	Unspecified	Q96DZ5	CLIP3_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		11	1757	-	Esophageal squamous(110;0.162)		492			GoLD.		A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	37	c.1475C>A	CCDS12486.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428042	0.43122	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.75050	-0.9	5.23	2.95	0.34219	Cytoskeleton-associated protein, Gly-rich domain (1);	0.364456	0.28151	N	0.016416	T	0.47021	0.1423	N	0.08118	0	0.30390	N	0.781121	P	0.39964	0.697	B	0.32864	0.154	T	0.54603	-0.8269	10	0.62326	D	0.03	-14.8346	6.0641	0.19854	0.0909:0.0:0.6195:0.2897	.	492	Q96DZ5	CLIP3_HUMAN	H	492;374;468	ENSP00000353732:P492H	ENSP00000353732:P492H	P	-	2	0	CLIP3	41200169	0.998000	0.40836	0.998000	0.56505	0.765000	0.43378	1.816000	0.38992	1.347000	0.45714	-0.140000	0.14226	CCC		0.572	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526		5	75	1	0	0.000602214	0.000602	0.000709602	5	75				
IFNL3	282617	broad.mit.edu	37	19	39734506	39734506	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:39734506G>T	ENST00000413851.2	-	4	488	c.450C>A	c.(448-450)cgC>cgA	p.R150R		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	150					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											AATGGTGGAGGCGGCCCCGGG	0.692																																							uc010xut.1		NA																	0					0						c.(448-450)CGC>CGA		interleukin 28B							25.0	32.0	30.0					19																	39734506		2190	4273	6463	SO:0001819	synonymous_variant	282617				response to virus	extracellular space	cytokine activity	g.chr19:39734506G>T	AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.450C>A	19.37:g.39734506G>T			Somatic				IL28B_uc010xuu.1_Silent_p.R150R	p.R150R	NM_172139	NP_742151	WXS	Illumina HiSeq	Unspecified	Q8IZI9	IL28B_HUMAN	Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		4	454	-	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		150					A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Silent	SNP	ENST00000413851.2	37	c.450C>A	CCDS12530.1																																																																																				0.692	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139		22	91	1	0	2.98393e-07	0.00278	4.08774e-07	22	91				
IFNL3	282617	broad.mit.edu	37	19	39735475	39735475	+	Silent	SNP	G	G	A	rs375329061		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:39735475G>A	ENST00000413851.2	-	1	171	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	IFNL4_ENST00000606380.1_RNA	NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	45					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											TGTGGAGACAGGGACTTGAAC	0.632																																							uc010xut.1		NA																	0					0						c.(133-135)CTG>TTG		interleukin 28B							33.0	34.0	34.0					19																	39735475		2203	4297	6500	SO:0001819	synonymous_variant	282617				response to virus	extracellular space	cytokine activity	g.chr19:39735475G>A	AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.133C>T	19.37:g.39735475G>A			Somatic				IL28B_uc010xuu.1_Silent_p.L45L	p.L45L	NM_172139	NP_742151	WXS	Illumina HiSeq	Unspecified	Q8IZI9	IL28B_HUMAN	Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		1	137	-	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		45					A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Silent	SNP	ENST00000413851.2	37	c.133C>T	CCDS12530.1																																																																																				0.632	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139		17	38	0	0	0	0.006122	0	17	38				
ZNF226	7769	broad.mit.edu	37	19	44680673	44680673	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:44680673A>G	ENST00000590089.1	+	7	1625	c.1258A>G	c.(1258-1260)Aaa>Gaa	p.K420E	ZNF226_ENST00000337433.5_Missense_Mutation_p.K420E|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.K420E			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				GAAACCATACAAATGTGAGGA	0.418																																					Pancreas(115;581 1665 13228 19278 50070)	Pancreas(115;581 1665 13228 19278 50070)	uc002oyp.2		NA																	0					0						c.(1258-1260)AAA>GAA		zinc finger protein 226 isoform a							60.0	65.0	63.0					19																	44680673		2200	4300	6500	SO:0001583	missense	7769				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44680673A>G	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1258A>G	19.37:g.44680673A>G	ENSP00000465121:p.Lys420Glu		Somatic				ZNF226_uc002oyq.2_Missense_Mutation_p.K303E|ZNF226_uc002oyr.2_Missense_Mutation_p.K303E|ZNF226_uc010ejg.2_3'UTR|ZNF226_uc002oys.2_Missense_Mutation_p.K420E|ZNF226_uc002oyt.2_Missense_Mutation_p.K420E	p.K420E	NM_001032373	NP_001027545	WXS	Illumina HiSeq	Unspecified	Q9NYT6	ZN226_HUMAN			6	1402	+		Prostate(69;0.0352)|all_neural(266;0.202)	420			C2H2-type 7.		Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	c.1258A>G	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	A	11.86	1.764804	0.31228	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.35973	1.28;1.28	3.92	2.91	0.33838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34628	N	0.003807	T	0.41488	0.1161	L	0.42581	1.335	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.24657	-1.0154	10	0.13853	T	0.58	.	5.1826	0.15167	0.7121:0.1846:0.1033:0.0	.	420	Q9NYT6	ZN226_HUMAN	E	420	ENSP00000336719:K420E;ENSP00000393265:K420E	ENSP00000336719:K420E	K	+	1	0	ZNF226	49372513	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.422000	0.07043	1.786000	0.52430	0.533000	0.62120	AAA		0.418	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1			24	48	0	0	0	0.002299	0	24	48				
GLTSCR1	29998	broad.mit.edu	37	19	48183951	48183951	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:48183951G>T	ENST00000396720.3	+	6	1718	c.1524G>T	c.(1522-1524)caG>caT	p.Q508H	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	508										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CAGGTGGACAGCTCATCGCGA	0.731																																							uc002phh.3		NA																	0				pancreas(3)	3						c.(1522-1524)CAG>CAT		glioma tumor suppressor candidate region gene 1							21.0	27.0	25.0					19																	48183951		1956	4108	6064	SO:0001583	missense	29998						protein binding	g.chr19:48183951G>T	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1524G>T	19.37:g.48183951G>T	ENSP00000379946:p.Gln508His		Somatic				GLTSCR1_uc002phi.3_Missense_Mutation_p.Q266H	p.Q508H	NM_015711	NP_056526	WXS	Illumina HiSeq	Unspecified	Q9NZM4	GSCR1_HUMAN		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)	6	1718	+		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)	508					A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	c.1524G>T	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	6.060	0.379365	0.11466	.	.	ENSG00000063169	ENST00000396720	T	0.50548	0.74	4.7	3.67	0.42095	.	.	.	.	.	T	0.59542	0.2201	L	0.47716	1.5	0.42305	D	0.992191	D	0.89917	1.0	D	0.78314	0.991	T	0.61865	-0.6975	9	0.62326	D	0.03	.	12.0277	0.53380	0.0862:0.0:0.9138:0.0	.	508	Q9NZM4	GSCR1_HUMAN	H	508	ENSP00000379946:Q508H	ENSP00000379946:Q508H	Q	+	3	2	GLTSCR1	52875763	1.000000	0.71417	1.000000	0.80357	0.232000	0.25224	2.380000	0.44327	1.109000	0.41680	0.561000	0.74099	CAG		0.731	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711		27	27	1	0	3.65163e-15	0.00632	5.77746e-15	27	27				
NLRP12	91662	broad.mit.edu	37	19	54312855	54312855	+	Silent	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:54312855C>A	ENST00000324134.6	-	3	2226	c.2058G>T	c.(2056-2058)acG>acT	p.T686T	NLRP12_ENST00000391775.3_Silent_p.T686T|NLRP12_ENST00000391772.1_Silent_p.T686T|NLRP12_ENST00000345770.5_Silent_p.T686T|NLRP12_ENST00000351894.4_Silent_p.T686T|NLRP12_ENST00000391773.1_Silent_p.T686T|NLRP12_ENST00000535162.1_Silent_p.T686T|NLRP12_ENST00000354278.3_Silent_p.T686T	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	686					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCACCAACAGCGTGTGCGCTC	0.567																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(2056-2058)ACG>ACT		NLR family, pyrin domain containing 12 isoform							23.0	23.0	23.0					19																	54312855		2200	4297	6497	SO:0001819	synonymous_variant	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54312855C>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2058G>T	19.37:g.54312855C>A			Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.T686T|NLRP12_uc002qcj.3_Silent_p.T686T|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.T686T	p.T686T	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	2278	-	Ovarian(34;0.19)		686					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	c.2058G>T	CCDS12864.1																																																																																				0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		6	21	1	0	8.12818e-05	0.001984	9.92463e-05	6	21				
CNOT3	4849	broad.mit.edu	37	19	54656017	54656017	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:54656017T>C	ENST00000406403.1	+	13	3263	c.1660T>C	c.(1660-1662)Tct>Cct	p.S554P	CNOT3_ENST00000496327.1_3'UTR|CNOT3_ENST00000358389.3_Missense_Mutation_p.S373P|CNOT3_ENST00000221232.5_Missense_Mutation_p.S554P			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	554	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AGCCATCAGCTCTGGCATTGA	0.652																																							uc002qdj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(1660-1662)TCT>CCT		CCR4-NOT transcription complex, subunit 3							63.0	60.0	61.0					19																	54656017		2203	4300	6503	SO:0001583	missense	4849				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	g.chr19:54656017T>C	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1660T>C	19.37:g.54656017T>C	ENSP00000383954:p.Ser554Pro		Somatic				CNOT3_uc010yel.1_Missense_Mutation_p.S554P|CNOT3_uc002qdi.2_Missense_Mutation_p.S467P|CNOT3_uc002qdk.1_Missense_Mutation_p.S554P|CNOT3_uc010ere.1_RNA|CNOT3_uc002qdl.2_Missense_Mutation_p.S9P	p.S554P	NM_014516	NP_055331	WXS	Illumina HiSeq	Unspecified	O75175	CNOT3_HUMAN			14	1971	+	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		554			Pro-rich.		Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	c.1660T>C	CCDS12880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.0|26.0	4.691961|4.691961	0.88735|0.88735	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000457463|ENST00000221232;ENST00000358389;ENST00000406403	.|T;T	.|0.46451	.|0.87;0.87	4.49|4.49	4.49|4.49	0.54785|0.54785	.|.	.|0.142934	.|0.49305	.|D	.|0.000154	T|T	0.48696|0.48696	0.1514|0.1514	L|L	0.43152|0.43152	1.355|1.355	0.52099|0.52099	D|D	0.999944|0.999944	.|D;P;D;D	.|0.65815	.|0.99;0.512;0.971;0.995	.|P;B;B;P	.|0.56278	.|0.676;0.322;0.441;0.795	T|T	0.44251|0.44251	-0.9340|-0.9340	5|10	.|0.40728	.|T	.|0.16	-16.5624|-16.5624	13.0749|13.0749	0.59081|0.59081	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|554;373;554;478	.|B7Z6J7;O75175-3;O75175;Q6ZMJ6	.|.;.;CNOT3_HUMAN;.	P|P	85|554;373;554	.|ENSP00000221232:S554P;ENSP00000383954:S554P	.|ENSP00000221232:S554P	L|S	+|+	2|1	0|0	CNOT3|CNOT3	59347829|59347829	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	4.263000|4.263000	0.58853|0.58853	1.785000|1.785000	0.52413|0.52413	0.533000|0.533000	0.62120|0.62120	CTC|TCT		0.652	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516		22	49	0	0	0	0.001882	0	22	49				
LILRA2	11027	broad.mit.edu	37	19	55085802	55085802	+	Silent	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:55085802A>T	ENST00000251377.3	+	4	238	c.105A>T	c.(103-105)ccA>ccT	p.P35P	LILRA2_ENST00000391737.1_Silent_p.P23P|LILRA2_ENST00000391738.3_Silent_p.P35P|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Silent_p.P35P|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000495786.1_3'UTR			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	35	Ig-like C2-type 1.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GGGCTGAGCCAGGCTCTGTGA	0.547																																							uc002qgg.3		NA																	0				ovary(1)	1						c.(103-105)CCA>CCT		leukocyte immunoglobulin-like receptor,							90.0	94.0	93.0					19																	55085802		2203	4300	6503	SO:0001819	synonymous_variant	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55085802A>T	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.105A>T	19.37:g.55085802A>T			Somatic				LILRA2_uc010ern.2_Silent_p.P35P|LILRA2_uc002qgf.2_Silent_p.P35P|LILRA2_uc010yfe.1_Silent_p.P35P|LILRA2_uc010yff.1_Silent_p.P23P|LILRA2_uc010ero.2_Silent_p.P23P|LILRA2_uc010yfg.1_Silent_p.P35P	p.P35P	NM_001130917	NP_001124389	WXS	Illumina HiSeq	Unspecified	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	3	194	+			35			Extracellular (Potential).|Ig-like C2-type 1.		O75020	Silent	SNP	ENST00000251377.3	37	c.105A>T	CCDS46179.1																																																																																				0.547	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			6	126	0	0	0	0.001168	0	6	126				
PTPRH	5794	broad.mit.edu	37	19	55713663	55713663	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:55713663A>G	ENST00000376350.3	-	6	936	c.914T>C	c.(913-915)gTg>gCg	p.V305A	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Missense_Mutation_p.V127A	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	305	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTGAGCCTCCACTGTCAGGTT	0.552																																							uc002qjq.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(913-915)GTG>GCG		protein tyrosine phosphatase, receptor type, H							91.0	76.0	81.0					19																	55713663		2203	4300	6503	SO:0001583	missense	5794				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:55713663A>G		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.914T>C	19.37:g.55713663A>G	ENSP00000365528:p.Val305Ala		Somatic				PTPRH_uc010esv.2_Missense_Mutation_p.V127A|PTPRH_uc002qjs.2_Missense_Mutation_p.V312A	p.V305A	NM_002842	NP_002833	WXS	Illumina HiSeq	Unspecified	Q9HD43	PTPRH_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)	6	987	-		Renal(1328;0.245)	305			Extracellular (Potential).|Fibronectin type-III 4.		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	c.914T>C	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312479	0.23908	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.58060	0.36;0.36	3.89	1.31	0.21738	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58380	0.2118	L	0.58428	1.81	0.09310	N	1	D;D;P	0.76494	0.999;0.999;0.743	D;D;P	0.67900	0.954;0.923;0.633	T	0.44877	-0.9299	9	0.30078	T	0.28	.	2.2618	0.04068	0.5884:0.0:0.1819:0.2296	.	127;127;305	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	A	305;127	ENSP00000365528:V305A;ENSP00000263434:V127A	ENSP00000263434:V127A	V	-	2	0	PTPRH	60405475	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	0.029000	0.13666	0.083000	0.17047	0.374000	0.22700	GTG		0.552	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1			16	43	0	0	0	0.00499	0	16	43				
BRSK1	84446	broad.mit.edu	37	19	55798406	55798406	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:55798406G>T	ENST00000309383.1	+	2	445	c.168G>T	c.(166-168)acG>acT	p.T56T	BRSK1_ENST00000590333.1_Silent_p.T72T|BRSK1_ENST00000585418.1_Silent_p.T56T	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	56	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		ACTGCATCACGGGTCAGAAGG	0.637																																							uc002qkg.2		NA																	0				ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(166-168)ACG>ACT		BR serine/threonine kinase 1							104.0	87.0	93.0					19																	55798406		2203	4300	6503	SO:0001819	synonymous_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55798406G>T	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.168G>T	19.37:g.55798406G>T			Somatic				BRSK1_uc002qkf.2_Silent_p.T72T	p.T56T	NM_032430	NP_115806	WXS	Illumina HiSeq	Unspecified	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	2	445	+		Renal(1328;0.245)	56			Protein kinase.		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	c.168G>T	CCDS12921.1																																																																																				0.637	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		7	86	1	0	1.12685e-05	0.004482	1.44391e-05	7	86				
ZSCAN5B	342933	broad.mit.edu	37	19	56704114	56704114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:56704114A>T	ENST00000586855.2	-	2	621	c.308T>A	c.(307-309)tTa>tAa	p.L103*	ZSCAN5B_ENST00000358992.3_Nonsense_Mutation_p.L103*			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	103	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CACCTTGACTAAGACCTGGAG	0.542																																							uc010ygh.1		NA																	0				ovary(1)|skin(1)	2						c.(307-309)TTA>TAA		zinc finger and SCAN domain containing 5B							30.0	32.0	32.0					19																	56704114		2182	4246	6428	SO:0001587	stop_gained	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56704114A>T		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.308T>A	19.37:g.56704114A>T	ENSP00000466072:p.Leu103*		Somatic					p.L103*	NM_001080456	NP_001073925	WXS	Illumina HiSeq	Unspecified	A6NJL1	ZSA5B_HUMAN			1	308	-			103			SCAN box.			Nonsense_Mutation	SNP	ENST00000586855.2	37	c.308T>A	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.008442	0.93346	.	.	ENSG00000197213	ENST00000358992	.	.	.	2.48	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.82	0.23852	1.0:0.0:0.0:0.0	.	.	.	.	X	103	.	ENSP00000351883:L103X	L	-	2	0	ZSCAN5B	61395926	.	.	0.003000	0.11579	0.861000	0.49209	.	.	1.384000	0.46424	0.260000	0.18958	TTA		0.542	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		7	67	0	0	0	0.004482	0	7	67				
ZSCAN4	201516	broad.mit.edu	37	19	58187634	58187634	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:58187634G>T	ENST00000318203.5	+	3	818	c.121G>T	c.(121-123)Gag>Tag	p.E41*		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	41					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGGGATTTCTGAGTTCTCAAG	0.398																																							uc002qpu.2		NA																	0				ovary(1)	1						c.(121-123)GAG>TAG		zinc finger and SCAN domain containing 4							104.0	101.0	102.0					19																	58187634		2203	4300	6503	SO:0001587	stop_gained	201516				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58187634G>T	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.121G>T	19.37:g.58187634G>T	ENSP00000321963:p.Glu41*		Somatic					p.E41*	NM_152677	NP_689890	WXS	Illumina HiSeq	Unspecified	Q8NAM6	ZSCA4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	818	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	41					Q3MIQ2	Nonsense_Mutation	SNP	ENST00000318203.5	37	c.121G>T	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	G	38	7.096677	0.98059	.	.	ENSG00000180532	ENST00000318203	.	.	.	4.42	-0.0573	0.13802	.	2.134210	0.02314	N	0.072415	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	2.9526	6.7666	0.23571	0.3889:0.0:0.6111:0.0	.	.	.	.	X	41	.	ENSP00000321963:E41X	E	+	1	0	ZSCAN4	62879446	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.495000	0.22483	0.108000	0.17862	-0.150000	0.13652	GAG		0.398	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677		11	33	1	0	6.40141e-05	0.000978	7.84464e-05	11	33				
ZNF606	80095	broad.mit.edu	37	19	58490705	58490705	+	Missense_Mutation	SNP	C	C	G	rs138065835		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:58490705C>G	ENST00000341164.4	-	7	1963	c.1343G>C	c.(1342-1344)cGg>cCg	p.R448P	ZNF606_ENST00000536132.1_Missense_Mutation_p.R358P	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		AGTGTGAGTCCGTTCATGTTT	0.353																																							uc002qqw.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1342-1344)CGG>CCG		zinc finger protein 606							54.0	58.0	57.0					19																	58490705		2203	4300	6503	SO:0001583	missense	80095				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58490705C>G	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.1343G>C	19.37:g.58490705C>G	ENSP00000343617:p.Arg448Pro		Somatic				ZNF606_uc010yhp.1_Missense_Mutation_p.R358P	p.R448P	NM_025027	NP_079303	WXS	Illumina HiSeq	Unspecified	Q8WXB4	ZN606_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)	7	1961	-		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	448			C2H2-type 4.		A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	37	c.1343G>C	CCDS12968.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257883	0.39896	.	.	ENSG00000166704	ENST00000341164;ENST00000536132;ENST00000551380	T;T;T	0.02446	4.29;4.29;4.29	4.55	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.174167	0.28114	N	0.016558	T	0.16981	0.0408	M	0.89968	3.075	0.32954	D	0.52015	D	0.89917	1.0	D	0.80764	0.994	T	0.11203	-1.0597	10	0.72032	D	0.01	.	10.2407	0.43310	0.0:0.9066:0.0:0.0934	.	448	Q8WXB4	ZN606_HUMAN	P	448;358;448	ENSP00000343617:R448P;ENSP00000445624:R358P;ENSP00000446972:R448P	ENSP00000343617:R448P	R	-	2	0	ZNF606	63182517	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	0.044000	0.13992	2.515000	0.84797	0.655000	0.94253	CGG		0.353	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027		6	22	0	0	0	0.001168	0	6	22				
C2orf71	388939	broad.mit.edu	37	2	29295617	29295617	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:29295617G>T	ENST00000331664.5	-	1	1510	c.1511C>A	c.(1510-1512)gCc>gAc	p.A504D		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	504					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TTCCTGCCAGGCACACAGACT	0.562																																							uc002rmt.1		NA																	0				skin(1)	1						c.(1510-1512)GCC>GAC		hypothetical protein LOC388939							84.0	87.0	86.0					2																	29295617		2101	4216	6317	SO:0001583	missense	388939				response to stimulus|visual perception	photoreceptor outer segment		g.chr2:29295617G>T		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1511C>A	2.37:g.29295617G>T	ENSP00000332809:p.Ala504Asp		Somatic					p.A504D	NM_001029883	NP_001025054	WXS	Illumina HiSeq	Unspecified	A6NGG8	CB071_HUMAN			1	1511	-			504						Missense_Mutation	SNP	ENST00000331664.5	37	c.1511C>A	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	G	2.129	-0.399589	0.04865	.	.	ENSG00000179270	ENST00000331664	T	0.19394	2.15	4.67	1.38	0.22167	.	1.893040	0.02165	N	0.059147	T	0.16514	0.0397	N	0.22421	0.69	0.09310	N	1	B	0.26258	0.145	B	0.23419	0.046	T	0.28490	-1.0042	10	0.21540	T	0.41	2.6801	9.8013	0.40766	0.1664:0.0:0.6827:0.1509	.	504	A6NGG8	CB071_HUMAN	D	504	ENSP00000332809:A504D	ENSP00000332809:A504D	A	-	2	0	C2orf71	29149121	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.875000	0.28079	0.078000	0.16900	-1.134000	0.01955	GCC		0.562	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883		31	91	1	0	2.81731e-10	0.002096	4.20104e-10	31	91				
CYP26B1	56603	broad.mit.edu	37	2	72360433	72360433	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:72360433C>G	ENST00000001146.2	-	5	1068	c.865G>C	c.(865-867)Ggg>Cgg	p.G289R	CYP26B1_ENST00000412253.1_Missense_Mutation_p.G98R|CYP26B1_ENST00000546307.1_Missense_Mutation_p.G214R	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	289					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TCCAGGGTCCCGTCCTGCAGG	0.632																																							uc002sih.1		NA																	0				skin(2)	2						c.(865-867)GGG>CGG		cytochrome P450, family 26, subfamily b,							23.0	25.0	25.0					2																	72360433		2183	4258	6441	SO:0001583	missense	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72360433C>G		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.865G>C	2.37:g.72360433C>G	ENSP00000001146:p.Gly289Arg		Somatic				CYP26B1_uc010yra.1_Missense_Mutation_p.G272R|CYP26B1_uc010yrb.1_Missense_Mutation_p.G214R	p.G289R	NM_019885	NP_063938	WXS	Illumina HiSeq	Unspecified	Q9NR63	CP26B_HUMAN			5	865	-			289					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	c.865G>C	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142664	0.77888	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.67865	-0.29;-0.29;-0.29	5.35	5.35	0.76521	.	0.109437	0.64402	D	0.000005	T	0.64549	0.2608	N	0.19112	0.55	0.50313	D	0.99986	P;B;B	0.39920	0.695;0.282;0.282	P;P;P	0.50231	0.635;0.499;0.499	T	0.60146	-0.7320	10	0.25106	T	0.35	-6.7456	18.0071	0.89212	0.0:1.0:0.0:0.0	.	214;272;289	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	R	289;98;214	ENSP00000001146:G289R;ENSP00000401465:G98R;ENSP00000443304:G214R	ENSP00000001146:G289R	G	-	1	0	CYP26B1	72213941	0.992000	0.36948	0.982000	0.44146	0.923000	0.55619	3.155000	0.50700	2.687000	0.91594	0.563000	0.77884	GGG		0.632	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		10	20	0	0	0	0.001368	0	10	20				
CCT7	10574	broad.mit.edu	37	2	73461511	73461511	+	Splice_Site	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:73461511T>A	ENST00000258091.5	+	1	146	c.5T>A	c.(4-6)aTg>aAg	p.M2K	CCT7_ENST00000538797.1_5'UTR|PRADC1_ENST00000258083.2_5'Flank|CCT7_ENST00000473786.1_3'UTR|PRADC1_ENST00000480093.1_5'Flank|CCT7_ENST00000539919.1_5'UTR|CCT7_ENST00000540468.1_Splice_Site_p.M2K|CCT7_ENST00000537131.1_5'UTR|CCT7_ENST00000398422.2_Splice_Site_p.M2K	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	2					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						TCCAAAATGATGGTGAGTGGC	0.627																																							uc002siz.2		NA																	0					0						c.(4-6)ATG>AAG		chaperonin containing TCP1, subunit 7 isoform a							26.0	33.0	31.0					2																	73461511		1977	4151	6128	SO:0001630	splice_region_variant	10574				'de novo' posttranslational protein folding		ATP binding|unfolded protein binding	g.chr2:73461511T>A	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.6+1T>A	2.37:g.73461511T>A			Somatic				C2orf7_uc002siy.2_5'Flank|CCT7_uc002sja.2_Missense_Mutation_p.M2K|CCT7_uc010yrf.1_5'UTR|CCT7_uc010feu.2_Missense_Mutation_p.M2K|CCT7_uc010yrg.1_5'UTR|CCT7_uc010yrh.1_5'UTR|CCT7_uc010yri.1_Missense_Mutation_p.M2K	p.M2K	NM_006429	NP_006420	WXS	Illumina HiSeq	Unspecified	Q99832	TCPH_HUMAN			1	107	+			2					A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	ENST00000258091.5	37	c.5T>A	CCDS46336.1	.	.	.	.	.	.	.	.	.	.	T	18.50	3.636702	0.67130	.	.	ENSG00000135624	ENST00000540468;ENST00000258091;ENST00000398422;ENST00000409081	T;T;T	0.77098	-1.07;0.36;-1.02	4.96	4.96	0.65561	.	0.325830	0.36972	N	0.002307	T	0.82116	0.4967	M	0.84846	2.72	0.80722	D	1	B;P;B;P	0.40578	0.039;0.722;0.001;0.594	P;B;B;B	0.45138	0.471;0.114;0.0;0.164	D	0.84435	0.0579	10	0.59425	D	0.04	-29.1072	11.2115	0.48802	0.0:0.0:0.0:1.0	.	2;2;2;2	B7Z4Z7;B8ZZC9;A8MWI8;Q99832	.;.;.;TCPH_HUMAN	K	2	ENSP00000442058:M2K;ENSP00000258091:M2K;ENSP00000381456:M2K	ENSP00000258091:M2K	M	+	2	0	CCT7	73315019	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.652000	0.54439	2.228000	0.72767	0.533000	0.62120	ATG		0.627	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		Missense_Mutation	12	21	0	0	0	0.000978	0	12	21				
LRRTM1	347730	broad.mit.edu	37	2	80530196	80530196	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:80530196C>A	ENST00000295057.3	-	2	1405	c.749G>T	c.(748-750)aGc>aTc	p.S250I	CTNNA2_ENST00000496558.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.S250I|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	250					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GTCCAGCGAGCTGACCACAAT	0.592										HNSCC(69;0.2)																													uc002sok.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(748-750)AGC>ATC		leucine rich repeat transmembrane neuronal 1							89.0	85.0	86.0					2																	80530196		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530196C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.749G>T	2.37:g.80530196C>A	ENSP00000295057:p.Ser250Ile	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.S250I	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	1019	-			250			LRR 7.|Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.749G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919544	0.33908	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.80653	-1.4;-1.4	5.26	4.26	0.50523	.	0.103731	0.64402	U	0.000006	T	0.60196	0.2250	N	0.14661	0.345	0.41272	D	0.986856	B	0.33000	0.393	B	0.34138	0.176	T	0.57087	-0.7871	9	.	.	.	.	3.4363	0.07446	0.0:0.6191:0.0:0.3809	.	250	Q86UE6	LRRT1_HUMAN	I	250	ENSP00000295057:S250I;ENSP00000386646:S250I	.	S	-	2	0	LRRTM1	80383707	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.778000	0.47726	2.416000	0.81992	0.655000	0.94253	AGC		0.592	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		12	58	1	0	0.000978159	0.000978	0.00114857	12	58				
GPR17	2840	broad.mit.edu	37	2	128409091	128409091	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:128409091A>T	ENST00000272644.3	+	3	940	c.866A>T	c.(865-867)cAc>cTc	p.H289L	LIMS2_ENST00000409455.1_Intron|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000544369.1_Missense_Mutation_p.H289L|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409254.1_5'Flank|LIMS2_ENST00000409808.2_Intron|GPR17_ENST00000393018.3_Missense_Mutation_p.H289L	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	289					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		TACGTGCTGCACTACCGCAGC	0.652																																							uc010yzn.1		NA																	0					0						c.(865-867)CAC>CTC		G protein-coupled receptor 17 isoform a							96.0	82.0	87.0					2																	128409091		2203	4300	6503	SO:0001583	missense	2840					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled	g.chr2:128409091A>T		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.866A>T	2.37:g.128409091A>T	ENSP00000272644:p.His289Leu		Somatic				LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.H289L|GPR17_uc010yzo.1_Missense_Mutation_p.H261L|GPR17_uc002tpd.2_Missense_Mutation_p.H261L	p.H289L	NM_001161415	NP_001154887	WXS	Illumina HiSeq	Unspecified	Q13304	GPR17_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0677)	4	1477	+	Colorectal(110;0.1)	Ovarian(717;0.15)	289			Extracellular (Potential).		A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	ENST00000272644.3	37	c.866A>T	CCDS2148.1	.	.	.	.	.	.	.	.	.	.	.	4.972	0.180570	0.09443	.	.	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000393018	T;T;T	0.71698	-0.59;-0.59;-0.59	5.2	-0.489	0.12052	GPCR, rhodopsin-like superfamily (1);	0.378221	0.30791	N	0.008861	T	0.36580	0.0972	N	0.03084	-0.415	0.22996	N	0.998451	B	0.02656	0.0	B	0.04013	0.001	T	0.16453	-1.0402	9	.	.	.	.	4.1402	0.10189	0.5247:0.0:0.2377:0.2376	.	289	Q13304	GPR17_HUMAN	L	289	ENSP00000442982:H289L;ENSP00000272644:H289L;ENSP00000376741:H289L	.	H	+	2	0	GPR17	128125561	0.436000	0.25586	0.306000	0.25113	0.903000	0.53119	0.924000	0.28777	0.005000	0.14708	0.459000	0.35465	CAC		0.652	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1			18	33	0	0	0	0.00499	0	18	33				
