#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
VPS13D	55187	broad.mit.edu	37	1	12408994	12408994	+	Missense_Mutation	SNP	A	A	G	rs372381323		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:12408994A>G	ENST00000358136.3	+	45	9314	c.9184A>G	c.(9184-9186)Atg>Gtg	p.M3062V	VPS13D_ENST00000356315.4_Missense_Mutation_p.M3037V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGAGACACCAATGGAACTAAG	0.458																																							uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(9184-9186)ATG>GTG		vacuolar protein sorting 13D isoform 1		A	VAL/MET,VAL/MET	1,4405	2.1+/-5.4	0,1,2202	116.0	106.0	110.0		9109,9184	5.9	1.0	1		110	0,8600		0,0,4300	no	missense,missense	VPS13D	NM_018156.2,NM_015378.2	21,21	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign,benign	3037/4364,3062/4389	12408994	1,13005	2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12408994A>G	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.9184A>G	1.37:g.12408994A>G	ENSP00000350854:p.Met3062Val		Somatic				VPS13D_uc001atw.2_Missense_Mutation_p.M3037V|VPS13D_uc001atx.2_Missense_Mutation_p.M2249V	p.M3062V	NM_015378	NP_056193	WXS	Illumina HiSeq	Unspecified	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	45	9325	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	3061						Missense_Mutation	SNP	ENST00000358136.3	37	c.9184A>G	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.592770	0.28357	2.27E-4	0.0	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.40756	1.04;1.02	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	N	0.01242	-0.935	0.80722	D	1	B;B	0.19935	0.04;0.023	B;B	0.17098	0.017;0.007	T	0.23833	-1.0177	10	0.05959	T	0.93	.	15.9979	0.80265	1.0:0.0:0.0:0.0	.	3037;3061	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	V	3037;3062	ENSP00000348666:M3037V;ENSP00000350854:M3062V	ENSP00000348666:M3037V	M	+	1	0	VPS13D	12331581	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.962000	0.93254	2.252000	0.74401	0.528000	0.53228	ATG		0.458	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		10	55	0	0	0	0.008291	0	10	55				
PRAMEF1	65121	broad.mit.edu	37	1	12856112	12856112	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:12856112G>A	ENST00000332296.7	+	4	1495	c.1392G>A	c.(1390-1392)ccG>ccA	p.P464P	PRAMEF1_ENST00000400814.3_Silent_p.P219P	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	464					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCATCACCGTCTGAGGAAC	0.557																																							uc001auj.1		NA																	0					0						c.(1390-1392)CCG>CCA		PRAME family member 1																																				SO:0001819	synonymous_variant	65121							g.chr1:12856112G>A	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1392G>A	1.37:g.12856112G>A			Somatic					p.P464P	NM_023013	NP_075389	WXS	Illumina HiSeq	Unspecified	O95521	PRAM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1495	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	464					Q9UQP2	Silent	SNP	ENST00000332296.7	37	c.1392G>A	CCDS148.1																																																																																				0.557	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013		12	127	0	0	0	0.00245	0	12	127				
AIM1L	55057	broad.mit.edu	37	1	26648746	26648746	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:26648746G>A	ENST00000308182.5	-	18	2100	c.1671C>T	c.(1669-1671)gcC>gcT	p.A557A	AIM1L_ENST00000527815.1_Silent_p.A728A			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	557	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGCGGCTCTCGGCCCACAGCA	0.627																																							uc001bmd.3		NA																	0				pancreas(1)	1						c.(1669-1671)GCC>GCT		absent in melanoma 1-like							70.0	71.0	70.0					1																	26648746		2203	4300	6503	SO:0001819	synonymous_variant	55057						sugar binding	g.chr1:26648746G>A			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.1671C>T	1.37:g.26648746G>A			Somatic					p.A557A	NM_001039775	NP_001034864	WXS	Illumina HiSeq	Unspecified	Q8N1P7	AIM1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)	18	2101	-		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	557			Ricin B-type lectin.		B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37	c.1671C>T																																																																																					0.627	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2		14	63	0	0	0	0.00245	0	14	63				
SLC44A5	204962	broad.mit.edu	37	1	75685020	75685020	+	Silent	SNP	C	C	T	rs531608712		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:75685020C>T	ENST00000370855.5	-	16	1301	c.1188G>A	c.(1186-1188)gcG>gcA	p.A396A	SLC44A5_ENST00000370859.3_Silent_p.A396A|SLC44A5_ENST00000535611.1_Silent_p.A266A	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	396					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A396A(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CCCCCGATGTCGCCAAGAAAC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		17200	0.0		0.0	False		,,,				2504	0.001						uc001dgu.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(2)|skin(2)	4						c.(1186-1188)GCG>GCA		solute carrier family 44, member 5 isoform A							89.0	83.0	85.0					1																	75685020		2203	4300	6503	SO:0001819	synonymous_variant	204962					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:75685020C>T	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1188G>A	1.37:g.75685020C>T			Somatic				SLC44A5_uc001dgt.2_Silent_p.A396A|SLC44A5_uc001dgs.2_Silent_p.A354A|SLC44A5_uc001dgr.2_Silent_p.A354A|SLC44A5_uc010oqz.1_Silent_p.A435A|SLC44A5_uc010ora.1_Silent_p.A390A|SLC44A5_uc010orb.1_Silent_p.A266A	p.A396A	NM_152697	NP_689910	WXS	Illumina HiSeq	Unspecified	Q8NCS7	CTL5_HUMAN			16	1332	-			396			Cytoplasmic (Potential).		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	ENST00000370855.5	37	c.1188G>A	CCDS667.1																																																																																				0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697		7	20	0	0	0	0.001984	0	7	20				
KCNA3	3738	broad.mit.edu	37	1	111216654	111216654	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:111216654G>A	ENST00000369769.2	-	1	1001	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	260					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	TTCTCGTCGCGGAACTCCGGC	0.667																																							uc001dzv.1		NA																	0				ovary(4)|pancreas(1)	5						c.(778-780)CGC>TGC		potassium voltage-gated channel, shaker-related							37.0	41.0	40.0					1																	111216654		2202	4299	6501	SO:0001583	missense	3738					voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr1:111216654G>A	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.778C>T	1.37:g.111216654G>A	ENSP00000358784:p.Arg260Cys		Somatic					p.R260C	NM_002232	NP_002223	WXS	Illumina HiSeq	Unspecified	P22001	KCNA3_HUMAN		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	1	1002	-		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	260					Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	c.778C>T	CCDS828.2	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065001	0.55432	.	.	ENSG00000177272	ENST00000369769	T	0.63580	-0.05	4.65	4.65	0.58169	.	0.000000	0.85682	U	0.000000	T	0.76385	0.3980	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.65010	0.931	T	0.82070	-0.0639	10	0.87932	D	0	.	12.5602	0.56277	0.0:0.0:0.7882:0.2118	.	260	P22001	KCNA3_HUMAN	C	260	ENSP00000358784:R260C	ENSP00000358784:R260C	R	-	1	0	KCNA3	111018177	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.505000	0.45424	2.127000	0.65507	0.561000	0.74099	CGC		0.667	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232		4	57	0	0	0	0.009096	0	4	57				
TBX15	6913	broad.mit.edu	37	1	119441710	119441710	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:119441710C>A	ENST00000369429.3	-	7	974	c.965G>T	c.(964-966)tGg>tTg	p.W322L	TBX15_ENST00000207157.3_Missense_Mutation_p.W216L			Q96SF7	TBX15_HUMAN	T-box 15	322					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		AGGAGGTCTCCAGAATGCATA	0.468																																							uc001ehl.1		NA																	0				large_intestine(1)|pancreas(1)	2						c.(646-648)TGG>TTG		T-box 15							145.0	128.0	134.0					1																	119441710		2203	4300	6503	SO:0001583	missense	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119441710C>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.965G>T	1.37:g.119441710C>A	ENSP00000358437:p.Trp322Leu		Somatic				TBX15_uc009whj.1_Missense_Mutation_p.W7L	p.W216L	NM_152380	NP_689593	WXS	Illumina HiSeq	Unspecified	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	7	962	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	322					Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	37	c.647G>T		.	.	.	.	.	.	.	.	.	.	C	28.1	4.888947	0.91814	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873;ENST00000393149	D;D;D	0.89939	-2.3;-2.23;-2.59	5.65	5.65	0.86999	.	0.141405	0.52532	D	0.000068	D	0.91845	0.7419	M	0.66297	2.02	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.87578	0.979;0.998	D	0.87483	0.2422	10	0.11182	T	0.66	.	20.073	0.97731	0.0:1.0:0.0:0.0	.	86;322	E9PCG3;Q96SF7	.;TBX15_HUMAN	L	86;216;322;17;16	ENSP00000207157:W216L;ENSP00000358437:W322L;ENSP00000398625:W17L	ENSP00000207157:W216L	W	-	2	0	TBX15	119243233	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.181000	0.77682	2.811000	0.96726	0.655000	0.94253	TGG		0.468	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		13	18	1	0	0.00136819	0.013537	0.00146405	13	18				
ITGA10	8515	broad.mit.edu	37	1	145530918	145530918	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:145530918G>T	ENST00000369304.3	+	7	825	c.650G>T	c.(649-651)tGg>tTg	p.W217L	ITGA10_ENST00000538811.1_Missense_Mutation_p.W86L|ITGA10_ENST00000539363.1_Missense_Mutation_p.W74L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	217	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTACATGAGTGGTCCCTGGGA	0.512																																							uc001eoa.2		NA																	0				lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(649-651)TGG>TTG		integrin, alpha 10 precursor							97.0	93.0	94.0					1																	145530918		2203	4300	6503	SO:0001583	missense	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145530918G>T	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.650G>T	1.37:g.145530918G>T	ENSP00000358310:p.Trp217Leu		Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.W86L|ITGA10_uc009wiw.2_Missense_Mutation_p.W74L|ITGA10_uc010oyw.1_Missense_Mutation_p.W162L	p.W217L	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			7	726	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		217			VWFA.|Extracellular (Potential).		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	c.650G>T	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009534	0.75046	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	D;D;D	0.82984	-1.67;-1.67;-1.67	5.4	5.4	0.78164	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000001	T	0.74574	0.3734	L	0.45581	1.43	0.80722	D	1	B;B;B;B	0.30563	0.069;0.042;0.285;0.085	B;B;B;B	0.33960	0.108;0.07;0.145;0.173	T	0.78001	-0.2375	10	0.87932	D	0	.	16.672	0.85269	0.0:0.0:1.0:0.0	.	183;86;74;217	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	217;183;74;86	ENSP00000358310:W217L;ENSP00000439894:W74L;ENSP00000440011:W86L	ENSP00000358310:W217L	W	+	2	0	ITGA10	144242275	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.217000	0.51184	2.539000	0.85634	0.655000	0.94253	TGG		0.512	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		20	37	1	0	3.51602e-12	0.008871	4.15979e-12	20	37				
NBPF14	25832	broad.mit.edu	37	1	148009459	148009459	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:148009459A>G	ENST00000369219.1	-	16	1864	c.1848T>C	c.(1846-1848)gaT>gaC	p.D616D				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	616	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					AATAGCATCTATCCAGTGACT	0.483																																							uc001eqq.2		NA																	0				ovary(1)	1						c.(1846-1848)GAT>GAC		hypothetical protein LOC25832							140.0	284.0	242.0					1																	148009459		1672	4062	5734	SO:0001819	synonymous_variant	25832					cytoplasm		g.chr1:148009459A>G	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1848T>C	1.37:g.148009459A>G			Somatic				LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Silent_p.D189D|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pad.1_Intron|NBPF14_uc001eqs.1_Intron	p.D616D	NM_015383	NP_056198	WXS	Illumina HiSeq	Unspecified	Q5TI25	NBPFE_HUMAN			16	1865	-	all_hematologic(923;0.032)		616			NBPF 7.		Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37	c.1848T>C		.	.	.	.	.	.	.	.	.	.	a	2.095	-0.407563	0.04832	.	.	ENSG00000122497	ENST00000310701	.	.	.	.	.	.	.	.	.	.	.	T	0.14270	0.0345	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28808	-1.0032	1	.	.	.	.	.	.	.	.	.	.	.	T	622	.	.	I	-	2	0	NBPF14	146476083	0.999000	0.42202	.	.	.	.	0.724000	0.25954	.	.	.	.	ATA		0.483	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383		14	179	0	0	0	0.00245	0	14	179				
FLG	2312	broad.mit.edu	37	1	152278890	152278890	+	Missense_Mutation	SNP	C	C	A	rs560440473	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:152278890C>A	ENST00000368799.1	-	3	8507	c.8472G>T	c.(8470-8472)agG>agT	p.R2824S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2824	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGGCATCAGACCTTCCCTGGG	0.582									Ichthyosis				c|||	2	0.000399361	0.0	0.0	5008	,	,		30525	0.0		0.001	False		,,,				2504	0.001						uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(8470-8472)AGG>AGT		filaggrin							132.0	197.0	176.0					1																	152278890		2151	4279	6430	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152278890C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8472G>T	1.37:g.152278890C>A	ENSP00000357789:p.Arg2824Ser		Somatic					p.R2824S	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	8508	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2824			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.8472G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	c	2.312	-0.357680	0.05138	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01685	4.69	2.21	-3.58	0.04597	.	.	.	.	.	T	0.00754	0.0025	M	0.76838	2.35	0.09310	N	1	P	0.45531	0.86	B	0.31390	0.129	T	0.37663	-0.9696	9	0.62326	D	0.03	.	6.9626	0.24605	0.1838:0.2718:0.5444:0.0	.	2824	P20930	FILA_HUMAN	S	2824;86	ENSP00000357789:R2824S	ENSP00000357786:R86S	R	-	3	2	FLG	150545514	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.070000	0.00619	-0.796000	0.04456	-0.672000	0.03802	AGG		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		16	469	1	0	6.44725e-10	0.014323	7.57439e-10	16	469				
GON4L	54856	broad.mit.edu	37	1	155753800	155753800	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:155753800G>A	ENST00000368331.1	-	14	1917	c.1869C>T	c.(1867-1869)aaC>aaT	p.N623N	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000271883.5_Silent_p.N623N|GON4L_ENST00000361040.5_Silent_p.N623N|GON4L_ENST00000437809.1_Silent_p.N623N	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	623					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGGTGTTAAAGTTAGGACGAG	0.448																																							uc001flz.2		NA																	0				ovary(3)	3						c.(1867-1869)AAC>AAT		gon-4-like isoform a							167.0	131.0	143.0					1																	155753800		2203	4300	6503	SO:0001819	synonymous_variant	54856				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:155753800G>A	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1869C>T	1.37:g.155753800G>A			Somatic				GON4L_uc001fly.1_Silent_p.N623N|GON4L_uc009wrh.1_Silent_p.N623N|GON4L_uc001fma.1_Silent_p.N623N|GON4L_uc001fmc.2_Silent_p.N623N|GON4L_uc001fmd.3_Silent_p.N623N|GON4L_uc009wri.2_Silent_p.N209N|GON4L_uc009wrj.1_Silent_p.N138N|GON4L_uc001fme.2_Silent_p.N451N	p.N623N	NM_001037533	NP_001032622	WXS	Illumina HiSeq	Unspecified	Q3T8J9	GON4L_HUMAN			14	1966	-	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)		623					B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37	c.1869C>T																																																																																					0.448	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		4	100	0	0	0	0.009096	0	4	100				
KIFAP3	22920	broad.mit.edu	37	1	169923240	169923240	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:169923240C>T	ENST00000361580.2	-	19	2412	c.2185G>A	c.(2185-2187)Gcc>Acc	p.A729T	KIFAP3_ENST00000367767.1_Missense_Mutation_p.A685T|KIFAP3_ENST00000540905.1_Missense_Mutation_p.A431T|KIFAP3_ENST00000367765.1_Missense_Mutation_p.A689T|KIFAP3_ENST00000538366.1_Missense_Mutation_p.A651T	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	729					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTTCAGAGGCAATTAATCCA	0.348																																							uc001ggv.2		NA																	0				skin(1)	1						c.(2185-2187)GCC>ACC		kinesin-associated protein 3							106.0	114.0	111.0					1																	169923240		2203	4300	6503	SO:0001583	missense	22920				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding	g.chr1:169923240C>T	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.2185G>A	1.37:g.169923240C>T	ENSP00000354560:p.Ala729Thr		Somatic				KIFAP3_uc010plx.1_Missense_Mutation_p.A431T	p.A729T	NM_014970	NP_055785	WXS	Illumina HiSeq	Unspecified	Q92845	KIFA3_HUMAN			19	2456	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		729					B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	ENST00000361580.2	37	c.2185G>A	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	C	9.758	1.169384	0.21621	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000540905;ENST00000538366	T;T;T;T;T	0.43688	0.95;0.95;0.95;0.95;0.94	5.3	4.14	0.48551	.	0.310366	0.34555	N	0.003877	T	0.06735	0.0172	N	0.08118	0	0.28318	N	0.922358	B	0.02656	0.0	B	0.01281	0.0	T	0.30995	-0.9959	9	.	.	.	-2.9754	5.4998	0.16823	0.0:0.6327:0.1542:0.2131	.	729	Q92845	KIFA3_HUMAN	T	729;689;685;431;651	ENSP00000354560:A729T;ENSP00000356739:A689T;ENSP00000356741:A685T;ENSP00000442712:A431T;ENSP00000444622:A651T	.	A	-	1	0	KIFAP3	168189864	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	1.100000	0.31025	1.016000	0.39470	0.650000	0.86243	GCC		0.348	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970		52	65	0	0	0	0.01441	0	52	65				
MYOC	4653	broad.mit.edu	37	1	171621223	171621223	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr1:171621223C>A	ENST00000037502.6	-	1	600	c.529G>T	c.(529-531)Gta>Tta	p.V177L		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	177					bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGCCTTGCTACCTCCTGGCTG	0.572																																							uc001ghu.2		NA																	0				lung(1)	1						c.(529-531)GTA>TTA		myocilin precursor							200.0	215.0	210.0					1																	171621223		2203	4300	6503	SO:0001583	missense	4653				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity	g.chr1:171621223C>A	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.529G>T	1.37:g.171621223C>A	ENSP00000037502:p.Val177Leu		Somatic				MYOC_uc010pmk.1_Missense_Mutation_p.V119L	p.V177L	NM_000261	NP_000252	WXS	Illumina HiSeq	Unspecified	Q99972	MYOC_HUMAN			1	551	-	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		177			Potential.		B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	c.529G>T	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524902	0.27299	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591;ENST00000537133	D	0.82526	-1.62	5.46	3.47	0.39725	.	0.424789	0.27912	N	0.017343	T	0.55657	0.1934	L	0.41027	1.25	0.27828	N	0.941558	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.41538	-0.9503	10	0.24483	T	0.36	.	6.7863	0.23675	0.0:0.7913:0.0:0.2087	.	119;177	B4DV44;Q99972	.;MYOC_HUMAN	L	177;130;110;177	ENSP00000037502:V177L	ENSP00000037502:V177L	V	-	1	0	MYOC	169887846	0.603000	0.26924	0.950000	0.38849	0.990000	0.78478	0.403000	0.20982	1.542000	0.49330	0.655000	0.94253	GTA		0.572	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261		14	355	1	0	1.05317e-09	0.00245	1.2287e-09	14	355				
IL15RA	3601	broad.mit.edu	37	10	5998369	5998369	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:5998369G>C	ENST00000379977.3	-	6	762	c.665C>G	c.(664-666)tCt>tGt	p.S222C	IL15RA_ENST00000534292.1_5'UTR|IL15RA_ENST00000525219.2_Missense_Mutation_p.S186C|IL15RA_ENST00000379971.1_Missense_Mutation_p.S124C|IL15RA_ENST00000528354.1_Missense_Mutation_p.S189C|IL15RA_ENST00000397251.3_Missense_Mutation_p.S157C|IL15RA_ENST00000397248.2_Missense_Mutation_p.S186C|IL15RA_ENST00000530685.1_Missense_Mutation_p.S189C|IL15RA_ENST00000397255.3_Missense_Mutation_p.S222C|IL15RA_ENST00000397250.2_Missense_Mutation_p.S124C			Q13261	I15RA_HUMAN	interleukin 15 receptor, alpha	222					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron projection development (GO:0010977)|positive regulation of natural killer cell differentiation (GO:0032825)|response to nutrient levels (GO:0031667)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5						TGCCAGGAGAGACACAGCGCT	0.557																																							uc001iiv.2		NA																	0					0						c.(664-666)TCT>TGT		interleukin 15 receptor, alpha isoform 1							142.0	97.0	112.0					10																	5998369		2202	4300	6502	SO:0001583	missense	3601				cell proliferation	cytoplasmic vesicle membrane|endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane|nuclear membrane	cytokine receptor activity	g.chr10:5998369G>C	U31628	CCDS7074.1, CCDS7075.1, CCDS7075.2, CCDS58069.1, CCDS73065.1	10p15.1	2012-02-27			ENSG00000134470	ENSG00000134470		"""Interleukins and interleukin receptors"", ""CD molecules"""	5978	protein-coding gene	gene with protein product		601070				8530383	Standard	NM_002189		Approved	CD215, IL-15RA	uc021pmo.1	Q13261	OTTHUMG00000017612	ENST00000379977.3:c.665C>G	10.37:g.5998369G>C	ENSP00000369312:p.Ser222Cys		Somatic				IL15RA_uc001iiu.2_Missense_Mutation_p.S70C|IL15RA_uc010qau.1_Missense_Mutation_p.S189C|IL15RA_uc001iiw.2_Missense_Mutation_p.S186C|IL15RA_uc001iix.2_Missense_Mutation_p.S153C|IL15RA_uc001iiy.2_Missense_Mutation_p.S70C	p.S222C	NM_002189	NP_002180	WXS	Illumina HiSeq	Unspecified	Q13261	I15RA_HUMAN			6	747	-			222			Helical; (Potential).		B4E2C2|Q3B769|Q5JVA1|Q5JVA2|Q5JVA4|Q6B0J2|Q7LDR4|Q7Z609	Missense_Mutation	SNP	ENST00000379977.3	37	c.665C>G	CCDS7074.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.12|10.12	1.263123|1.263123	0.23051|0.23051	.|.	.|.	ENSG00000134470|ENSG00000134470	ENST00000435171;ENST00000447291;ENST00000532039|ENST00000397246;ENST00000397251;ENST00000379977;ENST00000397248;ENST00000319465;ENST00000528354;ENST00000397250;ENST00000379971;ENST00000530685;ENST00000397255;ENST00000525219	.|T;T;T;T;T;T;T;T	.|0.52754	.|1.5;1.5;1.5;1.5;1.5;0.65;1.79;1.5	2.77|2.77	-3.09|-3.09	0.05331|0.05331	.|.	.|1.442610	.|0.05622	.|U	.|0.580075	T|T	0.34395|0.34395	0.0896|0.0896	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;D	.|0.55605	.|0.003;0.003;0.972	.|B;B;P	.|0.54460	.|0.002;0.002;0.753	T|T	0.17289|0.17289	-1.0374|-1.0374	5|10	.|0.37606	.|T	.|0.19	-14.9002|-14.9002	4.1031|4.1031	0.10023|0.10023	0.4231:0.1965:0.3803:0.0|0.4231:0.1965:0.3803:0.0	.|.	.|189;222;186	.|Q13261-3;Q13261;E7ETI1	.|.;I15RA_HUMAN;.	V|C	98;125;164|186;157;222;186;186;189;124;124;189;222;157	.|ENSP00000380423:S157C;ENSP00000369312:S222C;ENSP00000380421:S186C;ENSP00000435454:S189C;ENSP00000380422:S124C;ENSP00000369306:S124C;ENSP00000435995:S189C;ENSP00000380426:S222C	.|ENSP00000322245:S186C	L|S	-|-	1|2	0|0	IL15RA|IL15RA	6038375|6038375	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.777000|-0.777000	0.04669|0.04669	-0.691000|-0.691000	0.05135|0.05135	-0.436000|-0.436000	0.05848|0.05848	CTC|TCT		0.557	IL15RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046615.2	NM_172200, NM_002189		3	30	0	0	0	0.004672	0	3	30				
ITGA8	8516	broad.mit.edu	37	10	15760899	15760899	+	Splice_Site	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:15760899C>G	ENST00000378076.3	-	2	563		c.e2-1			NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8						brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GACACTCGCTCTGCAAAAGAG	0.607																																							uc001ioc.1		NA																	0				ovary(3)|lung(3)	6						c.e2-1		integrin, alpha 8 precursor							69.0	64.0	66.0					10																	15760899		2203	4300	6503	SO:0001630	splice_region_variant	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15760899C>G	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.210-1G>C	10.37:g.15760899C>G			Somatic				ITGA8_uc010qcb.1_Splice_Site_p.T70_splice	p.T70_splice	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			2	210	-								B0YJ31|Q5VX94	Splice_Site	SNP	ENST00000378076.3	37	c.210_splice	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998956	0.74818	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.029	0.89277	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA8	15800905	1.000000	0.71417	0.983000	0.44433	0.913000	0.54294	7.157000	0.77461	2.492000	0.84095	0.561000	0.74099	.		0.607	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	Intron	5	67	0	0	0	0.000602	0	5	67				
MYO3A	53904	broad.mit.edu	37	10	26462857	26462857	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:26462857G>C	ENST00000265944.5	+	30	3830	c.3664G>C	c.(3664-3666)Gaa>Caa	p.E1222Q	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1222					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CAAAGACCTGGAAGAGAACAG	0.413																																							uc001isn.2		NA																	0				ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						c.(3664-3666)GAA>CAA		myosin IIIA							102.0	105.0	104.0					10																	26462857		2203	4300	6503	SO:0001583	missense	53904				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity	g.chr10:26462857G>C	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3664G>C	10.37:g.26462857G>C	ENSP00000265944:p.Glu1222Gln		Somatic				MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	p.E1222Q	NM_017433	NP_059129	WXS	Illumina HiSeq	Unspecified	Q8NEV4	MYO3A_HUMAN			30	4024	+			1222					Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	c.3664G>C	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830154	0.32329	.	.	ENSG00000095777	ENST00000265944	T	0.80123	-1.34	5.18	4.28	0.50868	.	0.432596	0.28760	N	0.014228	T	0.64972	0.2647	N	0.14661	0.345	0.80722	D	1	D	0.56035	0.974	B	0.41571	0.36	T	0.65269	-0.6209	10	0.35671	T	0.21	.	11.1201	0.48284	0.15:0.0:0.85:0.0	.	1222	Q8NEV4	MYO3A_HUMAN	Q	1222	ENSP00000265944:E1222Q	ENSP00000265944:E1222Q	E	+	1	0	MYO3A	26502863	0.940000	0.31905	0.184000	0.23157	0.014000	0.08584	3.967000	0.56802	1.313000	0.45069	0.655000	0.94253	GAA		0.413	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		9	52	0	0	0	0.008291	0	9	52				
KIAA1462	57608	broad.mit.edu	37	10	30315685	30315685	+	Missense_Mutation	SNP	C	C	T	rs372754797		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:30315685C>T	ENST00000375377.1	-	3	3493	c.3392G>A	c.(3391-3393)cGc>cAc	p.R1131H		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1131					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CGGTGCTGGGCGAGATAGCAA	0.632																																							uc001iux.2		NA																	0				ovary(4)	4						c.(3391-3393)CGC>CAC		hypothetical protein LOC57608		C	HIS/ARG	0,3954		0,0,1977	53.0	55.0	54.0		3392	2.5	0.0	10		54	1,8339		0,1,4169	no	missense	KIAA1462	NM_020848.2	29	0,1,6146	TT,TC,CC		0.012,0.0,0.0081	benign	1131/1360	30315685	1,12293	1977	4170	6147	SO:0001583	missense	57608							g.chr10:30315685C>T	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3392G>A	10.37:g.30315685C>T	ENSP00000364526:p.Arg1131His		Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.R993H|KIAA1462_uc009xle.1_Missense_Mutation_p.R1131H	p.R1131H	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	3451	-			1131					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	c.3392G>A	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777682	0.31502	0.0	1.2E-4	ENSG00000165757	ENST00000375377	T	0.11712	2.75	4.91	2.54	0.30619	.	0.885835	0.10218	N	0.701318	T	0.04363	0.0120	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.37820	-0.9689	10	0.34782	T	0.22	-2.178	4.176	0.10351	0.0:0.6087:0.2348:0.1565	.	1131	Q9P266	K1462_HUMAN	H	1131	ENSP00000364526:R1131H	ENSP00000364526:R1131H	R	-	2	0	KIAA1462	30355691	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.209000	0.17435	1.149000	0.42402	0.462000	0.41574	CGC		0.632	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		10	95	0	0	0	0.008291	0	10	95				
PLEKHS1	79949	broad.mit.edu	37	10	115534042	115534042	+	Silent	SNP	A	A	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:115534042A>C	ENST00000369310.3	+	8	1273	c.711A>C	c.(709-711)ccA>ccC	p.P237P	PLEKHS1_ENST00000361048.1_Silent_p.P243P|PLEKHS1_ENST00000354462.3_5'UTR|PLEKHS1_ENST00000369309.1_Silent_p.P57P|PLEKHS1_ENST00000369312.4_Silent_p.P155P	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	237																	CTGATGGTCCAGACCAGGTCT	0.383																																							uc001lat.1		NA																	0				central_nervous_system(1)	1						c.(709-711)CCA>CCC		hypothetical protein LOC79949							127.0	117.0	120.0					10																	115534042		2203	4300	6503	SO:0001819	synonymous_variant	79949							g.chr10:115534042A>C	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.711A>C	10.37:g.115534042A>C			Somatic				C10orf81_uc001lar.1_Silent_p.P243P|C10orf81_uc009xyc.1_Silent_p.P155P|C10orf81_uc001las.1_Silent_p.P155P|C10orf81_uc001lau.1_Silent_p.P57P	p.P237P	NM_024889	NP_079165	WXS	Illumina HiSeq	Unspecified	Q5SXH7	CJ081_HUMAN		Epithelial(162;0.0181)|all cancers(201;0.0204)	8	1273	+		Colorectal(252;0.175)	237					A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Silent	SNP	ENST00000369310.3	37	c.711A>C	CCDS53580.1																																																																																				0.383	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889		4	38	0	0	0	0.009096	0	4	38				
VWA2	340706	broad.mit.edu	37	10	116032545	116032545	+	Nonsense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:116032545A>T	ENST00000392982.3	+	6	668	c.418A>T	c.(418-420)Aga>Tga	p.R140*	VWA2_ENST00000603594.1_Nonsense_Mutation_p.R140*			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	140	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CCTTCTGCACAGAGGGTTGCC	0.537																																							uc001lbl.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(418-420)AGA>TGA		von Willebrand factor A domain containing 2							111.0	106.0	108.0					10																	116032545		2203	4300	6503	SO:0001587	stop_gained	340706					extracellular region		g.chr10:116032545A>T	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.418A>T	10.37:g.116032545A>T	ENSP00000376708:p.Arg140*		Somatic				VWA2_uc001lbk.1_Nonsense_Mutation_p.R140*|VWA2_uc009xyf.1_5'UTR	p.R140*	NM_198496	NP_940898	WXS	Illumina HiSeq	Unspecified	Q5GFL6	VWA2_HUMAN		Epithelial(162;0.036)|all cancers(201;0.0793)	6	739	+			140			VWFA 1.		A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Nonsense_Mutation	SNP	ENST00000392982.3	37	c.418A>T		.	.	.	.	.	.	.	.	.	.	A	20.2	3.951090	0.73787	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	.	.	.	5.2	1.55	0.23275	.	0.238104	0.41396	D	0.000896	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	7.3944	0.26927	0.7306:0.0:0.2694:0.0	.	.	.	.	X	140	.	ENSP00000298715:R140X	R	+	1	2	VWA2	116022535	0.998000	0.40836	0.001000	0.08648	0.045000	0.14185	4.624000	0.61254	0.011000	0.14865	-0.250000	0.11733	AGA		0.537	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496		18	70	0	0	0	0.006122	0	18	70				
FAM204A	63877	broad.mit.edu	37	10	120095846	120095846	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:120095846A>G	ENST00000369183.4	-	3	341	c.82T>C	c.(82-84)Tct>Cct	p.S28P	FAM204A_ENST00000469758.1_5'UTR|FAM204A_ENST00000369172.4_Missense_Mutation_p.S28P	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	28										kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TTAAGTCCAGAGTTCTCCAAC	0.408																																							uc001ldo.2		NA																	0					0						c.(82-84)TCT>CCT		hypothetical protein LOC63877							138.0	125.0	130.0					10																	120095846		2203	4300	6503	SO:0001583	missense	63877							g.chr10:120095846A>G	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.82T>C	10.37:g.120095846A>G	ENSP00000358183:p.Ser28Pro		Somatic				C10orf84_uc010qss.1_Missense_Mutation_p.S28P	p.S28P	NM_022063	NP_071346	WXS	Illumina HiSeq	Unspecified	Q9H8W3	F204A_HUMAN		all cancers(201;0.0244)	3	349	-		Colorectal(252;0.101)	28					D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	ENST00000369183.4	37	c.82T>C	CCDS7605.1	.	.	.	.	.	.	.	.	.	.	A	13.10	2.135738	0.37728	.	.	ENSG00000165669	ENST00000369183;ENST00000369172;ENST00000369170	.	.	.	5.93	3.61	0.41365	.	0.247257	0.34676	N	0.003761	T	0.41673	0.1169	M	0.72118	2.19	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.42344	-0.9457	9	0.49607	T	0.09	-0.8619	3.5414	0.07812	0.6819:0.0:0.1442:0.1739	.	28	Q9H8W3	F204A_HUMAN	P	28	.	ENSP00000358168:S28P	S	-	1	0	FAM204A	120085836	0.001000	0.12720	0.455000	0.27031	0.117000	0.20001	0.696000	0.25541	1.050000	0.40346	0.533000	0.62120	TCT		0.408	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050596.2	NM_022063		6	60	0	0	0	0.001168	0	6	60				