RAB6C	84084	broad.mit.edu	37	2	130738011	130738011	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:130738011T>C	ENST00000410061.2	+	1	777	c.323T>C	c.(322-324)aTt>aCt	p.I108T	AC079776.7_ENST00000412425.1_RNA	NM_032144.2	NP_115520.2	Q9H0N0	RAB6C_HUMAN	RAB6C, member RAS oncogene family	108	Required for centrosome localization.				cell cycle process (GO:0022402)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of centrosome duplication (GO:0010824)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	5	Colorectal(110;0.1)					ACAAAGTGGATTGATGATGTC	0.433																																							uc002tpx.1		NA																	0				lung(1)	1						c.(322-324)ATT>ACT		RAB6C, member RAS oncogene family							173.0	183.0	180.0					2																	130738011		2203	4298	6501	SO:0001583	missense	84084				protein transport|response to drug|small GTPase mediated signal transduction		GTP binding|GTPase activity	g.chr2:130738011T>C	AF124200	CCDS46408.1	2q21.1	2012-07-02			ENSG00000222014	ENSG00000222014		"""RAB, member RAS oncogene"""	16525	protein-coding gene	gene with protein product		612909				11054569, 17426708	Standard	NM_032144		Approved	WTH3	uc002tpx.1	Q9H0N0	OTTHUMG00000153487	ENST00000410061.2:c.323T>C	2.37:g.130738011T>C	ENSP00000387307:p.Ile108Thr		Somatic				uc002tpw.1_RNA	p.I108T	NM_032144	NP_115520	WXS	Illumina HiSeq	Unspecified	Q9H0N0	RAB6C_HUMAN			1	777	+	Colorectal(110;0.1)		108					Q53RU3|Q6FIF7|Q9P128	Missense_Mutation	SNP	ENST00000410061.2	37	c.323T>C	CCDS46408.1	.	.	.	.	.	.	.	.	.	.	.	10.66	1.413459	0.25465	.	.	ENSG00000222014	ENST00000410061	T	0.80214	-1.35	.	.	.	Small GTP-binding protein domain (1);	.	.	.	.	D	0.85504	0.5712	M	0.89715	3.055	0.45366	D	0.998355	P	0.45768	0.866	P	0.54100	0.742	T	0.80879	-0.1185	8	0.87932	D	0	-5.0623	3.8038	0.08768	0.0:0.3283:0.0:0.6717	.	108	Q9H0N0	RAB6C_HUMAN	T	108	ENSP00000387307:I108T	ENSP00000387307:I108T	I	+	2	0	RAB6C	130454481	1.000000	0.71417	0.102000	0.21198	0.373000	0.29922	3.586000	0.53950	-0.482000	0.06782	0.092000	0.15492	ATT		0.433	RAB6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331384.1	NM_032144		21	196	0	0	0	0.00632	0	21	196				
PKP4	8502	broad.mit.edu	37	2	159533379	159533379	+	Splice_Site	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:159533379G>T	ENST00000389759.3	+	20	3368	c.3256G>T	c.(3256-3258)Ggc>Tgc	p.G1086C	AC005042.4_ENST00000442666.1_RNA|PKP4_ENST00000389757.3_Intron|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	1086					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CCTGTACCCTGGTAAGACGCC	0.517										HNSCC(62;0.18)																													uc002tzv.2		NA																	0				ovary(5)|skin(2)	7						c.(3256-3258)GGC>TGC		plakophilin 4 isoform a							86.0	80.0	82.0					2																	159533379		2203	4300	6503	SO:0001630	splice_region_variant	8502				cell adhesion	desmosome	protein binding	g.chr2:159533379G>T	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.3256+1G>T	2.37:g.159533379G>T		HNSCC(62;0.18)	Somatic				PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Missense_Mutation_p.G743C|PKP4_uc002uaa.2_Intron|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.G267C|PKP4_uc002uad.2_RNA|PKP4_uc002uae.1_Missense_Mutation_p.G173C	p.G1086C	NM_003628	NP_003619	WXS	Illumina HiSeq	Unspecified	Q99569	PKP4_HUMAN			20	3516	+			1086					Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	c.3256G>T	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094165	0.94149	.	.	ENSG00000144283	ENST00000389759	T	0.75154	-0.91	6.08	6.08	0.98989	.	0.051541	0.85682	D	0.000000	D	0.85318	0.5669	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	D	0.84704	0.0730	10	0.66056	D	0.02	-12.2042	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1041;1086	Q4W5T8;Q99569	.;PKP4_HUMAN	C	1086	ENSP00000374409:G1086C	ENSP00000374409:G1086C	G	+	1	0	PKP4	159241625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.434000	0.97515	2.894000	0.99253	0.655000	0.94253	GGC		0.517	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		Missense_Mutation	30	42	1	0	3.69857e-22	0.008361	6.13998e-22	30	42				
XIRP2	129446	broad.mit.edu	37	2	168074801	168074801	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:168074801A>G	ENST00000409728.1	+	6	1037	c.948A>G	c.(946-948)agA>agG	p.R316R	XIRP2_ENST00000409756.2_Silent_p.R283R|XIRP2_ENST00000409195.1_Silent_p.R283R|XIRP2_ENST00000420519.1_Silent_p.R316R|XIRP2_ENST00000409043.1_Silent_p.R283R|XIRP2_ENST00000409273.1_Silent_p.R61R|XIRP2_ENST00000295237.9_Silent_p.R283R|XIRP2_ENST00000409605.1_Silent_p.R61R	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	108					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATCAGAACAGATCTGAGCAGG	0.408																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(847-849)AGA>AGG		xin actin-binding repeat containing 2 isoform 1							75.0	73.0	73.0					2																	168074801		1892	4127	6019	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168074801A>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.948A>G	2.37:g.168074801A>G			Somatic				XIRP2_uc010fpn.2_Silent_p.R316R|XIRP2_uc010fpo.2_Silent_p.R283R|XIRP2_uc010fpp.2_Silent_p.R283R|XIRP2_uc002udy.2_Silent_p.R108R|XIRP2_uc010fpq.2_Silent_p.R61R|XIRP2_uc010fpr.2_Silent_p.R61R	p.R283R	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			4	867	+			108					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409728.1	37	c.849A>G	CCDS56143.1																																																																																				0.408	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381		6	36	0	0	0	0.001168	0	6	36				
TTN	7273	broad.mit.edu	37	2	179578033	179578033	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:179578033A>G	ENST00000591111.1	-	91	26101	c.25877T>C	c.(25876-25878)gTt>gCt	p.V8626A	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.V7699A|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V8943A|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12784	Ig-like 69.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCATTACAACTGAGGAGCC	0.418																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(23095-23097)GTT>GCT		titin isoform N2-A							67.0	57.0	60.0					2																	179578033		1870	4105	5975	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179578033A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25877T>C	2.37:g.179578033A>G	ENSP00000465570:p.Val8626Ala		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V4360A	p.V7699A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		90	23320	-			8626					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.23096T>C		.	.	.	.	.	.	.	.	.	.	A	9.583	1.124179	0.20959	.	.	ENSG00000155657	ENST00000342992	T	0.45276	0.9	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.21307	0.0513	N	0.04820	-0.15	0.35568	D	0.805228	B	0.02656	0.0	B	0.04013	0.001	T	0.18587	-1.0332	9	0.87932	D	0	.	4.9967	0.14243	0.693:0.1664:0.1406:0.0	.	8626	Q8WZ42	TITIN_HUMAN	A	7699	ENSP00000343764:V7699A	ENSP00000343764:V7699A	V	-	2	0	TTN	179286278	0.062000	0.20869	0.420000	0.26596	0.684000	0.39900	1.298000	0.33412	2.371000	0.80710	0.533000	0.62120	GTT		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	11	0	0	0	0.000248	0	4	11				
OSGEPL1	64172	broad.mit.edu	37	2	190619958	190619958	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:190619958A>T	ENST00000264151.5	-	3	652	c.550T>A	c.(550-552)Tca>Aca	p.S184T	OSGEPL1_ENST00000522700.1_Missense_Mutation_p.S184T|OSGEPL1_ENST00000519810.1_Missense_Mutation_p.S184T|Y_RNA_ENST00000411317.1_RNA	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			AGAAAATCTGAAACTCCTTGA	0.348																																							uc002uqz.1		NA																	0					0						c.(550-552)TCA>ACA		O-sialoglycoprotein endopeptidase-like 1							80.0	77.0	78.0					2																	190619958		1844	4085	5929	SO:0001583	missense	64172				proteolysis|tRNA processing		metalloendopeptidase activity	g.chr2:190619958A>T	AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.550T>A	2.37:g.190619958A>T	ENSP00000264151:p.Ser184Thr		Somatic				OSGEPL1_uc002ura.1_RNA|OSGEPL1_uc010zfy.1_Missense_Mutation_p.S184T	p.S184T	NM_022353	NP_071748	WXS	Illumina HiSeq	Unspecified	Q9H4B0	OSGP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)		3	1084	-			184						Missense_Mutation	SNP	ENST00000264151.5	37	c.550T>A	CCDS46472.1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573866	0.65765	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700;ENST00000520350;ENST00000517895;ENST00000521630	T;T;T;D;D;T	0.99105	2.29;2.29;2.29;-5.43;-5.43;0.97	5.64	1.56	0.23342	Peptidase M22, glycoprotease (1);	0.352028	0.29660	N	0.011540	D	0.96562	0.8878	N	0.16833	0.445	0.34707	D	0.727316	B;P	0.49185	0.131;0.92	B;P	0.48454	0.063;0.578	D	0.96305	0.9224	10	0.87932	D	0	-7.8093	8.8904	0.35429	0.5141:0.3678:0.0:0.1181	.	184;184	B4DGY7;Q9H4B0	.;OSGP2_HUMAN	T	184;184;184;37;184;184	ENSP00000264151:S184T;ENSP00000428859:S184T;ENSP00000429697:S184T;ENSP00000430062:S37T;ENSP00000430879:S184T;ENSP00000429385:S184T	ENSP00000264151:S184T	S	-	1	0	OSGEPL1	190328203	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.021000	0.49651	0.452000	0.26830	0.455000	0.32223	TCA		0.348	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353		28	22	0	0	0	0.007291	0	28	22				
PTH2R	5746	broad.mit.edu	37	2	209309504	209309504	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:209309504A>G	ENST00000272847.2	+	7	958	c.745A>G	c.(745-747)Aca>Gca	p.T249A	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	249					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	CTTCCTGGCTACAAATTATTA	0.383																																							uc002vdb.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(745-747)ACA>GCA		parathyroid hormone 2 receptor precursor							328.0	329.0	329.0					2																	209309504		2203	4300	6503	SO:0001583	missense	5746					integral to plasma membrane	parathyroid hormone receptor activity	g.chr2:209309504A>G	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.745A>G	2.37:g.209309504A>G	ENSP00000272847:p.Thr249Ala		Somatic				PTH2R_uc010zjb.1_Missense_Mutation_p.T260A	p.T249A	NM_005048	NP_005039	WXS	Illumina HiSeq	Unspecified	P49190	PTH2R_HUMAN		Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	7	958	+			249			Helical; Name=3; (Potential).		Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	c.745A>G	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027571	0.75390	.	.	ENSG00000144407	ENST00000272847	T	0.33865	1.39	5.6	5.6	0.85130	GPCR, family 2-like (1);	0.000000	0.49305	D	0.000158	T	0.43433	0.1247	L	0.37507	1.11	0.58432	D	0.999999	D;D	0.71674	0.988;0.998	D;D	0.70935	0.951;0.971	T	0.30327	-0.9982	10	0.02654	T	1	.	13.7354	0.62815	1.0:0.0:0.0:0.0	.	138;249	B4DFN8;P49190	.;PTH2R_HUMAN	A	249	ENSP00000272847:T249A	ENSP00000272847:T249A	T	+	1	0	PTH2R	209017749	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.888000	0.92464	2.133000	0.65898	0.482000	0.46254	ACA		0.383	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048		9	120	0	0	0	0.006214	0	9	120				
ERBB4	2066	broad.mit.edu	37	2	212248356	212248356	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:212248356C>A	ENST00000342788.4	-	28	4221	c.3911G>T	c.(3910-3912)cGg>cTg	p.R1304L	ERBB4_ENST00000402597.1_Missense_Mutation_p.R1294L|ERBB4_ENST00000436443.1_Missense_Mutation_p.R1288L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1304					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CACAGTATTCCGGTGTCTGTA	0.532										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(3910-3912)CGG>CTG		v-erb-a erythroblastic leukemia viral oncogene							60.0	63.0	62.0					2																	212248356		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212248356C>A	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3911G>T	2.37:g.212248356C>A	ENSP00000342235:p.Arg1304Leu	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.R1288L|ERBB4_uc010zji.1_Missense_Mutation_p.R1294L|ERBB4_uc010zjj.1_Missense_Mutation_p.R1278L	p.R1304L	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	28	4009	-		Renal(323;0.06)|Lung NSC(271;0.197)	1304			Cytoplasmic (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.3911G>T	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.248844	0.80024	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;D;D	0.81579	-1.48;-1.51;-1.5	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000002	D	0.88897	0.6562	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;0.996;0.993	D;D;D;D	0.85130	0.992;0.997;0.992;0.982	D	0.89318	0.3638	10	0.87932	D	0	.	19.2448	0.93898	0.0:1.0:0.0:0.0	.	1278;1294;1288;1304	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	L	1304;1288;1294	ENSP00000342235:R1304L;ENSP00000403204:R1288L;ENSP00000385565:R1294L	ENSP00000342235:R1304L	R	-	2	0	ERBB4	211956601	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.320000	0.79064	2.777000	0.95525	0.557000	0.71058	CGG		0.532	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		12	42	1	0	7.93312e-07	0.00245	1.06938e-06	12	42				
SLC11A1	6556	broad.mit.edu	37	2	219249930	219249930	+	Missense_Mutation	SNP	C	C	T	rs370095260		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:219249930C>T	ENST00000233202.6	+	4	674	c.334C>T	c.(334-336)Cgt>Tgt	p.R112C	SLC11A1_ENST00000473367.1_3'UTR|SLC11A1_ENST00000539932.1_5'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	112					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTGGCTGCACGTCTGGGCGT	0.642																																							uc002vhv.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(334-336)CGT>TGT		natural resistance-associated macrophage protein		C	CYS/ARG	0,4406		0,0,2203	99.0	93.0	95.0		334	5.1	1.0	2		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC11A1	NM_000578.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	112/551	219249930	1,13005	2203	4300	6503	SO:0001583	missense	6556				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity	g.chr2:219249930C>T	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.334C>T	2.37:g.219249930C>T	ENSP00000233202:p.Arg112Cys		Somatic				SLC11A1_uc010zkb.1_Missense_Mutation_p.R112C|SLC11A1_uc010fvp.1_Missense_Mutation_p.R112C|SLC11A1_uc010fvq.1_Missense_Mutation_p.R45C|SLC11A1_uc010zkc.1_Missense_Mutation_p.R45C|SLC11A1_uc002vhu.1_Translation_Start_Site|SLC11A1_uc002vhw.2_Translation_Start_Site|SLC11A1_uc010fvr.2_5'Flank	p.R112C	NM_000578	NP_000569	WXS	Illumina HiSeq	Unspecified	P49279	NRAM1_HUMAN		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	674	+		Renal(207;0.0474)	112			Cytoplasmic (Potential).		C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	c.334C>T	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442644	0.83993	0.0	1.16E-4	ENSG00000018280	ENST00000233202	T	0.75704	-0.96	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	D	0.91164	0.7217	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.93923	0.7207	10	0.87932	D	0	-31.6531	18.2375	0.89954	0.0:1.0:0.0:0.0	.	112;112;112	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	C	112	ENSP00000233202:R112C	ENSP00000233202:R112C	R	+	1	0	SLC11A1	218958174	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	4.406000	0.59748	2.637000	0.89404	0.549000	0.68633	CGT		0.642	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		7	114	0	0	0	0.001984	0	7	114				
PTPRN	5798	broad.mit.edu	37	2	220162011	220162011	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:220162011A>G	ENST00000295718.2	-	14	2272	c.2032T>C	c.(2032-2034)Tgg>Cgg	p.W678R	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000423636.2_Missense_Mutation_p.W588R|PTPRN_ENST00000409251.3_Missense_Mutation_p.W649R	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	678					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TCCTCGCACCAGGACGGGGTG	0.657																																							uc002vkz.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(2032-2034)TGG>CGG		protein tyrosine phosphatase, receptor type, N							52.0	50.0	51.0					2																	220162011		2203	4300	6503	SO:0001583	missense	5798				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr2:220162011A>G		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2032T>C	2.37:g.220162011A>G	ENSP00000295718:p.Trp678Arg		Somatic				PTPRN_uc010zlc.1_Missense_Mutation_p.W588R|PTPRN_uc002vla.2_Missense_Mutation_p.W649R	p.W678R	NM_002846	NP_002837	WXS	Illumina HiSeq	Unspecified	Q16849	PTPRN_HUMAN		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)	14	2121	-		Renal(207;0.0474)	678			Cytoplasmic (Potential).		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	c.2032T>C	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.404828	0.62288	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.13307	2.6;2.6;2.6	4.22	4.22	0.49857	.	0.000000	0.64402	D	0.000001	T	0.39600	0.1084	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.41698	-0.9494	10	0.72032	D	0.01	.	13.1466	0.59465	1.0:0.0:0.0:0.0	.	649;678	Q6NSL1;Q16849	.;PTPRN_HUMAN	R	649;678;649;588	ENSP00000386638:W649R;ENSP00000295718:W678R;ENSP00000444244:W588R	ENSP00000295718:W678R	W	-	1	0	PTPRN	219870255	1.000000	0.71417	0.999000	0.59377	0.684000	0.39900	6.730000	0.74780	1.770000	0.52166	0.459000	0.35465	TGG		0.657	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			20	43	0	0	0	0.008871	0	20	43				
GPR35	2859	broad.mit.edu	37	2	241569575	241569575	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:241569575T>G	ENST00000319838.5	+	6	1148	c.206T>G	c.(205-207)cTg>cGg	p.L69R	GPR35_ENST00000403859.1_Missense_Mutation_p.L69R|GPR35_ENST00000407714.1_Missense_Mutation_p.L69R|GPR35_ENST00000438013.2_Missense_Mutation_p.L100R|GPR35_ENST00000430267.1_Missense_Mutation_p.L69R	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	69					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		GACCTCTGCCTGCTGTGCACC	0.632																																							uc002vzs.1		NA																	0				skin(2)|pancreas(1)	3						c.(205-207)CTG>CGG		G protein-coupled receptor 35							113.0	94.0	100.0					2																	241569575		2203	4300	6503	SO:0001583	missense	2859					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:241569575T>G		CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.206T>G	2.37:g.241569575T>G	ENSP00000322731:p.Leu69Arg		Somatic				GPR35_uc010fzh.1_Missense_Mutation_p.L100R|GPR35_uc010fzi.1_Missense_Mutation_p.L100R	p.L69R	NM_005301	NP_005292	WXS	Illumina HiSeq	Unspecified	Q9HC97	GPR35_HUMAN		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)	1	781	+		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)	69			Helical; Name=2; (Potential).		J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Missense_Mutation	SNP	ENST00000319838.5	37	c.206T>G	CCDS2541.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.480539	0.63849	.	.	ENSG00000178623	ENST00000319838;ENST00000403859;ENST00000438013;ENST00000407714;ENST00000430267	T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.085214	0.47455	D	0.000227	D	0.87156	0.6107	M	0.90309	3.105	0.42825	D	0.994003	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.89256	0.3594	10	0.72032	D	0.01	-15.3896	11.2109	0.48797	0.0:0.0:0.0:1.0	.	154;100;69	Q6ZMP9;A8K2J1;Q9HC97	.;.;GPR35_HUMAN	R	69;69;100;69;69	ENSP00000322731:L69R;ENSP00000385140:L69R;ENSP00000415890:L100R;ENSP00000384263:L69R;ENSP00000411788:L69R	ENSP00000322731:L69R	L	+	2	0	GPR35	241218248	0.008000	0.16893	0.970000	0.41538	0.486000	0.33341	0.852000	0.27764	1.824000	0.53156	0.379000	0.24179	CTG		0.632	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382		18	28	0	0	0	0.008871	0	18	28				
SIRPD	128646	broad.mit.edu	37	20	1532359	1532360	+	Missense_Mutation	DNP	CC	CC	AA	rs141059543		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:1532359_1532360CC>AA	ENST00000381623.3	-	2	1587_1588	c.398_399GG>TT	c.(397-399)cGG>cTT	p.R133L	SIRPD_ENST00000381621.1_Missense_Mutation_p.R133L			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	133	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CCTGAGTGCCCCGACCTGATTG	0.441																																							uc002wfi.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(397-399)CGG>CTT		signal-regulatory protein delta precursor																																				SO:0001583	missense	128646					extracellular region		g.chr20:1532359_1532360CC>AA	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.398_399delinsAA	20.37:g.1532359_1532360delinsAA	ENSP00000371036:p.Arg133Leu		Somatic					p.R133L	NM_178460	NP_848555	WXS	Illumina HiSeq	Unspecified	Q9H106	SIRPD_HUMAN			2	442_443	-			133			Ig-like V-type.		B3KS88|Q5TFQ6	Missense_Mutation	DNP	ENST00000381623.3	37	c.398_399GG>TT	CCDS13018.1																																																																																				0.441	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460		16	34	0	0	0	0.004672	0	16	34				
SIRPA	140885	broad.mit.edu	37	20	1895888	1895888	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:1895888G>T	ENST00000358771.4	+	2	375	c.223G>T	c.(223-225)Ggc>Tgc	p.G75C	SIRPA_ENST00000400068.3_Missense_Mutation_p.G75C|SIRPA_ENST00000356025.3_Missense_Mutation_p.G75C	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	75	Ig-like V-type.		G -> A (in dbSNP:rs1057114). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		AGCTGGACCAGGCCGGGAATT	0.537																																					GBM(155;1668 1920 5945 42733 48121)	GBM(155;1668 1920 5945 42733 48121)	uc002wfq.2		NA																	0				ovary(1)	1						c.(223-225)GGC>TGC		signal-regulatory protein alpha precursor							67.0	62.0	64.0					20																	1895888		2203	4297	6500	SO:0001583	missense	140885				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding	g.chr20:1895888G>T	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.223G>T	20.37:g.1895888G>T	ENSP00000351621:p.Gly75Cys		Somatic				SIRPA_uc010zps.1_Missense_Mutation_p.G55C|SIRPA_uc002wfr.2_Missense_Mutation_p.G75C|SIRPA_uc002wfs.2_Missense_Mutation_p.G75C|SIRPA_uc002wft.2_Missense_Mutation_p.G75C	p.G75C	NM_001040022	NP_001035111	WXS	Illumina HiSeq	Unspecified	P78324	SHPS1_HUMAN		Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)	3	583	+			75			Ig-like V-type.|Extracellular (Potential).		A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	c.223G>T	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	g	10.47	1.359770	0.24598	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.68331	-0.32;-0.32;-0.32	5.11	-1.43	0.08884	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.281220	0.04967	N	0.463081	T	0.77785	0.4182	M	0.85859	2.78	0.09310	N	1	B;D;B	0.59767	0.002;0.986;0.011	B;P;B	0.57101	0.133;0.813;0.092	T	0.63637	-0.6592	10	0.72032	D	0.01	.	5.7565	0.18176	0.4805:0.1495:0.37:0.0	.	55;75;75	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	C	75	ENSP00000382941:G75C;ENSP00000348307:G75C;ENSP00000351621:G75C	ENSP00000348307:G75C	G	+	1	0	SIRPA	1843888	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.014000	0.13333	-0.265000	0.09352	-0.946000	0.02672	GGC		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792		4	64	1	0	2.56e-06	0.000248	3.42349e-06	4	64				
SLC32A1	140679	broad.mit.edu	37	20	37356572	37356572	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:37356572C>A	ENST00000217420.1	+	2	1131	c.868C>A	c.(868-870)Cgc>Agc	p.R290S		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	290					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	ATCGCGGGCGCGCGACTGGGC	0.532																																							uc002xjc.2		NA																	0					0						c.(868-870)CGC>AGC		solute carrier family 32, member 1	Glycine(DB00145)						74.0	56.0	62.0					20																	37356572		2203	4300	6503	SO:0001583	missense	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37356572C>A	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.868C>A	20.37:g.37356572C>A	ENSP00000217420:p.Arg290Ser		Somatic					p.R290S	NM_080552	NP_542119	WXS	Illumina HiSeq	Unspecified	Q9H598	VIAAT_HUMAN			2	1131	+		Myeloproliferative disorder(115;0.00878)	290			Cytoplasmic (Potential).		Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	c.868C>A	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.705970	0.00719	.	.	ENSG00000101438	ENST00000217420	T	0.02369	4.32	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.01523	0.0049	N	0.02539	-0.55	0.80722	D	1	B	0.21688	0.059	B	0.32864	0.154	T	0.52335	-0.8589	10	0.07175	T	0.84	-15.1678	10.7672	0.46301	0.1899:0.8101:0.0:0.0	.	290	Q9H598	VIAAT_HUMAN	S	290	ENSP00000217420:R290S	ENSP00000217420:R290S	R	+	1	0	SLC32A1	36789986	0.992000	0.36948	0.998000	0.56505	0.047000	0.14425	3.060000	0.49955	2.358000	0.79984	0.462000	0.41574	CGC		0.532	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		19	34	1	0	2.35188e-11	0.006122	3.58635e-11	19	34				
SEMG2	6407	broad.mit.edu	37	20	43850431	43850431	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:43850431A>G	ENST00000372769.3	+	2	248	c.158A>G	c.(157-159)gAc>gGc	p.D53G		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	53					sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				GGACAAAAAGACCAACAACAT	0.388																																							uc010ggz.2		NA																	0				skin(1)	1						c.(157-159)GAC>GGC		semenogelin II precursor							122.0	117.0	119.0					20																	43850431		2203	4300	6503	SO:0001583	missense	6407				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43850431A>G		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.158A>G	20.37:g.43850431A>G	ENSP00000361855:p.Asp53Gly		Somatic				SEMG2_uc002xnk.2_Missense_Mutation_p.D53G|SEMG2_uc002xnl.2_Missense_Mutation_p.D53G	p.D53G	NM_003008	NP_002999	WXS	Illumina HiSeq	Unspecified	Q02383	SEMG2_HUMAN			2	215	+		Myeloproliferative disorder(115;0.0122)	53					Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	c.158A>G	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	2.609	-0.291214	0.05568	.	.	ENSG00000124157	ENST00000372769	T	0.09723	2.95	1.27	-0.371	0.12525	.	.	.	.	.	T	0.05868	0.0153	N	0.25380	0.74	0.09310	N	1	B;B;B	0.17465	0.001;0.022;0.022	B;B;B	0.18561	0.007;0.022;0.022	T	0.45702	-0.9243	9	0.14252	T	0.57	.	3.5523	0.07851	0.4162:0.0:0.5838:0.0	.	53;53;53	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	G	53	ENSP00000361855:D53G	ENSP00000361855:D53G	D	+	2	0	SEMG2	43283845	0.000000	0.05858	0.005000	0.12908	0.021000	0.10359	-0.340000	0.07821	-0.097000	0.12307	0.455000	0.32223	GAC		0.388	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008		16	37	0	0	0	0.003163	0	16	37				
CDH22	64405	broad.mit.edu	37	20	44806656	44806656	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:44806656G>T	ENST00000372262.3	-	10	2244	c.1844C>A	c.(1843-1845)gCc>gAc	p.A615D	CDH22_ENST00000537909.1_Missense_Mutation_p.A615D	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	615	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CATGACAAAGGCCGTGGTGTT	0.652																																							uc002xrm.2		NA																	0				ovary(4)|skin(1)	5						c.(1843-1845)GCC>GAC		cadherin 22 precursor							89.0	67.0	75.0					20																	44806656		2203	4300	6503	SO:0001583	missense	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44806656G>T	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1844C>A	20.37:g.44806656G>T	ENSP00000361336:p.Ala615Asp		Somatic				CDH22_uc010ghk.1_Missense_Mutation_p.A615D	p.A615D	NM_021248	NP_067071	WXS	Illumina HiSeq	Unspecified	Q9UJ99	CAD22_HUMAN			10	2245	-		Myeloproliferative disorder(115;0.0122)	615			Cadherin 5.|Extracellular (Potential).		B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	c.1844C>A	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962612	0.92791	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.34859	1.34;1.34	4.43	4.43	0.53597	Cadherin (1);	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	M	0.86343	2.81	0.58432	D	0.999999	D	0.60575	0.988	P	0.50934	0.654	T	0.64158	-0.6473	10	0.46703	T	0.11	.	15.7828	0.78275	0.0:0.0:1.0:0.0	.	615	Q9UJ99	CAD22_HUMAN	D	615	ENSP00000361336:A615D;ENSP00000437790:A615D	ENSP00000361336:A615D	A	-	2	0	CDH22	44240063	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	7.564000	0.82326	2.303000	0.77524	0.655000	0.94253	GCC		0.652	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		5	21	1	0	1.23904e-05	0.000602	1.57568e-05	5	21				
KCNG1	3755	broad.mit.edu	37	20	49621081	49621081	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:49621081C>T	ENST00000371571.4	-	3	1322	c.1037G>A	c.(1036-1038)cGg>cAg	p.R346Q	KCNG1_ENST00000506387.1_5'UTR|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	346					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GCGCAGCGCCCGCAGCACGCG	0.736																																							uc002xwa.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1036-1038)CGG>CAG		potassium voltage-gated channel, subfamily G,							10.0	15.0	13.0					20																	49621081		2149	4141	6290	SO:0001583	missense	3755					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:49621081C>T	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.1037G>A	20.37:g.49621081C>T	ENSP00000360626:p.Arg346Gln		Somatic					p.R346Q	NM_002237	NP_002228	WXS	Illumina HiSeq	Unspecified	Q9UIX4	KCNG1_HUMAN			3	1332	-			346			Helical; Voltage-sensor; Name=Segment S4; (Potential).		A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	c.1037G>A	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	C	35	5.467084	0.96257	.	.	ENSG00000026559	ENST00000371571	D	0.99220	-5.58	5.0	5.0	0.66597	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97805	1.0247	9	.	.	.	.	18.3323	0.90274	0.0:1.0:0.0:0.0	.	346	Q9UIX4	KCNG1_HUMAN	Q	346	ENSP00000360626:R346Q	.	R	-	2	0	KCNG1	49054488	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.688000	0.84153	2.326000	0.78906	0.306000	0.20318	CGG		0.736	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237		9	8	0	0	0	0.006214	0	9	8				
ATP9A	10079	broad.mit.edu	37	20	50329578	50329578	+	Silent	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:50329578C>A	ENST00000338821.5	-	4	627	c.363G>T	c.(361-363)gcG>gcT	p.A121A	ATP9A_ENST00000311637.5_Silent_p.A106A|ATP9A_ENST00000402822.1_Silent_p.A121A	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	121					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCTCCTCCACCGCCTCACGGA	0.627																																							uc002xwg.1		NA																	0				ovary(4)	4						c.(361-363)GCG>GCT		ATPase, class II, type 9A							97.0	67.0	77.0					20																	50329578		2203	4300	6503	SO:0001819	synonymous_variant	10079				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr20:50329578C>A	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.363G>T	20.37:g.50329578C>A			Somatic				ATP9A_uc010gih.1_Silent_p.A106A	p.A121A	NM_006045	NP_006036	WXS	Illumina HiSeq	Unspecified	O75110	ATP9A_HUMAN			4	363	-			121			Cytoplasmic (Potential).		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	c.363G>T	CCDS33489.1																																																																																				0.627	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		6	20	1	0	0.00116845	0.001168	0.00135315	6	20				
CDH26	60437	broad.mit.edu	37	20	58569452	58569452	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr20:58569452C>T	ENST00000244047.5	+	11	1885	c.1574C>T	c.(1573-1575)cCg>cTg	p.P525L	CDH26_ENST00000348616.4_Missense_Mutation_p.P525L|CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000350849.6_5'Flank			Q8IXH8	CAD26_HUMAN	cadherin 26	525					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCAGAGGATCCGGACCTGGAG	0.542																																							uc002ybe.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1573-1575)CCG>CTG		cadherin-like 26 isoform a							69.0	64.0	66.0					20																	58569452		2203	4300	6503	SO:0001583	missense	60437				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:58569452C>T	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1574C>T	20.37:g.58569452C>T	ENSP00000244047:p.Pro525Leu		Somatic				CDH26_uc002ybf.1_Missense_Mutation_p.P105L|CDH26_uc010zzy.1_RNA|CDH26_uc002ybg.2_Missense_Mutation_p.P39L|CDH26_uc002ybh.2_5'Flank|CDH26_uc002ybi.2_5'Flank	p.P525L	NM_177980	NP_817089	WXS	Illumina HiSeq	Unspecified	Q8IXH8	CAD26_HUMAN	BRCA - Breast invasive adenocarcinoma(7;5.58e-09)		11	1874	+	all_lung(29;0.00963)		525			Extracellular (Potential).		A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37	c.1574C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.13|12.13	1.844788|1.844788	0.32606|0.32606	.|.	.|.	ENSG00000124215|ENSG00000124215	ENST00000244047;ENST00000348616|ENST00000370991	T;T|.	0.60672|.	0.17;0.17|.	4.14|4.14	0.524|0.524	0.17066|0.17066	Cadherin-like (1);|.	1.768230|.	0.03113|.	N|.	0.162747|.	T|T	0.20170|0.20170	0.0485|0.0485	N|N	0.25890|0.25890	0.77|0.77	0.09310|0.09310	N|N	1|1	B;B|.	0.28820|.	0.03;0.224|.	B;B|.	0.25987|.	0.008;0.065|.	T|T	0.21449|0.21449	-1.0245|-1.0245	10|5	0.30854|.	T|.	0.27|.	.|.	0.7386|0.7386	0.00970|0.00970	0.3293:0.3321:0.1806:0.1581|0.3293:0.3321:0.1806:0.1581	.|.	525;525|.	Q8IXH8;Q8IXH8-4|.	CAD26_HUMAN;.|.	L|W	525|117	ENSP00000244047:P525L;ENSP00000339390:P525L|.	ENSP00000244047:P525L|.	P|R	+|+	2|1	0|2	CDH26|CDH26	58002847|58002847	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.404000|0.404000	0.30871|0.30871	-0.776000|-0.776000	0.04674|0.04674	0.233000|0.233000	0.21120|0.21120	-0.137000|-0.137000	0.14449|0.14449	CCG|CGG		0.542	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980		3	32	0	0	0	0.004672	0	3	32				