TCERG1L	256536	broad.mit.edu	37	10	133106605	133106605	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr10:133106605T>A	ENST00000368642.4	-	3	624	c.539A>T	c.(538-540)gAg>gTg	p.E180V		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	180	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CCTTGACTCCTCAGGATGTAT	0.473																																							uc001lkp.2		NA																	0				large_intestine(2)|ovary(2)	4						c.(538-540)GAG>GTG		transcription elongation regulator 1-like							69.0	69.0	69.0					10																	133106605		2203	4300	6503	SO:0001583	missense	256536							g.chr10:133106605T>A	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.539A>T	10.37:g.133106605T>A	ENSP00000357631:p.Glu180Val		Somatic					p.E180V	NM_174937	NP_777597	WXS	Illumina HiSeq	Unspecified	Q5VWI1	TCRGL_HUMAN		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)	3	625	-		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)	180			WW 1.		Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	c.539A>T	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	T	18.62	3.663358	0.67700	.	.	ENSG00000176769	ENST00000368642	T	0.46063	0.88	5.87	4.74	0.60224	.	0.091303	0.45867	D	0.000326	T	0.46288	0.1385	L	0.32530	0.975	0.46078	D	0.998854	D	0.71674	0.998	P	0.59115	0.852	T	0.34850	-0.9812	10	0.41790	T	0.15	-4.3239	10.8035	0.46502	0.0:0.0746:0.0:0.9254	.	180	Q5VWI1	TCRGL_HUMAN	V	180	ENSP00000357631:E180V	ENSP00000357631:E180V	E	-	2	0	TCERG1L	132996595	1.000000	0.71417	0.995000	0.50966	0.747000	0.42532	4.105000	0.57797	1.055000	0.40461	0.482000	0.46254	GAG		0.473	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937		8	38	0	0	0	0.00308	0	8	38				
OR52K2	119774	broad.mit.edu	37	11	4470612	4470612	+	Silent	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:4470612T>C	ENST00000325719.4	+	1	88	c.43T>C	c.(43-45)Ttg>Ctg	p.L15L	AC010930.1_ENST00000408103.1_RNA	NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		AACTGCCTTCTTGTTGGTGGG	0.507																																							uc001lyz.1		NA																	0				skin(2)	2						c.(43-45)TTG>CTG		olfactory receptor, family 52, subfamily K,							140.0	120.0	127.0					11																	4470612		2201	4298	6499	SO:0001819	synonymous_variant	119774				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4470612T>C	AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.43T>C	11.37:g.4470612T>C			Somatic					p.L15L	NM_001005172	NP_001005172	WXS	Illumina HiSeq	Unspecified	Q8NGK3	O52K2_HUMAN		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	43	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	15			Extracellular (Potential).		A8MUY8|B2RP35|Q6IFK4	Silent	SNP	ENST00000325719.4	37	c.43T>C	CCDS31351.1																																																																																				0.507	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385844.1	NM_001005172		9	60	0	0	0	0.006214	0	9	60				
OR51T1	401665	broad.mit.edu	37	11	4903745	4903745	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:4903745C>A	ENST00000322049.1	+	1	616	c.616C>A	c.(616-618)Ctc>Atc	p.L206I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.L233I			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTTTCTTCAGCTCTACCTGAA	0.453																																							uc010qyp.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(697-699)CTC>ATC		olfactory receptor, family 51, subfamily T,							132.0	123.0	126.0					11																	4903745		2201	4298	6499	SO:0001583	missense	401665				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4903745C>A	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.616C>A	11.37:g.4903745C>A	ENSP00000322679:p.Leu206Ile		Somatic					p.L233I	NM_001004759	NP_001004759	WXS	Illumina HiSeq	Unspecified	Q8NGJ9	O51T1_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	697	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	206			Helical; Name=5; (Potential).		Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	37	c.697C>A		.	.	.	.	.	.	.	.	.	.	C	0.006	-2.066581	0.00382	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.72167	-0.63;-0.63	4.99	2.07	0.26955	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39475	N	0.001343	T	0.47710	0.1460	N	0.05467	-0.045	0.09310	N	0.999999	B	0.33379	0.41	B	0.41646	0.362	T	0.49399	-0.8944	10	0.02654	T	1	.	8.9903	0.36019	0.0:0.7447:0.0:0.2553	.	206	Q8NGJ9	O51T1_HUMAN	I	233;206	ENSP00000369738:L233I;ENSP00000322679:L206I	ENSP00000322679:L206I	L	+	1	0	OR51T1	4860321	0.000000	0.05858	0.995000	0.50966	0.073000	0.16967	0.104000	0.15313	0.707000	0.31934	-0.439000	0.05793	CTC		0.453	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759		25	61	1	0	3.83957e-06	0.00278	4.27184e-06	25	61				
OR52J3	119679	broad.mit.edu	37	11	5068178	5068178	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:5068178A>T	ENST00000380370.1	+	1	423	c.423A>T	c.(421-423)caA>caT	p.Q141H		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	141			Q -> L (in dbSNP:rs2500018). {ECO:0000269|PubMed:14983052, ECO:0000269|Ref.1, ECO:0000269|Ref.3}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGACATCCCAAGTGTTGGTGG	0.488																																							uc010qyv.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(421-423)CAA>CAT		olfactory receptor, family 52, subfamily J,							183.0	118.0	140.0					11																	5068178		2201	4298	6499	SO:0001583	missense	119679				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5068178A>T	AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.423A>T	11.37:g.5068178A>T	ENSP00000369728:p.Gln141His		Somatic					p.Q141H	NM_001001916	NP_001001916	WXS	Illumina HiSeq	Unspecified	Q8NH60	O52J3_HUMAN		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	423	+		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)	141			Cytoplasmic (Potential).		Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	c.423A>T	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	A	4.124	0.021220	0.08006	.	.	ENSG00000205495	ENST00000380370	T	0.11385	2.78	4.19	-5.3	0.02738	GPCR, rhodopsin-like superfamily (1);	1.059250	0.07502	N	0.907470	T	0.06050	0.0157	N	0.25825	0.765	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.42447	-0.9451	10	0.59425	D	0.04	.	2.1463	0.03788	0.2786:0.0984:0.4155:0.2075	.	141	Q8NH60	O52J3_HUMAN	H	141	ENSP00000369728:Q141H	ENSP00000369728:Q141H	Q	+	3	2	OR52J3	5024754	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.251000	0.01186	-1.019000	0.03358	-0.854000	0.03029	CAA		0.488	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916		9	40	0	0	0	0.006214	0	9	40				
OR4C16	219428	broad.mit.edu	37	11	55339872	55339872	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:55339872T>A	ENST00000314634.3	+	1	269	c.269T>A	c.(268-270)aTc>aAc	p.I90N		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				AAGACAACTATCTCCTTCAGC	0.448																																							uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(268-270)ATC>AAC		olfactory receptor, family 4, subfamily C,							271.0	254.0	260.0					11																	55339872		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55339872T>A	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.269T>A	11.37:g.55339872T>A	ENSP00000324913:p.Ile90Asn		Somatic					p.I90N	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	269	+		all_epithelial(135;0.0748)	90			Extracellular (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.269T>A	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.395870	0.25205	.	.	ENSG00000181935	ENST00000314634	T	0.01369	4.97	4.98	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.11410	0.0278	H	0.96889	3.9	0.24426	N	0.994596	D	0.58970	0.984	D	0.63033	0.91	T	0.14783	-1.0460	10	0.87932	D	0	.	8.8814	0.35376	0.0:0.0893:0.0:0.9107	.	90	Q8NGL9	OR4CG_HUMAN	N	90	ENSP00000324913:I90N	ENSP00000324913:I90N	I	+	2	0	OR4C16	55096448	0.773000	0.28580	0.081000	0.20488	0.030000	0.12068	2.939000	0.48995	0.925000	0.37094	0.448000	0.29417	ATC		0.448	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		70	109	0	0	0	0.01441	0	70	109				
SDHAF2	54949	broad.mit.edu	37	11	61205550	61205550	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:61205550C>G	ENST00000301761.2	+	3	409	c.335C>G	c.(334-336)cCt>cGt	p.P112R	SDHAF2_ENST00000543265.1_Intron|SDHAF2_ENST00000534878.1_Missense_Mutation_p.P112R|SDHAF2_ENST00000542074.1_Intron|SDHAF2_ENST00000537782.1_Missense_Mutation_p.P112R|RP11-286N22.8_ENST00000544880.1_3'UTR|RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.P100R	NM_017841.2	NP_060311.1			succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						ATTAACGAGCCTAGTAATGAC	0.388																																							uc001nrt.2		NA																	0				ovary(2)	2						c.(334-336)CCT>CGT		succinate dehydrogenase complex assembly factor							156.0	146.0	150.0					11																	61205550		2202	4299	6501	SO:0001583	missense	54949	Familial_Paragangliomas			mitochondrial electron transport, succinate to ubiquinone|protein-FAD linkage	mitochondrion	protein binding	g.chr11:61205550C>G	AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000301761.2:c.335C>G	11.37:g.61205550C>G	ENSP00000301761:p.Pro112Arg		Somatic					p.P112R	NM_017841	NP_060311	WXS	Illumina HiSeq	Unspecified	Q9NX18	SDHF2_HUMAN			3	357	+			112						Missense_Mutation	SNP	ENST00000301761.2	37	c.335C>G	CCDS8007.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892259	0.91889	.	.	ENSG00000256591;ENSG00000167985	ENST00000541135;ENST00000301761	T;T	0.77098	-1.07;-1.07	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90463	0.7013	M	0.90019	3.08	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	D	0.90725	0.4638	10	0.59425	D	0.04	-10.0961	19.6509	0.95805	0.0:1.0:0.0:0.0	.	112	Q9NX18	SDHF2_HUMAN	R	112	ENSP00000443130:P112R;ENSP00000301761:P112R	ENSP00000440939:P112R	P	+	2	0	SDHAF2;RP11-286N22.8	60962126	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.783000	0.75078	2.941000	0.99782	0.655000	0.94253	CCT		0.388	SDHAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398438.1	NM_017841		17	24	0	0	0	0.010504	0	17	24				
DAGLA	747	broad.mit.edu	37	11	61508674	61508674	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:61508674C>T	ENST00000257215.5	+	19	2140	c.2024C>T	c.(2023-2025)tCt>tTt	p.S675F		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	675					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GCTCTGCTCTCTGCAGCCAAG	0.647																																							uc001nsa.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2023-2025)TCT>TTT		neural stem cell-derived dendrite regulator							99.0	84.0	89.0					11																	61508674		2202	4299	6501	SO:0001583	missense	747				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity	g.chr11:61508674C>T	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2024C>T	11.37:g.61508674C>T	ENSP00000257215:p.Ser675Phe		Somatic					p.S675F	NM_006133	NP_006124	WXS	Illumina HiSeq	Unspecified	Q9Y4D2	DGLA_HUMAN		READ - Rectum adenocarcinoma(4;0.219)	19	2135	+			675			Cytoplasmic (Potential).		A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	c.2024C>T	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411378	0.42817	.	.	ENSG00000134780	ENST00000257215	T	0.27557	1.66	3.73	3.73	0.42828	.	0.125811	0.56097	D	0.000034	T	0.43010	0.1228	L	0.44542	1.39	0.51767	D	0.999934	D	0.65815	0.995	P	0.57911	0.829	T	0.47368	-0.9123	10	0.66056	D	0.02	-4.8248	16.4468	0.83936	0.0:1.0:0.0:0.0	.	675	Q9Y4D2	DGLA_HUMAN	F	675	ENSP00000257215:S675F	ENSP00000257215:S675F	S	+	2	0	DAGLA	61265250	1.000000	0.71417	0.896000	0.35187	0.732000	0.41865	5.681000	0.68175	2.039000	0.60335	0.456000	0.33151	TCT		0.647	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133		5	74	0	0	0	0.001168	0	5	74				
GANAB	23193	broad.mit.edu	37	11	62393613	62393613	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:62393613A>G	ENST00000356638.3	-	23	2665	c.2649T>C	c.(2647-2649)ttT>ttC	p.F883F	GANAB_ENST00000346178.4_Silent_p.F905F|GANAB_ENST00000540933.1_Silent_p.F786F|GANAB_ENST00000534779.1_Silent_p.F791F	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	883					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TTGGTGTCTCAAAGTGTCCTT	0.512																																					Melanoma(23;1005 1074 15747 18937)	Melanoma(23;1005 1074 15747 18937)	uc001nub.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(2647-2649)TTT>TTC		neutral alpha-glucosidase AB isoform 2							180.0	177.0	178.0					11																	62393613		2202	4299	6501	SO:0001819	synonymous_variant	23193				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding	g.chr11:62393613A>G	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2649T>C	11.37:g.62393613A>G			Somatic				GANAB_uc001ntz.2_Silent_p.F70F|GANAB_uc001nua.2_Silent_p.F905F|GANAB_uc001nuc.2_Silent_p.F786F|GANAB_uc010rma.1_Silent_p.F791F|GANAB_uc010rmb.1_Silent_p.F769F	p.F883F	NM_198334	NP_938148	WXS	Illumina HiSeq	Unspecified	Q14697	GANAB_HUMAN			23	2682	-			883					A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	c.2649T>C	CCDS8026.1																																																																																				0.512	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334		15	215	0	0	0	0.003163	0	15	215				
HYOU1	10525	broad.mit.edu	37	11	118925328	118925328	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:118925328G>A	ENST00000404233.3	-	7	680	c.556C>T	c.(556-558)Cga>Tga	p.R186*	HYOU1_ENST00000529972.1_Nonsense_Mutation_p.R186*|HYOU1_ENST00000543287.1_Nonsense_Mutation_p.R99*|HYOU1_ENST00000525859.1_Nonsense_Mutation_p.R186*	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	186					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		AGCACAGCTCGGCGCTCGGCC	0.587																																							uc001puu.2		NA																	0					0						c.(556-558)CGA>TGA		hypoxia up-regulated 1 precursor							68.0	62.0	64.0					11																	118925328		2200	4295	6495	SO:0001587	stop_gained	10525					endoplasmic reticulum lumen	ATP binding|protein binding	g.chr11:118925328G>A	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.556C>T	11.37:g.118925328G>A	ENSP00000384144:p.Arg186*		Somatic				HYOU1_uc001put.2_Nonsense_Mutation_p.R151*|HYOU1_uc010ryu.1_Nonsense_Mutation_p.R206*|HYOU1_uc010ryv.1_Nonsense_Mutation_p.R75*|HYOU1_uc001pux.3_Nonsense_Mutation_p.R186*|HYOU1_uc010ryw.1_RNA|HYOU1_uc001puw.1_Nonsense_Mutation_p.R186*	p.R186*	NM_006389	NP_006380	WXS	Illumina HiSeq	Unspecified	Q9Y4L1	HYOU1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)	7	749	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)	186					A8C1Z0|B7Z909|Q2I204|Q53H25	Nonsense_Mutation	SNP	ENST00000404233.3	37	c.556C>T	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627586	0.87560	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	.	.	.	5.21	2.18	0.27775	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0017	14.6835	0.69035	0.0:0.0:0.3187:0.6813	.	.	.	.	X	186;177;186;186;35;186;229;99;186	.	ENSP00000278752:R177X	R	-	1	2	HYOU1	118430538	1.000000	0.71417	0.972000	0.41901	0.991000	0.79684	2.497000	0.45354	0.160000	0.19432	0.557000	0.71058	CGA		0.587	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389		6	47	0	0	0	0.001168	0	6	47				
FGD6	55785	broad.mit.edu	37	12	95603382	95603382	+	Missense_Mutation	SNP	G	G	A	rs149076340	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:95603382G>A	ENST00000343958.4	-	2	1901	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	FGD6_ENST00000546711.1_Missense_Mutation_p.R560W|FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000549499.1_Missense_Mutation_p.R560W	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	560					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TCTGAAGCCCGTTTAGGCATA	0.423													G|||	3	0.000599042	0.0008	0.0	5008	,	,		19397	0.002		0.0	False		,,,				2504	0.0						uc001tdp.3		NA																	0				ovary(2)|breast(1)	3						c.(1678-1680)CGG>TGG		FYVE, RhoGEF and PH domain containing 6		G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	88.0	94.0	92.0		1678	5.1	0.4	12	dbSNP_134	92	0,8600		0,0,4300	yes	missense	FGD6	NM_018351.3	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	560/1431	95603382	2,13004	2203	4300	6503	SO:0001583	missense	55785				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:95603382G>A	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1678C>T	12.37:g.95603382G>A	ENSP00000344446:p.Arg560Trp		Somatic				FGD6_uc009zsx.2_Intron	p.R560W	NM_018351	NP_060821	WXS	Illumina HiSeq	Unspecified	Q6ZV73	FGD6_HUMAN			2	1902	-			560					Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	c.1678C>T	CCDS31878.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	16.94	3.260632	0.59431	4.54E-4	0.0	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.70631	-0.4;-0.5;-0.44	6.04	5.14	0.70334	.	0.861329	0.09697	N	0.767537	T	0.74405	0.3712	L	0.43152	1.355	0.29047	N	0.884715	D	0.76494	0.999	P	0.50490	0.642	T	0.69465	-0.5138	10	0.66056	D	0.02	-0.1208	16.7057	0.85371	0.0:0.0:0.8694:0.1306	.	560	Q6ZV73	FGD6_HUMAN	W	560	ENSP00000344446:R560W;ENSP00000450342:R560W;ENSP00000449005:R560W	ENSP00000344446:R560W	R	-	1	2	FGD6	94127513	0.995000	0.38212	0.405000	0.26409	0.740000	0.42216	2.380000	0.44327	1.536000	0.49237	0.561000	0.74099	CGG		0.423	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351		4	95	0	0	0	0.000602	0	4	95				
CFAP54	144535	broad.mit.edu	37	12	97102464	97102464	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:97102464A>G	ENST00000524981.4	+	48	6630	c.6607A>G	c.(6607-6609)Aat>Gat	p.N2203D				Q96N23	CL055_HUMAN		0																	AAATAAGTTTAATTTTGTTAA	0.323																																							uc001tet.1		NA																	0				skin(6)|ovary(1)	7						c.(1882-1884)AAT>GAT		hypothetical protein LOC374467							86.0	88.0	87.0					12																	97102464		2203	4300	6503	SO:0001583	missense	374467							g.chr12:97102464A>G																												ENST00000524981.4:c.6607A>G	12.37:g.97102464A>G	ENSP00000431759:p.Asn2203Asp		Somatic					p.N628D	NM_198520	NP_940922	WXS	Illumina HiSeq	Unspecified	Q6ZTY8	CL063_HUMAN			15	1960	+			628						Missense_Mutation	SNP	ENST00000524981.4	37	c.1882A>G		.	.	.	.	.	.	.	.	.	.	A	11.14	1.552515	0.27739	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.02	-2.81	0.05805	.	2.107970	0.02278	N	0.069113	T	0.27629	0.0679	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.18713	-1.0328	8	0.35671	T	0.21	2.5046	5.2398	0.15465	0.386:0.0:0.2417:0.3722	.	628	Q6ZTY8	CL063_HUMAN	D	2203;628	.	ENSP00000345466:N628D	N	+	1	0	C12orf63	95626595	0.034000	0.19679	0.157000	0.22605	0.869000	0.49853	-0.079000	0.11357	-0.052000	0.13311	-0.914000	0.02751	AAT		0.323	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4			5	26	0	0	0	0.000602	0	5	26				
FOXN4	121643	broad.mit.edu	37	12	109719362	109719362	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:109719362G>T	ENST00000299162.5	-	9	1248	c.1144C>A	c.(1144-1146)Ccg>Acg	p.P382T	FOXN4_ENST00000355216.1_Missense_Mutation_p.P202T	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	382					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						TGCAGTGGCGGGGTCTGGGCT	0.657																																							uc001toe.3		NA																	0				ovary(1)|lung(1)	2						c.(1144-1146)CCG>ACG		forkhead box N4							35.0	26.0	29.0					12																	109719362		2202	4298	6500	SO:0001583	missense	121643				axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr12:109719362G>T	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1144C>A	12.37:g.109719362G>T	ENSP00000299162:p.Pro382Thr		Somatic				FOXN4_uc009zvg.2_Missense_Mutation_p.P179T|FOXN4_uc001tof.3_Missense_Mutation_p.P202T	p.P382T	NM_213596	NP_998761	WXS	Illumina HiSeq	Unspecified	Q96NZ1	FOXN4_HUMAN			9	1249	-			382					Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	c.1144C>A	CCDS9126.2	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814471	0.70912	.	.	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.95756	-3.8;-3.51	4.76	4.76	0.60689	.	0.382752	0.26746	N	0.022711	D	0.97545	0.9196	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.981	D	0.97884	1.0293	10	0.62326	D	0.03	-20.9342	17.3305	0.87262	0.0:0.0:1.0:0.0	.	382;382	A6H901;Q96NZ1	.;FOXN4_HUMAN	T	202;382	ENSP00000347354:P202T;ENSP00000299162:P382T	ENSP00000299162:P382T	P	-	1	0	FOXN4	108203745	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	9.126000	0.94411	2.639000	0.89480	0.555000	0.69702	CCG		0.657	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735		7	14	1	0	0.00198382	0.001984	0.00209611	7	14				
RAB35	11021	broad.mit.edu	37	12	120536884	120536884	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:120536884C>T	ENST00000229340.5	-	4	490	c.302G>A	c.(301-303)cGg>cAg	p.R101Q	RAB35_ENST00000543364.1_5'UTR|RAB35_ENST00000432953.2_5'UTR|RAB35_ENST00000534951.1_Missense_Mutation_p.R101Q	NM_001167606.1|NM_006861.6	NP_001161078.1|NP_006852.1	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family	101					antigen processing and presentation (GO:0019882)|cellular response to nerve growth factor stimulus (GO:1990090)|cytokinesis (GO:0000910)|endosomal transport (GO:0016197)|GTP catabolic process (GO:0006184)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|protein localization (GO:0008104)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cell projection membrane (GO:0031253)|clathrin-coated endocytic vesicle (GO:0045334)|coated pit (GO:0005905)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		GTGAAGCCACCGCTTGACGTT	0.587																																							uc001txm.1		NA																	0					0						c.(301-303)CGG>CAG		RAB35, member RAS oncogene family							97.0	106.0	103.0					12																	120536884		2109	4229	6338	SO:0001583	missense	11021				cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding	g.chr12:120536884C>T	X79781	CCDS41846.1, CCDS53836.1	12q24	2008-07-28			ENSG00000111737	ENSG00000111737		"""RAB, member RAS oncogene"""	9774	protein-coding gene	gene with protein product		604199					Standard	NM_001167606		Approved	H-ray	uc009zww.2	Q15286	OTTHUMG00000169159	ENST00000229340.5:c.302G>A	12.37:g.120536884C>T	ENSP00000229340:p.Arg101Gln		Somatic				RAB35_uc010szg.1_5'UTR|RAB35_uc009zww.1_5'UTR|RAB35_uc010szh.1_Missense_Mutation_p.R101Q	p.R101Q	NM_006861	NP_006852	WXS	Illumina HiSeq	Unspecified	Q15286	RAB35_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.248)	4	447	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		101					B2R6E0|B4E390	Missense_Mutation	SNP	ENST00000229340.5	37	c.302G>A	CCDS41846.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275724	0.40294	.	.	ENSG00000111737	ENST00000229340;ENST00000534951;ENST00000538903	T;T;T	0.76316	-1.01;-1.01;-1.01	5.05	4.16	0.48862	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	N	0.04063	-0.285	0.80722	D	1	D;D	0.89917	1.0;0.964	P;B	0.62740	0.906;0.3	T	0.65512	-0.6150	10	0.02654	T	1	.	13.5484	0.61717	0.0:0.9252:0.0:0.0748	.	101;101	B4E390;Q15286	.;RAB35_HUMAN	Q	101;101;85	ENSP00000229340:R101Q;ENSP00000441883:R101Q;ENSP00000443994:R85Q	ENSP00000229340:R101Q	R	-	2	0	RAB35	119021267	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.590000	0.82653	1.355000	0.45865	-0.142000	0.14014	CGG		0.587	RAB35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402599.2			8	60	0	0	0	0.00308	0	8	60				
ZNF268	10795	broad.mit.edu	37	12	133779003	133779003	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:133779003T>C	ENST00000536435.2	+	6	1061	c.731T>C	c.(730-732)aTt>aCt	p.I244T	ZNF268_ENST00000539248.2_3'UTR|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000537565.1_Missense_Mutation_p.I83T|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000542711.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.I244T	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	244					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CAAACTGTTATTGGAATAAAA	0.323																																							uc010tcf.1		NA																	0				ovary(1)	1						c.(730-732)ATT>ACT		zinc finger protein 268 isoform a							38.0	39.0	39.0					12																	133779003		1848	4086	5934	SO:0001583	missense	10795					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:133779003T>C	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.731T>C	12.37:g.133779003T>C	ENSP00000444412:p.Ile244Thr		Somatic				ZNF268_uc010tbv.1_Missense_Mutation_p.I83T|ZNF268_uc010tbw.1_Missense_Mutation_p.I83T|ZNF268_uc010tbx.1_Missense_Mutation_p.I104T|ZNF268_uc010tby.1_Missense_Mutation_p.I83T|ZNF268_uc010tbz.1_Missense_Mutation_p.I83T|ZNF268_uc010tca.1_Missense_Mutation_p.I83T|ZNF268_uc010tcb.1_Missense_Mutation_p.I104T|ZNF268_uc010tcc.1_Missense_Mutation_p.I83T|ZNF268_uc010tcd.1_Missense_Mutation_p.I83T|ZNF268_uc010tce.1_Missense_Mutation_p.I83T|ZNF268_uc010tcg.1_Missense_Mutation_p.I83T|ZNF268_uc010tch.1_Missense_Mutation_p.I244T	p.I244T	NM_003415	NP_003406	WXS	Illumina HiSeq	Unspecified	Q14587	ZN268_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)	6	1061	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)	244					Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	ENST00000536435.2	37	c.731T>C	CCDS45012.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.539950	0.00143	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.09538	3.18;2.97	4.13	-8.25	0.01025	.	.	.	.	.	T	0.01835	0.0058	N	0.00223	-1.815	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50972	-0.8764	8	.	.	.	.	11.3068	0.49340	0.1028:0.592:0.0:0.3051	.	244;83	Q14587;Q14587-2	ZN268_HUMAN;.	T	244;244;83;83	ENSP00000228289:I244T;ENSP00000445713:I83T	.	I	+	2	0	ZNF268	132289076	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-0.744000	0.04839	-1.735000	0.01353	0.519000	0.50382	ATT		0.323	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943		5	8	0	0	0	0.000602	0	5	8				
STOML3	161003	broad.mit.edu	37	13	39544447	39544447	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr13:39544447C>T	ENST00000379631.4	-	5	735	c.391G>A	c.(391-393)Gct>Act	p.A131T	STOML3_ENST00000423210.1_Missense_Mutation_p.A122T	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	131					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TTGACATTAGCCACTGCTGAG	0.468																																							uc001uwx.2		NA																	0				ovary(1)	1						c.(391-393)GCT>ACT		stomatin-like 3 isoform 1							181.0	170.0	174.0					13																	39544447		2203	4300	6503	SO:0001583	missense	161003					integral to membrane|plasma membrane		g.chr13:39544447C>T	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.391G>A	13.37:g.39544447C>T	ENSP00000368952:p.Ala131Thr		Somatic				STOML3_uc010tez.1_Missense_Mutation_p.A122T	p.A131T	NM_145286	NP_660329	WXS	Illumina HiSeq	Unspecified	Q8TAV4	STML3_HUMAN		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)	5	529	-		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)	131			Cytoplasmic (Potential).		B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	37	c.391G>A	CCDS9367.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939749	0.73557	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.94862	-3.54;-3.54	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.90477	0.7017	N	0.16233	0.39	0.80722	D	1	B;B	0.23854	0.043;0.092	B;B	0.32393	0.085;0.145	D	0.86088	0.1548	10	0.25751	T	0.34	-20.4545	18.5072	0.90901	0.0:1.0:0.0:0.0	.	122;131	B4E285;Q8TAV4	.;STML3_HUMAN	T	131;122	ENSP00000368952:A131T;ENSP00000401989:A122T	ENSP00000368952:A131T	A	-	1	0	STOML3	38442447	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.695000	0.61767	2.710000	0.92621	0.563000	0.77884	GCT		0.468	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2			26	82	0	0	0	0.004656	0	26	82				
KLHL1	57626	broad.mit.edu	37	13	70413107	70413107	+	Splice_Site	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr13:70413107C>G	ENST00000377844.4	-	6	2174		c.e6+1		KLHL1_ENST00000545028.1_Splice_Site	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1						actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GAATTAAATACCTTTGTTGTT	0.343																																							uc001vip.2		NA																	0					0						c.e6+1		kelch-like 1 protein							92.0	86.0	88.0					13																	70413107		2201	4297	6498	SO:0001630	splice_region_variant	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70413107C>G	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1414+1G>C	13.37:g.70413107C>G			Somatic				KLHL1_uc010thm.1_Splice_Site_p.G411_splice	p.G472_splice	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	6	2208	-		Breast(118;0.000162)						A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Splice_Site	SNP	ENST00000377844.4	37	c.1414_splice	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.576432	0.86645	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9462	0.92623	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL1	69311108	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.984000	0.70548	2.561000	0.86390	0.585000	0.79938	.		0.343	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	Intron	16	19	0	0	0	0.006122	0	16	19				
FERMT2	10979	broad.mit.edu	37	14	53325101	53325101	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr14:53325101C>A	ENST00000395631.2	-	15	2253	c.2037G>T	c.(2035-2037)tgG>tgT	p.W679C	FERMT2_ENST00000341590.3_Missense_Mutation_p.W679C|FERMT2_ENST00000557255.1_5'UTR|FERMT2_ENST00000343279.4_Missense_Mutation_p.W686C|FERMT2_ENST00000553373.1_Missense_Mutation_p.W686C			Q96AC1	FERM2_HUMAN	fermitin family member 2	679					cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					CTATTCACACCCAACCACTGG	0.343																																							uc001xad.2		NA																	0					0						c.(2035-2037)TGG>TGT		fermitin family homolog 2 isoform 1							198.0	171.0	180.0					14																	53325101		2203	4300	6503	SO:0001583	missense	10979				actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding	g.chr14:53325101C>A	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.2037G>T	14.37:g.53325101C>A	ENSP00000378993:p.Trp679Cys		Somatic				FERMT2_uc001xac.2_Missense_Mutation_p.W686C|FERMT2_uc001xae.2_Missense_Mutation_p.W679C	p.W679C	NM_006832	NP_006823	WXS	Illumina HiSeq	Unspecified	Q96AC1	FERM2_HUMAN			15	2092	-	Breast(41;0.0342)		679					B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	37	c.2037G>T	CCDS9713.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871529	0.72065	.	.	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373	T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.69360	0.3102	L	0.46157	1.445	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.68330	-0.5437	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	679;686	Q96AC1;B5TJY2	FERM2_HUMAN;.	C	679;679;639;686;686	ENSP00000378993:W679C;ENSP00000340391:W679C;ENSP00000450741:W639C;ENSP00000342858:W686C;ENSP00000451084:W686C	ENSP00000340391:W679C	W	-	3	0	FERMT2	52394851	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.074000	0.71253	2.937000	0.99478	0.650000	0.86243	TGG		0.343	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832		4	47	1	0	0.000602214	0.000602	0.000656961	4	47				
HSPA2	3306	broad.mit.edu	37	14	65008152	65008152	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr14:65008152G>A	ENST00000394709.1	+	2	661	c.585G>A	c.(583-585)gaG>gaA	p.E195E	HSPA2_ENST00000554883.1_3'UTR|HSPA2_ENST00000247207.6_Silent_p.E195E|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	195					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CGGGCGGCGAGAAGAACGTGC	0.637																																					Pancreas(136;1211 1835 24894 31984 38227)	Pancreas(136;1211 1835 24894 31984 38227)	uc001xhj.2		NA																	0				skin(1)	1						c.(583-585)GAG>GAA		heat shock 70kDa protein 2							92.0	100.0	97.0					14																	65008152		2203	4300	6503	SO:0001819	synonymous_variant	3306				response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding	g.chr14:65008152G>A	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.585G>A	14.37:g.65008152G>A			Somatic				HSPA2_uc001xhk.3_Silent_p.E195E	p.E195E	NM_021979	NP_068814	WXS	Illumina HiSeq	Unspecified	P54652	HSP72_HUMAN		all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)	2	661	+			195					Q15508|Q53XM3|Q9UE78	Silent	SNP	ENST00000394709.1	37	c.585G>A	CCDS9766.1																																																																																				0.637	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1			11	121	0	0	0	0.013537	0	11	121				
ZFYVE26	23503	broad.mit.edu	37	14	68260457	68260457	+	Missense_Mutation	SNP	C	C	T	rs367911364		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr14:68260457C>T	ENST00000347230.4	-	14	2559	c.2421G>A	c.(2419-2421)atG>atA	p.M807I	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.M807I	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	807					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCCGGCCAGACATGGCACTCA	0.522																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(2419-2421)ATG>ATA		zinc finger, FYVE domain containing 26		C	ILE/MET	1,4405	2.1+/-5.4	0,1,2202	97.0	79.0	85.0		2421	0.5	0.0	14		85	0,8600		0,0,4300	no	missense	ZFYVE26	NM_015346.3	10	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	807/2540	68260457	1,13005	2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68260457C>T	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2421G>A	14.37:g.68260457C>T	ENSP00000251119:p.Met807Ile		Somatic				ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.M807I	p.M807I	NM_015346	NP_056161	WXS	Illumina HiSeq	Unspecified	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	14	2560	-			807					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.2421G>A	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	8.942	0.966109	0.18659	2.27E-4	0.0	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.26223	1.89;1.75	5.79	0.525	0.17072	.	1.077800	0.06995	N	0.822229	T	0.14399	0.0348	N	0.22421	0.69	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.001;0.001	T	0.32375	-0.9909	10	0.27082	T	0.32	-0.8388	2.0039	0.03473	0.2291:0.4591:0.1112:0.2005	.	807;807	G3V2D8;Q68DK2	.;ZFY26_HUMAN	I	807;786;807	ENSP00000251119:M807I;ENSP00000450603:M807I	ENSP00000251119:M807I	M	-	3	0	ZFYVE26	67330210	0.001000	0.12720	0.016000	0.15963	0.006000	0.05464	-0.112000	0.10791	-0.174000	0.10743	-0.345000	0.07892	ATG		0.522	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		4	45	0	0	0	0.009096	0	4	45				