TIAM1	7074	broad.mit.edu	37	21	32493002	32493002	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr21:32493002T>C	ENST00000286827.3	-	29	4931	c.4460A>G	c.(4459-4461)cAg>cGg	p.Q1487R	TIAM1_ENST00000541036.1_Missense_Mutation_p.Q1427R	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1487					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AAGATCAAACTGCTCCTCTAC	0.547																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(4459-4461)CAG>CGG		T-cell lymphoma invasion and metastasis 1							105.0	89.0	94.0					21																	32493002		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32493002T>C		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4460A>G	21.37:g.32493002T>C	ENSP00000286827:p.Gln1487Arg		Somatic				TIAM1_uc011adk.1_3'UTR|TIAM1_uc011adl.1_Missense_Mutation_p.Q1427R	p.Q1487R	NM_003253	NP_003244	WXS	Illumina HiSeq	Unspecified	Q13009	TIAM1_HUMAN			29	4932	-			1487					B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.4460A>G	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.530647	0.85706	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.44482	0.92;0.96	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.60235	0.2253	L	0.58101	1.795	0.58432	D	0.999998	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.986	T	0.60865	-0.7178	10	0.46703	T	0.11	.	14.9878	0.71362	0.0:0.0:0.0:1.0	.	1427;1487	F5GZ53;Q13009	.;TIAM1_HUMAN	R	1487;1427	ENSP00000286827:Q1487R;ENSP00000441570:Q1427R	ENSP00000286827:Q1487R	Q	-	2	0	TIAM1	31414873	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.586000	0.82596	1.927000	0.55829	0.533000	0.62120	CAG		0.547	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		17	26	0	0	0	0.00499	0	17	26				
MX1	4599	broad.mit.edu	37	21	42807878	42807878	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr21:42807878G>A	ENST00000398600.2	+	8	1245	c.220G>A	c.(220-222)Gcc>Acc	p.A74T	MX1_ENST00000398598.3_Missense_Mutation_p.A74T|MX1_ENST00000288383.6_Missense_Mutation_p.A74T|MX1_ENST00000455164.2_Missense_Mutation_p.A74T	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	74	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GCCAGCCATCGCCGTCATCGG	0.612																																							uc002yzh.2		NA																	0				ovary(1)	1						c.(220-222)GCC>ACC		myxovirus resistance protein 1							80.0	79.0	80.0					21																	42807878		2203	4300	6503	SO:0001583	missense	4599				induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding	g.chr21:42807878G>A		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.220G>A	21.37:g.42807878G>A	ENSP00000381601:p.Ala74Thr		Somatic				MX1_uc002yzi.2_Missense_Mutation_p.A74T|MX1_uc010goq.2_Missense_Mutation_p.A74T	p.A74T	NM_001144925	NP_001138397	WXS	Illumina HiSeq	Unspecified	P20591	MX1_HUMAN			8	1167	+		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)	74					B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	c.220G>A	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	G	33	5.253541	0.95336	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000424365;ENST00000417963;ENST00000441677;ENST00000288383	D;D;D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.19;-4.19;-2.7	4.48	4.48	0.54585	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.98169	0.9395	M	0.75085	2.285	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98816	1.0745	10	0.62326	D	0.03	-22.5154	16.5923	0.84769	0.0:0.0:1.0:0.0	.	74	P20591	MX1_HUMAN	T	74	ENSP00000381601:A74T;ENSP00000381599:A74T;ENSP00000410523:A74T;ENSP00000400923:A74T;ENSP00000402215:A74T;ENSP00000288383:A74T	ENSP00000288383:A74T	A	+	1	0	MX1	41729748	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	6.629000	0.74267	2.445000	0.82738	0.561000	0.74099	GCC		0.612	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2			5	60	0	0	0	0.000602	0	5	60				
PRODH	5625	broad.mit.edu	37	22	18918540	18918540	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:18918540C>A	ENST00000357068.6	-	2	710	c.445G>T	c.(445-447)Gac>Tac	p.D149Y	PRODH_ENST00000334029.2_Missense_Mutation_p.D41Y|PRODH_ENST00000420436.1_Missense_Mutation_p.D41Y	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	149					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	GGGCTCAGGTCCTCCTCCACT	0.627																																							uc010grl.2		NA																	0				breast(1)	1						c.(445-447)GAC>TAC		proline dehydrogenase 1	L-Proline(DB00172)						71.0	70.0	70.0					22																	18918540		2203	4300	6503	SO:0001583	missense	5625				glutamate biosynthetic process|induction of apoptosis by oxidative stress|proline catabolic process	mitochondrial inner membrane|mitochondrial matrix	proline dehydrogenase activity	g.chr22:18918540C>A	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.445G>T	22.37:g.18918540C>A	ENSP00000349577:p.Asp149Tyr		Somatic				PRODH_uc002zoj.3_Missense_Mutation_p.D39Y|PRODH_uc002zol.3_Missense_Mutation_p.D39Y|PRODH_uc002zok.3_Missense_Mutation_p.D149Y	p.D149Y	NM_016335	NP_057419	WXS	Illumina HiSeq	Unspecified	O43272	PROD_HUMAN			2	459	-			149					A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	c.445G>T	CCDS13754.1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.099196	0.76983	.	.	ENSG00000100033	ENST00000357068	D	0.81739	-1.53	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	D	0.89853	0.6835	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.963;0.988	D	0.91533	0.5244	10	0.87932	D	0	-38.7704	14.3995	0.67034	0.0:1.0:0.0:0.0	.	65;149;41	O43272-1;O43272;E7EQL6	.;PROD_HUMAN;.	Y	149	ENSP00000349577:D149Y	ENSP00000334726:D41Y	D	-	1	0	PRODH	17298540	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.894000	0.75655	2.340000	0.79590	0.549000	0.68633	GAC		0.627	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2	NM_016335		20	45	1	0	1.9806e-07	0.002299	2.7355e-07	20	45				
ZNRF3	84133	broad.mit.edu	37	22	29445929	29445929	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:29445929G>T	ENST00000544604.2	+	8	1935	c.1760G>T	c.(1759-1761)cGc>cTc	p.R587L	ZNRF3_ENST00000402174.1_Missense_Mutation_p.R487L|ZNRF3_ENST00000406323.3_Missense_Mutation_p.R487L|ZNRF3_ENST00000332811.4_Missense_Mutation_p.R487L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	587					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						TCCACCTTCCGCAGCTCCCTC	0.667																																							uc003aeg.2		NA																	0				ovary(1)	1						c.(1459-1461)CGC>CTC		zinc and ring finger 3							49.0	58.0	55.0					22																	29445929		2098	4240	6338	SO:0001583	missense	84133					integral to membrane	zinc ion binding	g.chr22:29445929G>T	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1760G>T	22.37:g.29445929G>T	ENSP00000443824:p.Arg587Leu		Somatic				ZNRF3_uc003aeh.1_Missense_Mutation_p.R487L	p.R487L	NM_032173	NP_115549	WXS	Illumina HiSeq	Unspecified	Q9ULT6	ZNRF3_HUMAN			8	1625	+			587			Cytoplasmic (Potential).		B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	c.1460G>T	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716167	0.89205	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.87398	0.6167	M	0.65498	2.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.88085	0.2809	10	0.66056	D	0.02	1.5144	18.24	0.89965	0.0:0.0:1.0:0.0	.	587	Q9ULT6	ZNRF3_HUMAN	L	587;487;294;487;487	ENSP00000443824:R587L;ENSP00000328614:R487L;ENSP00000384456:R487L;ENSP00000384553:R487L	ENSP00000328614:R487L	R	+	2	0	ZNRF3	27775929	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.534000	0.82004	2.546000	0.85860	0.655000	0.94253	CGC		0.667	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972		24	92	1	0	2.21704e-12	0.00278	3.42725e-12	24	92				
APOL5	80831	broad.mit.edu	37	22	36122751	36122751	+	Silent	SNP	T	T	C	rs201680926		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:36122751T>C	ENST00000249044.2	+	3	636	c.636T>C	c.(634-636)caT>caC	p.H212H		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	212					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						CAACATCACATGAGGCTTTCG	0.448																																							uc003aof.2		NA																	0					0						c.(634-636)CAT>CAC		apolipoprotein L5							127.0	139.0	135.0					22																	36122751		2203	4300	6503	SO:0001819	synonymous_variant	80831				lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding	g.chr22:36122751T>C	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.636T>C	22.37:g.36122751T>C			Somatic					p.H212H	NM_030642	NP_085145	WXS	Illumina HiSeq	Unspecified	Q9BWW9	APOL5_HUMAN			3	636	+			212					Q5TFL9|Q9UGW5	Silent	SNP	ENST00000249044.2	37	c.636T>C	CCDS13920.1																																																																																				0.448	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	NM_030642		39	116	0	0	0	0.005524	0	39	116				
EIF3D	8664	broad.mit.edu	37	22	36912753	36912753	+	Splice_Site	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:36912753G>A	ENST00000216190.8	-	11	1445	c.1075C>T	c.(1075-1077)Cgt>Tgt	p.R359C	EIF3D_ENST00000541106.1_Splice_Site_p.R310C|EIF3D_ENST00000405442.1_Splice_Site_p.R359C	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						GTGACCTACCGGTACGCAACA	0.502																																							uc003apq.2		NA																	0				pancreas(1)	1						c.(1075-1077)CGT>TGT		eukaryotic translation initiation factor 3							210.0	190.0	196.0					22																	36912753		2203	4300	6503	SO:0001630	splice_region_variant	8664					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr22:36912753G>A	U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1076+1C>T	22.37:g.36912753G>A			Somatic				EIF3D_uc011amr.1_Missense_Mutation_p.R186C|EIF3D_uc003apr.2_Missense_Mutation_p.R359C|EIF3D_uc011ams.1_Missense_Mutation_p.R262C|EIF3D_uc011amt.1_Missense_Mutation_p.R310C	p.R359C	NM_003753	NP_003744	WXS	Illumina HiSeq	Unspecified	O15371	EIF3D_HUMAN			11	1191	-			359						Missense_Mutation	SNP	ENST00000216190.8	37	c.1075C>T	CCDS13930.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379546	0.61845	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000426531;ENST00000458572	.	.	.	5.65	5.65	0.86999	.	0.041338	0.85682	D	0.000000	D	0.84347	0.5452	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87033	0.2136	9	0.87932	D	0	-8.4234	13.6956	0.62578	0.0:0.0:0.7425:0.2575	.	310;359	B4DVY1;O15371	.;EIF3D_HUMAN	C	359;344;310;359;12;46	.	ENSP00000216190:R359C	R	-	1	0	EIF3D	35242699	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	4.427000	0.59888	2.675000	0.91044	0.555000	0.69702	CGT		0.502	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1		Missense_Mutation	8	132	0	0	0	0.00308	0	8	132				
SCUBE1	80274	broad.mit.edu	37	22	43614412	43614412	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:43614412G>T	ENST00000360835.4	-	15	1866	c.1740C>A	c.(1738-1740)gcC>gcA	p.A580A		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	580					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TCTTGATGGCGGCCTGCAGGC	0.612																																							uc003bdt.1		NA																	0				central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5						c.(1738-1740)GCC>GCA		signal peptide, CUB domain, EGF-like 1							89.0	94.0	92.0					22																	43614412		2203	4300	6503	SO:0001819	synonymous_variant	80274				adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity	g.chr22:43614412G>T		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1740C>A	22.37:g.43614412G>T			Somatic					p.A580A	NM_173050	NP_766638	WXS	Illumina HiSeq	Unspecified	Q8IWY4	SCUB1_HUMAN			15	1828	-		all_neural(38;0.0414)|Ovarian(80;0.07)	580					Q5R336	Silent	SNP	ENST00000360835.4	37	c.1740C>A	CCDS14048.1																																																																																				0.612	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050		63	74	1	0	6.8682e-38	0.00361	1.19927e-37	63	74				
SCUBE1	80274	broad.mit.edu	37	22	43616542	43616542	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:43616542C>A	ENST00000360835.4	-	14	1727	c.1601G>T	c.(1600-1602)aGg>aTg	p.R534M		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	534					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				GCCACGGCGCCTCTTCTTGGA	0.582																																							uc003bdt.1		NA																	0				central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5						c.(1600-1602)AGG>ATG		signal peptide, CUB domain, EGF-like 1							130.0	107.0	115.0					22																	43616542		2202	4300	6502	SO:0001583	missense	80274				adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity	g.chr22:43616542C>A		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1601G>T	22.37:g.43616542C>A	ENSP00000354080:p.Arg534Met		Somatic					p.R534M	NM_173050	NP_766638	WXS	Illumina HiSeq	Unspecified	Q8IWY4	SCUB1_HUMAN			14	1689	-		all_neural(38;0.0414)|Ovarian(80;0.07)	534					Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	c.1601G>T	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.693770	0.68386	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.85702	-2.02	4.87	2.57	0.30868	.	0.156843	0.56097	D	0.000032	T	0.82250	0.4996	L	0.60455	1.87	0.80722	D	1	P	0.40250	0.709	P	0.45913	0.497	T	0.78945	-0.2004	10	0.45353	T	0.12	.	4.4283	0.11515	0.0:0.5068:0.0:0.4932	.	534	Q8IWY4	SCUB1_HUMAN	M	534;164	ENSP00000354080:R534M	ENSP00000354080:R534M	R	-	2	0	SCUBE1	41946486	0.579000	0.26725	1.000000	0.80357	0.988000	0.76386	0.754000	0.26390	1.175000	0.42826	-0.345000	0.07892	AGG		0.582	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050		12	58	1	0	0.00010058	0.001368	0.000121926	12	58				
SHANK3	85358	broad.mit.edu	37	22	51160827	51160827	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:51160827G>T	ENST00000414786.2	+	21	4751	c.4524G>T	c.(4522-4524)ctG>ctT	p.L1508L	SHANK3_ENST00000262795.3_Silent_p.L1538L|SHANK3_ENST00000445220.2_Silent_p.L1524L			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1522					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TGGGCAGCCTGCTGGACCCTG	0.642																																							uc003bne.1		NA																	0				central_nervous_system(1)	1						c.(4612-4614)CTG>CTT		SH3 and multiple ankyrin repeat domains 3							21.0	25.0	23.0					22																	51160827		1912	3780	5692	SO:0001819	synonymous_variant	85358							g.chr22:51160827G>T	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4524G>T	22.37:g.51160827G>T			Somatic				SHANK3_uc003bnf.1_Silent_p.L985L|SHANK3_uc010hbg.1_Silent_p.L720L	p.L1538L	NM_001080420	NP_001073889	WXS	Illumina HiSeq	Unspecified	F2Z3L0	F2Z3L0_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.22)	22	4614	+		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)	1538					D7UT47|Q8TET3	Silent	SNP	ENST00000414786.2	37	c.4614G>T																																																																																					0.642	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420		12	24	1	0	3.07112e-06	0.000978	4.07467e-06	12	24				
IL17RC	84818	broad.mit.edu	37	3	9975223	9975223	+	Silent	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:9975223G>T	ENST00000295981.3	+	19	2540	c.2322G>T	c.(2320-2322)gcG>gcT	p.A774A	RP11-1020A11.1_ENST00000602411.1_RNA|IL17RC_ENST00000413608.1_Silent_p.A690A|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000416074.2_Silent_p.A529A|CRELD1_ENST00000383811.3_5'Flank|IL17RC_ENST00000403601.3_Silent_p.A703A|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000455057.1_Silent_p.A671A|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000383812.4_Silent_p.A688A|CRELD1_ENST00000397170.3_5'Flank	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	774					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGACTCCCGCGCCGGGACGCG	0.687																																							uc003bua.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2320-2322)GCG>GCT		interleukin 17 receptor C isoform 1 precursor							6.0	8.0	8.0					3																	9975223		1771	3893	5664	SO:0001819	synonymous_variant	84818					integral to membrane|plasma membrane	receptor activity	g.chr3:9975223G>T	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.2322G>T	3.37:g.9975223G>T			Somatic				CIDEC_uc003bto.2_Intron|IL17RC_uc003btz.2_Silent_p.A703A|IL17RC_uc011atp.1_Silent_p.A529A|IL17RC_uc003bud.2_Silent_p.A244A|IL17RC_uc003bub.2_Silent_p.A688A|IL17RC_uc010hct.2_Silent_p.A690A|IL17RC_uc010hcu.2_Silent_p.A673A|IL17RC_uc010hcv.2_Silent_p.A671A|IL17RC_uc011atq.1_3'UTR|IL17RC_uc003buc.2_Silent_p.A231A|IL17RC_uc003bue.2_Silent_p.A326A|CRELD1_uc003buf.2_5'Flank|CRELD1_uc003bug.2_5'Flank|CRELD1_uc003buh.2_5'Flank|CRELD1_uc003bui.2_5'Flank|CRELD1_uc003buj.2_5'Flank	p.A774A	NM_153461	NP_703191	WXS	Illumina HiSeq	Unspecified	Q8NAC3	I17RC_HUMAN			19	2558	+			774			Cytoplasmic (Potential).		E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	ENST00000295981.3	37	c.2322G>T	CCDS2590.1																																																																																				0.687	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732		7	8	1	0	0.00198382	0.001984	0.00226626	7	8				
CAND2	23066	broad.mit.edu	37	3	12856747	12856747	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:12856747G>C	ENST00000456430.2	+	8	1155	c.1114G>C	c.(1114-1116)Gat>Cat	p.D372H	CAND2_ENST00000295989.5_Missense_Mutation_p.D279H	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	372					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCTGCTGCCCGATTTCCACTG	0.602																																					GBM(43;676 868 1633 6395 37496)	GBM(43;676 868 1633 6395 37496)	uc003bxk.2		NA																	0				skin(3)|pancreas(1)	4						c.(1114-1116)GAT>CAT		TBP-interacting protein isoform 1							50.0	57.0	54.0					3																	12856747		2147	4248	6395	SO:0001583	missense	23066				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr3:12856747G>C		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1114G>C	3.37:g.12856747G>C	ENSP00000387641:p.Asp372His		Somatic				CAND2_uc003bxj.2_Missense_Mutation_p.D279H	p.D372H	NM_001162499	NP_001155971	WXS	Illumina HiSeq	Unspecified	O75155	CAND2_HUMAN			8	1163	+			372			HEAT 9.		B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	c.1114G>C	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887204	0.33348	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.65916	-0.18;-0.18	4.86	2.07	0.26955	Armadillo-like helical (1);Armadillo-type fold (1);	0.387043	0.25916	N	0.027478	T	0.63367	0.2505	L	0.59436	1.845	0.80722	D	1	B;B	0.33807	0.013;0.426	B;P	0.45138	0.018;0.471	T	0.59043	-0.7528	10	0.49607	T	0.09	-2.9234	8.7644	0.34694	0.257:0.0:0.743:0.0	.	372;279	O75155;O75155-2	CAND2_HUMAN;.	H	279;372	ENSP00000295989:D279H;ENSP00000387641:D372H	ENSP00000295989:D279H	D	+	1	0	CAND2	12831747	1.000000	0.71417	0.008000	0.14137	0.048000	0.14542	3.466000	0.53071	0.121000	0.18284	-0.215000	0.12644	GAT		0.602	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617		6	53	0	0	0	0.001168	0	6	53				
SCN11A	11280	broad.mit.edu	37	3	38938351	38938351	+	Silent	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:38938351C>A	ENST00000302328.3	-	14	2586	c.2388G>T	c.(2386-2388)gtG>gtT	p.V796V	SCN11A_ENST00000444237.2_Silent_p.V796V|SCN11A_ENST00000456224.3_Silent_p.V796V|SCN11A_ENST00000450244.1_Silent_p.V796V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	796					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTTTTCCTATCACCGTGATCA	0.353																																							uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(2386-2388)GTG>GTT		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						90.0	90.0	90.0					3																	38938351		2203	4300	6503	SO:0001819	synonymous_variant	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38938351C>A	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2388G>T	3.37:g.38938351C>A			Somatic				SCN11A_uc010hhn.1_5'Flank	p.V796V	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	14	2587	-			796			II.|Helical; Name=S6 of repeat II; (By similarity).		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	c.2388G>T	CCDS33737.1																																																																																				0.353	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		12	15	1	0	0.00136819	0.001368	0.00157905	12	15				
ROBO2	6092	broad.mit.edu	37	3	77607285	77607285	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:77607285G>T	ENST00000461745.1	+	9	2322	c.1422G>T	c.(1420-1422)caG>caT	p.Q474H	ROBO2_ENST00000487694.3_Missense_Mutation_p.Q490H|ROBO2_ENST00000332191.8_Missense_Mutation_p.Q474H	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	474	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCACACTGCAGATTAAGAATT	0.378																																							uc003dpy.3		NA																	0				lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(1420-1422)CAG>CAT		roundabout, axon guidance receptor, homolog 2							82.0	80.0	81.0					3																	77607285		1880	4114	5994	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77607285G>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1422G>T	3.37:g.77607285G>T	ENSP00000417164:p.Gln474His		Somatic				ROBO2_uc003dpz.2_Missense_Mutation_p.Q478H|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.Q478H	p.Q474H	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	9	2065	+			474			Ig-like C2-type 5.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.1422G>T	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355097	0.41700	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.27557	1.66;1.66;1.66	5.68	4.81	0.61882	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43747	D	0.000529	T	0.32041	0.0816	N	0.11064	0.09	0.39177	D	0.962700	B;D;B	0.76494	0.385;0.999;0.385	P;D;B	0.73708	0.516;0.981;0.275	T	0.44528	-0.9322	9	0.31617	T	0.26	.	10.4003	0.44225	0.1503:0.0:0.8497:0.0	.	490;474;474	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	H	490;490;494;474;474;195	ENSP00000417335:Q490H;ENSP00000417164:Q474H;ENSP00000327536:Q474H	ENSP00000327536:Q474H	Q	+	3	2	ROBO2	77689975	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	1.639000	0.37176	1.550000	0.49438	0.585000	0.79938	CAG		0.378	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		7	37	1	0	5.18039e-06	0.00308	6.84624e-06	7	37				
GPR156	165829	broad.mit.edu	37	3	119886746	119886746	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:119886746C>A	ENST00000464295.1	-	10	2023	c.1578G>T	c.(1576-1578)agG>agT	p.R526S	GPR156_ENST00000461057.1_Missense_Mutation_p.R522S|GPR156_ENST00000315843.3_Missense_Mutation_p.R526S			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	526						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TCTCCAGATGCCTCTGTCTCT	0.577																																							uc011bjf.1		NA																	0				ovary(1)|skin(1)	2						c.(1576-1578)AGG>AGT		G protein-coupled receptor 156							100.0	116.0	110.0					3																	119886746		2203	4300	6503	SO:0001583	missense	165829					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr3:119886746C>A	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.1578G>T	3.37:g.119886746C>A	ENSP00000417261:p.Arg526Ser		Somatic				GPR156_uc011bjg.1_Missense_Mutation_p.R522S	p.R526S	NM_153002	NP_694547	WXS	Illumina HiSeq	Unspecified	Q8NFN8	GP156_HUMAN		GBM - Glioblastoma multiforme(114;0.19)	9	1578	-			526			Cytoplasmic (Potential).		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	c.1578G>T	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	C	7.779	0.709068	0.15239	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.23950	1.88;1.88;1.88	5.28	2.56	0.30785	.	0.838163	0.10987	N	0.612081	T	0.16214	0.0390	N	0.19112	0.55	0.23180	N	0.998165	B;B	0.17038	0.02;0.02	B;B	0.16722	0.016;0.016	T	0.32322	-0.9911	9	.	.	.	-3.5205	9.7111	0.40245	0.0:0.7848:0.0:0.2152	.	522;526	E9PFZ4;Q8NFN8	.;GP156_HUMAN	S	526;526;522	ENSP00000417261:R526S;ENSP00000324553:R526S;ENSP00000418758:R522S	.	R	-	3	2	GPR156	121369436	0.006000	0.16342	0.359000	0.25824	0.806000	0.45545	-0.115000	0.10741	0.398000	0.25338	0.563000	0.77884	AGG		0.577	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002		55	110	1	0	5.47352e-35	0.00361	9.50813e-35	55	110				
CHCHD6	84303	broad.mit.edu	37	3	126423156	126423156	+	Start_Codon_SNP	SNP	A	A	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:126423156A>C	ENST00000290913.3	+	1	94	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	CHCHD6_ENST00000508789.1_Start_Codon_SNP_p.M1L	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	1					cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						GCATCTCGCCATGGGGAGCAC	0.731																																							uc003ejf.1		NA																	0					0						c.(1-3)ATG>CTG		coiled-coil-helix-coiled-coil-helix domain							13.0	15.0	14.0					3																	126423156		2190	4281	6471	SO:0001582	initiator_codon_variant	84303							g.chr3:126423156A>C	BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.1A>C	3.37:g.126423156A>C	ENSP00000290913:p.Met1Leu		Somatic				CHCHD6_uc010hsj.1_Missense_Mutation_p.M1L	p.M1L	NM_032343	NP_115719	WXS	Illumina HiSeq	Unspecified	Q9BRQ6	CHCH6_HUMAN			1	39	+			1					D6R9U0|D6RIB4|H8Y0Y7	Missense_Mutation	SNP	ENST00000290913.3	37	c.1A>C	CCDS3041.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181223	0.57800	.	.	ENSG00000159685	ENST00000290913;ENST00000508789	T;T	0.54866	0.65;0.55	3.88	3.88	0.44766	.	0.089663	0.85682	D	0.000000	T	0.69160	0.3080	.	.	.	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.80764	0.97;0.994	T	0.72600	-0.4244	9	0.87932	D	0	-29.2549	9.3604	0.38192	1.0:0.0:0.0:0.0	.	1;1	D6R9U0;Q9BRQ6	.;CHCH6_HUMAN	L	1	ENSP00000290913:M1L;ENSP00000422912:M1L	ENSP00000290913:M1L	M	+	1	0	CHCHD6	127905846	0.997000	0.39634	1.000000	0.80357	0.029000	0.11900	2.217000	0.42880	1.985000	0.57927	0.482000	0.46254	ATG		0.731	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356432.1	NM_032343	Missense_Mutation	4	12	0	0	0	0.000248	0	4	12				
ABTB1	80325	broad.mit.edu	37	3	127395174	127395174	+	Missense_Mutation	SNP	G	G	A	rs375653991		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:127395174G>A	ENST00000232744.8	+	5	466	c.380G>A	c.(379-381)cGg>cAg	p.R127Q	ABTB1_ENST00000453791.2_5'UTR|ABTB1_ENST00000393363.3_5'UTR|ABTB1_ENST00000468137.1_5'UTR					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						AAGCCATTCCGGGTGCATCGC	0.582																																							uc003ejt.2		NA																	0					0						c.(379-381)CGG>CAG		ankyrin repeat and BTB (POZ) domain containing 1			,GLN/ARG	0,4406		0,0,2203	167.0	144.0	152.0		,380	3.5	0.8	3		152	2,8598	2.2+/-6.3	0,2,4298	no	utr-5,missense	ABTB1	NM_032548.3,NM_172027.2	,43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,benign	,127/479	127395174	2,13004	2203	4300	6503	SO:0001583	missense	80325					cytoplasm|nucleolus|plasma membrane	translation elongation factor activity	g.chr3:127395174G>A	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.380G>A	3.37:g.127395174G>A	ENSP00000232744:p.Arg127Gln		Somatic				ABTB1_uc003ejr.2_5'UTR|ABTB1_uc003ejs.2_Missense_Mutation_p.R102Q|ABTB1_uc003eju.2_5'UTR|ABTB1_uc010hsm.2_5'Flank	p.R127Q	NM_172027	NP_742024	WXS	Illumina HiSeq	Unspecified	Q969K4	ABTB1_HUMAN			5	468	+			127			BTB 1.			Missense_Mutation	SNP	ENST00000232744.8	37	c.380G>A	CCDS3045.1	.	.	.	.	.	.	.	.	.	.	g	4.813	0.151164	0.09185	0.0	2.33E-4	ENSG00000114626	ENST00000232744	T	0.68624	-0.34	4.41	3.53	0.40419	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.764829	0.12884	N	0.431183	T	0.55768	0.1941	L	0.48877	1.53	0.80722	D	1	B;B	0.22800	0.051;0.075	B;B	0.13407	0.008;0.009	T	0.43734	-0.9373	10	0.20046	T	0.44	-17.6626	9.145	0.36928	0.1687:0.0:0.8313:0.0	.	127;102	Q969K4;Q969K4-3	ABTB1_HUMAN;.	Q	127	ENSP00000232744:R127Q	ENSP00000232744:R127Q	R	+	2	0	ABTB1	128877864	0.998000	0.40836	0.770000	0.31555	0.007000	0.05969	1.598000	0.36740	0.967000	0.38186	0.457000	0.33378	CGG		0.582	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027		23	91	0	0	0	0.00333	0	23	91				
SI	6476	broad.mit.edu	37	3	164732923	164732923	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:164732923A>G	ENST00000264382.3	-	33	4049	c.3987T>C	c.(3985-3987)atT>atC	p.I1329I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1329	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTGCCCAACAAATGTCATTGG	0.318										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(3985-3987)ATT>ATC		sucrase-isomaltase	Acarbose(DB00284)						92.0	86.0	88.0					3																	164732923		2203	4300	6503	SO:0001819	synonymous_variant	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164732923A>G	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3987T>C	3.37:g.164732923A>G		HNSCC(35;0.089)	Somatic					p.I1329I	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			33	4049	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1329			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	c.3987T>C	CCDS3196.1																																																																																				0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		12	16	0	0	0	0.00245	0	12	16				
BCL6	604	broad.mit.edu	37	3	187449674	187449674	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:187449674A>G	ENST00000406870.2	-	4	572	c.206T>C	c.(205-207)cTt>cCt	p.L69P	RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.L69P|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.L69P	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	69	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GATCACACTAAGGTTGCATTT	0.438			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																		uc003frp.3		NA		Dom	yes		3	3q27	604	T|Mis	B-cell CLL/lymphoma 6			L	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3		NHL|CLL		0				ovary(2)|lung(2)|central_nervous_system(1)	5						c.(205-207)CTT>CCT		B-cell lymphoma 6 protein isoform 1							98.0	79.0	85.0					3																	187449674		2203	4300	6503	SO:0001583	missense	604				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:187449674A>G		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.206T>C	3.37:g.187449674A>G	ENSP00000384371:p.Leu69Pro		Somatic				BCL6_uc011bsf.1_Missense_Mutation_p.L69P|BCL6_uc010hza.2_Intron|BCL6_uc003frq.1_Missense_Mutation_p.L69P	p.L69P	NM_001130845	NP_001124317	WXS	Illumina HiSeq	Unspecified	P41182	BCL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)	4	663	-	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		69			BTB.		A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	c.206T>C	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949265	0.73787	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123;ENST00000430339;ENST00000438077	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.65	5.65	0.86999	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.062472	0.64402	D	0.000004	T	0.72669	0.3489	L	0.43152	1.355	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.65987	0.913;0.94	T	0.75167	-0.3413	10	0.87932	D	0	.	9.8065	0.40797	0.9235:0.0:0.0765:0.0	.	69;69	B8PSA7;P41182	.;BCL6_HUMAN	P	69	ENSP00000384371:L69P;ENSP00000232014:L69P;ENSP00000413122:L69P;ENSP00000415574:L69P;ENSP00000414455:L69P	ENSP00000232014:L69P	L	-	2	0	BCL6	188932368	1.000000	0.71417	0.937000	0.37676	0.994000	0.84299	7.218000	0.77991	2.288000	0.76882	0.482000	0.46254	CTT		0.438	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931		3	24	0	0	0	0.004672	0	3	24				
ATP13A5	344905	broad.mit.edu	37	3	193082037	193082037	+	Silent	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:193082037C>G	ENST00000342358.4	-	2	213	c.96G>C	c.(94-96)cgG>cgC	p.R32R		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	32						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AGAAGGCTTTCCGTACATTGT	0.463																																							uc011bsq.1		NA																	0				ovary(5)|skin(4)|large_intestine(2)	11						c.(94-96)CGG>CGC		ATPase type 13A5							154.0	158.0	157.0					3																	193082037		2203	4300	6503	SO:0001819	synonymous_variant	344905				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193082037C>G	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.96G>C	3.37:g.193082037C>G			Somatic					p.R32R	NM_198505	NP_940907	WXS	Illumina HiSeq	Unspecified	Q4VNC0	AT135_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)	2	96	-	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		32					Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	c.96G>C	CCDS33914.1																																																																																				0.463	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505		28	113	0	0	0	0.008361	0	28	113				
SLC2A9	56606	broad.mit.edu	37	4	9982247	9982247	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:9982247T>A	ENST00000264784.3	-	5	703	c.650A>T	c.(649-651)cAg>cTg	p.Q217L	SLC2A9_ENST00000506583.1_Missense_Mutation_p.Q188L|SLC2A9_ENST00000309065.3_Missense_Mutation_p.Q188L	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	217					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	GCCCAGAAGCTGCCCAGTGAA	0.567																																							uc003gmc.2		NA																	0				ovary(3)	3						c.(649-651)CAG>CTG		solute carrier family 2, member 9 protein							64.0	58.0	60.0					4																	9982247		2203	4300	6503	SO:0001583	missense	56606				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity	g.chr4:9982247T>A	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.650A>T	4.37:g.9982247T>A	ENSP00000264784:p.Gln217Leu		Somatic				SLC2A9_uc003gmd.2_Missense_Mutation_p.Q188L	p.Q217L	NM_020041	NP_064425	WXS	Illumina HiSeq	Unspecified	Q9NRM0	GTR9_HUMAN			5	711	-			217			Helical; Name=5; (Potential).		Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	ENST00000264784.3	37	c.650A>T	CCDS3407.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133494	0.77662	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065;ENST00000513129	T;T;T;T	0.80214	0.39;-0.88;0.39;-1.35	4.77	3.58	0.41010	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.065991	0.64402	D	0.000008	D	0.89107	0.6621	M	0.86573	2.825	0.43160	D	0.99494	D;D	0.89917	0.999;1.0	D;D	0.81914	0.979;0.995	D	0.88392	0.3009	9	.	.	.	.	9.1571	0.36998	0.1631:0.0:0.0:0.8369	.	188;217	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	L	188;217;188;188	ENSP00000422209:Q188L;ENSP00000264784:Q217L;ENSP00000311383:Q188L;ENSP00000426800:Q188L	.	Q	-	2	0	SLC2A9	9591345	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	5.649000	0.67936	0.673000	0.31224	-0.265000	0.10407	CAG		0.567	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1			21	28	0	0	0	0.002299	0	21	28				
RFC1	5981	broad.mit.edu	37	4	39291518	39291518	+	Nonsense_Mutation	SNP	G	G	A	rs377688011		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:39291518G>A	ENST00000381897.1	-	24	3446	c.3313C>T	c.(3313-3315)Caa>Taa	p.Q1105*	RFC1_ENST00000349703.2_Nonsense_Mutation_p.Q1104*	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	1105					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						TCATCAGATTGAGAGTCATCT	0.398																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	uc003gty.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(3313-3315)CAA>TAA		replication factor C large subunit		G	stop/GLN,stop/GLN	0,4406		0,0,2203	225.0	222.0	223.0		3313,3310	5.8	0.9	4		223	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	RFC1	NM_001204747.1,NM_002913.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	1105/1149,1104/1148	39291518	1,13005	2203	4300	6503	SO:0001587	stop_gained	5981				DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding	g.chr4:39291518G>A	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.3313C>T	4.37:g.39291518G>A	ENSP00000371321:p.Gln1105*		Somatic				RFC1_uc003gtx.1_Nonsense_Mutation_p.Q1104*	p.Q1105*	NM_002913	NP_002904	WXS	Illumina HiSeq	Unspecified	P35251	RFC1_HUMAN			24	3447	-			1105					A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Nonsense_Mutation	SNP	ENST00000381897.1	37	c.3313C>T	CCDS56329.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.226647|8.226647	0.98714|0.98714	0.0|0.0	1.16E-4|1.16E-4	ENSG00000035928|ENSG00000035928	ENST00000381897;ENST00000349703|ENST00000514572	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.568609|.	0.18332|.	N|.	0.144462|.	.|T	.|0.73938	.|0.3651	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68205	.|-0.5470	.|5	0.12103|0.30854	T|T	0.63|0.27	-4.7778|-4.7778	20.1218|20.1218	0.97964|0.97964	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1105;1104|81	.|.	ENSP00000261424:Q1104X|ENSP00000424713:S81L	Q|S	-|-	1|2	0|0	RFC1|RFC1	38967913|38967913	1.000000|1.000000	0.71417|0.71417	0.924000|0.924000	0.36721|0.36721	0.591000|0.591000	0.36615|0.36615	6.934000|6.934000	0.75880|0.75880	2.763000|2.763000	0.94921|0.94921	0.561000|0.561000	0.74099|0.74099	CAA|TCA		0.398	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913		20	89	0	0	0	0.007413	0	20	89				
GABRA4	2557	broad.mit.edu	37	4	46930594	46930594	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:46930594C>T	ENST00000264318.3	-	9	2295	c.1313G>A	c.(1312-1314)cGt>cAt	p.R438H		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	438					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGCATTTGCACGGCTGAATGG	0.463																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(1312-1314)CGT>CAT		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						122.0	111.0	115.0					4																	46930594		2203	4300	6503	SO:0001583	missense	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46930594C>T		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1313G>A	4.37:g.46930594C>T	ENSP00000264318:p.Arg438His		Somatic					p.R438H	NM_000809	NP_000800	WXS	Illumina HiSeq	Unspecified	P48169	GBRA4_HUMAN			9	1452	-			438			Cytoplasmic (Probable).		Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	c.1313G>A	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216265	0.39201	.	.	ENSG00000109158	ENST00000264318	D	0.85484	-1.99	5.71	2.8	0.32819	Neurotransmitter-gated ion-channel transmembrane domain (2);	3.036110	0.00853	N	0.001844	T	0.80665	0.4666	L	0.40543	1.245	0.25352	N	0.98885	B	0.06786	0.001	B	0.06405	0.002	T	0.58555	-0.7616	10	0.15066	T	0.55	.	9.6277	0.39761	0.0:0.7883:0.0:0.2117	.	438	P48169	GBRA4_HUMAN	H	438	ENSP00000264318:R438H	ENSP00000264318:R438H	R	-	2	0	GABRA4	46625351	0.823000	0.29233	0.933000	0.37362	0.993000	0.82548	1.356000	0.34079	0.229000	0.21039	0.650000	0.86243	CGT		0.463	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			5	69	0	0	0	0.001168	0	5	69				
SRP72	6731	broad.mit.edu	37	4	57344766	57344766	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:57344766A>T	ENST00000342756.5	+	8	1497	c.776A>T	c.(775-777)gAt>gTt	p.D259V	SRP72_ENST00000510663.1_Intron	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	259					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					AGACCAACAGATGTGGGATTA	0.348																																							uc003hbv.2		NA																	0				ovary(1)	1						c.(775-777)GAT>GTT		signal recognition particle 72kDa							117.0	101.0	107.0					4																	57344766		2203	4299	6502	SO:0001583	missense	6731				response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding	g.chr4:57344766A>T	AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.776A>T	4.37:g.57344766A>T	ENSP00000342181:p.Asp259Val		Somatic				SRP72_uc010ihe.2_Intron|SRP72_uc003hbw.1_Missense_Mutation_p.D64V	p.D259V	NM_006947	NP_008878	WXS	Illumina HiSeq	Unspecified	O76094	SRP72_HUMAN			8	816	+	Glioma(25;0.08)|all_neural(26;0.101)		259			TPR 3.		G5E9Z8|Q7Z3C0	Missense_Mutation	SNP	ENST00000342756.5	37	c.776A>T	CCDS3506.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.234254	0.79688	.	.	ENSG00000174780	ENST00000342756;ENST00000505314	T	0.38077	1.16	5.24	5.24	0.73138	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.67341	-0.5695	10	0.59425	D	0.04	.	13.1179	0.59309	1.0:0.0:0.0:0.0	.	259;259	Q86X80;O76094	.;SRP72_HUMAN	V	259;64	ENSP00000342181:D259V	ENSP00000342181:D259V	D	+	2	0	SRP72	57039523	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.399000	0.79935	1.978000	0.57642	0.528000	0.53228	GAT		0.348	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7			15	26	0	0	0	0.003163	0	15	26				
STAP1	26228	broad.mit.edu	37	4	68436850	68436850	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:68436850T>A	ENST00000265404.2	+	2	251	c.169T>A	c.(169-171)Tat>Aat	p.Y57N	STAP1_ENST00000396225.1_Missense_Mutation_p.Y57N	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	57	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.Y57H(1)		NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						TCTTTTCTTTTATACCGACAA	0.313																																							uc003hde.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(169-171)TAT>AAT		signal transducing adaptor family member 1							130.0	148.0	142.0					4																	68436850		2203	4298	6501	SO:0001583	missense	26228				cellular membrane fusion|intracellular protein transport	cytoplasm		g.chr4:68436850T>A	AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.169T>A	4.37:g.68436850T>A	ENSP00000265404:p.Tyr57Asn		Somatic				STAP1_uc003hdf.2_Missense_Mutation_p.Y57N	p.Y57N	NM_012108	NP_036240	WXS	Illumina HiSeq	Unspecified	Q9ULZ2	STAP1_HUMAN			2	251	+			57			PH.		B2R980	Missense_Mutation	SNP	ENST00000265404.2	37	c.169T>A	CCDS3515.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236823	0.58886	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.46819	0.86;0.86	4.36	4.36	0.52297	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	M	0.77820	2.39	0.48632	D	0.999682	D	0.61697	0.99	D	0.65874	0.939	T	0.69232	-0.5199	10	0.87932	D	0	-5.19	10.097	0.42482	0.0:0.0:0.0:1.0	.	57	Q9ULZ2	STAP1_HUMAN	N	57	ENSP00000265404:Y57N;ENSP00000379527:Y57N	ENSP00000265404:Y57N	Y	+	1	0	STAP1	68119445	1.000000	0.71417	0.994000	0.49952	0.768000	0.43524	3.748000	0.55142	1.957000	0.56846	0.352000	0.21897	TAT		0.313	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251434.1	NM_012108		38	107	0	0	0	0.003214	0	38	107				
HNRNPDL	9987	broad.mit.edu	37	4	83350667	83350667	+	Silent	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:83350667G>C	ENST00000295470.5	-	1	352	c.177C>G	c.(175-177)cgC>cgG	p.R59R	HNRNPDL_ENST00000502762.1_Silent_p.R59R|HNRNPDL_ENST00000514511.1_5'Flank|HNRNPDL_ENST00000602300.1_5'Flank|HNRNPDL_ENST00000349655.4_5'Flank|ENOPH1_ENST00000509635.1_5'Flank|ENOPH1_ENST00000273920.3_5'Flank	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	59					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										CGGTGACGTGGCGCTGGGCCC	0.751																																							uc003hmr.2		NA																	0				skin(1)	1						c.(175-177)CGC>CGG		heterogeneous nuclear ribonucleoprotein D-like							4.0	5.0	5.0					4																	83350667		1673	3604	5277	SO:0001819	synonymous_variant	9987				regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|heterogeneous nuclear ribonucleoprotein complex	double-stranded DNA binding|nucleotide binding|poly(A) RNA binding|protein binding|single-stranded DNA binding	g.chr4:83350667G>C	D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.177C>G	4.37:g.83350667G>C			Somatic				ENOPH1_uc003hmv.2_5'Flank|ENOPH1_uc003hmw.2_5'Flank|ENOPH1_uc003hmx.2_5'Flank|HNRPDL_uc003hmq.2_RNA|HNRPDL_uc003hms.2_RNA|HNRPDL_uc003hmt.2_Silent_p.R59R	p.R59R	NM_031372	NP_112740	WXS	Illumina HiSeq	Unspecified	O14979	HNRDL_HUMAN			1	712	-		Hepatocellular(203;0.114)	59					Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Silent	SNP	ENST00000295470.5	37	c.177C>G	CCDS3593.1																																																																																				0.751	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1	NM_005463		3	3	0	0	0	0.004672	0	3	3				
UNC5C	8633	broad.mit.edu	37	4	96163625	96163625	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:96163625G>T	ENST00000453304.1	-	7	1411	c.1063C>A	c.(1063-1065)Ctc>Atc	p.L355I	UNC5C_ENST00000506749.1_Missense_Mutation_p.L355I	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	355	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TGCAAGACGAGGCCGTCGCAG	0.542																																							uc003htp.1		NA																	0				ovary(3)|pancreas(1)	4						c.(1063-1065)CTC>ATC		unc5C precursor							62.0	52.0	55.0					4																	96163625		2203	4300	6503	SO:0001583	missense	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96163625G>T	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1063C>A	4.37:g.96163625G>T	ENSP00000406022:p.Leu355Ile		Somatic				UNC5C_uc010ilc.1_Missense_Mutation_p.L355I|UNC5C_uc003htq.2_Missense_Mutation_p.L355I	p.L355I	NM_003728	NP_003719	WXS	Illumina HiSeq	Unspecified	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	7	1217	-		Hepatocellular(203;0.114)	355			Extracellular (Potential).|TSP type-1 2.		Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	c.1063C>A	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302027	0.40694	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.61040	0.14;0.14;0.14	5.1	4.25	0.50352	.	0.204706	0.44902	D	0.000418	T	0.50394	0.1613	L	0.44542	1.39	0.38298	D	0.942895	B;B;B	0.31125	0.019;0.309;0.201	B;B;B	0.31946	0.026;0.138;0.138	T	0.54944	-0.8217	10	0.38643	T	0.18	.	14.2979	0.66327	0.0725:0.0:0.9275:0.0	.	355;355;355	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	I	355;314;355;355	ENSP00000406022:L355I;ENSP00000426924:L355I;ENSP00000426153:L355I	ENSP00000328673:L314I	L	-	1	0	UNC5C	96382648	0.190000	0.23276	0.992000	0.48379	0.995000	0.86356	1.043000	0.30316	1.485000	0.48380	0.655000	0.94253	CTC		0.542	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		8	15	1	0	1.06961e-07	0.00308	1.4895e-07	8	15				
CENPE	1062	broad.mit.edu	37	4	104116363	104116363	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:104116363C>A	ENST00000265148.3	-	5	474	c.385G>T	c.(385-387)Gta>Tta	p.V129L	CENPE_ENST00000380026.3_Missense_Mutation_p.V129L	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	129	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATGTAAGATACACGTAAGAGA	0.318																																							uc003hxb.1		NA																	0				ovary(5)|breast(4)	9						c.(385-387)GTA>TTA		centromere protein E							70.0	70.0	70.0					4																	104116363		2203	4292	6495	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104116363C>A	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.385G>T	4.37:g.104116363C>A	ENSP00000265148:p.Val129Leu		Somatic				CENPE_uc003hxc.1_Missense_Mutation_p.V129L	p.V129L	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	5	475	-			129			Kinesin-motor.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.385G>T	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.988791	0.93106	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.77489	-1.1;-1.1;-1.1	5.94	5.94	0.96194	Kinesin, motor domain (4);	.	.	.	.	D	0.86493	0.5946	M	0.70842	2.15	0.80722	D	1	D;D	0.71674	0.974;0.998	P;D	0.69654	0.799;0.965	D	0.87083	0.2167	9	0.72032	D	0.01	.	14.5127	0.67800	0.0:0.9305:0.0:0.0695	.	129;129	Q02224-3;Q02224	.;CENPE_HUMAN	L	129	ENSP00000265148:V129L;ENSP00000369365:V129L;ENSP00000423981:V129L	ENSP00000265148:V129L	V	-	1	0	CENPE	104335812	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	5.425000	0.66470	2.820000	0.97059	0.650000	0.86243	GTA		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	14	1	0	2.17888e-05	0.006214	2.72967e-05	10	14				
TBCK	93627	broad.mit.edu	37	4	107168317	107168317	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:107168317C>A	ENST00000273980.5	-	11	1357	c.910G>T	c.(910-912)Gat>Tat	p.D304Y	TBCK_ENST00000361687.4_Missense_Mutation_p.D241Y|TBCK_ENST00000394708.2_Missense_Mutation_p.D304Y|TBCK_ENST00000432496.2_Missense_Mutation_p.D304Y|TBCK_ENST00000394706.3_Missense_Mutation_p.D265Y					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TGACTGATATCCTCAGGCAGA	0.358																																							uc010ilv.2		NA																	0				large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						c.(910-912)GAT>TAT		TBC domain-containing protein kinase-like							90.0	89.0	90.0					4																	107168317		2203	4300	6503	SO:0001583	missense	93627					intracellular	Rab GTPase activator activity	g.chr4:107168317C>A		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.910G>T	4.37:g.107168317C>A	ENSP00000273980:p.Asp304Tyr		Somatic				TBCK_uc003hyb.2_Missense_Mutation_p.D47Y|TBCK_uc003hye.2_Missense_Mutation_p.D265Y|TBCK_uc003hyc.2_Missense_Mutation_p.D241Y|TBCK_uc003hyd.2_Missense_Mutation_p.D132Y|TBCK_uc003hyf.2_Missense_Mutation_p.D304Y	p.D304Y	NM_001163435	NP_001156907	WXS	Illumina HiSeq	Unspecified	Q8TEA7	TBCK_HUMAN			10	1275	-			304						Missense_Mutation	SNP	ENST00000273980.5	37	c.910G>T	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618215	0.87359	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.08193	3.12;3.12;3.12;3.12;3.12	5.59	5.59	0.84812	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.22859	0.0552	L	0.47716	1.5	0.80722	D	1	P;D;D	0.65815	0.921;0.987;0.995	B;P;P	0.61201	0.344;0.885;0.772	T	0.00077	-1.2115	10	0.72032	D	0.01	.	19.5985	0.95549	0.0:1.0:0.0:0.0	.	304;265;241	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	Y	304;304;241;265;304	ENSP00000273980:D304Y;ENSP00000405847:D304Y;ENSP00000355338:D241Y;ENSP00000378196:D265Y;ENSP00000378198:D304Y	ENSP00000273980:D304Y	D	-	1	0	TBCK	107387766	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.844000	0.75390	2.636000	0.89361	0.563000	0.77884	GAT		0.358	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		7	27	1	0	0.00198382	0.001984	0.00226626	7	27				
SORBS2	8470	broad.mit.edu	37	4	186544274	186544274	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:186544274G>A	ENST00000284776.7	-	13	2806	c.2297C>T	c.(2296-2298)cCa>cTa	p.P766L	SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.P670L|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.P766L|SORBS2_ENST00000355634.5_Missense_Mutation_p.P866L	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	766					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GGGAACATCTGGCAGCAGCTC	0.557																																					Esophageal Squamous(153;41 2433 9491 36028)	Esophageal Squamous(153;41 2433 9491 36028)	uc003iyl.2		NA																	0				ovary(1)	1						c.(2296-2298)CCA>CTA		sorbin and SH3 domain containing 2 isoform 2							133.0	150.0	144.0					4																	186544274		2203	4300	6503	SO:0001583	missense	8470					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chr4:186544274G>A		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2297C>T	4.37:g.186544274G>A	ENSP00000284776:p.Pro766Leu		Somatic				SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.P866L|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.P670L|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.P880L|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	p.P766L	NM_021069	NP_066547	WXS	Illumina HiSeq	Unspecified	O94875	SRBS2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)	13	3155	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	766					A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	c.2297C>T	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552962	0.65425	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.60797	0.26;0.26;0.2;0.16	5.92	5.92	0.95590	.	0.142756	0.64402	D	0.000004	T	0.75997	0.3926	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.76239	-0.3032	10	0.87932	D	0	-22.047	20.3206	0.98668	0.0:0.0:1.0:0.0	.	670;866;766	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	L	766;766;670;866	ENSP00000284776:P766L;ENSP00000411764:P766L;ENSP00000397482:P670L;ENSP00000347852:P866L	ENSP00000284776:P766L	P	-	2	0	SORBS2	186781268	1.000000	0.71417	0.987000	0.45799	0.214000	0.24535	9.869000	0.99810	2.813000	0.96785	0.561000	0.74099	CCA		0.557	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		9	167	0	0	0	0.006214	0	9	167				
FAT1	2195	broad.mit.edu	37	4	187524999	187524999	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr4:187524999C>A	ENST00000441802.2	-	19	10890	c.10681G>T	c.(10681-10683)Ggt>Tgt	p.G3561C		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3561	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATGACGCCACCTGAGTATTCT	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(10681-10683)GGT>TGT		FAT tumor suppressor 1 precursor							89.0	89.0	89.0					4																	187524999		1972	4146	6118	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187524999C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10681G>T	4.37:g.187524999C>A	ENSP00000406229:p.Gly3561Cys	HNSCC(5;0.00058)	Somatic					p.G3561C	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			19	10869	-			3561			Extracellular (Potential).|Cadherin 33.			Missense_Mutation	SNP	ENST00000441802.2	37	c.10681G>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265295	0.80358	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.56275	0.47	5.06	5.06	0.68205	Cadherin (2);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81597	-0.0860	10	0.87932	D	0	.	18.6333	0.91369	0.0:1.0:0.0:0.0	.	3561	Q14517	FAT1_HUMAN	C	3561;3563	ENSP00000406229:G3561C	ENSP00000260147:G3563C	G	-	1	0	FAT1	187761993	1.000000	0.71417	0.157000	0.22605	0.762000	0.43233	7.651000	0.83577	2.636000	0.89361	0.563000	0.77884	GGT		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		12	32	1	0	5.50884e-06	0.001368	7.19565e-06	12	32				
CDH18	1016	broad.mit.edu	37	5	19473781	19473781	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:19473781G>A	ENST00000507958.1	-	15	2917	c.1927C>T	c.(1927-1929)Ccc>Tcc	p.P643S	CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000274170.4_Missense_Mutation_p.P643S|CDH18_ENST00000382275.1_Missense_Mutation_p.P643S|CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000506372.1_3'UTR			Q13634	CAD18_HUMAN	cadherin 18, type 2	643					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ATGATCAAGGGCTCTTTTTTG	0.443																																							uc003jgc.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(1927-1929)CCC>TCC		cadherin 18, type 2 preproprotein							151.0	159.0	156.0					5																	19473781		2203	4300	6503	SO:0001583	missense	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19473781G>A	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1927C>T	5.37:g.19473781G>A	ENSP00000425093:p.Pro643Ser		Somatic				CDH18_uc003jgd.2_Missense_Mutation_p.P643S|CDH18_uc011cnm.1_3'UTR	p.P643S	NM_004934	NP_004925	WXS	Illumina HiSeq	Unspecified	Q13634	CAD18_HUMAN			12	2304	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		643			Cytoplasmic (Potential).		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	c.1927C>T	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	32	5.134569	0.94517	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.76060	-0.99;-0.99;-0.99	6.16	6.16	0.99307	Cadherin, cytoplasmic domain (1);	0.050817	0.85682	D	0.000000	T	0.79690	0.4489	M	0.63428	1.95	0.58432	D	0.999999	P	0.47106	0.89	P	0.48952	0.596	T	0.76977	-0.2759	9	.	.	.	.	19.4236	0.94732	0.0:0.0:1.0:0.0	.	643	Q13634	CAD18_HUMAN	S	643	ENSP00000371710:P643S;ENSP00000425093:P643S;ENSP00000274170:P643S	.	P	-	1	0	CDH18	19509538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.863000	0.99569	2.937000	0.99478	0.650000	0.86243	CCC		0.443	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		15	226	0	0	0	0.003163	0	15	226				
CDH12	1010	broad.mit.edu	37	5	21751882	21751882	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:21751882G>A	ENST00000382254.1	-	15	3435	c.2349C>T	c.(2347-2349)ggC>ggT	p.G783G	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Silent_p.G743G|CDH12_ENST00000504376.2_Silent_p.G783G	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	783					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TCTCTTCTTCGCCAAACATGT	0.448										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(2347-2349)GGC>GGT		cadherin 12, type 2 preproprotein							82.0	83.0	83.0					5																	21751882		2203	4300	6503	SO:0001819	synonymous_variant	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21751882G>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2349C>T	5.37:g.21751882G>A		HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Silent_p.G743G|CDH12_uc003jgk.2_Silent_p.G783G|uc003jgj.2_Intron	p.G783G	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			12	2807	-			783			Cytoplasmic (Potential).		B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	c.2349C>T	CCDS3890.1																																																																																				0.448	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		6	84	0	0	0	0.001984	0	6	84				
OXCT1	5019	broad.mit.edu	37	5	41739555	41739555	+	Silent	SNP	C	C	G	rs372337270		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:41739555C>G	ENST00000196371.5	-	16	1618	c.1458G>C	c.(1456-1458)ctG>ctC	p.L486L	OXCT1_ENST00000512084.1_Silent_p.L89L|OXCT1_ENST00000510634.1_Silent_p.L89L|OXCT1_ENST00000509987.1_Silent_p.L300L	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	486					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	AGAGCTCAATCAGAGTCAACC	0.413																																							uc003jmn.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1456-1458)CTG>CTC		3-oxoacid CoA transferase 1 precursor	Succinic acid(DB00139)						158.0	141.0	147.0					5																	41739555		2203	4300	6503	SO:0001819	synonymous_variant	5019				cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity	g.chr5:41739555C>G	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1458G>C	5.37:g.41739555C>G			Somatic				OXCT1_uc011cpo.1_Silent_p.L89L|OXCT1_uc011cpp.1_Silent_p.L89L	p.L486L	NM_000436	NP_000427	WXS	Illumina HiSeq	Unspecified	P55809	SCOT1_HUMAN			16	1789	-			486					B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	c.1458G>C	CCDS3937.1																																																																																				0.413	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		3	81	0	0	0	0.004672	0	3	81				
NIM1K	167359	broad.mit.edu	37	5	43280133	43280133	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:43280133A>G	ENST00000512796.1	+	4	2112	c.613A>G	c.(613-615)Acc>Gcc	p.T205A	NIM1_ENST00000326035.2_Missense_Mutation_p.T205A			Q8IY84	NIM1_HUMAN		205	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)										TGTATTCTATACCAGTAATAC	0.378																																							uc003jno.2		NA																	0				lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						c.(613-615)ACC>GCC		serine/threonine-protein kinase NIM1							67.0	66.0	66.0					5																	43280133		2203	4300	6503	SO:0001583	missense	167359						ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:43280133A>G																												ENST00000512796.1:c.613A>G	5.37:g.43280133A>G	ENSP00000420849:p.Thr205Ala		Somatic					p.T205A	NM_153361	NP_699192	WXS	Illumina HiSeq	Unspecified	Q8IY84	NIM1_HUMAN			4	1494	+			205			Protein kinase.		B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	c.613A>G	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338847	0.41398	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.25749	1.78;1.78	5.69	4.53	0.55603	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.18173	0.0436	N	0.21373	0.66	0.58432	D	0.999999	B	0.12013	0.005	B	0.20384	0.029	T	0.03344	-1.1046	10	0.52906	T	0.07	.	10.178	0.42950	0.8623:0.0:0.1377:0.0	.	205	Q8IY84	NIM1_HUMAN	A	205	ENSP00000313572:T205A;ENSP00000420849:T205A	ENSP00000313572:T205A	T	+	1	0	AC114947.1	43315890	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.430000	0.66501	0.994000	0.38892	0.533000	0.62120	ACC		0.378	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1			17	42	0	0	0	0.00499	0	17	42				
HCN1	348980	broad.mit.edu	37	5	45645551	45645551	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:45645551C>A	ENST00000303230.4	-	2	642	c.585G>T	c.(583-585)agG>agT	p.R195S		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	195					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CAGTCCCAGTCCTAAAATTCA	0.373																																							uc003jok.2		NA																	0				ovary(1)	1						c.(583-585)AGG>AGT		hyperpolarization activated cyclic							95.0	92.0	93.0					5																	45645551		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45645551C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.585G>T	5.37:g.45645551C>A	ENSP00000307342:p.Arg195Ser		Somatic					p.R195S	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			2	610	-			195			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.585G>T	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270865	0.59540	.	.	ENSG00000164588	ENST00000303230	D	0.98164	-4.76	5.37	5.37	0.77165	Ion transport (1);	0.000000	0.64402	D	0.000003	D	0.98842	0.9609	M	0.90483	3.12	0.58432	D	0.999994	P	0.45594	0.862	D	0.67103	0.949	D	0.99850	1.1070	10	0.87932	D	0	.	7.0045	0.24828	0.0:0.7881:0.0:0.2119	.	195	O60741	HCN1_HUMAN	S	195	ENSP00000307342:R195S	ENSP00000307342:R195S	R	-	3	2	HCN1	45681308	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.042000	0.30303	2.520000	0.84964	0.555000	0.69702	AGG		0.373	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		15	33	1	0	1.49906e-05	0.00245	1.89207e-05	15	33				
ENC1	8507	broad.mit.edu	37	5	73931234	73931234	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:73931234C>A	ENST00000302351.4	-	2	2207	c.1077G>T	c.(1075-1077)tgG>tgT	p.W359C	ENC1_ENST00000537006.1_Missense_Mutation_p.W359C|ENC1_ENST00000510316.1_Missense_Mutation_p.W286C	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	359					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		TATCATAAACCCAGACATCTT	0.542																																							uc003kdc.3		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1075-1077)TGG>TGT		ectodermal-neural cortex (with BTB-like domain)							74.0	77.0	76.0					5																	73931234		2203	4300	6503	SO:0001583	missense	8507				nervous system development	cytoplasm|cytoskeleton|nuclear matrix	actin binding	g.chr5:73931234C>A	AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1077G>T	5.37:g.73931234C>A	ENSP00000306356:p.Trp359Cys		Somatic				ENC1_uc011css.1_Missense_Mutation_p.W286C	p.W359C	NM_003633	NP_003624	WXS	Illumina HiSeq	Unspecified	O14682	ENC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)	2	2208	-		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)	359			Kelch 2.		B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	ENST00000302351.4	37	c.1077G>T	CCDS4021.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681475	0.68042	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	T;T;T	0.78481	-1.18;-1.18;-1.18	5.89	5.89	0.94794	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.89743	0.6803	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90136	0.4210	10	0.87932	D	0	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	359	O14682	ENC1_HUMAN	C	359;286;359	ENSP00000306356:W359C;ENSP00000423804:W286C;ENSP00000446289:W359C	ENSP00000306356:W359C	W	-	3	0	ENC1	73966990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.793000	0.96121	0.561000	0.74099	TGG		0.542	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	NM_003633		40	68	1	0	2.52637e-11	0.005524	3.83508e-11	40	68				