EXD1	161829	broad.mit.edu	37	15	41476627	41476627	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr15:41476627C>G	ENST00000314992.5	-	10	1237	c.1047G>C	c.(1045-1047)gaG>gaC	p.E349D	EXD1_ENST00000458580.2_Missense_Mutation_p.E407D	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	349							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						CTTTGACTTTCTCCTCTTTCC	0.398																																							uc001znk.2		NA																	0				ovary(1)	1						c.(1045-1047)GAG>GAC		exonuclease 3'-5' domain containing 1							133.0	143.0	140.0					15																	41476627		2201	4300	6501	SO:0001583	missense	161829				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding	g.chr15:41476627C>G	BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1047G>C	15.37:g.41476627C>G	ENSP00000321029:p.Glu349Asp		Somatic				EXD1_uc001znj.2_Missense_Mutation_p.E147D|EXD1_uc010ucv.1_Missense_Mutation_p.E407D	p.E349D	NM_152596	NP_689809	WXS	Illumina HiSeq	Unspecified	Q8NHP7	EXD1_HUMAN			10	1238	-			349					A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	ENST00000314992.5	37	c.1047G>C	CCDS10072.1	.	.	.	.	.	.	.	.	.	.	C	6.661	0.490544	0.12702	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.46819	0.86;0.87	5.28	-0.741	0.11112	.	0.934180	0.09098	N	0.848954	T	0.34193	0.0889	N	0.19112	0.55	0.09310	N	1	B;B;P	0.50272	0.281;0.281;0.933	B;B;P	0.46452	0.11;0.11;0.517	T	0.29518	-1.0009	10	0.20046	T	0.44	-17.1583	9.6822	0.40076	0.0:0.4001:0.0:0.5999	.	407;349;147	B7Z839;Q8NHP7;Q8NHP7-2	.;EXD1_HUMAN;.	D	349;407	ENSP00000321029:E349D;ENSP00000415056:E407D	ENSP00000321029:E349D	E	-	3	2	EXD1	39263919	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.310000	0.08135	-0.020000	0.14032	-0.320000	0.08662	GAG		0.398	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596		12	83	0	0	0	0.013537	0	12	83				
ADAL	161823	broad.mit.edu	37	15	43627963	43627963	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr15:43627963G>T	ENST00000562188.1	+	2	149	c.133G>T	c.(133-135)Gat>Tat	p.D45Y	ADAL_ENST00000428046.3_Missense_Mutation_p.D45Y|ADAL_ENST00000422466.2_Missense_Mutation_p.D45Y|ADAL_ENST00000389651.4_Missense_Mutation_p.D45Y			Q6DHV7	ADAL_HUMAN	adenosine deaminase-like	45					adenosine catabolic process (GO:0006154)|drug metabolic process (GO:0017144)|inosine biosynthetic process (GO:0046103)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	adenosine deaminase activity (GO:0004000)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)	7		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		CCAGAAGCCAGATCTTAAAAT	0.383																																							uc010udo.1		NA																	0					0						c.(133-135)GAT>TAT		adenosine deaminase-like isoform 1							117.0	117.0	117.0					15																	43627963		2201	4299	6500	SO:0001583	missense	161823				adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding	g.chr15:43627963G>T		CCDS32214.1, CCDS53936.1	15q15.3	2014-08-08			ENSG00000168803	ENSG00000168803			31853	protein-coding gene	gene with protein product							Standard	NM_001012969		Approved		uc010udo.2	Q6DHV7	OTTHUMG00000176646	ENST00000562188.1:c.133G>T	15.37:g.43627963G>T	ENSP00000456242:p.Asp45Tyr		Somatic				ADAL_uc001zrh.2_Missense_Mutation_p.D45Y	p.D45Y	NM_001159280	NP_001152752	WXS	Illumina HiSeq	Unspecified	Q6DHV7	ADAL_HUMAN		GBM - Glioblastoma multiforme(94;9.31e-07)	5	707	+		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)	45					A6NHZ3|B4DQM8	Missense_Mutation	SNP	ENST00000562188.1	37	c.133G>T		.	.	.	.	.	.	.	.	.	.	G	5.612	0.297677	0.10622	.	.	ENSG00000168803	ENST00000422466;ENST00000428046;ENST00000389651	D;D;D	0.95001	-3.58;-3.58;-3.58	5.5	3.6	0.41247	.	0.312083	0.38381	N	0.001707	D	0.90452	0.7010	L	0.50333	1.59	0.25900	N	0.98337	B;B	0.10296	0.003;0.002	B;B	0.18263	0.021;0.014	T	0.80042	-0.1548	10	0.30078	T	0.28	-0.9251	7.5863	0.27995	0.086:0.3336:0.5804:0.0	.	45;45	B4DQM8;Q6DHV7-2	.;.	Y	45	ENSP00000398744:D45Y;ENSP00000413074:D45Y;ENSP00000374302:D45Y	ENSP00000374302:D45Y	D	+	1	0	ADAL	41415255	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	0.649000	0.24843	0.850000	0.35239	0.655000	0.94253	GAT		0.383	ADAL-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432960.1	XM_091156		7	31	1	0	0.00198382	0.001984	0.00209611	7	31				
PSMA4	5685	broad.mit.edu	37	15	78836557	78836557	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr15:78836557A>T	ENST00000044462.7	+	5	385	c.235A>T	c.(235-237)Ata>Tta	p.I79L	PSMA4_ENST00000560217.1_Missense_Mutation_p.I48L|PSMA4_ENST00000559082.1_Missense_Mutation_p.I79L|PSMA4_ENST00000558341.1_Missense_Mutation_p.I79L|PSMA4_ENST00000557929.1_3'UTR|PSMA4_ENST00000558281.1_Missense_Mutation_p.I79L|PSMA4_ENST00000558094.1_5'Flank|PSMA4_ENST00000413382.2_Missense_Mutation_p.I8L	NM_002789.4	NP_002780.1	P25789	PSA4_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 4	79					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						TGTGGCAGGCATAACTTCTGA	0.358																																							uc002bdu.3		NA																	0					0						c.(235-237)ATA>TTA		proteasome alpha 4 subunit isoform 1							91.0	82.0	85.0					15																	78836557		2196	4293	6489	SO:0001583	missense	5685				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity	g.chr15:78836557A>T	BC005361	CCDS10303.1, CCDS45319.1	15q24.1	2004-01-19			ENSG00000041357	ENSG00000041357		"""Proteasome (prosome, macropain) subunits"""	9533	protein-coding gene	gene with protein product		176846				2025653	Standard	NM_002789		Approved	HC9, HsT17706	uc010blf.3	P25789	OTTHUMG00000143859	ENST00000044462.7:c.235A>T	15.37:g.78836557A>T	ENSP00000044462:p.Ile79Leu		Somatic				PSMA4_uc010blf.2_Missense_Mutation_p.I79L|PSMA4_uc002bdv.3_Missense_Mutation_p.I8L|PSMA4_uc002bdw.3_Missense_Mutation_p.I55L|PSMA4_uc002bdx.3_Missense_Mutation_p.I8L	p.I79L	NM_002789	NP_002780	WXS	Illumina HiSeq	Unspecified	P25789	PSA4_HUMAN			5	393	+			79					D3DW86|Q53XP2|Q567Q5|Q8TBD1	Missense_Mutation	SNP	ENST00000044462.7	37	c.235A>T	CCDS10303.1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.255784	0.59321	.	.	ENSG00000041357	ENST00000413382;ENST00000044462	T;T	0.18338	2.22;2.22	5.7	5.7	0.88788	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	N	0.11313	0.125	0.80722	D	1	B	0.28026	0.198	B	0.42771	0.397	T	0.05178	-1.0901	10	0.02654	T	1	-24.3405	15.9745	0.80049	1.0:0.0:0.0:0.0	.	79	P25789	PSA4_HUMAN	L	8;79	ENSP00000402118:I8L;ENSP00000044462:I79L	ENSP00000044462:I79L	I	+	1	0	PSMA4	76623612	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	9.072000	0.93986	2.168000	0.68352	0.533000	0.62120	ATA		0.358	PSMA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290107.5	NM_002789		4	15	0	0	0	0.000602	0	4	15				
TBC1D24	57465	broad.mit.edu	37	16	2549370	2549370	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:2549370G>A	ENST00000293970.5	+	5	1288	c.1155G>A	c.(1153-1155)caG>caA	p.Q385Q	TBC1D24_ENST00000567020.1_Silent_p.Q379Q|RP11-20I23.1_ENST00000564543.1_Intron|TBC1D24_ENST00000434757.2_Silent_p.Q385Q	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	385	TLD.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						TCTACTTCCAGTGTGAAGGAC	0.642																																							uc002cql.2		NA																	0					0						c.(1153-1155)CAG>CAA		TBC1 domain family, member 24							57.0	65.0	62.0					16																	2549370		2159	4265	6424	SO:0001819	synonymous_variant	57465				neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity	g.chr16:2549370G>A	AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.1155G>A	16.37:g.2549370G>A			Somatic				TBC1D24_uc002cqk.2_Silent_p.Q379Q|TBC1D24_uc002cqm.2_Intron|TBC1D24_uc010bsm.2_Intron	p.Q385Q	NM_020705	NP_065756	WXS	Illumina HiSeq	Unspecified	Q9ULP9	TBC24_HUMAN			5	1295	+			385			TLD.		A0JNW3|B9A6M6|Q2KJ08	Silent	SNP	ENST00000293970.5	37	c.1155G>A	CCDS55980.1																																																																																				0.642	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000435637.1	NM_020705		3	29	0	0	0	0.004672	0	3	29				
XYLT1	64131	broad.mit.edu	37	16	17221526	17221526	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:17221526G>A	ENST00000261381.6	-	10	2304	c.2220C>T	c.(2218-2220)tcC>tcT	p.S740S		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	740					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTCTTACCTCGGAAAACTGAA	0.488																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(2218-2220)TCC>TCT		xylosyltransferase I							145.0	149.0	147.0					16																	17221526		2197	4300	6497	SO:0001819	synonymous_variant	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17221526G>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2220C>T	16.37:g.17221526G>A			Somatic					p.S740S	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			10	2305	-			740			Lumenal (Potential).		Q9H1B6	Silent	SNP	ENST00000261381.6	37	c.2220C>T	CCDS10569.1																																																																																				0.488	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		15	142	0	0	0	0.004007	0	15	142				
XYLT1	64131	broad.mit.edu	37	16	17292086	17292086	+	Silent	SNP	C	C	T	rs144531370|rs34709724	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:17292086C>T	ENST00000261381.6	-	5	1356	c.1272G>A	c.(1270-1272)gcG>gcA	p.A424A		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	424					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGTAGTCGGCCGCACTCAGGT	0.622													C|||	10	0.00199681	0.0	0.0	5008	,	,		15992	0.001		0.0	False		,,,				2504	0.0092						uc002dfa.2		NA																	0				ovary(4)	4						c.(1270-1272)GCG>GCA		xylosyltransferase I		C		0,4394		0,0,2197	72.0	63.0	66.0		1272	-10.7	0.8	16	dbSNP_134	66	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	XYLT1	NM_022166.3		0,3,6494	TT,TC,CC		0.0349,0.0,0.0231		424/960	17292086	3,12991	2197	4300	6497	SO:0001819	synonymous_variant	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17292086C>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1272G>A	16.37:g.17292086C>T			Somatic					p.A424A	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			5	1357	-			424			Lumenal (Potential).		Q9H1B6	Silent	SNP	ENST00000261381.6	37	c.1272G>A	CCDS10569.1																																																																																				0.622	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		14	40	0	0	0	0.00245	0	14	40				
SRCAP	10847	broad.mit.edu	37	16	30740307	30740307	+	Silent	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:30740307G>T	ENST00000262518.4	+	26	6064	c.5679G>T	c.(5677-5679)cgG>cgT	p.R1893R	SRCAP_ENST00000344771.4_Silent_p.R1735R|SRCAP_ENST00000395059.2_Silent_p.R1831R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1893					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGGAAAAGCGGAAGCGGCAGC	0.527																																							uc002dze.1		NA																	0				ovary(3)|skin(1)	4						c.(5677-5679)CGG>CGT		Snf2-related CBP activator protein							67.0	75.0	73.0					16																	30740307		2197	4300	6497	SO:0001819	synonymous_variant	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30740307G>T	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5679G>T	16.37:g.30740307G>T			Somatic				SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.R1688R	p.R1893R	NM_006662	NP_006653	WXS	Illumina HiSeq	Unspecified	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		26	6064	+			1893					B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	c.5679G>T	CCDS10689.2																																																																																				0.527	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		20	80	1	0	1.28384e-07	0.012319	1.47729e-07	20	80				
SLC9A5	6553	broad.mit.edu	37	16	67290871	67290871	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:67290871T>C	ENST00000299798.11	+	7	1255	c.1190T>C	c.(1189-1191)aTt>aCt	p.I397T		NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	397					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CTGGACAAGATTGACCAAGTG	0.592																																							uc002esm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1189-1191)ATT>ACT		solute carrier family 9 (sodium/hydrogen							75.0	80.0	78.0					16																	67290871		2044	4196	6240	SO:0001583	missense	6553				regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr16:67290871T>C		CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.1190T>C	16.37:g.67290871T>C	ENSP00000299798:p.Ile397Thr		Somatic				SLC9A5_uc010cee.2_Missense_Mutation_p.I102T|SLC9A5_uc010vji.1_5'UTR	p.I397T	NM_004594	NP_004585	WXS	Illumina HiSeq	Unspecified	Q14940	SL9A5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)	7	1253	+		Ovarian(137;0.0563)	397					A5PKY7|Q9Y626	Missense_Mutation	SNP	ENST00000299798.11	37	c.1190T>C	CCDS42178.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741698	0.69304	.	.	ENSG00000135740	ENST00000299798	T	0.14766	2.48	5.63	5.63	0.86233	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.34019	0.0883	L	0.58925	1.835	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.01504	-1.1338	10	0.45353	T	0.12	.	15.3144	0.74062	0.0:0.0:0.0:1.0	.	397	Q14940	SL9A5_HUMAN	T	397	ENSP00000299798:I397T	ENSP00000299798:I397T	I	+	2	0	SLC9A5	65848372	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.153000	0.71819	2.271000	0.75665	0.533000	0.62120	ATT		0.592	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421386.1			10	96	0	0	0	0.013537	0	10	96				
PLCG2	5336	broad.mit.edu	37	16	81960739	81960739	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:81960739G>A	ENST00000359376.3	+	23	2684	c.2470G>A	c.(2470-2472)Gtc>Atc	p.V824I		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	824	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.V824I(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ATCCAACTACGTCGAGGACAT	0.522																																							uc002fgt.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						c.(2470-2472)GTC>ATC		phospholipase C, gamma 2							171.0	169.0	170.0					16																	81960739		2011	4180	6191	SO:0001583	missense	5336				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr16:81960739G>A		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2470G>A	16.37:g.81960739G>A	ENSP00000352336:p.Val824Ile		Somatic					p.V824I	NM_002661	NP_002652	WXS	Illumina HiSeq	Unspecified	P16885	PLCG2_HUMAN			23	2622	+			824			SH3.		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	c.2470G>A	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352057	0.82132	.	.	ENSG00000197943	ENST00000359376	T	0.51817	0.69	5.29	5.29	0.74685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Src homology-3 domain (4);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.71888	0.3393	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.76200	-0.3046	10	0.87932	D	0	.	18.9351	0.92582	0.0:0.0:1.0:0.0	.	824	P16885	PLCG2_HUMAN	I	824	ENSP00000352336:V824I	ENSP00000352336:V824I	V	+	1	0	PLCG2	80518240	1.000000	0.71417	0.137000	0.22149	0.440000	0.31957	9.675000	0.98638	2.473000	0.83533	0.655000	0.94253	GTC		0.522	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1			8	148	0	0	0	0.004482	0	8	148				