CMYA5	202333	broad.mit.edu	37	5	79025142	79025142	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:79025142A>G	ENST00000446378.2	+	2	585	c.554A>G	c.(553-555)tAt>tGt	p.Y185C		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	185					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GAGAAGTCATATACTGGCATT	0.368																																							uc003kgc.2		NA																	0				ovary(6)|pancreas(2)|lung(1)	9						c.(553-555)TAT>TGT		cardiomyopathy associated 5							44.0	42.0	43.0					5																	79025142		1838	4098	5936	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79025142A>G	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.554A>G	5.37:g.79025142A>G	ENSP00000394770:p.Tyr185Cys		Somatic					p.Y185C	NM_153610	NP_705838	WXS	Illumina HiSeq	Unspecified	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	626	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	185					A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.554A>G	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	2.288	-0.363140	0.05103	.	.	ENSG00000164309	ENST00000446378	T	0.36878	1.23	5.78	3.96	0.45880	.	0.434403	0.20082	N	0.099632	T	0.18718	0.0449	N	0.08118	0	0.09310	N	1	P	0.51653	0.947	B	0.43103	0.408	T	0.04915	-1.0918	10	0.52906	T	0.07	.	5.5796	0.17243	0.3923:0.4514:0.0:0.1563	.	185	Q8N3K9	CMYA5_HUMAN	C	185	ENSP00000394770:Y185C	ENSP00000394770:Y185C	Y	+	2	0	CMYA5	79060898	0.000000	0.05858	0.003000	0.11579	0.104000	0.19210	0.505000	0.22642	0.736000	0.32559	0.496000	0.49642	TAT		0.368	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		12	26	0	0	0	0.000978	0	12	26				
FBN2	2201	broad.mit.edu	37	5	127666351	127666351	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:127666351C>A	ENST00000508053.1	-	39	5233	c.4259G>T	c.(4258-4260)aGc>aTc	p.S1420I	FBN2_ENST00000507835.1_Missense_Mutation_p.S270I|FBN2_ENST00000508989.1_Missense_Mutation_p.S1387I|FBN2_ENST00000262464.4_Missense_Mutation_p.S1420I			P35556	FBN2_HUMAN	fibrillin 2	1420	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGCATTGATGCTACACTGGTG	0.468																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(4258-4260)AGC>ATC		fibrillin 2 precursor							137.0	124.0	128.0					5																	127666351		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127666351C>A	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4259G>T	5.37:g.127666351C>A	ENSP00000424571:p.Ser1420Ile		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.S1387I	p.S1420I	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	33	4698	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1420			EGF-like 23; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.4259G>T	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825281	0.50739	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04	5.14	4.27	0.50696	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.076855	0.56097	D	0.000034	D	0.95921	0.8672	M	0.88979	2.995	0.43118	D	0.994832	D;B	0.69078	0.997;0.021	D;B	0.64506	0.926;0.012	D	0.95379	0.8471	10	0.45353	T	0.12	.	14.5781	0.68265	0.0:0.9261:0.0:0.0739	.	1387;1420	D6RJI3;P35556	.;FBN2_HUMAN	I	1420;1420;270;1387	ENSP00000262464:S1420I;ENSP00000424571:S1420I;ENSP00000426839:S270I;ENSP00000425596:S1387I	ENSP00000262464:S1420I	S	-	2	0	FBN2	127694250	0.975000	0.34042	1.000000	0.80357	0.981000	0.71138	1.381000	0.34362	2.835000	0.97688	0.591000	0.81541	AGC		0.468	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		5	33	1	0	0.000602214	0.000602	0.000709602	5	33				
PCDHB16	57717	broad.mit.edu	37	5	140563531	140563531	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:140563531C>A	ENST00000361016.2	+	1	2552	c.1397C>A	c.(1396-1398)cCc>cAc	p.P466H		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	466	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACAACAGCCCCGCCCTGCAC	0.607																																							uc003liv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1396-1398)CCC>CAC		protocadherin beta 16 precursor							88.0	86.0	87.0					5																	140563531		2203	4298	6501	SO:0001583	missense	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140563531C>A	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1397C>A	5.37:g.140563531C>A	ENSP00000354293:p.Pro466His		Somatic				PCDHB16_uc010jfw.1_Missense_Mutation_p.P138H	p.P466H	NM_020957	NP_066008	WXS	Illumina HiSeq	Unspecified	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2552	+			466			Extracellular (Potential).|Cadherin 5.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	c.1397C>A	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	c	19.37	3.814884	0.70912	.	.	ENSG00000196963	ENST00000361016	T	0.01745	4.66	4.26	4.26	0.50523	Cadherin (3);Cadherin-like (1);	0.000000	0.34067	N	0.004292	T	0.16385	0.0394	H	0.94964	3.605	0.31473	N	0.668172	D	0.89917	1.0	D	0.97110	1.0	T	0.33189	-0.9878	10	0.72032	D	0.01	.	16.3541	0.83228	0.0:1.0:0.0:0.0	.	466	Q9NRJ7	PCDBG_HUMAN	H	466	ENSP00000354293:P466H	ENSP00000354293:P466H	P	+	2	0	PCDHB16	140543715	0.322000	0.24634	1.000000	0.80357	0.952000	0.60782	3.634000	0.54302	1.931000	0.55961	0.580000	0.79431	CCC		0.607	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		17	178	1	0	1.99824e-07	0.00499	2.74859e-07	17	178				
PPP2R2B	5521	broad.mit.edu	37	5	146070757	146070757	+	Silent	SNP	T	T	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:146070757T>A	ENST00000394413.3	-	4	951	c.381A>T	c.(379-381)ccA>ccT	p.P127P	PPP2R2B_ENST00000453001.1_Silent_p.P127P|PPP2R2B_ENST00000394410.2_Silent_p.P116P|PPP2R2B_ENST00000394414.1_Silent_p.P193P|PPP2R2B_ENST00000508545.2_Silent_p.P116P|PPP2R2B_ENST00000394409.3_Silent_p.P185P|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000394411.4_Silent_p.P127P|PPP2R2B_ENST00000504198.1_Silent_p.P133P|PPP2R2B_ENST00000356826.3_Silent_p.P127P|PPP2R2B_ENST00000336640.6_Silent_p.P130P			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	127					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTAGCCTTCTGGCCTCTTAT	0.517																																							uc003loe.2		NA																	0				ovary(1)|prostate(1)	2						c.(379-381)CCA>CCT		beta isoform of regulatory subunit B55, protein							102.0	109.0	107.0					5																	146070757		2203	4300	6503	SO:0001819	synonymous_variant	5521				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr5:146070757T>A	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.381A>T	5.37:g.146070757T>A			Somatic				PPP2R2B_uc010jgm.2_Silent_p.P116P|PPP2R2B_uc003log.3_Silent_p.P127P|PPP2R2B_uc003lof.3_Silent_p.P127P|PPP2R2B_uc003loi.3_Silent_p.P130P|PPP2R2B_uc003loh.3_Silent_p.P127P|PPP2R2B_uc003loj.3_Silent_p.P107P|PPP2R2B_uc003lok.3_Silent_p.P116P|PPP2R2B_uc011dbu.1_Silent_p.P133P|PPP2R2B_uc011dbv.1_Silent_p.P185P	p.P127P	NM_004576	NP_004567	WXS	Illumina HiSeq	Unspecified	Q00005	2ABB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		4	906	-			127			WD 2.		A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Silent	SNP	ENST00000394413.3	37	c.381A>T	CCDS4284.1																																																																																				0.517	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678		31	58	0	0	0	0.002836	0	31	58				
FAM71B	153745	broad.mit.edu	37	5	156589500	156589500	+	Silent	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:156589500G>C	ENST00000302938.4	-	2	1871	c.1776C>G	c.(1774-1776)tcC>tcG	p.S592S		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	592						nucleus (GO:0005634)		p.S592S(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCGTCTTCTCGGATGTCATAG	0.512																																							uc003lwn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(1774-1776)TCC>TCG		family with sequence similarity 71, member B							223.0	220.0	221.0					5																	156589500		2203	4300	6503	SO:0001819	synonymous_variant	153745					nucleus		g.chr5:156589500G>C		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1776C>G	5.37:g.156589500G>C			Somatic					p.S592S	NM_130899	NP_570969	WXS	Illumina HiSeq	Unspecified	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1876	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	592					Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	c.1776C>G	CCDS4335.1																																																																																				0.512	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		78	187	0	0	0	0.00361	0	78	187				
GABRG2	2566	broad.mit.edu	37	5	161576310	161576310	+	Missense_Mutation	SNP	G	G	T	rs571034662		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:161576310G>T	ENST00000361925.4	+	8	1339	c.1119G>T	c.(1117-1119)aaG>aaT	p.K373N	GABRG2_ENST00000414552.2_Missense_Mutation_p.K413N|GABRG2_ENST00000393933.4_Missense_Mutation_p.K278N|GABRG2_ENST00000356592.3_Missense_Mutation_p.K373N			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	373					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATAAAAAGAAGAAAAACCCTG	0.388																																							uc003lyz.3		NA																	0				ovary(4)|skin(1)	5						c.(1117-1119)AAG>AAT		gamma-aminobutyric acid A receptor, gamma 2							97.0	84.0	88.0					5																	161576310		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161576310G>T		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1119G>T	5.37:g.161576310G>T	ENSP00000354651:p.Lys373Asn		Somatic				GABRG2_uc010jjc.2_Missense_Mutation_p.K413N|GABRG2_uc003lyy.3_Missense_Mutation_p.K373N|GABRG2_uc011dej.1_Missense_Mutation_p.K278N	p.K373N	NM_000816	NP_000807	WXS	Illumina HiSeq	Unspecified	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	8	1477	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	373			Cytoplasmic (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.1119G>T	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207070	0.58343	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.86497	-2.13;-2.13;-2.05;-2.05	5.61	5.61	0.85477	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.519392	0.22516	N	0.059026	T	0.80182	0.4576	N	0.12182	0.205	0.80722	D	1	B;B;B	0.32101	0.257;0.249;0.356	B;B;B	0.36030	0.142;0.216;0.138	T	0.76493	-0.2939	10	0.23891	T	0.37	.	19.6572	0.95847	0.0:0.0:1.0:0.0	.	413;373;373	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	N	373;413;373;278	ENSP00000349000:K373N;ENSP00000410732:K413N;ENSP00000354651:K373N;ENSP00000377510:K278N	ENSP00000349000:K373N	K	+	3	2	GABRG2	161508888	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.115000	0.71566	2.630000	0.89119	0.650000	0.86243	AAG		0.388	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			6	39	1	0	4.096e-09	0.001168	6.00153e-09	6	39				
TENM2	57451	broad.mit.edu	37	5	167589629	167589629	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:167589629C>A	ENST00000518659.1	+	13	2475	c.2436C>A	c.(2434-2436)gaC>gaA	p.D812E	CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000520394.1_Missense_Mutation_p.D580E|TENM2_ENST00000545108.1_Missense_Mutation_p.D812E|TENM2_ENST00000403607.2_Missense_Mutation_p.D636E|TENM2_ENST00000519204.1_Missense_Mutation_p.D691E	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	812	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GCTGCCCTGACTTGTGCAACG	0.617																																							uc010jjd.2		NA																	0				ovary(6)|central_nervous_system(4)	10						c.(2407-2409)GAC>GAA		odz, odd Oz/ten-m homolog 2							59.0	58.0	58.0					5																	167589629		2068	4211	6279	SO:0001583	missense	57451							g.chr5:167589629C>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2436C>A	5.37:g.167589629C>A	ENSP00000429430:p.Asp812Glu		Somatic				ODZ2_uc003lzr.3_Missense_Mutation_p.D580E|ODZ2_uc003lzt.3_Missense_Mutation_p.D176E|ODZ2_uc010jje.2_Missense_Mutation_p.D74E|uc003lzs.1_Intron	p.D803E	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	13	2409	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.2409C>A		.	.	.	.	.	.	.	.	.	.	C	14.22	2.470311	0.43942	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.03212	4.01;4.01;4.01;4.01;4.01	5.42	2.9	0.33743	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.135802	0.64402	D	0.000003	T	0.02929	0.0087	N	0.14661	0.345	0.32828	D	0.503686	P;B;B	0.35139	0.486;0.354;0.372	B;B;B	0.38755	0.281;0.101;0.085	T	0.38628	-0.9652	10	0.46703	T	0.11	.	8.3249	0.32151	0.0:0.2834:0.0:0.7166	.	812;812;580	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	E	812;812;691;580;636	ENSP00000429430:D812E;ENSP00000438635:D812E;ENSP00000428964:D691E;ENSP00000427874:D580E;ENSP00000384905:D636E	ENSP00000384905:D636E	D	+	3	2	ODZ2	167522207	0.904000	0.30761	0.995000	0.50966	0.992000	0.81027	1.433000	0.34947	0.296000	0.22592	-0.345000	0.07892	GAC		0.617	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		12	23	1	0	5.50884e-06	0.001368	7.19565e-06	12	23				
TRIM52	84851	broad.mit.edu	37	5	180687006	180687006	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr5:180687006T>C	ENST00000327767.4	-	1	1113	c.809A>G	c.(808-810)tAc>tGc	p.Y270C	CTC-338M12.4_ENST00000506340.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|CTC-338M12.4_ENST00000505151.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52_ENST00000514805.1_5'UTR|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA|CTC-338M12.4_ENST00000417281.2_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	270					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TCTCACCTGGTACTCCTGCAC	0.542																																							uc003mnp.2		NA																	0					0						c.(808-810)TAC>TGC		tripartite motif-containing 52							159.0	145.0	150.0					5																	180687006		2203	4300	6503	SO:0001583	missense	84851					intracellular	zinc ion binding	g.chr5:180687006T>C		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.809A>G	5.37:g.180687006T>C	ENSP00000332152:p.Tyr270Cys		Somatic				uc003mnq.2_5'Flank	p.Y270C	NM_032765	NP_116154	WXS	Illumina HiSeq	Unspecified	Q96A61	TRI52_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)	1	1114	-	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	270						Missense_Mutation	SNP	ENST00000327767.4	37	c.809A>G	CCDS4467.1	.	.	.	.	.	.	.	.	.	.	t	13.14	2.147162	0.37923	.	.	ENSG00000183718	ENST00000327767	T	0.57752	0.38	3.0	0.255	0.15561	.	.	.	.	.	T	0.43366	0.1244	N	0.08118	0	0.31390	N	0.677914	D	0.76494	0.999	D	0.66979	0.948	T	0.48822	-0.9001	9	0.87932	D	0	.	2.2749	0.04100	0.4029:0.15:0.0:0.4471	.	270	Q96A61	TRI52_HUMAN	C	270	ENSP00000332152:Y270C	ENSP00000332152:Y270C	Y	-	2	0	TRIM52	180619612	0.342000	0.24809	0.995000	0.50966	0.435000	0.31806	0.154000	0.16343	0.370000	0.24538	0.418000	0.28097	TAC		0.542	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765		56	157	0	0	0	0.00361	0	56	157				
SYCP2L	221711	broad.mit.edu	37	6	10911057	10911057	+	Splice_Site	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:10911057G>T	ENST00000283141.6	+	12	1169	c.873G>T	c.(871-873)agG>agT	p.R291S	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_Splice_Site_p.R132S	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	291			R -> W. {ECO:0000269|PubMed:23033978}.			nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TATTTTGCAGGGTGTATTCAT	0.408																																							uc003mzo.2		NA																	0				ovary(1)|skin(1)	2						c.(871-873)AGG>AGT		synaptonemal complex protein 2-like							239.0	219.0	225.0					6																	10911057		1905	4121	6026	SO:0001630	splice_region_variant	221711					nucleus		g.chr6:10911057G>T	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.873-1G>T	6.37:g.10911057G>T			Somatic				SYCP2L_uc011din.1_Missense_Mutation_p.R132S|SYCP2L_uc010jow.2_Intron	p.R291S	NM_001040274	NP_001035364	WXS	Illumina HiSeq	Unspecified	Q5T4T6	SYC2L_HUMAN	Epithelial(50;0.239)		12	1169	+	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	291					A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	c.873G>T	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.180981	0.57800	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.47528	0.84;2.08	5.66	3.86	0.44501	.	0.152801	0.56097	N	0.000027	T	0.29256	0.0728	L	0.60455	1.87	0.80722	D	1	P;P	0.50443	0.875;0.935	B;B	0.43889	0.341;0.435	T	0.10222	-1.0639	9	.	.	.	.	7.9808	0.30183	0.1274:0.0:0.7307:0.1419	.	132;291	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	S	132;291	ENSP00000440676:R132S;ENSP00000283141:R291S	.	R	+	3	2	SYCP2L	11019043	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	1.246000	0.32803	1.378000	0.46305	0.591000	0.81541	AGG		0.408	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	Missense_Mutation	24	90	1	0	6.44725e-10	0.002299	9.52949e-10	24	90				
HIVEP1	3096	broad.mit.edu	37	6	12161872	12161872	+	Missense_Mutation	SNP	G	G	A	rs377571560		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:12161872G>A	ENST00000379388.2	+	8	7020	c.6688G>A	c.(6688-6690)Gag>Aag	p.E2230K	HIVEP1_ENST00000541134.1_Missense_Mutation_p.E95K	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2230					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GAGTACTGACGAGGATGTCAG	0.572																																							uc003nac.2		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(6688-6690)GAG>AAG		human immunodeficiency virus type I enhancer		G	LYS/GLU	0,4244		0,0,2122	88.0	96.0	93.0		6688	5.9	0.9	6		93	1,8499		0,1,4249	no	missense	HIVEP1	NM_002114.2	56	0,1,6371	AA,AG,GG		0.0118,0.0,0.0078	possibly-damaging	2230/2719	12161872	1,12743	2122	4250	6372	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12161872G>A	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6688G>A	6.37:g.12161872G>A	ENSP00000368698:p.Glu2230Lys		Somatic				HIVEP1_uc011diq.1_RNA	p.E2230K	NM_002114	NP_002105	WXS	Illumina HiSeq	Unspecified	P15822	ZEP1_HUMAN			8	6867	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	2230					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.6688G>A	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490111	0.64074	0.0	1.18E-4	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000541134;ENST00000542327	T;T	0.34472	2.92;1.36	5.91	5.91	0.95273	.	0.000000	0.36628	N	0.002493	T	0.49745	0.1575	M	0.79805	2.47	0.44595	D	0.997563	D	0.71674	0.998	P	0.57324	0.818	T	0.36335	-0.9752	10	0.22706	T	0.39	-34.5476	20.3052	0.98627	0.0:0.0:1.0:0.0	.	2230	P15822	ZEP1_HUMAN	K	2230;157;95;212	ENSP00000368698:E2230K;ENSP00000445617:E95K	ENSP00000368698:E2230K	E	+	1	0	HIVEP1	12269858	1.000000	0.71417	0.889000	0.34880	0.031000	0.12232	8.284000	0.89912	2.808000	0.96608	0.655000	0.94253	GAG		0.572	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		14	15	0	0	0	0.001855	0	14	15				
NOTCH4	4855	broad.mit.edu	37	6	32169149	32169149	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:32169149G>A	ENST00000375023.3	-	22	4022	c.3884C>T	c.(3883-3885)cCc>cTc	p.P1295L		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1295					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GGCCAGGGAGGGCCCCCACTC	0.642																																							uc003obb.2		NA																	0				lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(3883-3885)CCC>CTC		notch4 preproprotein							38.0	39.0	39.0					6																	32169149		1508	2709	4217	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32169149G>A		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3884C>T	6.37:g.32169149G>A	ENSP00000364163:p.Pro1295Leu		Somatic				NOTCH4_uc003oba.2_5'UTR|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.P1295L	NM_004557	NP_004548	WXS	Illumina HiSeq	Unspecified	Q99466	NOTC4_HUMAN			22	4023	-			1295			Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.3884C>T	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492260	0.64074	.	.	ENSG00000204301	ENST00000375023	T	0.80994	-1.44	4.57	4.57	0.56435	.	0.000000	0.38436	U	0.001681	T	0.58552	0.2130	L	0.27053	0.805	0.80722	D	1	B	0.16603	0.018	B	0.24394	0.053	T	0.64339	-0.6431	10	0.72032	D	0.01	.	10.0517	0.42219	0.0:0.0:0.7993:0.2007	.	1295	Q99466	NOTC4_HUMAN	L	1295	ENSP00000364163:P1295L	ENSP00000364163:P1295L	P	-	2	0	NOTCH4	32277127	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.394000	0.44450	2.407000	0.81776	0.555000	0.69702	CCC		0.642	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			13	28	0	0	0	0.001368	0	13	28				
DST	667	broad.mit.edu	37	6	56501375	56501375	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:56501375C>T	ENST00000361203.3	-	19	2414	c.2407G>A	c.(2407-2409)Gag>Aag	p.E803K	DST_ENST00000446842.2_Missense_Mutation_p.E477K|DST_ENST00000518935.1_Missense_Mutation_p.E477K|DST_ENST00000244364.6_Missense_Mutation_p.E477K|DST_ENST00000370788.2_Missense_Mutation_p.E803K|DST_ENST00000421834.2_Missense_Mutation_p.E803K|DST_ENST00000370765.6_Missense_Mutation_p.E477K|DST_ENST00000312431.6_Missense_Mutation_p.E803K|DST_ENST00000370769.4_Missense_Mutation_p.E803K|DST_ENST00000370754.5_Missense_Mutation_p.E981K			Q03001	DYST_HUMAN	dystonin	803					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTGTGTTCTCCTTTATGTGC	0.418																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(2941-2943)GAG>AAG		dystonin isoform 2							207.0	168.0	181.0					6																	56501375		2203	4300	6503	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56501375C>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2407G>A	6.37:g.56501375C>T	ENSP00000354508:p.Glu803Lys		Somatic				DST_uc003pcz.3_Missense_Mutation_p.E803K|DST_uc011dxj.1_Missense_Mutation_p.E832K|DST_uc011dxk.1_Missense_Mutation_p.E843K|DST_uc003pcy.3_Missense_Mutation_p.E477K|DST_uc003pdb.2_Missense_Mutation_p.E477K|DST_uc003pdc.3_Missense_Mutation_p.E477K|DST_uc003pdd.3_Missense_Mutation_p.E477K	p.E981K	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		22	2969	-	Lung NSC(77;0.103)		803					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.2941G>A		.	.	.	.	.	.	.	.	.	.	C	28.7	4.939006	0.92526	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	D;D;D;D;D;D;D;D;D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44;-3.44	5.15	5.15	0.70609	.	0.127874	0.34386	N	0.004006	D	0.96454	0.8843	M	0.81341	2.54	0.33044	D	0.531884	P;D;P;P;D;D;B;P	0.63880	0.614;0.97;0.912;0.66;0.993;0.991;0.424;0.749	B;P;P;B;P;D;B;P	0.65010	0.415;0.477;0.512;0.331;0.815;0.931;0.152;0.523	D	0.96805	0.9592	9	0.72032	D	0.01	.	14.4267	0.67220	0.0:0.8528:0.1472:0.0	.	803;803;981;477;477;477;803;477	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	K	477;981;803;803;477;803;803;803;477;843;477;477	ENSP00000244364:E477K;ENSP00000359790:E981K;ENSP00000359805:E803K;ENSP00000400883:E803K;ENSP00000393645:E477K;ENSP00000307959:E803K;ENSP00000359824:E803K;ENSP00000354508:E803K;ENSP00000404924:E477K;ENSP00000431030:E843K;ENSP00000359801:E477K;ENSP00000431003:E477K	ENSP00000244364:E477K	E	-	1	0	DST	56609334	1.000000	0.71417	0.998000	0.56505	0.859000	0.49053	5.841000	0.69409	2.679000	0.91253	0.579000	0.79373	GAG		0.418	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		5	93	0	0	0	0.000602	0	5	93				
COL9A1	1297	broad.mit.edu	37	6	70942411	70942411	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:70942411C>A	ENST00000357250.6	-	36	2536	c.2378G>T	c.(2377-2379)gGa>gTa	p.G793V	COL9A1_ENST00000320755.7_Missense_Mutation_p.G550V|RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000370499.4_Missense_Mutation_p.G550V|COL9A1_ENST00000489611.1_5'UTR	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	793	Collagen-like 9.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GCCAGGCCTTCCAGGAAGCCC	0.567																																							uc003pfg.3		NA																	0				ovary(4)	4						c.(2377-2379)GGA>GTA		alpha 1 type IX collagen isoform 1 precursor							32.0	37.0	35.0					6																	70942411		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70942411C>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2378G>T	6.37:g.70942411C>A	ENSP00000349790:p.Gly793Val		Somatic				COL9A1_uc003pfe.3_Missense_Mutation_p.G342V|COL9A1_uc003pff.3_Missense_Mutation_p.G550V	p.G793V	NM_001851	NP_001842	WXS	Illumina HiSeq	Unspecified	P20849	CO9A1_HUMAN			36	2537	-			793			Triple-helical region (COL1).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.2378G>T	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841192	0.32513	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99353	-5.77;-5.77;-5.77	5.84	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	H	0.98833	4.345	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.97061	0.9771	10	0.87932	D	0	.	15.0939	0.72217	0.0:0.9321:0.0:0.0679	.	793;550;342	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	V	793;550;550	ENSP00000349790:G793V;ENSP00000315252:G550V;ENSP00000359530:G550V	ENSP00000315252:G550V	G	-	2	0	COL9A1	70999132	1.000000	0.71417	0.882000	0.34594	0.009000	0.06853	7.717000	0.84732	1.471000	0.48121	0.655000	0.94253	GGA		0.567	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			9	30	1	0	0.000274275	0.004482	0.000328935	9	30				
EEF1A1	1915	broad.mit.edu	37	6	74228319	74228319	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:74228319G>A	ENST00000316292.9	-	5	1778	c.787C>T	c.(787-789)Cct>Tct	p.P263S	EEF1A1_ENST00000331523.2_Missense_Mutation_p.P263S|EEF1A1_ENST00000309268.6_Missense_Mutation_p.P263S|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	263					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CGGCCAACAGGAACAGTACCA	0.413											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc003phi.2		NA																	0					0						c.(787-789)CCT>TCT		eukaryotic translation elongation factor 1 alpha							90.0	92.0	91.0					6																	74228319		2155	4281	6436	SO:0001583	missense	1915					cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr6:74228319G>A	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.787C>T	6.37:g.74228319G>A	ENSP00000339063:p.Pro263Ser		Somatic	OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1151	EEF1A1_uc003phd.2_5'UTR|EEF1A1_uc003phe.2_Missense_Mutation_p.P253S|EEF1A1_uc003phf.2_Missense_Mutation_p.P263S|EEF1A1_uc003phg.2_Missense_Mutation_p.P263S|EEF1A1_uc003phh.2_Missense_Mutation_p.P109S|EEF1A1_uc003phj.2_Missense_Mutation_p.P263S|EEF1A1_uc003phk.2_Missense_Mutation_p.P263S|EEF1A1_uc003phl.2_Intron|EEF1A1_uc003phm.1_Intron	p.P263S	NM_001402	NP_001393	WXS	Illumina HiSeq	Unspecified	P68104	EF1A1_HUMAN			5	824	-			263					P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	c.787C>T	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083368	0.76642	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.55760	0.5;0.5;0.5	4.71	4.71	0.59529	Translation elongation factor EFTu/EF1A, domain 2 (2);Translation elongation/initiation factor/Ribosomal, beta-barrel (2);	0.000000	0.85682	U	0.000000	T	0.71169	0.3308	H	0.96691	3.865	0.80722	D	1	P;P;P;P	0.42248	0.774;0.774;0.774;0.774	P;P;P;P	0.48654	0.585;0.585;0.585;0.585	T	0.82121	-0.0614	10	0.87932	D	0	.	18.0919	0.89478	0.0:0.0:1.0:0.0	.	263;263;263;263	P68104;Q53HR5;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;.;EF1A3_HUMAN	S	263;263;263;263;242	ENSP00000339063:P263S;ENSP00000339053:P263S;ENSP00000330054:P263S	ENSP00000339053:P263S	P	-	1	0	EEF1A1	74285040	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.551000	0.82182	2.323000	0.78572	0.556000	0.70494	CCT		0.413	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402		8	47	0	0	0	0.00308	0	8	47				
PHIP	55023	broad.mit.edu	37	6	79735767	79735767	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:79735767T>C	ENST00000275034.4	-	8	882	c.715A>G	c.(715-717)Atg>Gtg	p.M239V		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	239					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		GCTGCTATCATGGTATTCTCA	0.433																																							uc003pir.2		NA																	0				large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(715-717)ATG>GTG		pleckstrin homology domain interacting protein							531.0	483.0	499.0					6																	79735767		2203	4300	6503	SO:0001583	missense	55023				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding	g.chr6:79735767T>C	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.715A>G	6.37:g.79735767T>C	ENSP00000275034:p.Met239Val		Somatic				PHIP_uc011dyp.1_Missense_Mutation_p.M239V	p.M239V	NM_017934	NP_060404	WXS	Illumina HiSeq	Unspecified	Q8WWQ0	PHIP_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.231)	8	941	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	239			WD 2.		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	c.715A>G	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.532790	0.64972	.	.	ENSG00000146247	ENST00000275034	T	0.58506	0.33	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.25531	0.0621	N	0.21142	0.635	0.53688	D	0.999978	P;P	0.35551	0.509;0.509	B;B	0.35470	0.203;0.203	T	0.13953	-1.0490	9	.	.	.	-14.5593	10.0267	0.42076	0.1504:0.0:0.0:0.8496	.	239;239	A7J992;Q8WWQ0	.;PHIP_HUMAN	V	239	ENSP00000275034:M239V	.	M	-	1	0	PHIP	79792486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.989000	0.56958	2.064000	0.61679	0.528000	0.53228	ATG		0.433	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2			21	43	0	0	0	0.001523	0	21	43				
ZNF292	23036	broad.mit.edu	37	6	87965604	87965604	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:87965604A>G	ENST00000369577.3	+	8	2300	c.2257A>G	c.(2257-2259)Ata>Gta	p.I753V	ZNF292_ENST00000339907.4_Missense_Mutation_p.I748V	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	753						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ATATATCTGTATACAGATGAA	0.378																																							uc003plm.3		NA																	0				ovary(4)	4						c.(2257-2259)ATA>GTA		zinc finger protein 292							44.0	42.0	43.0					6																	87965604		1842	4091	5933	SO:0001583	missense	23036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:87965604A>G	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2257A>G	6.37:g.87965604A>G	ENSP00000358590:p.Ile753Val		Somatic					p.I753V	NM_015021	NP_055836	WXS	Illumina HiSeq	Unspecified	O60281	ZN292_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0199)	8	2298	+		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)	753			C2H2-type 4.		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	c.2257A>G	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	A	8.553	0.876065	0.17395	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.31247	1.5;1.5	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10508	0.0257	N	0.05330	-0.07	0.44477	D	0.997415	P	0.42757	0.789	B	0.42112	0.376	T	0.12243	-1.0555	10	0.26408	T	0.33	.	16.087	0.81065	1.0:0.0:0.0:0.0	.	753	O60281	ZN292_HUMAN	V	753;748	ENSP00000358590:I753V;ENSP00000342847:I748V	ENSP00000342847:I748V	I	+	1	0	ZNF292	88022323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.440000	0.80464	2.202000	0.70862	0.533000	0.62120	ATA		0.378	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		8	20	0	0	0	0.00308	0	8	20				