SERPINF1	5176	broad.mit.edu	37	17	1675164	1675164	+	Splice_Site	SNP	A	A	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:1675164A>C	ENST00000254722.4	+	5	602		c.e5-1		SERPINF1_ENST00000571870.1_Splice_Site	NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1						aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GCCTCTTCTCAGAGCTGCGCA	0.572																																							uc002ftl.2		NA																	0				ovary(1)	1						c.e5-2		serine (or cysteine) proteinase inhibitor, clade							37.0	37.0	37.0					17																	1675164		2203	4300	6503	SO:0001630	splice_region_variant	5176				cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity	g.chr17:1675164A>C	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.440-1A>C	17.37:g.1675164A>C			Somatic				SERPINF1_uc010cjw.2_Splice_Site	p.K147_splice	NM_002615	NP_002606	WXS	Illumina HiSeq	Unspecified	P36955	PEDF_HUMAN			5	597	+								F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Splice_Site	SNP	ENST00000254722.4	37	c.440_splice	CCDS11012.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113782	0.56398	.	.	ENSG00000132386	ENST00000254722	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1189	0.81329	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SERPINF1	1621914	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	7.322000	0.79097	2.208000	0.71279	0.459000	0.35465	.		0.572	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	Intron	3	28	0	0	0	0.000602	0	3	28				
WSCD1	23302	broad.mit.edu	37	17	5991404	5991404	+	Silent	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:5991404C>T	ENST00000574946.1	+	3	912	c.522C>T	c.(520-522)tgC>tgT	p.C174C	WSCD1_ENST00000573634.1_Silent_p.C58C|WSCD1_ENST00000317744.5_Silent_p.C174C|WSCD1_ENST00000539421.1_Silent_p.C174C|WSCD1_ENST00000574232.1_Silent_p.C174C			Q658N2	WSCD1_HUMAN	WSC domain containing 1	174	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						TCTCCCACTGCCAGGATGCGT	0.542																																							uc010cli.2		NA																	0					0						c.(520-522)TGC>TGT		WSC domain containing 1							144.0	120.0	128.0					17																	5991404		2203	4300	6503	SO:0001819	synonymous_variant	23302					integral to membrane	sulfotransferase activity	g.chr17:5991404C>T		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.522C>T	17.37:g.5991404C>T			Somatic				WSCD1_uc002gcn.2_Silent_p.C174C|WSCD1_uc002gco.2_Silent_p.C174C|WSCD1_uc010clj.2_Intron	p.C174C	NM_015253	NP_056068	WXS	Illumina HiSeq	Unspecified	Q658N2	WSCD1_HUMAN			3	901	+			174			WSC 1.		A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	37	c.522C>T	CCDS32538.1																																																																																				0.542	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		7	64	0	0	0	0.001984	0	7	64				
UBBP4	23666	broad.mit.edu	37	17	21731144	21731144	+	Missense_Mutation	SNP	T	T	G	rs375625296		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:21731144T>G	ENST00000578713.1	+	1	450	c.446T>G	c.(445-447)cTg>cGg	p.L149R	UBBP4_ENST00000584398.1_3'UTR|UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000584755.1_Missense_Mutation_p.L149R					ubiquitin B pseudogene 4									p.L149R(18)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GTCCTGCGTCTGAGAGGTGGT	0.542																																							uc002gyy.3		NA																	18	Substitution - Missense(18)		endometrium(12)|prostate(6)		NA						c.(445-447)CTG>CGG		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21731144T>G	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.446T>G	17.37:g.21731144T>G	ENSP00000464265:p.Leu149Arg		Somatic					p.L149R			WXS	Illumina HiSeq	Unspecified					2	571	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.446T>G																																																																																					0.542	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			6	95	0	0	0	0.001168	0	6	95				
NLE1	54475	broad.mit.edu	37	17	33467047	33467047	+	Silent	SNP	A	A	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:33467047A>C	ENST00000442241.4	-	3	240	c.201T>G	c.(199-201)gcT>gcG	p.A67A	NLE1_ENST00000593176.1_5'UTR|NLE1_ENST00000360831.5_Silent_p.A67A|NLE1_ENST00000586869.1_5'UTR	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	67					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				AGACGATCTCAGCATCGTGGA	0.552																																							uc002hiy.1		NA																	0				breast(3)|ovary(1)	4						c.(199-201)GCT>GCG		Notchless gene homolog isoform a							78.0	66.0	70.0					17																	33467047		2203	4300	6503	SO:0001819	synonymous_variant	54475					nucleolus		g.chr17:33467047A>C		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.201T>G	17.37:g.33467047A>C			Somatic				NLE1_uc010ctn.1_5'UTR|NLE1_uc002hiz.1_5'UTR	p.A67A	NM_018096	NP_060566	WXS	Illumina HiSeq	Unspecified	Q9NVX2	NLE1_HUMAN			3	229	-		Ovarian(249;0.17)	67					O60868|Q59GJ8|Q9BU54	Silent	SNP	ENST00000442241.4	37	c.201T>G	CCDS11291.1																																																																																				0.552	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096		10	27	0	0	0	0.006214	0	10	27				
VAT1	10493	broad.mit.edu	37	17	41170197	41170197	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:41170197G>A	ENST00000420567.3	-	3	365	c.220C>T	c.(220-222)Ctg>Ttg	p.L74L	VAT1_ENST00000587173.1_Silent_p.L140L|VAT1_ENST00000355653.3_Silent_p.L208L			P54219	VMAT1_HUMAN	vesicle amine transport 1	0			A -> V (in dbSNP:rs17215815).		monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	GTACGGCACAGCTGCACGGCA	0.587																																							uc002icm.1		NA																	0					0						c.(622-624)CTG>TTG		vesicle amine transport protein 1							103.0	88.0	93.0					17																	41170197		2203	4300	6503	SO:0001819	synonymous_variant	10493					cytoplasm|integral to membrane	oxidoreductase activity|zinc ion binding	g.chr17:41170197G>A	U18009	CCDS11451.1	17q21	2013-08-23	2013-08-23			ENSG00000108828			16919	protein-coding gene	gene with protein product		604631	"""vesicle amine transport protein 1 homolog (T. californica)"""			7774926, 8938427	Standard	NM_006373		Approved	VATI, FLJ20230	uc002icm.1	Q99536		ENST00000420567.3:c.220C>T	17.37:g.41170197G>A			Somatic				VAT1_uc010cyw.1_Silent_p.L74L|VAT1_uc010whk.1_Silent_p.L140L	p.L208L	NM_006373	NP_006364	WXS	Illumina HiSeq	Unspecified	Q99536	VAT1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.156)	3	742	-		Breast(137;0.000717)	208	QL -> HV (in Ref. 7; AAA95990).				E9PDJ5|Q9BRE4	Silent	SNP	ENST00000420567.3	37	c.622C>T																																																																																					0.587	VAT1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453104.1	NM_006373		10	80	0	0	0	0.008291	0	10	80				
SP2	6668	broad.mit.edu	37	17	45994184	45994184	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:45994184G>A	ENST00000376741.4	+	3	884	c.747G>A	c.(745-747)aaG>aaA	p.K249K	AC003665.1_ENST00000433001.1_RNA|AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000451140.2_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	249					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						AAGCAAGGAAGAAGAGCCTTC	0.582																																							uc002imk.2		NA																	0					0						c.(745-747)AAG>AAA		Sp2 transcription factor							103.0	108.0	106.0					17																	45994184		2203	4300	6503	SO:0001819	synonymous_variant	6668				immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|zinc ion binding	g.chr17:45994184G>A		CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.747G>A	17.37:g.45994184G>A			Somatic				SP2_uc002iml.2_Silent_p.K242K|uc002imm.2_Intron	p.K249K	NM_003110	NP_003101	WXS	Illumina HiSeq	Unspecified	Q02086	SP2_HUMAN			3	884	+			249					A6NK74	Silent	SNP	ENST00000376741.4	37	c.747G>A	CCDS11521.2																																																																																				0.582	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316777.1	NM_003110		12	133	0	0	0	0.013537	0	12	133				
SPATA20	64847	broad.mit.edu	37	17	48627386	48627386	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:48627386A>G	ENST00000356488.4	+	7	938	c.855A>G	c.(853-855)cgA>cgG	p.R285R	SPATA20_ENST00000006658.6_Silent_p.R301R|SPATA20_ENST00000393244.3_Silent_p.R241R|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	285					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			TCAGCCATCGACTGACTCAGG	0.592																																							uc002irf.2		NA																	0					0						c.(853-855)CGA>CGG		spermatogenesis associated 20							202.0	208.0	206.0					17																	48627386		2203	4300	6503	SO:0001819	synonymous_variant	64847				cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding	g.chr17:48627386A>G		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.855A>G	17.37:g.48627386A>G			Somatic				SPATA20_uc002irc.2_5'UTR|SPATA20_uc002ire.2_Silent_p.R241R|SPATA20_uc002ird.2_Silent_p.R301R|SPATA20_uc010wmv.1_Silent_p.R311R|SPATA20_uc002irg.2_RNA	p.R285R	NM_022827	NP_073738	WXS	Illumina HiSeq	Unspecified	Q8TB22	SPT20_HUMAN	BRCA - Breast invasive adenocarcinoma(22;9.38e-09)		7	996	+	Breast(11;1.23e-18)		285					Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	c.855A>G	CCDS58563.1																																																																																				0.592	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827		28	346	0	0	0	0.00632	0	28	346				
KIF2B	84643	broad.mit.edu	37	17	51900728	51900728	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:51900728G>A	ENST00000268919.4	+	1	490	c.334G>A	c.(334-336)Gcc>Acc	p.A112T		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	112			A -> V (in dbSNP:rs3803824). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.1}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CCAGCGTACCGCCACGAAATG	0.602																																							uc002iua.2		NA																	0				ovary(5)|skin(3)	8						c.(334-336)GCC>ACC		kinesin family member 2B							78.0	83.0	81.0					17																	51900728		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51900728G>A	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.334G>A	17.37:g.51900728G>A	ENSP00000268919:p.Ala112Thr		Somatic				uc010wna.1_RNA	p.A112T	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	490	+			112					Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.334G>A	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	1.988	-0.432467	0.04669	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.75154	-0.91	4.99	-0.787	0.10943	.	0.344162	0.20835	N	0.084805	T	0.45736	0.1357	N	0.11927	0.2	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.20273	-1.0280	10	0.12103	T	0.63	.	4.4214	0.11482	0.2273:0.0:0.5024:0.2703	.	112	Q8N4N8	KIF2B_HUMAN	T	112;35	ENSP00000268919:A112T	ENSP00000268919:A112T	A	+	1	0	KIF2B	49255727	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.319000	0.08039	0.091000	0.17302	-0.137000	0.14449	GCC		0.602	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		9	147	0	0	0	0.004482	0	9	147				
KIF2B	84643	broad.mit.edu	37	17	51900914	51900914	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:51900914C>T	ENST00000268919.4	+	1	676	c.520C>T	c.(520-522)Cgc>Tgc	p.R174C		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	174					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R174C(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CCGAGCTAGACGCGCCCTCGA	0.542																																							uc002iua.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(5)|skin(3)	8						c.(520-522)CGC>TGC		kinesin family member 2B							67.0	64.0	65.0					17																	51900914		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51900914C>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.520C>T	17.37:g.51900914C>T	ENSP00000268919:p.Arg174Cys		Somatic				uc010wna.1_RNA	p.R174C	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	676	+			174			Potential.		Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.520C>T	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605757	0.46527	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.76709	-1.04	5.52	4.49	0.54785	.	0.161344	0.25166	N	0.032624	D	0.83422	0.5251	L	0.49126	1.545	0.39712	D	0.971346	D	0.89917	1.0	D	0.71414	0.973	D	0.84940	0.0865	10	0.87932	D	0	.	12.6969	0.57010	0.2193:0.7807:0.0:0.0	.	174	Q8N4N8	KIF2B_HUMAN	C	174;97	ENSP00000268919:R174C	ENSP00000268919:R174C	R	+	1	0	KIF2B	49255913	0.055000	0.20627	0.646000	0.29493	0.469000	0.32828	0.681000	0.25320	2.739000	0.93911	0.655000	0.94253	CGC		0.542	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		5	112	0	0	0	0.001168	0	5	112				
PITPNC1	26207	broad.mit.edu	37	17	65688891	65688891	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr17:65688891C>T	ENST00000581322.1	+	9	886	c.886C>T	c.(886-888)Cgg>Tgg	p.R296W	PITPNC1_ENST00000299954.9_3'UTR|PITPNC1_ENST00000335257.6_Missense_Mutation_p.R296W|PITPNC1_ENST00000580974.1_3'UTR			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	296					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			AGATCGGCCCCGGAAAAAGTC	0.562																																							uc002jgc.2		NA																	0				skin(1)	1						c.(886-888)CGG>TGG		phosphatidylinositol transfer protein,							88.0	90.0	90.0					17																	65688891		1868	4092	5960	SO:0001583	missense	26207				signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding	g.chr17:65688891C>T	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.886C>T	17.37:g.65688891C>T	ENSP00000464006:p.Arg296Trp		Somatic				PITPNC1_uc002jgb.2_3'UTR	p.R296W	NM_012417	NP_036549	WXS	Illumina HiSeq	Unspecified	Q9UKF7	PITC1_HUMAN	BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)		9	1233	+	all_cancers(12;3.03e-10)		296					A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	ENST00000581322.1	37	c.886C>T	CCDS58588.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071248	0.76301	.	.	ENSG00000154217	ENST00000335257	T	0.58652	0.32	5.87	4.9	0.64082	.	0.208082	0.49916	D	0.000134	T	0.68586	0.3017	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72877	-0.4159	10	0.87932	D	0	-24.1445	16.7546	0.85496	0.1304:0.8696:0.0:0.0	.	296	Q9UKF7	PITC1_HUMAN	W	296	ENSP00000335618:R296W	ENSP00000335618:R296W	R	+	1	2	PITPNC1	63119353	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.335000	0.43929	1.614000	0.50241	0.655000	0.94253	CGG		0.562	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417		12	89	0	0	0	0.013537	0	12	89				
LONP1	9361	broad.mit.edu	37	19	5700829	5700829	+	Missense_Mutation	SNP	C	C	T	rs368727101		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:5700829C>T	ENST00000360614.3	-	9	1634	c.1477G>A	c.(1477-1479)Ggc>Agc	p.G493S	LONP1_ENST00000540670.2_Missense_Mutation_p.G297S|LONP1_ENST00000585374.1_Missense_Mutation_p.G379S|LONP1_ENST00000593119.1_Missense_Mutation_p.G429S|LONP1_ENST00000590729.1_Missense_Mutation_p.G363S	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCCTCCATGCCGTAGTGGTCT	0.602																																							uc002mcx.2		NA																	0					0						c.(1477-1479)GGC>AGC		mitochondrial lon peptidase 1 precursor		C	SER/GLY	0,4406		0,0,2203	216.0	135.0	162.0		1477	4.7	1.0	19		162	1,8599	1.2+/-3.3	0,1,4299	no	missense	LONP1	NM_004793.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	493/960	5700829	1,13005	2203	4300	6503	SO:0001583	missense	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5700829C>T	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1477G>A	19.37:g.5700829C>T	ENSP00000353826:p.Gly493Ser		Somatic				LONP1_uc002mcy.2_Missense_Mutation_p.G429S|LONP1_uc010duh.2_Missense_Mutation_p.G234S|LONP1_uc010dui.2_Missense_Mutation_p.G477S|LONP1_uc002mcz.2_Missense_Mutation_p.G297S	p.G493S	NM_004793	NP_004784	WXS	Illumina HiSeq	Unspecified	P36776	LONM_HUMAN			9	1510	-			493						Missense_Mutation	SNP	ENST00000360614.3	37	c.1477G>A	CCDS12148.1	.	.	.	.	.	.	.	.	.	.	C	34	5.325061	0.95708	0.0	1.16E-4	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.47869	1.07;0.83	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.78855	0.4349	H	0.96576	3.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86518	0.1814	10	0.87932	D	0	-45.2296	15.1381	0.72586	0.0:1.0:0.0:0.0	.	493;429;493	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	S	493;457;297	ENSP00000353826:G493S;ENSP00000441523:G297S	ENSP00000351177:G457S	G	-	1	0	LONP1	5651829	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	7.537000	0.82033	2.157000	0.67596	0.561000	0.74099	GGC		0.602	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		4	64	0	0	0	0.009096	0	4	64				