MED23	9439	broad.mit.edu	37	6	131924232	131924232	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:131924232G>A	ENST00000368068.3	-	16	2048	c.1869C>T	c.(1867-1869)ctC>ctT	p.L623L	MED23_ENST00000545957.1_Silent_p.L264L|MED23_ENST00000403834.3_Silent_p.L629L|MED23_ENST00000368053.4_Silent_p.L629L|MED23_ENST00000368060.3_Silent_p.L623L|MED23_ENST00000368058.1_Silent_p.L629L|MED23_ENST00000539158.1_3'UTR|MED23_ENST00000540546.1_Silent_p.L629L|MED23_ENST00000354577.4_Silent_p.L629L	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	623					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GATGACTCAGGAGCTGAACTC	0.423																																							uc003qcs.1		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(1867-1869)CTC>CTT		mediator complex subunit 23 isoform a							125.0	118.0	120.0					6																	131924232		2203	4300	6503	SO:0001819	synonymous_variant	9439				regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity	g.chr6:131924232G>A	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1869C>T	6.37:g.131924232G>A			Somatic				MED23_uc003qcq.2_Silent_p.L629L|MED23_uc011eca.1_Silent_p.L264L|MED23_uc003qct.1_Silent_p.L629L|MED23_uc011ecb.1_RNA	p.L623L	NM_004830	NP_004821	WXS	Illumina HiSeq	Unspecified	Q9ULK4	MED23_HUMAN		GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)	16	2043	-	Breast(56;0.0753)		623					B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Silent	SNP	ENST00000368068.3	37	c.1869C>T	CCDS5147.1																																																																																				0.423	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1			18	40	0	0	0	0.007413	0	18	40				
UNC93A	54346	broad.mit.edu	37	6	167721398	167721399	+	Splice_Site	DNP	GG	GG	TT			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr6:167721398_167721399GG>TT	ENST00000230256.3	+	7	1283	c.1108_1108GG>TT	c.(1108-1110)GGgc>TTggc	p.G370L	UNC93A_ENST00000366829.2_Splice_Site_p.G328L	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	370						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ACAAAACAATGGTGAGTCCCCA	0.609																																							uc003qvq.2		NA																	0					0						c.e7+1		unc-93 homolog A isoform 1																																				SO:0001630	splice_region_variant	54346					integral to membrane|plasma membrane		g.chr6:167721398_167721399GG>TT	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	Exception_encountered	6.37:g.167721398_167721399delinsTT			Somatic				UNC93A_uc003qvr.2_Splice_Site_p.A328_splice	p.A370_splice	NM_018974	NP_061847	WXS	Illumina HiSeq	Unspecified	Q86WB7	UN93A_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)	7	1283	+		Breast(66;7.62e-05)|Ovarian(120;0.105)						B3KRP5|Q4QQJ4|Q5JZD6	Splice_Site	DNP	ENST00000230256.3	37	c.1108_splice	CCDS5300.1																																																																																				0.609	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	Missense_Mutation	11	28	0	0	0	0.004672	0	11	28				
ITGB8	3696	broad.mit.edu	37	7	20441744	20441744	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:20441744G>T	ENST00000222573.4	+	10	2366	c.1682G>T	c.(1681-1683)tGt>tTt	p.C561F	ITGB8_ENST00000537992.1_Missense_Mutation_p.C426F	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	561	Cysteine-rich tandem repeats.				cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						GGAAATCTGTGTGCTGGTGAG	0.333																																							uc003suu.2		NA																	0				skin(3)	3						c.(1681-1683)TGT>TTT		integrin, beta 8 precursor							73.0	77.0	76.0					7																	20441744		2203	4300	6503	SO:0001583	missense	3696				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity	g.chr7:20441744G>T		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1682G>T	7.37:g.20441744G>T	ENSP00000222573:p.Cys561Phe		Somatic				ITGB8_uc011jyh.1_Missense_Mutation_p.C426F	p.C561F	NM_002214	NP_002205	WXS	Illumina HiSeq	Unspecified	P26012	ITB8_HUMAN			10	2387	+			561			III.|Cysteine-rich tandem repeats.|Extracellular (Potential).		A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	37	c.1682G>T	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321535	0.81580	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	D;D	0.99724	-3.57;-6.54	6.06	6.06	0.98353	EGF, extracellular (1);Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97211	0.9871	10	0.87932	D	0	.	20.6282	0.99521	0.0:0.0:1.0:0.0	.	561	P26012	ITB8_HUMAN	F	426;561	ENSP00000441561:C426F;ENSP00000222573:C561F	ENSP00000222573:C561F	C	+	2	0	ITGB8	20408269	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.487000	0.90454	2.871000	0.98454	0.655000	0.94253	TGT		0.333	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214		17	32	1	0	9.16793e-09	0.00499	1.32034e-08	17	32				
HOXA10	3206	broad.mit.edu	37	7	27213368	27213368	+	Silent	SNP	G	G	T	rs375513480		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:27213368G>T	ENST00000283921.4	-	1	557	c.558C>A	c.(556-558)gcC>gcA	p.A186A	RP1-170O19.20_ENST00000465941.1_Intron|RP1-170O19.20_ENST00000470747.4_Intron|HOXA10_ENST00000521421.1_5'Flank|HOXA10_ENST00000396344.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|HOXA-AS4_ENST00000523790.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	186					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						GAGCCAGTTCGGCGGCGGTGG	0.672																																							uc011jzm.1		NA																	0					0						c.(556-558)GCC>GCA		homeobox A10 isoform a							8.0	9.0	9.0					7																	27213368		2185	4285	6470	SO:0001819	synonymous_variant	3206				spermatogenesis		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27213368G>T		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.558C>A	7.37:g.27213368G>T			Somatic				HOXA10_uc003syw.3_Intron	p.A186A	NM_018951	NP_061824	WXS	Illumina HiSeq	Unspecified	P31260	HXA10_HUMAN			1	588	-			186					O43370|O43605|Q15949|Q504T1	Silent	SNP	ENST00000283921.4	37	c.558C>A	CCDS5410.2																																																																																				0.672	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2			6	12	1	0	0.00116845	0.001168	0.00135315	6	12				
AMPH	273	broad.mit.edu	37	7	38500890	38500890	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:38500890G>T	ENST00000356264.2	-	11	1225	c.1010C>A	c.(1009-1011)cCt>cAt	p.P337H	AMPH_ENST00000428293.2_Missense_Mutation_p.P337H|AMPH_ENST00000325590.5_Missense_Mutation_p.P337H	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	337					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TACCTGGGAAGGTGTTGTCAC	0.502																																							uc003tgu.2		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(1009-1011)CCT>CAT		amphiphysin isoform 1							161.0	157.0	159.0					7																	38500890		2203	4300	6503	SO:0001583	missense	273				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane		g.chr7:38500890G>T		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1010C>A	7.37:g.38500890G>T	ENSP00000348602:p.Pro337His		Somatic				AMPH_uc003tgv.2_Missense_Mutation_p.P337H|AMPH_uc003tgt.2_Missense_Mutation_p.P90H	p.P337H	NM_001635	NP_001626	WXS	Illumina HiSeq	Unspecified	P49418	AMPH_HUMAN			11	1079	-			337					A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	c.1010C>A	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376132	0.82682	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070	T;T;T	0.50001	0.76;0.76;0.76	5.77	5.77	0.91146	.	0.119566	0.64402	D	0.000020	T	0.71281	0.3321	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.988	T	0.72997	-0.4121	10	0.87932	D	0	-15.2147	19.9922	0.97370	0.0:0.0:1.0:0.0	.	337;337;93	P49418-2;P49418;Q8NFL4	.;AMPH_HUMAN;.	H	337;337;337;107;340	ENSP00000317441:P337H;ENSP00000348602:P337H;ENSP00000390734:P337H	ENSP00000317441:P337H	P	-	2	0	AMPH	38467415	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	7.895000	0.87343	2.740000	0.93945	0.557000	0.71058	CCT		0.502	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		51	91	1	0	1.32667e-27	0.00361	2.25802e-27	51	91				
SUGCT	79783	broad.mit.edu	37	7	40277289	40277289	+	Silent	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:40277289G>C	ENST00000335693.4	+	7	584	c.561G>C	c.(559-561)tcG>tcC	p.S187S	C7orf10_ENST00000401647.2_Silent_p.S187S|C7orf10_ENST00000309930.5_Silent_p.S187S	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		187					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						CTGTTGCCTCGGCTGTTTCTG	0.428																																							uc003thn.1		NA																	0				ovary(2)	2						c.(538-540)TCG>TCC		dermal papilla derived protein 13							171.0	160.0	163.0					7																	40277289		1962	4166	6128	SO:0001819	synonymous_variant	79783						transferase activity	g.chr7:40277289G>C																												ENST00000335693.4:c.561G>C	7.37:g.40277289G>C			Somatic				C7orf10_uc003thm.1_Silent_p.S150S|C7orf10_uc003tho.1_Silent_p.S180S	p.S180S	NM_024728	NP_079004	WXS	Illumina HiSeq	Unspecified	Q9HAC7	CG010_HUMAN			7	585	+			187					A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Silent	SNP	ENST00000335693.4	37	c.540G>C	CCDS55105.1	.	.	.	.	.	.	.	.	.	.	G	8.714	0.912794	0.17907	.	.	ENSG00000175600	ENST00000416370	.	.	.	5.35	-0.0848	0.13689	.	.	.	.	.	T	0.44993	0.1320	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23797	-1.0178	4	.	.	.	-8.6806	4.0185	0.09655	0.1172:0.0661:0.2471:0.5696	.	.	.	.	P	182	.	.	R	+	2	0	C7orf10	40243814	1.000000	0.71417	0.994000	0.49952	0.939000	0.58152	0.654000	0.24918	-0.145000	0.11294	-1.124000	0.02001	CGG		0.428	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1			18	50	0	0	0	0.007413	0	18	50				
TNS3	64759	broad.mit.edu	37	7	47436483	47436483	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:47436483T>C	ENST00000398879.1	-	16	1304	c.938A>G	c.(937-939)aAc>aGc	p.N313S	TNS3_ENST00000311160.9_Missense_Mutation_p.N313S|TNS3_ENST00000355730.3_Intron			Q68CZ2	TENS3_HUMAN	tensin 3	313					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						ACCGTGGTCGTTGTACAAGTG	0.527																																							uc003tnv.2		NA																	0				ovary(4)	4						c.(937-939)AAC>AGC		tensin 3							173.0	184.0	180.0					7																	47436483		2166	4270	6436	SO:0001583	missense	64759					focal adhesion	protein binding	g.chr7:47436483T>C	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.938A>G	7.37:g.47436483T>C	ENSP00000381854:p.Asn313Ser		Somatic				TNS3_uc003tnw.2_Missense_Mutation_p.N313S	p.N313S	NM_022748	NP_073585	WXS	Illumina HiSeq	Unspecified	Q68CZ2	TENS3_HUMAN			16	1305	-			313					B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	c.938A>G	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	T	6.128	0.391931	0.11581	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000457718;ENST00000450444	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	4.62	-1.78	0.07957	.	0.394383	0.28796	N	0.014111	T	0.14743	0.0356	L	0.47016	1.485	0.09310	N	0.999999	B	0.16166	0.016	B	0.12156	0.007	T	0.25467	-1.0131	10	0.24483	T	0.36	-22.243	8.9179	0.35592	0.0:0.5359:0.0:0.4641	.	313	Q68CZ2	TENS3_HUMAN	S	313;423;313;416;402	ENSP00000312143:N313S;ENSP00000381854:N313S;ENSP00000414358:N416S;ENSP00000396914:N402S	ENSP00000312143:N313S	N	-	2	0	TNS3	47403008	0.968000	0.33430	0.000000	0.03702	0.083000	0.17756	1.666000	0.37460	-0.507000	0.06549	-0.366000	0.07423	AAC		0.527	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748		6	85	0	0	0	0.001168	0	6	85				
POM121L12	285877	broad.mit.edu	37	7	53103448	53103449	+	Missense_Mutation	DNP	CC	CC	AA	rs199875299		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:53103448_53103449CC>AA	ENST00000408890.4	+	1	100_101	c.84_85CC>AA	c.(82-87)gcCCtg>gcAAtg	p.L29M		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	29										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GCCCCGACGCCCTGGCGGCTCC	0.703																																							uc003tpz.2		NA																	0					0						c.(82-87)GCCCTG>GCAATG		POM121 membrane glycoprotein-like 12																																				SO:0001583	missense	285877							g.chr7:53103448_53103449CC>AA		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	Exception_encountered	7.37:g.53103448_53103449delinsAA	ENSP00000386133:p.Leu29Met		Somatic					p.L29M	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	100_101	+			29					Q8NDI9	Missense_Mutation	DNP	ENST00000408890.4	37	c.84_85CC>AA	CCDS43584.1																																																																																				0.703	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		12	27	0	0	0	0.004672	0	12	27				
SEMA3D	223117	broad.mit.edu	37	7	84628952	84628952	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:84628952T>C	ENST00000284136.6	-	17	2181	c.2138A>G	c.(2137-2139)tAc>tGc	p.Y713C	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	713					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						GTAGTCTTTGTATCTCAACCG	0.488																																					Ovarian(63;442 1191 17318 29975 31528)	Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2		NA																	0				ovary(3)|large_intestine(2)	5						c.(2137-2139)TAC>TGC		semaphorin 3D precursor							173.0	144.0	154.0					7																	84628952		2203	4300	6503	SO:0001583	missense	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84628952T>C	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.2138A>G	7.37:g.84628952T>C	ENSP00000284136:p.Tyr713Cys		Somatic				SEMA3D_uc010led.2_Missense_Mutation_p.Y713C|SEMA3D_uc003uib.2_Missense_Mutation_p.Y352C	p.Y713C	NM_152754	NP_689967	WXS	Illumina HiSeq	Unspecified	O95025	SEM3D_HUMAN			17	2178	-			713					A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	c.2138A>G	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.953602	0.73902	.	.	ENSG00000153993	ENST00000284136	T	0.39406	1.08	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.67624	-0.5623	10	0.87932	D	0	.	16.0183	0.80460	0.0:0.0:0.0:1.0	.	713	O95025	SEM3D_HUMAN	C	713	ENSP00000284136:Y713C	ENSP00000284136:Y713C	Y	-	2	0	SEMA3D	84466888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.436000	0.80404	2.187000	0.69744	0.533000	0.62120	TAC		0.488	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		18	44	0	0	0	0.006122	0	18	44				
MUC17	140453	broad.mit.edu	37	7	100679577	100679577	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:100679577G>T	ENST00000306151.4	+	3	4944	c.4880G>T	c.(4879-4881)aGt>aTt	p.S1627I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1627	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S1627I(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAACTCCTAGTGAAGGAAGT	0.493																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(4879-4881)AGT>ATT		mucin 17 precursor							220.0	226.0	224.0					7																	100679577		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679577G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4880G>T	7.37:g.100679577G>T	ENSP00000302716:p.Ser1627Ile		Somatic				MUC17_uc010lho.1_RNA	p.S1627I	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	4933	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1627			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|25.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.4880G>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	1.148	-0.647523	0.03506	.	.	ENSG00000169876	ENST00000306151	T	0.02067	4.47	0.683	-1.37	0.09056	.	.	.	.	.	T	0.01454	0.0047	N	0.24115	0.695	0.09310	N	1	B	0.27594	0.182	B	0.12156	0.007	T	0.46512	-0.9186	9	0.35671	T	0.21	.	3.7202	0.08453	0.0:0.0:0.5811:0.4189	.	1627	Q685J3	MUC17_HUMAN	I	1627	ENSP00000302716:S1627I	ENSP00000302716:S1627I	S	+	2	0	MUC17	100466297	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.216000	0.02982	-0.478000	0.06823	0.134000	0.15878	AGT		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		71	244	1	0	2.36135e-34	0.00361	4.0809e-34	71	244				
LAMB4	22798	broad.mit.edu	37	7	107708521	107708521	+	Missense_Mutation	SNP	C	C	G	rs544784448		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:107708521C>G	ENST00000388781.3	-	19	2469	c.2386G>C	c.(2386-2388)Ggg>Cgg	p.G796R	LAMB4_ENST00000388780.3_Missense_Mutation_p.G796R|LAMB4_ENST00000205386.4_Missense_Mutation_p.G796R	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	796	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CAGCAGCGCCCGACCACAAGA	0.567																																							uc010ljo.1		NA																	0				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(2386-2388)GGG>CGG		laminin, beta 4 precursor							171.0	160.0	164.0					7																	107708521		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107708521C>G	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2386G>C	7.37:g.107708521C>G	ENSP00000373433:p.Gly796Arg		Somatic				LAMB4_uc003vey.2_Missense_Mutation_p.G796R	p.G796R	NM_007356	NP_031382	WXS	Illumina HiSeq	Unspecified	A4D0S4	LAMB4_HUMAN			19	2470	-			796			Laminin EGF-like 6.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.2386G>C	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971715	0.74246	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	D;D;D	0.85629	-2.01;-2.01;-2.01	4.78	4.78	0.61160	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.000000	0.56097	D	0.000034	D	0.94476	0.8222	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95672	0.8724	10	0.87932	D	0	.	18.3584	0.90367	0.0:1.0:0.0:0.0	.	796	A4D0S4	LAMB4_HUMAN	R	796	ENSP00000205386:G796R;ENSP00000373433:G796R;ENSP00000373432:G796R	ENSP00000205386:G796R	G	-	1	0	LAMB4	107495757	1.000000	0.71417	0.686000	0.30086	0.350000	0.29205	5.361000	0.66092	2.640000	0.89533	0.655000	0.94253	GGG		0.567	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		7	174	0	0	0	0.001984	0	7	174				
TMEM168	64418	broad.mit.edu	37	7	112407566	112407566	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:112407566C>G	ENST00000312814.6	-	5	2340	c.1780G>C	c.(1780-1782)Gaa>Caa	p.E594Q	TMEM168_ENST00000454074.1_Missense_Mutation_p.E594Q	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	594						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						CAGTTATATTCTACCCAGTCT	0.433																																							uc003vgn.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1780-1782)GAA>CAA		transmembrane protein 168							122.0	111.0	115.0					7																	112407566		2203	4300	6503	SO:0001583	missense	64418					integral to membrane|transport vesicle		g.chr7:112407566C>G		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1780G>C	7.37:g.112407566C>G	ENSP00000323068:p.Glu594Gln		Somatic				TMEM168_uc010lju.2_Missense_Mutation_p.E594Q|TMEM168_uc011kmr.1_Missense_Mutation_p.E210Q	p.E594Q	NM_022484	NP_071929	WXS	Illumina HiSeq	Unspecified	Q9H0V1	TM168_HUMAN			5	2172	-			594					A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	ENST00000312814.6	37	c.1780G>C	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715474	0.68844	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000447395;ENST00000418785	.	.	.	5.71	5.71	0.89125	.	0.046820	0.85682	D	0.000000	T	0.60327	0.2260	L	0.40543	1.245	0.58432	D	0.999998	D	0.57571	0.98	P	0.50352	0.638	T	0.54748	-0.8247	9	0.29301	T	0.29	-32.2377	19.8516	0.96743	0.0:1.0:0.0:0.0	.	594	Q9H0V1	TM168_HUMAN	Q	594;594;210;155	.	ENSP00000323068:E594Q	E	-	1	0	TMEM168	112194802	1.000000	0.71417	0.983000	0.44433	0.998000	0.95712	6.008000	0.70739	2.685000	0.91497	0.585000	0.79938	GAA		0.433	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484		13	29	0	0	0	0.00245	0	13	29				
PLXNA4	91584	broad.mit.edu	37	7	132192477	132192477	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:132192477G>C	ENST00000359827.3	-	2	1938	c.976C>G	c.(976-978)Ctt>Gtt	p.L326V	PLXNA4_ENST00000321063.4_Missense_Mutation_p.L326V|PLXNA4_ENST00000423507.2_Missense_Mutation_p.L326V|PLXNA4_ENST00000378539.5_Missense_Mutation_p.L326V			Q9HCM2	PLXA4_HUMAN	plexin A4	326	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGGACTCCAAGGGTCCTGCCA	0.587																																							uc003vra.3		NA																	0				ovary(1)	1						c.(976-978)CTT>GTT		plexin A4 isoform 1							64.0	58.0	60.0					7																	132192477		2203	4300	6503	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:132192477G>C	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.976C>G	7.37:g.132192477G>C	ENSP00000352882:p.Leu326Val		Somatic				PLXNA4_uc003vrc.2_Missense_Mutation_p.L326V|PLXNA4_uc003vrb.2_Missense_Mutation_p.L326V	p.L326V	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			2	1205	-			326			Extracellular (Potential).|Sema.		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.976C>G	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341246	0.41498	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	5.72	4.66	0.58398	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.46758	U	0.000264	T	0.25269	0.0614	M	0.78285	2.405	0.54753	D	0.999988	D;D;D	0.71674	0.998;0.995;0.985	D;D;P	0.74348	0.982;0.983;0.903	T	0.00159	-1.1974	10	0.41790	T	0.15	.	9.4429	0.38679	0.2264:0.0:0.7736:0.0	.	326;326;326	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	V	326	ENSP00000323194:L326V;ENSP00000352882:L326V;ENSP00000392772:L326V;ENSP00000367800:L326V	ENSP00000323194:L326V	L	-	1	0	PLXNA4	131843017	1.000000	0.71417	0.994000	0.49952	0.587000	0.36485	2.219000	0.42899	2.709000	0.92574	0.655000	0.94253	CTT		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		17	27	0	0	0	0.007413	0	17	27				
EPHB6	2051	broad.mit.edu	37	7	142561001	142561001	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:142561001G>T	ENST00000392957.2	+	5	803	c.16G>T	c.(16-18)Gct>Tct	p.A6S	EPHB6_ENST00000411471.2_Missense_Mutation_p.A6S|EPHB6_ENST00000442129.1_Missense_Mutation_p.A6S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	6						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					TACTGAAGGGGCTGCCCAGTT	0.607																																							uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(16-18)GCT>TCT		ephrin receptor EphB6 precursor							77.0	60.0	66.0					7																	142561001		2203	4300	6503	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142561001G>T	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.16G>T	7.37:g.142561001G>T	ENSP00000376684:p.Ala6Ser		Somatic				EPHB6_uc011ksu.1_Missense_Mutation_p.A6S|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_5'UTR	p.A6S	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			5	803	+	Melanoma(164;0.059)		6					A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.16G>T	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348383	0.24426	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.71222	-0.49;-0.49;-0.55	5.87	1.38	0.22167	.	.	.	.	.	T	0.46541	0.1398	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.16289	0.015	T	0.35176	-0.9799	9	0.59425	D	0.04	.	4.6501	0.12591	0.3092:0.1552:0.5356:0.0	.	6	O15197	EPHB6_HUMAN	S	6	ENSP00000376684:A6S;ENSP00000410789:A6S;ENSP00000409061:A6S	ENSP00000376684:A6S	A	+	1	0	EPHB6	142271123	0.190000	0.23276	0.126000	0.21872	0.378000	0.30076	-0.031000	0.12287	-0.026000	0.13895	-0.176000	0.13171	GCT		0.607	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			4	24	1	0	0.00024832	0.000248	0.000298871	4	24				
CNTNAP2	26047	broad.mit.edu	37	7	146825897	146825897	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:146825897C>A	ENST00000361727.3	+	7	1568	c.1052C>A	c.(1051-1053)gCc>gAc	p.A351D		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	351	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACTGATCTTGCCAGAAGGAAG	0.393										HNSCC(39;0.1)																													uc003weu.1		NA																	0				ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1051-1053)GCC>GAC		cell recognition molecule Caspr2 precursor							110.0	113.0	112.0					7																	146825897		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146825897C>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1052C>A	7.37:g.146825897C>A	ENSP00000354778:p.Ala351Asp	HNSCC(39;0.1)	Somatic					p.A351D	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		7	1568	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	351			Laminin G-like 1.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1052C>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570471	0.86542	.	.	ENSG00000174469	ENST00000361727	D	0.90004	-2.6	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.64402	D	0.000011	D	0.94411	0.8202	M	0.84082	2.675	0.80722	D	1	D	0.65815	0.995	D	0.62955	0.909	D	0.94491	0.7701	10	0.59425	D	0.04	.	18.2754	0.90081	0.0:1.0:0.0:0.0	.	351	Q9UHC6	CNTP2_HUMAN	D	351	ENSP00000354778:A351D	ENSP00000354778:A351D	A	+	2	0	CNTNAP2	146456830	0.998000	0.40836	0.992000	0.48379	0.997000	0.91878	3.241000	0.51376	2.674000	0.91012	0.655000	0.94253	GCC		0.393	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			20	73	1	0	2.89027e-11	0.002299	4.3678e-11	20	73				
KMT2C	58508	broad.mit.edu	37	7	151970862	151970862	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr7:151970862C>A	ENST00000262189.6	-	7	1158	c.940G>T	c.(940-942)Gcc>Tcc	p.A314S	KMT2C_ENST00000355193.2_Missense_Mutation_p.A314S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	314					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAGGTGCCGGCTCCTGCAGCA	0.438																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(940-942)GCC>TCC		myeloid/lymphoid or mixed-lineage leukemia 3							249.0	232.0	238.0					7																	151970862		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151970862C>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.940G>T	7.37:g.151970862C>A	ENSP00000262189:p.Ala314Ser		Somatic					p.A314S	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	7	1159	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	314					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.940G>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158661	0.57368	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.71579	-0.58;-0.58	4.87	4.87	0.63330	Zinc finger, PHD-type (1);	0.000000	0.44285	D	0.000477	T	0.66877	0.2834	N	0.16066	0.365	0.80722	D	1	P	0.45283	0.855	P	0.53313	0.723	T	0.64462	-0.6402	10	0.22109	T	0.4	.	18.3752	0.90433	0.0:1.0:0.0:0.0	.	314	Q8NEZ4	MLL3_HUMAN	S	314	ENSP00000262189:A314S;ENSP00000347325:A314S	ENSP00000262189:A314S	A	-	1	0	MLL3	151601795	1.000000	0.71417	0.882000	0.34594	0.961000	0.63080	7.752000	0.85141	2.423000	0.82170	0.650000	0.86243	GCC		0.438	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			6	153	1	0	3.59834e-05	0.001168	4.47468e-05	6	153				
RAB11FIP1	80223	broad.mit.edu	37	8	37756794	37756794	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:37756794C>A	ENST00000330843.4	-	1	178	c.166G>T	c.(166-168)Gtg>Ttg	p.V56L	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.V56L	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	56	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CGCTCCGACACGGAGGTGGCG	0.751																																							uc003xkm.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(166-168)GTG>TTG		RAB11 family interacting protein 1 isoform 3							11.0	14.0	13.0					8																	37756794		2189	4277	6466	SO:0001583	missense	80223				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding	g.chr8:37756794C>A	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.166G>T	8.37:g.37756794C>A	ENSP00000331342:p.Val56Leu		Somatic				RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Missense_Mutation_p.V56L	p.V56L	NM_001002814	NP_001002814	WXS	Illumina HiSeq	Unspecified	Q6WKZ4	RFIP1_HUMAN	LUSC - Lung squamous cell carcinoma(8;3.62e-11)		1	210	-		Lung NSC(58;0.118)|all_lung(54;0.195)	56			C2.		J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	c.166G>T	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	c	35	5.421697	0.96111	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000343853	T;T	0.75260	-0.92;-0.92	5.05	5.05	0.67936	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000037	D	0.88962	0.6580	M	0.90595	3.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91270	0.5043	10	0.72032	D	0.01	-8.4875	18.0352	0.89298	0.0:1.0:0.0:0.0	.	56;56	Q6WKZ4-3;Q6WKZ4	.;RFIP1_HUMAN	L	56	ENSP00000287263:V56L;ENSP00000331342:V56L	ENSP00000287263:V56L	V	-	1	0	RAB11FIP1	37875952	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.573000	0.82421	2.346000	0.79739	0.645000	0.84053	GTG		0.751	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151		9	27	1	0	0.00448238	0.004482	0.00505205	9	27				
SLCO5A1	81796	broad.mit.edu	37	8	70744733	70744733	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:70744733G>T	ENST00000260126.4	-	2	882	c.176C>A	c.(175-177)cCg>cAg	p.P59Q	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.P59Q|SLCO5A1_ENST00000528658.1_5'UTR|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.P59Q|RP11-159H10.3_ENST00000528800.2_RNA|RP11-159H10.3_ENST00000501104.2_RNA|RP11-159H10.3_ENST00000533300.1_RNA	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GCCAAAGGCCGGGTTGGCGTC	0.657											OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003xyl.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(175-177)CCG>CAG		solute carrier organic anion transporter family,							35.0	38.0	37.0					8																	70744733		2203	4300	6503	SO:0001583	missense	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70744733G>T	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.176C>A	8.37:g.70744733G>T	ENSP00000260126:p.Pro59Gln		Somatic	OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1124	SLCO5A1_uc010lzb.2_Missense_Mutation_p.P59Q|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.P59Q|SLCO5A1_uc010lzc.2_Missense_Mutation_p.P59Q	p.P59Q	NM_030958	NP_112220	WXS	Illumina HiSeq	Unspecified	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		2	883	-	Breast(64;0.0654)		59			Cytoplasmic (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	c.176C>A	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	G	6.807	0.517941	0.13005	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.40476	1.18;1.54;1.03	5.46	3.66	0.41972	.	1.619920	0.03563	N	0.227315	T	0.40423	0.1116	N	0.24115	0.695	0.09310	N	1	P;D;P;B	0.59357	0.911;0.985;0.8;0.302	B;P;B;B	0.51415	0.397;0.669;0.301;0.223	T	0.27739	-1.0065	10	0.18710	T	0.47	.	7.9027	0.29744	0.1925:0.0:0.8075:0.0	.	59;59;59;59	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	Q	59	ENSP00000260126:P59Q;ENSP00000434422:P59Q;ENSP00000431611:P59Q	ENSP00000260126:P59Q	P	-	2	0	SLCO5A1	70907287	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.064000	0.14437	0.676000	0.31285	-0.347000	0.07816	CCG		0.657	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		14	46	1	0	9.31168e-06	0.001855	1.2116e-05	14	46				
KCNB2	9312	broad.mit.edu	37	8	73849655	73849655	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:73849655A>T	ENST00000523207.1	+	3	2653	c.2065A>T	c.(2065-2067)Agt>Tgt	p.S689C		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	689					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TGGGCTACATAGTCCTTTGCA	0.512																																							uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(2065-2067)AGT>TGT		potassium voltage-gated channel, Shab-related							61.0	60.0	61.0					8																	73849655		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73849655A>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2065A>T	8.37:g.73849655A>T	ENSP00000430846:p.Ser689Cys		Somatic					p.S689C	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	2653	+	Breast(64;0.137)		689			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.2065A>T	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	A	8.280	0.815286	0.16607	.	.	ENSG00000182674	ENST00000523207	T	0.25250	1.81	4.65	1.89	0.25635	.	1.650410	0.03695	N	0.247710	T	0.22166	0.0534	N	0.08118	0	0.23120	N	0.998267	P	0.36125	0.538	B	0.43680	0.427	T	0.43909	-0.9362	10	0.66056	D	0.02	.	9.8263	0.40914	0.1662:0.0:0.8338:0.0	.	689	Q92953	KCNB2_HUMAN	C	689	ENSP00000430846:S689C	ENSP00000430846:S689C	S	+	1	0	KCNB2	74012209	0.998000	0.40836	0.080000	0.20451	0.504000	0.33889	3.020000	0.49643	0.283000	0.22279	-0.326000	0.08463	AGT		0.512	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		25	48	0	0	0	0.003954	0	25	48				