PNPLA6	10908	broad.mit.edu	37	19	7614968	7614968	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:7614968T>G	ENST00000221249.6	+	17	2098	c.1667T>G	c.(1666-1668)tTc>tGc	p.F556C	PNPLA6_ENST00000594864.1_3'UTR|PNPLA6_ENST00000545201.2_Missense_Mutation_p.F530C|PNPLA6_ENST00000414982.3_Missense_Mutation_p.F604C|PNPLA6_ENST00000600737.1_Missense_Mutation_p.F595C|PNPLA6_ENST00000450331.3_Missense_Mutation_p.F556C	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	595					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GACTGCACCTTCCTGCGGATC	0.627																																							uc010xjq.1		NA																	0				ovary(3)	3						c.(1810-1812)TTC>TGC		neuropathy target esterase isoform b							102.0	98.0	99.0					19																	7614968		2203	4300	6503	SO:0001583	missense	10908				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity	g.chr19:7614968T>G	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.1667T>G	19.37:g.7614968T>G	ENSP00000221249:p.Phe556Cys		Somatic				PNPLA6_uc002mgq.1_Missense_Mutation_p.F556C|PNPLA6_uc010xjp.1_Missense_Mutation_p.F530C|PNPLA6_uc002mgr.1_Missense_Mutation_p.F556C|PNPLA6_uc002mgs.2_Missense_Mutation_p.F595C	p.F604C	NM_006702	NP_006693	WXS	Illumina HiSeq	Unspecified	Q8IY17	PLPL6_HUMAN			16	2006	+			595			cNMP 2.|Cytoplasmic (Potential).		A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	c.1811T>G	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688232	0.48097	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0	5.09	5.09	0.68999	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.168417	0.53938	D	0.000060	D	0.95118	0.8418	M	0.72353	2.195	0.53005	D	0.999968	D;D;D;D	0.89917	0.999;0.998;1.0;0.992	D;D;D;P	0.73708	0.981;0.967;0.979;0.882	D	0.95482	0.8561	10	0.87932	D	0	.	12.8378	0.57784	0.0:0.0:0.0:1.0	.	595;530;595;556	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	C	556;530;604;556	ENSP00000221249:F556C;ENSP00000443323:F530C;ENSP00000407509:F604C;ENSP00000394348:F556C	ENSP00000221249:F556C	F	+	2	0	PNPLA6	7520968	1.000000	0.71417	1.000000	0.80357	0.435000	0.31806	5.006000	0.63978	1.919000	0.55581	0.402000	0.26972	TTC		0.627	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702		7	79	0	0	0	0.00308	0	7	79				
KEAP1	9817	broad.mit.edu	37	19	10610361	10610361	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:10610361C>T	ENST00000171111.5	-	2	896	c.349G>A	c.(349-351)Gag>Aag	p.E117K	KEAP1_ENST00000393623.2_Missense_Mutation_p.E117K|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	117	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ATGCCCTGCTCCCGCAGCCCG	0.607																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(349-351)GAG>AAG		kelch-like ECH-associated protein 1							94.0	77.0	83.0					19																	10610361		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610361C>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.349G>A	19.37:g.10610361C>T	ENSP00000171111:p.Glu117Lys		Somatic				KEAP1_uc002mor.1_Missense_Mutation_p.E117K	p.E117K	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	505	-			117			BTB.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.349G>A	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	32	5.132156	0.94473	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.75154	-0.91;-0.91	4.68	4.68	0.58851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.88220	0.6378	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90629	0.4565	10	0.66056	D	0.02	.	15.0979	0.72250	0.0:1.0:0.0:0.0	.	117	Q14145	KEAP1_HUMAN	K	117	ENSP00000171111:E117K;ENSP00000377245:E117K	ENSP00000171111:E117K	E	-	1	0	KEAP1	10471361	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.690000	0.84178	2.162000	0.67917	0.462000	0.41574	GAG		0.607	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		8	34	0	0	0	0.00308	0	8	34				
SPINT2	10653	broad.mit.edu	37	19	38774333	38774333	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:38774333T>C	ENST00000301244.7	+	2	608	c.173T>C	c.(172-174)gTc>gCc	p.V58A	SPINT2_ENST00000454580.3_Intron|SPINT2_ENST00000587090.1_Missense_Mutation_p.V8A	NM_021102.3	NP_066925.1	O43291	SPIT2_HUMAN	serine peptidase inhibitor, Kunitz type, 2	58	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)|lung(1)|ovary(1)	4	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TGGTACAATGTCACTGACGGA	0.552																																							uc002ohr.1		NA																	0					0						c.(172-174)GTC>GCC		serine protease inhibitor, Kunitz type, 2							181.0	143.0	156.0					19																	38774333		2203	4300	6503	SO:0001583	missense	10653				cellular component movement	cytoplasm|extracellular region|integral to membrane|soluble fraction	serine-type endopeptidase inhibitor activity	g.chr19:38774333T>C	U78095	CCDS12510.1, CCDS54261.1	19q13.2	2010-05-12	2005-08-17		ENSG00000167642	ENSG00000167642			11247	protein-coding gene	gene with protein product	"""placental bikunin"""	605124	"""serine protease inhibitor, Kunitz type, 2"""			9115294, 9346890	Standard	NM_021102		Approved	Kop, HAI-2	uc002ohr.2	O43291		ENST00000301244.7:c.173T>C	19.37:g.38774333T>C	ENSP00000301244:p.Val58Ala		Somatic				SPINT2_uc002ohs.1_Intron	p.V58A	NM_021102	NP_066925	WXS	Illumina HiSeq	Unspecified	O43291	SPIT2_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		2	504	+	all_cancers(60;6.83e-07)		58			Extracellular (Potential).|BPTI/Kunitz inhibitor 1.		A8K667|B4DLU1|O00271|O14895|Q5TZQ3|Q969E0	Missense_Mutation	SNP	ENST00000301244.7	37	c.173T>C	CCDS12510.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.311468	0.23821	.	.	ENSG00000167642	ENST00000301244	T	0.55760	0.5	5.47	-1.65	0.08291	Proteinase inhibitor I2, Kunitz metazoa (5);	1.248540	0.05452	N	0.549590	T	0.31949	0.0813	N	0.13327	0.33	0.80722	D	1	B	0.15141	0.012	B	0.18561	0.022	T	0.44620	-0.9316	10	0.06099	T	0.92	.	10.8602	0.46823	0.0:0.5705:0.0:0.4295	.	58	O43291	SPIT2_HUMAN	A	58	ENSP00000301244:V58A	ENSP00000301244:V58A	V	+	2	0	SPINT2	43466173	0.000000	0.05858	0.927000	0.36925	0.923000	0.55619	-0.588000	0.05774	-0.448000	0.07128	-0.566000	0.04163	GTC		0.552	SPINT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458151.2			6	111	0	0	0	0.001984	0	6	111				
FCGBP	8857	broad.mit.edu	37	19	40367841	40367841	+	Silent	SNP	T	T	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:40367841T>G	ENST00000221347.6	-	29	13126	c.13119A>C	c.(13117-13119)gcA>gcC	p.A4373A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4373	TIL 10.					extracellular vesicular exosome (GO:0070062)		p.A4373A(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCGTAAGGGGTGCAGGGGACG	0.627																																							uc002omp.3		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(13117-13119)GCA>GCC		Fc fragment of IgG binding protein precursor							17.0	32.0	27.0					19																	40367841		2132	4018	6150	SO:0001819	synonymous_variant	8857					extracellular region	protein binding	g.chr19:40367841T>G	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13119A>C	19.37:g.40367841T>G			Somatic					p.A4373A	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		29	13127	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		4373			TIL 10.		O95784	Silent	SNP	ENST00000221347.6	37	c.13119A>C	CCDS12546.1																																																																																				0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		8	30	0	0	0	0.003163	0	8	30				
PPP1R15A	23645	broad.mit.edu	37	19	49379184	49379184	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:49379184C>T	ENST00000200453.5	+	3	2248	c.1979C>T	c.(1978-1980)tCt>tTt	p.S660F		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	660					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		TCCCGCTCGTCTGCTGCTGCA	0.562																																							uc002pky.3		NA																	0				lung(1)	1						c.(1978-1980)TCT>TTT		protein phosphatase 1, regulatory subunit 15A							70.0	71.0	71.0					19																	49379184		2203	4300	6503	SO:0001583	missense	23645				apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding	g.chr19:49379184C>T	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1979C>T	19.37:g.49379184C>T	ENSP00000200453:p.Ser660Phe		Somatic					p.S660F	NM_014330	NP_055145	WXS	Illumina HiSeq	Unspecified	O75807	PR15A_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)	3	2248	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	660					B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	c.1979C>T	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	C	5.496	0.276468	0.10403	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.07688	3.17	0.827	0.827	0.18835	.	5.315310	0.00397	N	0.000048	T	0.04588	0.0125	N	0.24115	0.695	0.09310	N	1	P	0.46064	0.872	B	0.27262	0.078	T	0.36335	-0.9752	10	0.30078	T	0.28	0.1712	4.9646	0.14083	0.0:1.0:0.0:0.0	.	660	O75807	PR15A_HUMAN	F	660;500;618	ENSP00000200453:S660F	ENSP00000200453:S660F	S	+	2	0	PPP1R15A	54070996	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.157000	0.16402	0.740000	0.32651	0.609000	0.83330	TCT		0.562	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330		14	158	0	0	0	0.001855	0	14	158				
OTOF	9381	broad.mit.edu	37	2	26705336	26705336	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:26705336T>C	ENST00000272371.2	-	14	1643	c.1517A>G	c.(1516-1518)aAc>aGc	p.N506S	OTOF_ENST00000403946.3_Missense_Mutation_p.N506S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	506	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCACGTCGTTGACCTTGTC	0.577																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(1516-1518)AAC>AGC		otoferlin isoform a							112.0	104.0	107.0					2																	26705336		2203	4299	6502	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26705336T>C	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1517A>G	2.37:g.26705336T>C	ENSP00000272371:p.Asn506Ser		Somatic					p.N506S	NM_194248	NP_919224	WXS	Illumina HiSeq	Unspecified	Q9HC10	OTOF_HUMAN			14	1644	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		506			Cytoplasmic (Potential).|C2 2.		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.1517A>G	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160114	0.78226	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.78481	-1.18;-1.18	5.13	5.13	0.70059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.73885	0.3644	N	0.10629	0.01	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.70081	-0.4970	10	0.09590	T	0.72	-40.2014	14.6043	0.68466	0.0:0.0:0.0:1.0	.	506	Q9HC10	OTOF_HUMAN	S	506	ENSP00000272371:N506S;ENSP00000385255:N506S	ENSP00000272371:N506S	N	-	2	0	OTOF	26558840	1.000000	0.71417	0.936000	0.37596	0.763000	0.43281	7.991000	0.88244	1.941000	0.56285	0.459000	0.35465	AAC		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			19	82	0	0	0	0.006122	0	19	82				
MAPRE3	22924	broad.mit.edu	37	2	27248599	27248599	+	Silent	SNP	C	C	T	rs139273861		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:27248599C>T	ENST00000233121.2	+	5	816	c.618C>T	c.(616-618)aaC>aaT	p.N206N	MAPRE3_ENST00000405074.3_Silent_p.N191N|MAPRE3_ENST00000402218.1_Silent_p.N191N			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	206	EB1 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00576}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAACTCAACCAACAGGTGA	0.597													c|||	1	0.000199681	0.0	0.0	5008	,	,		19234	0.0		0.001	False		,,,				2504	0.0						uc002rhw.2		NA																	0				ovary(1)	1						c.(616-618)AAC>AAT		microtubule-associated protein, RP/EB family,		C		0,4406		0,0,2203	51.0	49.0	50.0		618	3.2	1.0	2	dbSNP_134	50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MAPRE3	NM_012326.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		206/282	27248599	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22924				cell division|mitosis|positive regulation of transcription, DNA-dependent	cytoplasm|cytoplasmic microtubule|microtubule|midbody|perinuclear region of cytoplasm	microtubule binding|protein binding|small GTPase regulator activity	g.chr2:27248599C>T	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.618C>T	2.37:g.27248599C>T			Somatic				MAPRE3_uc002rhx.2_Silent_p.N191N	p.N206N	NM_012326	NP_036458	WXS	Illumina HiSeq	Unspecified	Q9UPY8	MARE3_HUMAN			5	771	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		206			EB1 C-terminal.		B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	c.618C>T	CCDS1731.1																																																																																				0.597	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326		4	54	0	0	0	0.000602	0	4	54				
RGPD3	653489	broad.mit.edu	37	2	107041237	107041237	+	Silent	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:107041237T>A	ENST00000409886.3	-	20	3273	c.3186A>T	c.(3184-3186)tcA>tcT	p.S1062S	RGPD3_ENST00000304514.7_Silent_p.S1062S	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1062	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTACCCCCTGTGAATACAGAA	0.398																																							uc010ywi.1		NA																	0				ovary(1)	1						c.(3184-3186)TCA>TCT		RANBP2-like and GRIP domain containing 3							14.0	12.0	12.0					2																	107041237		692	1568	2260	SO:0001819	synonymous_variant	653489				intracellular transport		binding	g.chr2:107041237T>A		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3186A>T	2.37:g.107041237T>A			Somatic					p.S1062S	NM_001144013	NP_001137485	WXS	Illumina HiSeq	Unspecified	A6NKT7	RGPD3_HUMAN			20	3243	-			1062			RanBD1 1.		B8ZZM4	Silent	SNP	ENST00000409886.3	37	c.3186A>T	CCDS46379.1																																																																																				0.398	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		59	362	0	0	0	0.01441	0	59	362				
CFAP221	200373	broad.mit.edu	37	2	120388402	120388402	+	Silent	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:120388402C>A	ENST00000413369.3	+	19	1986	c.1899C>A	c.(1897-1899)ggC>ggA	p.G633G	PCDP1_ENST00000602047.1_Silent_p.G347G	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					AGCTCTCTGGCAAAACATCAG	0.473																																							uc002tmb.2		NA																	0					0						c.(1039-1041)GGC>GGA		primary ciliary dyskinesia protein 1							182.0	172.0	176.0					2																	120388402		2203	4300	6503	SO:0001819	synonymous_variant	200373					cilium	calmodulin binding	g.chr2:120388402C>A																												ENST00000413369.3:c.1899C>A	2.37:g.120388402C>A			Somatic				PCDP1_uc010yyq.1_Silent_p.G477G	p.G347G	NM_001029996	NP_001025167	WXS	Illumina HiSeq	Unspecified	Q4G0U5	PCDP1_HUMAN			20	2133	+	Colorectal(110;0.196)		633						Silent	SNP	ENST00000413369.3	37	c.1041C>A	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	C	6.280	0.419804	0.11928	.	.	ENSG00000163075	ENST00000443972;ENST00000413057	.	.	.	4.91	-9.82	0.00484	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15809	-1.0424	4	.	.	.	-3.7171	1.1035	0.01689	0.4048:0.1334:0.2581:0.2037	.	.	.	.	E	192;181	.	.	A	+	2	0	AC069154.2	120104872	0.000000	0.05858	0.000000	0.03702	0.217000	0.24651	-2.230000	0.01207	-1.755000	0.01320	0.563000	0.77884	GCA		0.473	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1			12	73	1	0	2.27111e-07	0.013537	2.59555e-07	12	73				
SLC40A1	30061	broad.mit.edu	37	2	190428871	190428871	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:190428871C>G	ENST00000261024.2	-	7	1267	c.841G>C	c.(841-843)Gag>Cag	p.E281Q		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	281					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CAAGTAGGCTCTTGCTCATGT	0.498																																							uc002uqp.3		NA																	0				ovary(1)	1						c.(841-843)GAG>CAG		solute carrier family 40 (iron-regulated							120.0	102.0	108.0					2																	190428871		2203	4300	6503	SO:0001583	missense	30061				anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding	g.chr2:190428871C>G	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.841G>C	2.37:g.190428871C>G	ENSP00000261024:p.Glu281Gln		Somatic					p.E281Q	NM_014585	NP_055400	WXS	Illumina HiSeq	Unspecified	Q9NP59	S40A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)		7	1192	-			281					Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	c.841G>C	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.105741	0.37145	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.93659	-3.26	6.05	5.16	0.70880	Major facilitator superfamily domain, general substrate transporter (1);	0.148156	0.64402	D	0.000010	D	0.90679	0.7076	L	0.49350	1.555	0.51012	D	0.999904	B	0.19706	0.038	B	0.20384	0.029	D	0.87059	0.2152	10	0.14656	T	0.56	-2.5787	17.2463	0.87029	0.0:0.8743:0.1257:0.0	.	281	Q9NP59	S40A1_HUMAN	Q	281;16	ENSP00000261024:E281Q	ENSP00000261024:E281Q	E	-	1	0	SLC40A1	190137116	1.000000	0.71417	0.986000	0.45419	0.949000	0.60115	3.456000	0.53000	1.532000	0.49169	0.650000	0.86243	GAG		0.498	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2			9	48	0	0	0	0.004482	0	9	48				