ZFHX4	79776	broad.mit.edu	37	8	77776363	77776363	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:77776363C>A	ENST00000521891.2	+	11	10861	c.10413C>A	c.(10411-10413)caC>caA	p.H3471Q	ZFHX4_ENST00000050961.6_Missense_Mutation_p.H3422Q|ZFHX4_ENST00000455469.2_Missense_Mutation_p.H3426Q|ZFHX4_ENST00000518282.1_Missense_Mutation_p.H3445Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3422	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAGCTTGCACAAAGAGAAAA	0.448										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10276-10278)CAC>CAA		zinc finger homeodomain 4							107.0	103.0	104.0					8																	77776363		2068	4208	6276	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776363C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10413C>A	8.37:g.77776363C>A	ENSP00000430497:p.His3471Gln	HNSCC(33;0.089)	Somatic					p.H3426Q	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10665	+			3422			C2H2-type 20.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.10278C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523207	0.44866	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	4.75	4.75	0.60458	.	0.000000	0.47093	U	0.000253	D	0.98030	0.9351	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99170	1.0864	10	0.87932	D	0	.	17.964	0.89094	0.0:1.0:0.0:0.0	.	3426	Q86UP3-4	.	Q	3471;3455;3426;3422;3445	ENSP00000430497:H3471Q;ENSP00000399605:H3426Q;ENSP00000050961:H3422Q;ENSP00000430848:H3445Q	ENSP00000050961:H3422Q	H	+	3	2	ZFHX4	77938918	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.563000	0.82314	2.482000	0.83794	0.650000	0.86243	CAC		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		18	39	1	0	5.01169e-05	0.00499	6.16402e-05	18	39				
LRRCC1	85444	broad.mit.edu	37	8	86025216	86025216	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:86025216A>G	ENST00000360375.3	+	4	575	c.426A>G	c.(424-426)ctA>ctG	p.L142L	LRRCC1_ENST00000414626.2_Silent_p.L122L	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	142					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						ATATTGATCTACATAGTAATC	0.343																																							uc003ycw.2		NA																	0					0						c.(424-426)CTA>CTG		sodium channel associated protein 2 isoform a							118.0	112.0	114.0					8																	86025216		1867	4092	5959	SO:0001819	synonymous_variant	85444				cell division|mitosis	centriole|nucleus		g.chr8:86025216A>G	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.426A>G	8.37:g.86025216A>G			Somatic				LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_5'UTR|LRRCC1_uc003ycx.2_Silent_p.L49L|LRRCC1_uc003ycy.2_Silent_p.L122L	p.L142L	NM_033402	NP_208325	WXS	Illumina HiSeq	Unspecified	Q9C099	LRCC1_HUMAN			4	580	+			142			LRR 5.		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Silent	SNP	ENST00000360375.3	37	c.426A>G	CCDS43750.1																																																																																				0.343	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402		20	24	0	0	0	0.002299	0	20	24				
RAD54B	25788	broad.mit.edu	37	8	95392404	95392404	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:95392404T>G	ENST00000336148.5	-	12	2340	c.2216A>C	c.(2215-2217)gAc>gCc	p.D739A		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	739	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			CCAATCAATGTCATAGAGAAT	0.338								Direct reversal of damage;Homologous recombination																															uc003ygk.2		NA																	0				kidney(2)|lung(1)|skin(1)	4						c.(2215-2217)GAC>GCC	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							51.0	50.0	50.0					8																	95392404		2203	4300	6503	SO:0001583	missense	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95392404T>G	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2216A>C	8.37:g.95392404T>G	ENSP00000336606:p.Asp739Ala		Somatic				RAD54B_uc010may.1_Missense_Mutation_p.D546A	p.D739A	NM_012415	NP_036547	WXS	Illumina HiSeq	Unspecified	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		12	2314	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	c.2216A>C	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559966	0.86335	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.81821	-1.54	5.83	5.83	0.93111	Helicase, C-terminal (3);	0.097194	0.64402	D	0.000002	D	0.94016	0.8083	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96186	0.9134	10	0.87932	D	0	-24.0909	14.7657	0.69637	0.0:0.0:0.0:1.0	.	739	Q9Y620	RA54B_HUMAN	A	739;411	ENSP00000336606:D739A	ENSP00000336606:D739A	D	-	2	0	RAD54B	95461580	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.841000	0.86834	2.228000	0.72767	0.528000	0.53228	GAC		0.338	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		17	26	0	0	0	0.004007	0	17	26				
PTDSS1	9791	broad.mit.edu	37	8	97296350	97296350	+	Silent	SNP	A	A	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:97296350A>T	ENST00000517309.1	+	3	611	c.285A>T	c.(283-285)cgA>cgT	p.R95R	PTDSS1_ENST00000455950.2_Intron|PTDSS1_ENST00000518776.1_3'UTR	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	95					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CGTTCACTCGACCTCATCCAG	0.353																																							uc003yht.1		NA																	0				ovary(1)	1						c.(283-285)CGA>CGT		phosphatidylserine synthase 1	Phosphatidylserine(DB00144)						155.0	156.0	156.0					8																	97296350		2203	4300	6503	SO:0001819	synonymous_variant	9791				phosphatidylserine biosynthetic process	integral to membrane	transferase activity	g.chr8:97296350A>T	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.285A>T	8.37:g.97296350A>T			Somatic				PTDSS1_uc003yhu.1_Intron	p.R95R	NM_014754	NP_055569	WXS	Illumina HiSeq	Unspecified	P48651	PTSS1_HUMAN			3	387	+	Breast(36;6.18e-05)		95					E5RFC5|Q9BUQ5	Silent	SNP	ENST00000517309.1	37	c.285A>T	CCDS6271.1																																																																																				0.353	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2			4	67	0	0	0	0.000248	0	4	67				
POP1	10940	broad.mit.edu	37	8	99142321	99142321	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:99142321G>A	ENST00000401707.2	+	5	683	c.602G>A	c.(601-603)tGg>tAg	p.W201*	POP1_ENST00000349693.3_Nonsense_Mutation_p.W201*	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	201					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AAGAACATTTGGTTAGAAACT	0.448																																							uc003yij.3		NA																	0				ovary(1)|breast(1)	2						c.(601-603)TGG>TAG		processing of precursor 1							71.0	68.0	69.0					8																	99142321		2203	4300	6503	SO:0001587	stop_gained	10940				tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity	g.chr8:99142321G>A	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.602G>A	8.37:g.99142321G>A	ENSP00000385787:p.Trp201*		Somatic				POP1_uc011lgv.1_Nonsense_Mutation_p.W201*|POP1_uc003yik.2_Nonsense_Mutation_p.W201*	p.W201*	NM_001145860	NP_001139332	WXS	Illumina HiSeq	Unspecified	Q99575	POP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.145)		5	702	+	Breast(36;1.78e-06)		201					A8K5W9|Q15037	Nonsense_Mutation	SNP	ENST00000401707.2	37	c.602G>A	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	G	36	5.780737	0.96929	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	.	.	.	5.81	5.81	0.92471	.	0.087235	0.50627	D	0.000110	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.93	17.8794	0.88835	0.0:0.0:1.0:0.0	.	.	.	.	X	201	.	.	W	+	2	0	POP1	99211497	1.000000	0.71417	0.982000	0.44146	0.960000	0.62799	9.756000	0.98918	2.746000	0.94184	0.591000	0.81541	TGG		0.448	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029		24	31	0	0	0	0.00278	0	24	31				
VPS13B	157680	broad.mit.edu	37	8	100829872	100829872	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:100829872G>A	ENST00000358544.2	+	45	8388	c.8277G>A	c.(8275-8277)cgG>cgA	p.R2759R	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.R2734R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2759					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTGTAGTTCGGGAACATTTTG	0.423																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(8275-8277)CGG>CGA		vacuolar protein sorting 13B isoform 5							129.0	119.0	123.0					8																	100829872		2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100829872G>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8277G>A	8.37:g.100829872G>A			Somatic				VPS13B_uc003yiw.2_Silent_p.R2734R	p.R2759R	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		45	8388	+	Breast(36;3.73e-07)		2759					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.8277G>A	CCDS6280.1																																																																																				0.423	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		22	44	0	0	0	0.002299	0	22	44				
HAS2	3037	broad.mit.edu	37	8	122641356	122641356	+	Silent	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:122641356T>C	ENST00000303924.4	-	2	762	c.225A>G	c.(223-225)ctA>ctG	p.L75L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	75					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGGGGGTTTCTAGGGATTTTT	0.413																																							uc003yph.2		NA																HAS2/PLAG1(10)	0				soft_tissue(10)|ovary(5)	15						c.(223-225)CTA>CTG		hyaluronan synthase 2							250.0	257.0	254.0					8																	122641356		2203	4300	6503	SO:0001819	synonymous_variant	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122641356T>C	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.225A>G	8.37:g.122641356T>C			Somatic					p.L75L	NM_005328	NP_005319	WXS	Illumina HiSeq	Unspecified	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		2	763	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		75			Cytoplasmic (Potential).		Q32MM3	Silent	SNP	ENST00000303924.4	37	c.225A>G	CCDS6335.1																																																																																				0.413	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		34	184	0	0	0	0.002836	0	34	184				
CYP11B1	1584	broad.mit.edu	37	8	143957227	143957227	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:143957227C>A	ENST00000292427.4	-	6	1054	c.1022G>T	c.(1021-1023)cGc>cTc	p.R341L	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R412L|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R341L	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	341					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GCTCTCCTGGCGCAGGGCCTG	0.642									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	0				ovary(3)	3						c.(1021-1023)CGC>CTC		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						76.0	78.0	78.0					8																	143957227		2203	4300	6503	SO:0001583	missense	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143957227C>A	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1022G>T	8.37:g.143957227C>A	ENSP00000292427:p.Arg341Leu		Somatic				CYP11B1_uc010mex.2_Missense_Mutation_p.R17L|CYP11B1_uc003yxh.2_Missense_Mutation_p.R57L|CYP11B1_uc003yxj.2_Missense_Mutation_p.R341L|CYP11B1_uc010mey.2_Missense_Mutation_p.R412L	p.R341L	NM_000497	NP_000488	WXS	Illumina HiSeq	Unspecified	P15538	C11B1_HUMAN			6	1029	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		341					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	c.1022G>T	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	25.3	4.628715	0.87560	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.72051	-0.62;2.41;-0.62	4.42	4.42	0.53409	.	0.126247	0.31963	N	0.006789	T	0.82066	0.4956	M	0.70787	2.145	0.53005	D	0.999962	D;D;D;D;D	0.89917	1.0;0.997;0.998;0.995;1.0	D;D;D;D;D	0.83275	0.993;0.988;0.988;0.945;0.996	T	0.81741	-0.0794	10	0.37606	T	0.19	.	14.8598	0.70372	0.0:1.0:0.0:0.0	.	412;341;341;341;57	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	L	341;341;412	ENSP00000292427:R341L;ENSP00000428043:R341L;ENSP00000366903:R412L	ENSP00000292427:R341L	R	-	2	0	CYP11B1	143954229	0.021000	0.18746	0.994000	0.49952	0.811000	0.45836	2.466000	0.45084	2.169000	0.68431	0.555000	0.69702	CGC		0.642	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			52	108	1	0	7.47603e-22	0.00361	1.23501e-21	52	108				
APBA1	320	broad.mit.edu	37	9	72055918	72055918	+	Silent	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:72055918A>G	ENST00000265381.4	-	11	2517	c.2295T>C	c.(2293-2295)aaT>aaC	p.N765N		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	765	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TTACAATTCCATTCTGGACGC	0.483																																							uc004ahh.2		NA																	0				lung(1)	1						c.(2293-2295)AAT>AAC		amyloid beta A4 precursor protein-binding,							163.0	148.0	153.0					9																	72055918		2203	4300	6503	SO:0001819	synonymous_variant	320				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle		g.chr9:72055918A>G	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2295T>C	9.37:g.72055918A>G			Somatic					p.N765N	NM_001163	NP_001154	WXS	Illumina HiSeq	Unspecified	Q02410	APBA1_HUMAN			11	2571	-			765			PDZ 2.		O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	c.2295T>C	CCDS6630.1																																																																																				0.483	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163		8	63	0	0	0	0.008291	0	8	63				
Unknown	0	broad.mit.edu	37	9	79013852	79013852	+	IGR	SNP	A	A	G			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:79013852A>G								RFK (4419 upstream) : GCNT1 (20899 downstream)																							TATATCCTCCAGGAATACTGG	0.498																																							uc011lsj.1		NA																	0					0						c.(238-240)AGG>GGG		SubName: Full=Laminin receptor-like protein LAMRL5;																																				SO:0001628	intergenic_variant	653162							g.chr9:79013852A>G																													9.37:g.79013852A>G			Somatic					p.R80G	NR_026890		WXS	Illumina HiSeq	Unspecified					1	338	+									Missense_Mutation	SNP		37	c.238A>G																																																																																				0	0.498									6	25	0	0	0	0.001168	0	6	25				
PRUNE2	158471	broad.mit.edu	37	9	79267540	79267540	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:79267540G>C	ENST00000376718.3	-	11	8539	c.8416C>G	c.(8416-8418)Cca>Gca	p.P2806A	PRUNE2_ENST00000428286.1_Missense_Mutation_p.P2447A|PRUNE2_ENST00000223609.6_Missense_Mutation_p.P70A|PRUNE2_ENST00000443509.2_Missense_Mutation_p.P55A|PRUNE2_ENST00000466266.2_5'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2806					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TTGATATTTGGGGCTGTGAGC	0.393																																							uc010mpk.2		NA																	0					0						c.(8416-8418)CCA>GCA		prune homolog 2							204.0	190.0	194.0					9																	79267540		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79267540G>C	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8416C>G	9.37:g.79267540G>C	ENSP00000365908:p.Pro2806Ala		Somatic				PRUNE2_uc011lsk.1_Missense_Mutation_p.P55A|PRUNE2_uc011lsl.1_Missense_Mutation_p.P70A|PRUNE2_uc011lsm.1_Missense_Mutation_p.P70A|PRUNE2_uc004akj.3_Missense_Mutation_p.P259A|PRUNE2_uc010mpl.1_Missense_Mutation_p.P259A	p.P2806A	NM_015225	NP_056040	WXS	Illumina HiSeq	Unspecified	Q8WUY3	PRUN2_HUMAN			11	8540	-			2806					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.8416C>G	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.696132|4.696132	0.88830|0.88830	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376717;ENST00000376718;ENST00000428286;ENST00000441554;ENST00000443509;ENST00000223609;ENST00000422033|ENST00000426088	T;T;T;T;T|.	0.69306|.	0.04;-0.39;-0.3;0.06;0.1|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.84955|0.84955	0.5587|0.5587	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;0.969;1.0;0.994;1.0|.	D;P;D;D;D|.	0.97110|.	0.999;0.868;0.999;0.975;1.0|.	D|D	0.86224|0.86224	0.1633|0.1633	10|6	0.51188|.	T|.	0.08|.	-17.2799|-17.2799	19.9659|19.9659	0.97266|0.97266	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	70;70;55;2806;2806|.	B4DSQ3;Q8WUY3-5;B4DJW7;Q8WUY3-3;Q8WUY3|.	.;.;.;.;PRUN2_HUMAN|.	A|R	70;2806;2447;24;55;70;2805|2127	ENSP00000365907:P70A;ENSP00000365908:P2806A;ENSP00000397425:P2447A;ENSP00000393843:P55A;ENSP00000223609:P70A|.	ENSP00000223609:P70A|.	P|P	-|-	1|2	0|0	PRUNE2|PRUNE2	78457360|78457360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	9.327000|9.327000	0.96396|0.96396	2.802000|2.802000	0.96397|0.96397	0.650000|0.650000	0.86243|0.86243	CCA|CCC		0.393	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		57	73	0	0	0	0.00361	0	57	73				
TBC1D2	55357	broad.mit.edu	37	9	101014106	101014106	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:101014106C>A	ENST00000375064.1	-	2	510	c.472G>T	c.(472-474)Gcc>Tcc	p.A158S	TBC1D2_ENST00000375066.5_Missense_Mutation_p.A158S|TBC1D2_ENST00000342112.5_Intron	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	158	Interaction with CADH1.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CCAGCCAGGGCGGCATCAGGG	0.637																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(472-474)GCC>TCC		TBC1 domain family, member 2							68.0	62.0	64.0					9																	101014106		2203	4300	6503	SO:0001583	missense	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:101014106C>A	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.472G>T	9.37:g.101014106C>A	ENSP00000364205:p.Ala158Ser		Somatic				TBC1D2_uc004ayq.2_Missense_Mutation_p.A158S|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Missense_Mutation_p.A158S	p.A158S	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	2	652	-		Myeloproliferative disorder(762;0.0255)	158			Interaction with CADH1.		B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	ENST00000375064.1	37	c.472G>T		.	.	.	.	.	.	.	.	.	.	C	7.080	0.570063	0.13560	.	.	ENSG00000095383	ENST00000375064;ENST00000375066	T;T	0.08634	3.36;3.07	5.07	-1.35	0.09114	.	1.118960	0.06735	N	0.777421	T	0.07234	0.0183	L	0.51422	1.61	0.25593	N	0.986672	B;B	0.30634	0.057;0.288	B;B	0.22880	0.019;0.042	T	0.43637	-0.9379	10	0.09843	T	0.71	.	9.1047	0.36689	0.0:0.4912:0.0:0.5088	.	158;158	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	S	158	ENSP00000364205:A158S;ENSP00000364207:A158S	ENSP00000364205:A158S	A	-	1	0	TBC1D2	100053927	0.000000	0.05858	0.003000	0.11579	0.319000	0.28217	-1.902000	0.01596	-0.292000	0.08999	0.305000	0.20034	GCC		0.637	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		7	55	1	0	0.00198382	0.001984	0.00226626	7	55				
HSPA5	3309	broad.mit.edu	37	9	128000949	128000949	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:128000949G>C	ENST00000324460.6	-	6	1357	c.1154C>G	c.(1153-1155)tCc>tGc	p.S385C	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	385					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	TATGCCACGGGATGGTTCCTT	0.463										Prostate(1;0.17)																													uc004bpn.2		NA																	0				ovary(3)|skin(1)	4						c.(1153-1155)TCC>TGC		heat shock 70kDa protein 5	Antihemophilic Factor(DB00025)						121.0	103.0	109.0					9																	128000949		2203	4300	6503	SO:0001583	missense	3309				anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding	g.chr9:128000949G>C		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1154C>G	9.37:g.128000949G>C	ENSP00000324173:p.Ser385Cys	Prostate(1;0.17)	Somatic					p.S385C	NM_005347	NP_005338	WXS	Illumina HiSeq	Unspecified	P11021	GRP78_HUMAN			6	1410	-			385					B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	c.1154C>G	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351133	0.61183	.	.	ENSG00000044574	ENST00000324460	T	0.01099	5.34	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.02304	0.0071	M	0.62154	1.92	0.80722	D	1	B	0.15930	0.015	B	0.20384	0.029	T	0.52328	-0.8590	10	0.45353	T	0.12	-26.8157	16.4549	0.84009	0.0:0.0:1.0:0.0	.	385	P11021	GRP78_HUMAN	C	385	ENSP00000324173:S385C	ENSP00000324173:S385C	S	-	2	0	HSPA5	127040770	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.773000	0.75006	2.097000	0.63578	0.563000	0.77884	TCC		0.463	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			26	17	0	0	0	0.003954	0	26	17				
AIF1L	83543	broad.mit.edu	37	9	133986984	133986984	+	Splice_Site	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:133986984G>T	ENST00000247291.3	+	3	182	c.94G>T	c.(94-96)Gag>Tag	p.E32*	AIF1L_ENST00000372301.2_5'UTR|AIF1L_ENST00000372300.1_Splice_Site_p.E32*|AIF1L_ENST00000372297.2_5'UTR|AIF1L_ENST00000372312.3_Splice_Site_p.E37*|AIF1L_ENST00000472942.1_3'UTR|AIF1L_ENST00000372298.1_Splice_Site_p.E32*|AIF1L_ENST00000372302.1_Splice_Site_p.E32*|AIF1L_ENST00000372309.3_Splice_Site_p.E58*	NM_031426.3	NP_113614.1	Q9BQI0	AIF1L_HUMAN	allograft inflammatory factor 1-like	32						actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			lung(2)	2						ACCTCTTTAGGAGTTTCTGTG	0.547																																					Esophageal Squamous(95;611 1423 5044 34794 42333)	Esophageal Squamous(95;611 1423 5044 34794 42333)	uc004cab.1		NA																	0					0						c.(94-96)GAG>TAG		ionized calcium binding adapter molecule 2							194.0	201.0	199.0					9																	133986984		2203	4300	6503	SO:0001630	splice_region_variant	83543					actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding	g.chr9:133986984G>T	AL136566	CCDS6939.1, CCDS55348.1, CCDS55349.1	9q34.13-q34.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000126878	ENSG00000126878		"""EF-hand domain containing"""	28904	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 58"""	C9orf58		11230166	Standard	NM_001185095		Approved	IBA2, FLJ12783	uc004cad.2	Q9BQI0	OTTHUMG00000020817	ENST00000247291.3:c.94-1G>T	9.37:g.133986984G>T			Somatic				AIF1L_uc004cad.1_Nonsense_Mutation_p.E58*|AIF1L_uc004cae.1_Nonsense_Mutation_p.E32*|AIF1L_uc004cac.1_RNA|AIF1L_uc011mce.1_Nonsense_Mutation_p.E37*	p.E32*	NM_031426	NP_113614	WXS	Illumina HiSeq	Unspecified	Q9BQI0	AIF1L_HUMAN			3	199	+			32					B2RBC4|Q6ZR40|Q8NAX7|Q8WU47|Q9H9G0	Nonsense_Mutation	SNP	ENST00000247291.3	37	c.94G>T	CCDS6939.1	.	.	.	.	.	.	.	.	.	.	G	38	6.787627	0.97837	.	.	ENSG00000126878	ENST00000372309;ENST00000247291;ENST00000372302;ENST00000372300;ENST00000372298;ENST00000372312	.	.	.	5.08	5.08	0.68730	.	0.879316	0.09775	N	0.757513	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-5.5199	17.0436	0.86496	0.0:0.0:1.0:0.0	.	.	.	.	X	58;32;32;32;32;37	.	ENSP00000247291:E32X	E	+	1	0	AIF1L	132976805	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.012000	0.93624	2.371000	0.80710	0.549000	0.68633	GAG		0.547	AIF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054703.2	NM_031426	Nonsense_Mutation	84	124	1	0	1.58411e-63	0.00361	2.80971e-63	84	124				
NOTCH1	4851	broad.mit.edu	37	9	139391157	139391157	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:139391157C>A	ENST00000277541.6	-	34	7109	c.7034G>T	c.(7033-7035)gGc>gTc	p.G2345V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2345					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCCTACCATGCCATGCTGCAG	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		0				haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(7033-7035)GGC>GTC		notch1 preproprotein							30.0	36.0	34.0					9																	139391157		2032	4161	6193	SO:0001583	missense	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139391157C>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7034G>T	9.37:g.139391157C>A	ENSP00000277541:p.Gly2345Val	HNSCC(8;0.001)	Somatic					p.G2345V	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	34	7034	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	2345			Cytoplasmic (Potential).		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.7034G>T	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	4.234	0.042328	0.08196	.	.	ENSG00000148400	ENST00000277541	D	0.81659	-1.52	5.18	3.27	0.37495	.	0.495174	0.20860	U	0.084364	T	0.63873	0.2548	N	0.14661	0.345	0.80722	D	1	B	0.22276	0.067	B	0.20577	0.03	T	0.57573	-0.7788	10	0.25751	T	0.34	.	10.6994	0.45918	0.0:0.7892:0.1346:0.0762	.	2345	P46531	NOTC1_HUMAN	V	2345	ENSP00000277541:G2345V	ENSP00000277541:G2345V	G	-	2	0	NOTCH1	138510978	0.994000	0.37717	0.346000	0.25655	0.027000	0.11550	3.100000	0.50275	1.294000	0.44707	0.467000	0.42956	GGC		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		8	71	1	0	2.17888e-05	0.006214	2.72967e-05	8	71				
SHOX	6473	broad.mit.edu	37	X	595382	595382	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:595382G>A	ENST00000554971.1	+	2	398	c.307G>A	c.(307-309)Gac>Aac	p.D103N	SHOX_ENST00000381578.1_Missense_Mutation_p.D103N|SHOX_ENST00000334060.3_Missense_Mutation_p.D103N|SHOX_ENST00000381575.1_Missense_Mutation_p.D103N			O15266	SHOX_HUMAN	short stature homeobox	103					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAAGCGCGAGGACGTGAAGTC	0.622																																					Ovarian(95;18 1419 12424 14056 28266)	Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NA																	0					0						c.(307-309)GAC>AAC		short stature homeobox isoform SHOXa							112.0	105.0	108.0					X																	595382		2203	4296	6499	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:595382G>A	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.307G>A	X.37:g.595382G>A	ENSP00000452016:p.Asp103Asn		Somatic				SHOX_uc004cpi.2_Missense_Mutation_p.D103N	p.D103N	NM_000451	NP_000442	WXS	Illumina HiSeq	Unspecified	O15266	SHOX_HUMAN			3	998	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	103					O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.307G>A	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681696	0.68042	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.95137	-3.62;-3.5;-3.5;-3.62	2.03	2.03	0.26663	Homeodomain-related (1);	0.123149	0.52532	U	0.000068	D	0.91700	0.7376	M	0.66939	2.045	0.09310	N	1	B;B	0.27559	0.014;0.181	B;B	0.21151	0.033;0.031	T	0.83001	-0.0177	10	0.33141	T	0.24	.	12.455	0.55700	0.0:0.0:1.0:0.0	.	103;103	O15266-2;O15266	.;SHOX_HUMAN	N	103	ENSP00000335505:D103N;ENSP00000370990:D103N;ENSP00000452016:D103N;ENSP00000370987:D103N	ENSP00000335505:D103N	D	+	1	0	SHOX	515382	1.000000	0.71417	0.893000	0.35052	0.692000	0.40212	7.652000	0.83633	0.798000	0.33994	0.426000	0.28351	GAC		0.622	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451		16	25	0	0	0	0.008871	0	16	25				
EIF1AX	1964	broad.mit.edu	37	X	20148716	20148716	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:20148716T>C	ENST00000379607.5	-	6	550	c.347A>G	c.(346-348)aAt>aGt	p.N116S	EIF1AX_ENST00000379593.1_Missense_Mutation_p.N88S	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	116					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						ATCAGTTTCATTGATTTTAGC	0.328																																							uc004czt.2		NA																	0				ovary(1)	1						c.(346-348)AAT>AGT		X-linked eukaryotic translation initiation							150.0	122.0	132.0					X																	20148716		2203	4297	6500	SO:0001583	missense	1964					cytosol	translation initiation factor activity	g.chrX:20148716T>C	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.347A>G	X.37:g.20148716T>C	ENSP00000368927:p.Asn116Ser		Somatic					p.N116S	NM_001412	NP_001403	WXS	Illumina HiSeq	Unspecified	P47813	IF1AX_HUMAN			6	555	-			116					B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	ENST00000379607.5	37	c.347A>G	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.085889	0.55861	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.45276	0.9;0.9	4.82	4.82	0.62117	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.45013	0.1321	M	0.73372	2.23	0.58432	D	0.999998	B	0.19200	0.034	B	0.20184	0.028	T	0.45234	-0.9275	9	0.62326	D	0.03	-28.4454	13.594	0.61978	0.0:0.0:0.0:1.0	.	116	P47813	IF1AX_HUMAN	S	116;88	ENSP00000368927:N116S;ENSP00000368912:N88S	ENSP00000368912:N88S	N	-	2	0	EIF1AX	20058637	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.286000	0.78671	1.582000	0.49881	0.481000	0.45027	AAT		0.328	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1			14	4	0	0	0	0.00245	0	14	4				
DCAF8L1	139425	broad.mit.edu	37	X	27999035	27999035	+	Silent	SNP	C	C	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:27999035C>T	ENST00000441525.1	-	1	531	c.417G>A	c.(415-417)ttG>ttA	p.L139L		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	139										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TCCACTCCTCCAACGCCTGAT	0.577																																							uc004dbx.1		NA																	0				ovary(3)|skin(1)	4						c.(415-417)TTG>TTA		DDB1 and CUL4 associated factor 8-like 1							97.0	62.0	74.0					X																	27999035		2202	4300	6502	SO:0001819	synonymous_variant	139425							g.chrX:27999035C>T		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.417G>A	X.37:g.27999035C>T			Somatic					p.L139L	NM_001017930	NP_001017930	WXS	Illumina HiSeq	Unspecified	A6NGE4	DC8L1_HUMAN			1	532	-			139					B3KXX1	Silent	SNP	ENST00000441525.1	37	c.417G>A	CCDS35222.1																																																																																				0.577	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		8	7	0	0	0	0.00308	0	8	7				
FAM47C	442444	broad.mit.edu	37	X	37028396	37028396	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:37028396G>A	ENST00000358047.3	+	1	1965	c.1913G>A	c.(1912-1914)cGg>cAg	p.R638Q		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	638										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCCAAGACTCGGATGTACAGT	0.647																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(1912-1914)CGG>CAG		hypothetical protein LOC442444							34.0	39.0	37.0					X																	37028396		2200	4296	6496	SO:0001583	missense	442444							g.chrX:37028396G>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1913G>A	X.37:g.37028396G>A	ENSP00000367913:p.Arg638Gln		Somatic					p.R638Q	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	1927	+			638					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1913G>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	0.499	-0.871817	0.02570	.	.	ENSG00000198173	ENST00000358047	T	0.13538	2.58	1.61	-3.22	0.05125	.	.	.	.	.	T	0.10465	0.0256	M	0.66939	2.045	0.09310	N	1	B	0.24317	0.101	B	0.19148	0.024	T	0.43653	-0.9378	9	0.12766	T	0.61	.	2.7615	0.05307	0.4394:0.0:0.3519:0.2087	.	638	Q5HY64	FA47C_HUMAN	Q	638	ENSP00000367913:R638Q	ENSP00000367913:R638Q	R	+	2	0	FAM47C	36938317	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.118000	0.15605	-1.807000	0.01236	-2.350000	0.00243	CGG		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		43	33	0	0	0	0.00361	0	43	33				
RBM10	8241	broad.mit.edu	37	X	47034417	47034417	+	Splice_Site	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:47034417G>A	ENST00000377604.3	+	6	1244		c.e6-1		RBM10_ENST00000329236.7_Splice_Site|RBM10_ENST00000345781.6_Splice_Site	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10						3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCTGTCTCCAGGTCAGAGCCG	0.607																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.e6-1		RNA binding motif protein 10 isoform 1							81.0	69.0	73.0					X																	47034417		2203	4300	6503	SO:0001630	splice_region_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47034417G>A	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.503-1G>A	X.37:g.47034417G>A			Somatic				RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Splice_Site_p.G91_splice|RBM10_uc004dhh.2_Splice_Site_p.G168_splice|RBM10_uc010nhq.2_Splice_Site_p.G91_splice|RBM10_uc004dhi.2_Splice_Site_p.G233_splice	p.G168_splice	NM_005676	NP_005667	WXS	Illumina HiSeq	Unspecified	P98175	RBM10_HUMAN			6	882	+								C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Splice_Site	SNP	ENST00000377604.3	37	c.503_splice	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733420	0.48939	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1526	0.65395	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM10	46919361	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.465000	0.97660	2.002000	0.58637	0.525000	0.51046	.		0.607	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	Intron	20	8	0	0	0	0.001882	0	20	8				
ITIH6	347365	broad.mit.edu	37	X	54781507	54781507	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:54781507G>T	ENST00000218436.6	-	9	3174	c.3145C>A	c.(3145-3147)Ctg>Atg	p.L1049M		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1049					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GCTCCTCCCAGGATCTCCTCA	0.483																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(3145-3147)CTG>ATG		inter-alpha (globulin) inhibitor H5-like							104.0	86.0	92.0					X																	54781507		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54781507G>T	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3145C>A	X.37:g.54781507G>T	ENSP00000218436:p.Leu1049Met		Somatic					p.L1049M	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			9	3175	-			1049					A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.3145C>A	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.876543	0.33162	.	.	ENSG00000102313	ENST00000218436	T	0.03124	4.04	1.58	1.58	0.23477	.	1.827870	0.05412	U	0.542647	T	0.04048	0.0113	N	0.14661	0.345	0.09310	N	1	D	0.63046	0.992	P	0.48738	0.588	T	0.44190	-0.9344	10	0.42905	T	0.14	.	6.0319	0.19684	0.0:0.0:1.0:0.0	.	1049	Q6UXX5	ITH5L_HUMAN	M	1049	ENSP00000218436:L1049M	ENSP00000218436:L1049M	L	-	1	2	ITIH5L	54798232	0.002000	0.14202	0.078000	0.20375	0.754000	0.42855	0.430000	0.21428	1.069000	0.40788	0.287000	0.19450	CTG		0.483	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		35	15	1	0	1.43246e-33	0.007835	2.46296e-33	35	15				
LAS1L	81887	broad.mit.edu	37	X	64749694	64749694	+	Silent	SNP	C	C	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:64749694C>A	ENST00000374811.3	-	5	619	c.579G>T	c.(577-579)ctG>ctT	p.L193L	LAS1L_ENST00000312391.8_Silent_p.L193L|LAS1L_ENST00000374807.5_Silent_p.L193L|LAS1L_ENST00000374804.5_Silent_p.L151L	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	193					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						AGGTCTCTCTCAGGCTGTTCT	0.517																																							uc004dwa.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(577-579)CTG>CTT		LAS1-like							127.0	112.0	117.0					X																	64749694		2203	4300	6503	SO:0001819	synonymous_variant	81887					MLL1 complex|nucleolus	protein binding	g.chrX:64749694C>A	BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.579G>T	X.37:g.64749694C>A			Somatic				LAS1L_uc004dwc.1_Silent_p.L193L|LAS1L_uc004dwd.1_Silent_p.L151L	p.L193L	NM_031206	NP_112483	WXS	Illumina HiSeq	Unspecified	Q9Y4W2	LAS1L_HUMAN			5	651	-			193					A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Silent	SNP	ENST00000374811.3	37	c.579G>T	CCDS14381.1																																																																																				0.517	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206		42	30	1	0	4.0492e-12	0.006999	6.23096e-12	42	30				
TEX11	56159	broad.mit.edu	37	X	69890292	69890292	+	Silent	SNP	G	G	A	rs148392671		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:69890292G>A	ENST00000395889.2	-	17	1515	c.1360C>T	c.(1360-1362)Ctg>Ttg	p.L454L	TEX11_ENST00000374320.2_Silent_p.L129L|TEX11_ENST00000374333.2_Silent_p.L439L|TEX11_ENST00000344304.3_Silent_p.L454L	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	454					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GTGAAGTCCAGATCCATTTCA	0.353																																							uc004dyl.2		NA																	0				ovary(3)|breast(1)|skin(1)	5						c.(1360-1362)CTG>TTG		testis expressed sequence 11 isoform 1		G	,	0,3835		0,0,1632,571	120.0	99.0	106.0		1360,1315	-3.3	0.0	X	dbSNP_134	106	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous	TEX11	NM_001003811.1,NM_031276.2	,	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	,	454/941,439/926	69890292	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	56159						protein binding	g.chrX:69890292G>A	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1360C>T	X.37:g.69890292G>A			Somatic				TEX11_uc004dyk.2_Silent_p.L129L|TEX11_uc004dym.2_Silent_p.L439L	p.L454L	NM_001003811	NP_001003811	WXS	Illumina HiSeq	Unspecified	Q8IYF3	TEX11_HUMAN			17	1522	-	Renal(35;0.156)		454					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Silent	SNP	ENST00000395889.2	37	c.1360C>T	CCDS35323.1																																																																																				0.353	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			19	3	0	0	0	0.001523	0	19	3				
ATRX	546	broad.mit.edu	37	X	76891476	76891476	+	Silent	SNP	T	T	C			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:76891476T>C	ENST00000373344.5	-	16	4843	c.4629A>G	c.(4627-4629)gaA>gaG	p.E1543E	ATRX_ENST00000395603.3_Silent_p.E1505E|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1543					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CTTTGGTTTCTTCATCTTCAT	0.333			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(4627-4629)GAA>GAG		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						98.0	82.0	88.0					X																	76891476		2203	4295	6498	SO:0001819	synonymous_variant	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76891476T>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4629A>G	X.37:g.76891476T>C			Somatic				ATRX_uc004ecq.3_Silent_p.E1505E|ATRX_uc004eco.3_Silent_p.E1328E	p.E1543E	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			16	4861	-			1543					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	37	c.4629A>G	CCDS14434.1																																																																																				0.333	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		13	7	0	0	0	0.001368	0	13	7				
TEX13A	56157	broad.mit.edu	37	X	104464957	104464957	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:104464957G>T	ENST00000413579.1	-	2	236	c.125C>A	c.(124-126)tCc>tAc	p.S42Y	IL1RAPL2_ENST00000344799.4_Intron|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.S42Y|TEX13A_ENST00000372578.3_Missense_Mutation_p.S42Y			Q9BXU3	TX13A_HUMAN	testis expressed 13A	42							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CTTCTCCCAGGATAAGGATAT	0.567																																							uc004ema.2		NA																	0				ovary(2)	2						c.(124-126)TCC>TAC		testis expressed sequence 13A							63.0	59.0	60.0					X																	104464957		2203	4300	6503	SO:0001583	missense	56157					intracellular	zinc ion binding	g.chrX:104464957G>T	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.125C>A	X.37:g.104464957G>T	ENSP00000399753:p.Ser42Tyr		Somatic				IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.S42Y	p.S42Y	NM_031274	NP_112564	WXS	Illumina HiSeq	Unspecified	Q9BXU3	TX13A_HUMAN			2	237	-			42					B1B1G8|Q32NB6	Missense_Mutation	SNP	ENST00000413579.1	37	c.125C>A		.	.	.	.	.	.	.	.	.	.	G	11.15	1.553703	0.27739	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	3.33	3.33	0.38152	.	0.243551	0.21648	N	0.071223	T	0.63390	0.2507	.	.	.	0.20307	N	0.999916	D;D	0.76494	0.999;0.998	D;D	0.76071	0.987;0.978	T	0.51996	-0.8634	8	0.72032	D	0.01	.	9.2819	0.37733	0.0:0.0:1.0:0.0	.	42;42	C9JWK0;Q9BXU3	.;TX13A_HUMAN	Y	42	.	ENSP00000361656:S42Y	S	-	2	0	TEX13A	104351613	0.995000	0.38212	0.429000	0.26710	0.147000	0.21601	3.386000	0.52492	1.930000	0.55929	0.506000	0.49869	TCC		0.567	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274		11	23	1	0	1.61879e-10	0.001368	2.42459e-10	11	23				
COL4A6	1288	broad.mit.edu	37	X	107418907	107418907	+	Missense_Mutation	SNP	C	C	A	rs140519216	byFrequency	TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:107418907C>A	ENST00000372216.4	-	29	2910	c.2810G>T	c.(2809-2811)cGt>cTt	p.R937L	COL4A6_ENST00000545689.1_Missense_Mutation_p.R936L|COL4A6_ENST00000538570.1_Missense_Mutation_p.R936L|COL4A6_ENST00000394872.2_Missense_Mutation_p.R937L|COL4A6_ENST00000334504.7_Missense_Mutation_p.R936L	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	937	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.R936L(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGTACCAGCACGTCCAGATGG	0.428									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.(2809-2811)CGT>CTT		type IV alpha 6 collagen isoform A precursor							115.0	99.0	104.0					X																	107418907		2203	4300	6503	SO:0001583	missense	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107418907C>A	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2810G>T	X.37:g.107418907C>A	ENSP00000361290:p.Arg937Leu		Somatic				COL4A6_uc004env.3_Missense_Mutation_p.R936L|COL4A6_uc011msn.1_Missense_Mutation_p.R936L|COL4A6_uc010npk.2_Missense_Mutation_p.R936L	p.R937L	NM_001847	NP_001838	WXS	Illumina HiSeq	Unspecified	Q14031	CO4A6_HUMAN			29	2913	-			937			Triple-helical region.		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	c.2810G>T	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	4.680	0.126349	0.08931	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25;-3.25	5.08	-10.2	0.00374	.	2.961340	0.01273	N	0.009504	D	0.85168	0.5635	N	0.05414	-0.055	0.09310	N	1	P;P;P;B	0.39022	0.487;0.655;0.543;0.307	B;P;B;B	0.47044	0.373;0.535;0.408;0.285	T	0.76984	-0.2756	10	0.09590	T	0.72	.	7.2668	0.26234	0.0757:0.4686:0.2481:0.2075	.	936;936;937;936	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	L	937;936;937;936;936;936	ENSP00000361290:R937L;ENSP00000334733:R936L;ENSP00000378340:R937L;ENSP00000443707:R936L;ENSP00000445236:R936L	ENSP00000334733:R936L	R	-	2	0	COL4A6	107305563	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.342000	0.00249	-4.168000	0.00068	-1.639000	0.00775	CGT		0.428	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			41	7	1	0	7.05121e-23	0.002522	1.17637e-22	41	7				
DCX	1641	broad.mit.edu	37	X	110654013	110654013	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:110654013G>A	ENST00000338081.3	-	1	361	c.190C>T	c.(190-192)Ccg>Tcg	p.P64S	DCX_ENST00000356220.3_Intron|DCX_ENST00000371993.2_Intron|DCX_ENST00000496551.1_Intron|DCX_ENST00000356915.2_Intron|DCX_ENST00000488120.1_Intron	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	64					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						TGGAACTTCGGGCTAAATACA	0.423																																							uc004epd.2		NA																	0				central_nervous_system(2)|lung(1)|skin(1)	4						c.(190-192)CCG>TCG		doublecortin isoform a							172.0	162.0	165.0					X																	110654013		2203	4300	6503	SO:0001583	missense	1641				axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding	g.chrX:110654013G>A	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.190C>T	X.37:g.110654013G>A	ENSP00000337697:p.Pro64Ser		Somatic				DCX_uc011msv.1_Missense_Mutation_p.P64S|DCX_uc004epe.2_Intron|DCX_uc004epf.2_Intron|DCX_uc004epg.2_Intron	p.P64S	NM_000555	NP_000546	WXS	Illumina HiSeq	Unspecified	O43602	DCX_HUMAN			1	362	-			64					A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	ENST00000338081.3	37	c.190C>T	CCDS14556.1	.	.	.	.	.	.	.	.	.	.	g	13.07	2.127369	0.37533	.	.	ENSG00000077279	ENST00000338081	T	0.23950	1.88	4.44	4.44	0.53790	.	0.896444	0.09236	N	0.829910	T	0.18759	0.0450	N	0.14661	0.345	0.80722	D	1	B;B	0.22604	0.072;0.072	B;B	0.17098	0.017;0.017	T	0.04767	-1.0928	10	0.49607	T	0.09	.	13.9934	0.64380	0.0:0.0:1.0:0.0	.	52;64	B4DM53;O43602	.;DCX_HUMAN	S	64	ENSP00000337697:P64S	ENSP00000337697:P64S	P	-	1	0	DCX	110540669	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.433000	0.66520	2.442000	0.82660	0.509000	0.49947	CCG		0.423	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153		11	98	0	0	0	0.000978	0	11	98				
AMOT	154796	broad.mit.edu	37	X	112024174	112024174	+	Silent	SNP	G	G	A			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:112024174G>A	ENST00000524145.1	-	10	2487	c.2413C>T	c.(2413-2415)Ctg>Ttg	p.L805L	AMOT_ENST00000371959.3_Silent_p.L805L|AMOT_ENST00000304758.1_Silent_p.L396L|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371958.1_Silent_p.L573L|AMOT_ENST00000371962.1_Silent_p.L573L			Q4VCS5	AMOT_HUMAN	angiomotin	805					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GAGCCAGTCAGGGTGGATGAG	0.527																																							uc004epr.2		NA																	0				ovary(1)	1						c.(2413-2415)CTG>TTG		angiomotin isoform 1							147.0	135.0	139.0					X																	112024174		2203	4300	6503	SO:0001819	synonymous_variant	154796				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity	g.chrX:112024174G>A	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2413C>T	X.37:g.112024174G>A			Somatic				AMOT_uc004eps.2_Silent_p.L396L|AMOT_uc011mtc.1_Silent_p.L45L|hsa-mir-4329|MI0015901_5'Flank	p.L805L	NM_001113490	NP_001106962	WXS	Illumina HiSeq	Unspecified	Q4VCS5	AMOT_HUMAN			9	2413	-			805					Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	37	c.2413C>T	CCDS48154.1																																																																																				0.527	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265		5	83	0	0	0	0.000602	0	5	83				
USP26	83844	broad.mit.edu	37	X	132160640	132160640	+	Missense_Mutation	SNP	G	G	T	rs144039408		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chrX:132160640G>T	ENST00000511190.1	-	6	2078	c.1609C>A	c.(1609-1611)Cag>Aag	p.Q537K	USP26_ENST00000370832.1_Missense_Mutation_p.Q537K|USP26_ENST00000406273.1_Missense_Mutation_p.Q537K	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	537	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					ATGACTTCCTGGTCATTCTTC	0.403																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	0				lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(1609-1611)CAG>AAG		ubiquitin-specific protease 26							105.0	106.0	106.0					X																	132160640		2203	4299	6502	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132160640G>T	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1609C>A	X.37:g.132160640G>T	ENSP00000423390:p.Gln537Lys		Somatic				USP26_uc011mvf.1_Missense_Mutation_p.Q537K	p.Q537K	NM_031907	NP_114113	WXS	Illumina HiSeq	Unspecified	Q9BXU7	UBP26_HUMAN			6	2079	-	Acute lymphoblastic leukemia(192;0.000127)		537					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.1609C>A	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953614	0.34471	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.29397	1.57;1.57;1.57	3.95	3.95	0.45737	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.850584	0.09873	N	0.744691	T	0.38401	0.1039	M	0.64170	1.965	0.09310	N	1	P	0.34815	0.47	B	0.42343	0.384	T	0.24154	-1.0168	10	0.38643	T	0.18	-1.4866	10.491	0.44750	0.0:0.0:1.0:0.0	.	537	Q9BXU7	UBP26_HUMAN	K	537	ENSP00000359869:Q537K;ENSP00000423390:Q537K;ENSP00000384360:Q537K	ENSP00000359869:Q537K	Q	-	1	0	USP26	131988306	0.945000	0.32115	0.003000	0.11579	0.003000	0.03518	4.447000	0.60020	2.235000	0.73313	0.529000	0.55759	CAG		0.403	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		42	36	1	0	9.73076e-26	0.006999	1.64787e-25	42	36				
HIAT1	64645	broad.mit.edu	37	1	100544036	100544037	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr1:100544036_100544037delCC	ENST00000370152.3	+	10	1170_1171	c.1034_1035delCC	c.(1033-1035)gccfs	p.A345fs	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	345					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		GCAGTAGCAGCCATGTCTAGCA	0.426																																							uc001dst.2		NA																	0					0						c.(1033-1035)GCCfs		hippocampus abundant transcript 1																																				SO:0001589	frameshift_variant	64645				transmembrane transport	integral to membrane|plasma membrane	transporter activity	g.chr1:100544036_100544037delCC	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.1034_1035delCC	1.37:g.100544036_100544037delCC	ENSP00000359171:p.Ala345fs		Somatic					p.A345fs	NM_033055	NP_149044	WXS	Illumina HiSeq	Unspecified	Q96MC6	HIAT1_HUMAN		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)	10	1034_1035	+		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	345			Helical; Name=10; (Potential).		Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Frame_Shift_Del	DEL	ENST00000370152.3	37	c.1034_1035delCC	CCDS763.1																																																																																				0.426	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055		7	80	NA	NA	NA	NA	NA	7	80	---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30315934	30315935	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	AA	AA	-	-	AA	AA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr10:30315934_30315935delAA	ENST00000375377.1	-	3	3243_3244	c.3142_3143delTT	c.(3142-3144)ttafs	p.L1048fs		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1048					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CACAGACCGTAAGTCTGGAGCT	0.589																																							uc001iux.2		NA																	0				ovary(4)	4						c.(3142-3144)TTAfs		hypothetical protein LOC57608																																				SO:0001589	frameshift_variant	57608							g.chr10:30315934_30315935delAA	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3142_3143delTT	10.37:g.30315934_30315935delAA	ENSP00000364526:p.Leu1048fs		Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Frame_Shift_Del_p.L910fs|KIAA1462_uc009xle.1_Frame_Shift_Del_p.L1048fs	p.L1048fs	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	3201_3202	-			1048					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Frame_Shift_Del	DEL	ENST00000375377.1	37	c.3142_3143delTT	CCDS41500.1																																																																																				0.589	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		35	131	NA	NA	NA	NA	NA	35	131	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1221270	1221279	+	Frame_Shift_Del	DEL	GAGAACATCG	GAGAACATCG	-	rs539772540		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	GAGAACATCG	GAGAACATCG	-	-	GAGAACATCG	GAGAACATCG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr19:1221270_1221279delGAGAACATCG	ENST00000326873.7	+	6	1966_1975	c.793_802delGAGAACATCG	c.(793-804)gagaacatcgggfs	p.ENIG265fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGTTGTTTGAGAACATCGGGAAGGGGAG	0.605		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(2)|p.Y246fs*3(1)	cervix(14)|lung(5)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(793-804)GAGAACATCGGGfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221270_1221279delGAGAACATCG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.793_802delGAGAACATCG	19.37:g.1221270_1221279delGAGAACATCG	ENSP00000324856:p.Glu265fs	TSP Lung(3;<1E-08)	Somatic					p.E265fs	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1908_1917	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	265_268			Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	c.793_802delGAGAACATCG	CCDS45896.1																																																																																				0.605	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		8	14	NA	NA	NA	NA	NA	8	14	---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144709595	144709595	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:144709595delT	ENST00000392869.2	-	10	1399	c.1247delA	c.(1246-1248)cagfs	p.Q416fs	GTDC1_ENST00000409214.1_Frame_Shift_Del_p.Q416fs|AC016910.1_ENST00000422799.1_RNA|GTDC1_ENST00000463875.2_Frame_Shift_Del_p.Q287fs|GTDC1_ENST00000542155.1_Frame_Shift_Del_p.Q416fs|GTDC1_ENST00000409298.1_Frame_Shift_Del_p.Q298fs|GTDC1_ENST00000344850.4_Frame_Shift_Del_p.Q416fs|GTDC1_ENST00000392867.3_Frame_Shift_Del_p.Q331fs|GTDC1_ENST00000241391.5_Frame_Shift_Del_p.Q331fs	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	416					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		GCAGAAATTCTGGAGCCTTTT	0.333																																							uc002tvp.2		NA																	0				ovary(1)	1						c.(1246-1248)CAGfs		glycosyltransferase-like domain containing 1							86.0	92.0	90.0					2																	144709595		2203	4296	6499	SO:0001589	frameshift_variant	79712				biosynthetic process		transferase activity, transferring glycosyl groups	g.chr2:144709595delT	AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.1247delA	2.37:g.144709595delT	ENSP00000376608:p.Gln416fs		Somatic				GTDC1_uc002tvo.2_Frame_Shift_Del_p.R368fs|GTDC1_uc002tvq.2_Frame_Shift_Del_p.Q298fs|GTDC1_uc002tvr.2_Frame_Shift_Del_p.Q331fs|GTDC1_uc010fnn.2_Frame_Shift_Del_p.Q416fs|GTDC1_uc002tvs.2_Frame_Shift_Del_p.Q384fs|GTDC1_uc010fno.2_Frame_Shift_Del_p.Q287fs	p.Q416fs	NM_001006636	NP_001006637	WXS	Illumina HiSeq	Unspecified	Q4AE62	GTDC1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0914)	11	1526	-			416					A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Frame_Shift_Del	DEL	ENST00000392869.2	37	c.1247delA	CCDS33300.1																																																																																				0.333	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659		24	42	NA	NA	NA	NA	NA	24	42	---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198966044	198966044	+	Frame_Shift_Del	DEL	G	G	-	rs2228136	byFrequency	TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr2:198966044delG	ENST00000428675.1	+	4	3353	c.2955delG	c.(2953-2955)gcgfs	p.A985fs	PLCL1_ENST00000437704.2_Frame_Shift_Del_p.A887fs	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	985					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TAGAAATGGCGGACACAGTCC	0.343																																							uc010fsp.2		NA																	0				ovary(1)|skin(1)	2						c.(2953-2955)GCGfs		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						113.0	114.0	114.0					2																	198966044		2203	4300	6503	SO:0001589	frameshift_variant	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198966044delG	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2955delG	2.37:g.198966044delG	ENSP00000402861:p.Ala985fs		Somatic				PLCL1_uc002uuv.3_Frame_Shift_Del_p.A906fs	p.A985fs	NM_001114661	NP_001108133	WXS	Illumina HiSeq	Unspecified	Q15111	PLCL1_HUMAN			4	3246	+			985					Q3MJ90|Q53SD3|Q7Z3S3	Frame_Shift_Del	DEL	ENST00000428675.1	37	c.2955delG	CCDS2326.2																																																																																				0.343	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		37	57	NA	NA	NA	NA	NA	37	57	---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18389298	18389318	+	Splice_Site	DEL	ACAGGAGCAAAGCTTACCTTG	ACAGGAGCAAAGCTTACCTTG	-	rs201272560|rs544357924|rs565328971		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	ACAGGAGCAAAGCTTACCTTG	ACAGGAGCAAAGCTTACCTTG	-	-	ACAGGAGCAAAGCTTACCTTG	ACAGGAGCAAAGCTTACCTTG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr22:18389298_18389318delACAGGAGCAAAGCTTACCTTG	ENST00000441493.2	-	2	613_617	c.261_265delCAAGGTAAGCTTTGCTCCTGT	c.(259-267)accaaggta>acta	p.KV88del	MICAL3_ENST00000444520.1_Splice_Site_p.KV88del|MICAL3_ENST00000429452.1_Splice_Site_p.KV88del|MICAL3_ENST00000414725.2_Splice_Site_p.KV88del|MICAL3_ENST00000207726.7_Splice_Site_p.KV88del|MICAL3_ENST00000383094.3_Splice_Site_p.KV88del|MICAL3_ENST00000400561.2_Splice_Site_p.KV88del|MICAL3_ENST00000585038.1_Splice_Site_p.KV88del	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	88	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CCAGGGCCCAACAGGAGCAAAGCTTACCTTGGTGTTAGTGC	0.498																																							uc002zng.3		NA																	0					0						c.e2+1		microtubule associated monoxygenase, calponin																																				SO:0001630	splice_region_variant	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18389298_18389318delACAGGAGCAAAGCTTACCTTG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.264+1CAAGGTAAGCTTTGCTCCTGT>-	22.37:g.18389298_18389318delACAGGAGCAAAGCTTACCTTG			Somatic				MICAL3_uc011agl.1_Splice_Site_p.K88_splice|MICAL3_uc002znh.2_Splice_Site_p.K88_splice|MICAL3_uc002znk.1_Splice_Site_p.K88_splice|MICAL3_uc002znl.1_Splice_Site|MICAL3_uc010grf.2_Splice_Site_p.K88_splice|MICAL3_uc011agm.1_Splice_Site_p.K88_splice	p.K88_splice	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	2	617	-		all_epithelial(15;0.198)						B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Splice_Site	DEL	ENST00000441493.2	37	c.264_splice	CCDS46659.1																																																																																				0.498	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		In_Frame_Del	24	104	NA	NA	NA	NA	NA	24	104	---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97251210	97251210	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr3:97251210delG	ENST00000514100.1	+	8	627	c.385delG	c.(385-387)ggafs	p.G129fs	EPHA6_ENST00000442602.2_Frame_Shift_Del_p.G103fs|EPHA6_ENST00000502694.1_Frame_Shift_Del_p.G129fs|EPHA6_ENST00000389672.5_Frame_Shift_Del_p.G737fs	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	643	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AGGTGAATTTGGAGAAGTCTG	0.388																																							uc010how.1		NA																	0				stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(2209-2211)GGAfs		EPH receptor A6 isoform a							129.0	123.0	125.0					3																	97251210		1818	4096	5914	SO:0001589	frameshift_variant	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:97251210delG	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.385delG	3.37:g.97251210delG	ENSP00000421711:p.Gly129fs		Somatic				EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_Frame_Shift_Del_p.G103fs|EPHA6_uc003drs.3_Frame_Shift_Del_p.G129fs|EPHA6_uc003drr.3_Frame_Shift_Del_p.G129fs|EPHA6_uc003drt.2_Frame_Shift_Del_p.G129fs|EPHA6_uc010hox.1_RNA	p.G737fs	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			11	2252	+			642			ATP (By similarity).|Protein kinase.|Cytoplasmic (Potential).		D6RAL5	Frame_Shift_Del	DEL	ENST00000514100.1	37	c.2209delG																																																																																					0.388	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448		8	63	NA	NA	NA	NA	NA	8	63	---	---	---	---
LZTS1	11178	broad.mit.edu	37	8	20110819	20110819	+	Frame_Shift_Del	DEL	C	C	-	rs371282620		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr8:20110819delC	ENST00000381569.1	-	3	980	c.623delG	c.(622-624)ggcfs	p.G208fs	LZTS1_ENST00000522290.1_Frame_Shift_Del_p.G208fs|LZTS1_ENST00000265801.6_Frame_Shift_Del_p.G208fs			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	208					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GTGGGCGGAGCCCCCAAAACG	0.637																																							uc003wzr.2		NA																	0				ovary(1)	1						c.(622-624)GGCfs		leucine zipper, putative tumor suppressor 1							49.0	54.0	53.0					8																	20110819		2202	4300	6502	SO:0001589	frameshift_variant	11178				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:20110819delC	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.623delG	8.37:g.20110819delC	ENSP00000370981:p.Gly208fs		Somatic				LZTS1_uc010ltg.1_Frame_Shift_Del_p.G208fs	p.G208fs	NM_021020	NP_066300	WXS	Illumina HiSeq	Unspecified	Q9Y250	LZTS1_HUMAN		Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	2	734	-			208					D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Frame_Shift_Del	DEL	ENST00000381569.1	37	c.623delG	CCDS6015.1																																																																																				0.637	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		47	82	NA	NA	NA	NA	NA	47	82	---	---	---	---
CDKN2A	1029	broad.mit.edu	37	9	21974782	21974783	+	Frame_Shift_Ins	INS	-	-	GA	rs138677674		TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:21974782_21974783insGA	ENST00000304494.5	-	1	314_315	c.44_45insTC	c.(43-45)tggfs	p.W15fs	CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.W15fs|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.W15fs|CDKN2A_ENST00000579755.1_Intron|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.W15fs|CDKN2A_ENST00000494262.1_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	15					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.W15*(7)|p.S12fs*6(1)|p.L16fs*9(1)|p.0(1)|p.W15L(1)|p.S7_A19del(1)|p.S12fs*20(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCGTGGCCAGCCAGTCAGCCGA	0.757		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																													uc003zpk.2		17																	1351	Whole gene deletion(1316)|Unknown(23)|Substitution - Nonsense(7)|Deletion - Frameshift(3)|Deletion - In frame(1)|Substitution - Missense(1)	p.0?(1112)|p.?(23)|p.W15*(7)|p.S12fs*6(1)|p.L16fs*9(1)|p.W15L(1)|p.S7_A19del(1)|p.M9_A20>X(1)|p.S12fs*20(1)	haematopoietic_and_lymphoid_tissue(279)|skin(169)|central_nervous_system(165)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(58)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(50)|ovary(34)|kidney(31)|pancreas(31)|breast(30)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678	GRCh37	CM960269|CM994496	CDKN2A	M	rs138677674	c.(43-45)TGGfs		cyclin-dependent kinase inhibitor 2A isoform 1																																				SO:0001589	frameshift_variant	1029	Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma			cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	g.chr9:21974782_21974783insGA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.44_45insTC	9.37:g.21974782_21974783insGA	ENSP00000307101:p.Trp15fs	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)	Somatic				MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Frame_Shift_Ins_p.W15fs|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	p.W15fs	NM_000077	NP_000068	WXS	Illumina HiSeq	Unspecified	P42771	CD2A1_HUMAN		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)	1	256_257	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	15			ANK 1.		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Ins	INS	ENST00000304494.5	37	c.44_45insTC	CCDS6510.1																																																																																				0.757	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077		9	26	NA	NA	NA	NA	NA	9	26	---	---	---	---
ZNF484	83744	broad.mit.edu	37	9	95609868	95609871	+	Frame_Shift_Del	DEL	TACT	TACT	-			TCGA-78-7148-01A-11D-2036-08	TCGA-78-7148-10A-01D-2036-08	TACT	TACT	-	-	TACT	TACT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d3061bb3-7a2d-4aa1-8b7b-420e97395323	8d191fa8-2509-4103-ac4a-d2bf44dedffb	g.chr9:95609868_95609871delTACT	ENST00000375495.3	-	5	1346_1349	c.1198_1201delAGTA	c.(1198-1203)agtatgfs	p.SM400fs	ZNF484_ENST00000332591.6_Frame_Shift_Del_p.SM364fs|ZNF484_ENST00000395506.3_Frame_Shift_Del_p.SM402fs|ZNF484_ENST00000395505.2_Frame_Shift_Del_p.SM364fs|ANKRD19P_ENST00000473204.1_RNA	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						TTCTGATGCATACTTAGTGTTGAT	0.338																																							uc004asu.1		NA																	0					0						c.(1198-1203)AGTATGfs		zinc finger protein 484 isoform a																																				SO:0001589	frameshift_variant	83744				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:95609868_95609871delTACT	AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.1198_1201delAGTA	9.37:g.95609868_95609871delTACT	ENSP00000364645:p.Ser400fs		Somatic				ANKRD19_uc004asr.3_Intron|ZNF484_uc011lub.1_Frame_Shift_Del_p.S402fs|ZNF484_uc010mrb.1_Frame_Shift_Del_p.S364fs|ZNF484_uc004asv.1_Frame_Shift_Del_p.S364fs	p.S400fs	NM_031486	NP_113674	WXS	Illumina HiSeq	Unspecified	Q5JVG2	ZN484_HUMAN			5	1347_1350	-			400_401			C2H2-type 5.		B1AL89|B4DRI2	Frame_Shift_Del	DEL	ENST00000375495.3	37	c.1198_1201delAGTA	CCDS35066.1																																																																																				0.338	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053111.2	XM_046861		14	22	NA	NA	NA	NA	NA	14	22	---	---	---	---