PARD3B	117583	broad.mit.edu	37	2	206166352	206166352	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:206166352G>A	ENST00000406610.2	+	18	2764	c.2557G>A	c.(2557-2559)Gag>Aag	p.E853K	PARD3B_ENST00000349953.3_Missense_Mutation_p.E853K|PARD3B_ENST00000358768.2_Missense_Mutation_p.E791K|PARD3B_ENST00000462231.1_Missense_Mutation_p.E853K|PARD3B_ENST00000351153.1_Missense_Mutation_p.E784K	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	853	Lys-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.E791K(1)|p.E792K(1)|p.E784K(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		gaaagtcaaggagaaaaagcg	0.433																																							uc002var.1		NA																	3	Substitution - Missense(3)		endometrium(3)	skin(2)|ovary(1)|breast(1)	4						c.(2557-2559)GAG>AAG		par-3 partitioning defective 3 homolog B isoform							56.0	56.0	56.0					2																	206166352		1838	4094	5932	SO:0001583	missense	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:206166352G>A	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2557G>A	2.37:g.206166352G>A	ENSP00000385848:p.Glu853Lys		Somatic				PARD3B_uc010fub.1_Missense_Mutation_p.E853K|PARD3B_uc002vao.1_Missense_Mutation_p.E853K|PARD3B_uc002vap.1_Missense_Mutation_p.E791K|PARD3B_uc002vaq.1_Missense_Mutation_p.E784K	p.E853K	NM_152526	NP_689739	WXS	Illumina HiSeq	Unspecified	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	18	2764	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)	853			Lys-rich.		E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37	c.2557G>A		.	.	.	.	.	.	.	.	.	.	G	13.91	2.377006	0.42105	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.87	4.97	0.65823	.	0.303044	0.31519	N	0.007520	T	0.47563	0.1452	L	0.43152	1.355	0.34166	D	0.669283	P;D;B;D;D	0.76494	0.51;0.997;0.376;0.999;0.999	B;D;B;D;D	0.80764	0.154;0.98;0.073;0.942;0.994	T	0.58031	-0.7708	10	0.33141	T	0.24	.	16.4488	0.83973	0.0:0.1316:0.8684:0.0	.	784;853;784;791;853	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	K	853;791;784;853	ENSP00000385848:E853K;ENSP00000351618:E791K;ENSP00000317261:E784K;ENSP00000340280:E853K	ENSP00000340280:E853K	E	+	1	0	PARD3B	205874597	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.049000	0.64244	1.423000	0.47198	0.650000	0.86243	GAG		0.433	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177		6	30	0	0	0	0.001168	0	6	30				
DNER	92737	broad.mit.edu	37	2	230456436	230456436	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr2:230456436C>G	ENST00000341772.4	-	2	579	c.445G>C	c.(445-447)Gca>Cca	p.A149P		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	149					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		TGTCGGGGTGCCATGGATTCG	0.572																																							uc002vpv.2		NA																	0				lung(5)|ovary(2)|skin(1)	8						c.(445-447)GCA>CCA		delta-notch-like EGF repeat-containing							76.0	62.0	67.0					2																	230456436		2203	4300	6503	SO:0001583	missense	92737				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity	g.chr2:230456436C>G	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.445G>C	2.37:g.230456436C>G	ENSP00000345229:p.Ala149Pro		Somatic					p.A149P	NM_139072	NP_620711	WXS	Illumina HiSeq	Unspecified	Q8NFT8	DNER_HUMAN		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)	2	592	-		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)	149			Extracellular (Potential).		A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	c.445G>C	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	C	7.079	0.569787	0.13560	.	.	ENSG00000187957	ENST00000341772	D	0.85411	-1.98	5.46	4.57	0.56435	.	0.320352	0.32640	N	0.005829	T	0.72277	0.3440	N	0.14661	0.345	0.09310	N	1	P	0.49961	0.93	B	0.41860	0.368	T	0.66874	-0.5813	10	0.66056	D	0.02	.	7.9097	0.29782	0.306:0.6185:0.0:0.0755	.	149	Q8NFT8	DNER_HUMAN	P	149	ENSP00000345229:A149P	ENSP00000345229:A149P	A	-	1	0	DNER	230164680	0.018000	0.18449	0.004000	0.12327	0.163000	0.22366	1.079000	0.30766	1.252000	0.44001	0.655000	0.94253	GCA		0.572	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072		4	37	0	0	0	0.009096	0	4	37				
PSMF1	9491	broad.mit.edu	37	20	1108107	1108107	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:1108107C>G	ENST00000335877.6	+	3	497	c.321C>G	c.(319-321)aaC>aaG	p.N107K	PSMF1_ENST00000438768.2_Missense_Mutation_p.N107K|PSMF1_ENST00000333082.3_Missense_Mutation_p.N107K|PSMF1_ENST00000381898.4_Missense_Mutation_p.N19K|PSMF1_ENST00000246015.4_Missense_Mutation_p.N107K	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	107	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						TGACCCTGAACTTGGATGATT	0.448																																							uc002wel.3		NA																	0					0						c.(319-321)AAC>AAG		proteasome inhibitor subunit 1							134.0	135.0	135.0					20																	1108107		2203	4300	6503	SO:0001583	missense	9491				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome core complex	endopeptidase inhibitor activity|protein binding	g.chr20:1108107C>G	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.321C>G	20.37:g.1108107C>G	ENSP00000338039:p.Asn107Lys		Somatic				PSMF1_uc010zpo.1_Missense_Mutation_p.N19K|PSMF1_uc002wem.3_Missense_Mutation_p.N107K|PSMF1_uc010zpp.1_Missense_Mutation_p.N107K|PSMF1_uc002wen.3_Missense_Mutation_p.N107K	p.N107K	NM_178578	NP_848693	WXS	Illumina HiSeq	Unspecified	Q92530	PSMF1_HUMAN			4	489	+			107					A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	ENST00000335877.6	37	c.321C>G	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446367	0.43429	.	.	ENSG00000125818	ENST00000333082;ENST00000381898;ENST00000381899;ENST00000454500;ENST00000246015;ENST00000335877;ENST00000438768	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.64	2.7	0.31948	.	0.169123	0.51477	D	0.000098	T	0.26666	0.0652	L	0.55481	1.735	0.39133	D	0.961891	B;B;P;P	0.38767	0.048;0.011;0.589;0.646	B;B;B;B	0.28553	0.014;0.013;0.067;0.091	T	0.33497	-0.9866	10	0.05833	T	0.94	-16.3866	2.5366	0.04716	0.154:0.5383:0.1488:0.1589	.	107;19;107;107	E7ER20;F5H4Z3;Q5QPM7;Q92530	.;.;.;PSMF1_HUMAN	K	107;19;107;19;107;107;107	ENSP00000327704:N107K;ENSP00000371323:N19K;ENSP00000371324:N107K;ENSP00000246015:N107K;ENSP00000338039:N107K;ENSP00000401404:N107K	ENSP00000246015:N107K	N	+	3	2	PSMF1	1056107	0.988000	0.35896	1.000000	0.80357	0.932000	0.56968	0.074000	0.14662	0.491000	0.27793	-0.156000	0.13503	AAC		0.448	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2	NM_178578		45	108	0	0	0	0.01441	0	45	108				
ADAM33	80332	broad.mit.edu	37	20	3652284	3652284	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:3652284G>T	ENST00000356518.2	-	16	2090	c.1849C>A	c.(1849-1851)Ctg>Atg	p.L617M	ADAM33_ENST00000350009.2_Missense_Mutation_p.L617M|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000379861.4_Missense_Mutation_p.L617M	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	617	Cys-rich.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						AGCAGGTCCAGCTGGGCACTG	0.637																																							uc002wit.2		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(1849-1851)CTG>ATG		ADAM metallopeptidase domain 33 isoform alpha							25.0	21.0	22.0					20																	3652284		2196	4297	6493	SO:0001583	missense	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3652284G>T	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1849C>A	20.37:g.3652284G>T	ENSP00000348912:p.Leu617Met		Somatic				ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Missense_Mutation_p.L617M|ADAM33_uc002wis.2_Missense_Mutation_p.L139M|ADAM33_uc002wiu.2_Missense_Mutation_p.L617M|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_RNA|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Missense_Mutation_p.L133M	p.L617M	NM_025220	NP_079496	WXS	Illumina HiSeq	Unspecified	Q9BZ11	ADA33_HUMAN			16	1936	-			617			Extracellular (Potential).|Cys-rich.		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	c.1849C>A	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.402032	0.25291	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000428784;ENST00000439201	T;T;T	0.01584	4.75;4.75;4.78	5.46	4.51	0.55191	ADAM, cysteine-rich (1);	.	.	.	.	T	0.04907	0.0132	L	0.34521	1.04	0.09310	N	1	D;D;D;D	0.76494	0.999;0.998;0.997;0.999	D;D;D;D	0.80764	0.994;0.916;0.927;0.927	T	0.44605	-0.9317	9	0.45353	T	0.12	.	8.0781	0.30729	0.0852:0.1585:0.7564:0.0	.	133;617;617;617	E9PEB2;Q9BZ11-2;Q9BZ11;A2A2L3	.;.;ADA33_HUMAN;.	M	617;617;617;133;497	ENSP00000348912:L617M;ENSP00000369190:L617M;ENSP00000322550:L617M	ENSP00000322550:L617M	L	-	1	2	ADAM33	3600284	0.005000	0.15991	0.860000	0.33809	0.099000	0.18886	1.777000	0.38604	1.306000	0.44926	-0.254000	0.11334	CTG		0.637	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		4	6	1	0	2.56e-06	0.009096	2.88644e-06	4	6				
NCOA3	8202	broad.mit.edu	37	20	46264276	46264276	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:46264276A>G	ENST00000371998.3	+	11	1514	c.1323A>G	c.(1321-1323)tcA>tcG	p.S441S	NCOA3_ENST00000372004.3_Silent_p.S441S|NCOA3_ENST00000341724.6_Silent_p.S451S|NCOA3_ENST00000371997.3_Silent_p.S451S			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	441					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ACATAGCTTCATTGACCCCTG	0.562																																							uc002xtk.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(1321-1323)TCA>TCG		nuclear receptor coactivator 3 isoform a							70.0	66.0	68.0					20																	46264276		2203	4300	6503	SO:0001819	synonymous_variant	8202				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding	g.chr20:46264276A>G	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1323A>G	20.37:g.46264276A>G			Somatic				NCOA3_uc010ght.1_Silent_p.S451S|NCOA3_uc002xtl.2_Silent_p.S441S|NCOA3_uc002xtm.2_Silent_p.S441S|NCOA3_uc002xtn.2_Silent_p.S441S|NCOA3_uc010zyc.1_Silent_p.S236S	p.S441S	NM_181659	NP_858045	WXS	Illumina HiSeq	Unspecified	Q9Y6Q9	NCOA3_HUMAN			11	1528	+			441					A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	c.1323A>G	CCDS13407.1																																																																																				0.562	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534		15	199	0	0	0	0.003163	0	15	199				
DDX27	55661	broad.mit.edu	37	20	47836000	47836000	+	Silent	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:47836000C>G	ENST00000371764.4	+	1	117	c.108C>G	c.(106-108)ctC>ctG	p.L36L	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	36						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TTGCGGACCTCGGCTTAATCG	0.602																																							uc002xuh.2		NA																	0				kidney(2)	2						c.(106-108)CTC>CTG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							67.0	59.0	62.0					20																	47836000		2203	4300	6503	SO:0001819	synonymous_variant	55661					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr20:47836000C>G	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.108C>G	20.37:g.47836000C>G			Somatic					p.L36L	NM_017895	NP_060365	WXS	Illumina HiSeq	Unspecified	Q96GQ7	DDX27_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		1	169	+			36					A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Silent	SNP	ENST00000371764.4	37	c.108C>G	CCDS13416.1																																																																																				0.602	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1			3	37	0	0	0	0.004672	0	3	37				
VAPB	9217	broad.mit.edu	37	20	56993313	56993313	+	Silent	SNP	G	G	A	rs141383583	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:56993313G>A	ENST00000475243.1	+	2	443	c.105G>A	c.(103-105)ccG>ccA	p.P35P	VAPB_ENST00000265619.2_3'UTR|VAPB_ENST00000395802.3_Silent_p.P35P	NM_004738.4	NP_004729.1	O95292	VAPB_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein B and C	35	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|endoplasmic reticulum unfolded protein response (GO:0030968)|modulation by virus of host morphology or physiology (GO:0019048)|positive regulation of viral genome replication (GO:0045070)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-tubulin binding (GO:0048487)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|structural molecule activity (GO:0005198)			kidney(2)|lung(3)|prostate(1)	6	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			TTGGCAACCCGACAGACCGAA	0.493													G|||	4	0.000798722	0.003	0.0	5008	,	,		14531	0.0		0.0	False		,,,				2504	0.0						uc002xza.2		NA																	0				kidney(1)	1						c.(103-105)CCG>CCA		VAMP-associated protein B/C		G	,	5,4401	9.9+/-24.2	0,5,2198	169.0	149.0	156.0		105,105	-5.2	1.0	20	dbSNP_134	156	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	VAPB	NM_001195677.1,NM_004738.4	,	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	,	35/100,35/244	56993313	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	9217				cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity	g.chr20:56993313G>A	AF086628	CCDS33498.1, CCDS56198.1	20q13	2014-09-17			ENSG00000124164	ENSG00000124164			12649	protein-coding gene	gene with protein product		605704				9920726	Standard	NM_004738		Approved	VAP-B, VAP-C, ALS8	uc002xza.3	O95292	OTTHUMG00000032840	ENST00000475243.1:c.105G>A	20.37:g.56993313G>A			Somatic				VAPB_uc002xzb.2_RNA|VAPB_uc010zzo.1_5'UTR|VAPB_uc002xzc.2_Silent_p.P35P	p.P35P	NM_004738	NP_004729	WXS	Illumina HiSeq	Unspecified	O95292	VAPB_HUMAN	BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)		2	376	+	Lung NSC(12;0.000615)|all_lung(29;0.00186)		35			Cytoplasmic (Potential).|MSP.		A2A2F2|O95293|Q9P0H0	Silent	SNP	ENST00000475243.1	37	c.105G>A	CCDS33498.1																																																																																				0.493	VAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079875.2			15	488	0	0	0	0.00245	0	15	488				
TAF4	6874	broad.mit.edu	37	20	60589671	60589671	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:60589671G>C	ENST00000252996.4	-	2	1452	c.1453C>G	c.(1453-1455)Cag>Gag	p.Q485E	TAF4_ENST00000609045.1_5'Flank	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	485					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			ATGGTGGTCTGAGGCTGGGCA	0.632																																							uc002ybs.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1453-1455)CAG>GAG		TBP-associated factor 4							69.0	61.0	64.0					20																	60589671		2203	4300	6503	SO:0001583	missense	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60589671G>C	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1453C>G	20.37:g.60589671G>C	ENSP00000252996:p.Gln485Glu		Somatic					p.Q485E	NM_003185	NP_003176	WXS	Illumina HiSeq	Unspecified	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		2	1453	-	Breast(26;1e-08)		485					A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	c.1453C>G	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245620	0.59103	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.31769	1.48;1.48	4.97	4.97	0.65823	.	0.060568	0.64402	D	0.000003	T	0.48750	0.1517	M	0.68317	2.08	0.58432	D	0.999999	D	0.58268	0.982	D	0.67548	0.952	T	0.46938	-0.9155	10	0.02654	T	1	-5.9953	18.2131	0.89877	0.0:0.0:1.0:0.0	.	485	O00268	TAF4_HUMAN	E	485;349	ENSP00000252996:Q485E;ENSP00000399091:Q349E	ENSP00000252996:Q485E	Q	-	1	0	TAF4	60023066	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	8.498000	0.90492	2.304000	0.77564	0.462000	0.41574	CAG		0.632	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		8	63	0	0	0	0.00308	0	8	63				
SAMD10	140700	broad.mit.edu	37	20	62608328	62608328	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr20:62608328G>A	ENST00000369886.3	-	3	615	c.441C>T	c.(439-441)atC>atT	p.I147I	ZNF512B_ENST00000217130.3_Intron|SAMD10_ENST00000498830.1_5'UTR|ZNF512B_ENST00000450537.1_Intron	NM_080621.4	NP_542188.1	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	147	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	7	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTGTACCGGTGATGGCATGCT	0.592																																							uc002yhm.2		NA																	0					0						c.(439-441)ATC>ATT		sterile alpha motif domain containing 10							88.0	79.0	82.0					20																	62608328		2203	4300	6503	SO:0001819	synonymous_variant	140700							g.chr20:62608328G>A		CCDS13549.1	20q13.33	2013-01-10	2004-07-15	2004-07-16	ENSG00000130590	ENSG00000130590		"""Sterile alpha motif (SAM) domain containing"""	16129	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 136"""	C20orf136			Standard	NM_080621		Approved		uc002yhm.2	Q9BYL1	OTTHUMG00000033011	ENST00000369886.3:c.441C>T	20.37:g.62608328G>A			Somatic				SAMD10_uc002yhn.2_RNA	p.I147I	NM_080621	NP_542188	WXS	Illumina HiSeq	Unspecified	Q9BYL1	SAM10_HUMAN			3	616	-	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)		147			SAM.			Silent	SNP	ENST00000369886.3	37	c.441C>T	CCDS13549.1																																																																																				0.592	SAMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080255.1	NM_080621		40	112	0	0	0	0.00623	0	40	112				
EIF3D	8664	broad.mit.edu	37	22	36915565	36915565	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr22:36915565C>T	ENST00000216190.8	-	8	968	c.598G>A	c.(598-600)Gaa>Aaa	p.E200K	EIF3D_ENST00000405442.1_Missense_Mutation_p.E200K|EIF3D_ENST00000541106.1_Missense_Mutation_p.E151K	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						TCGTAGTATTCTAGGGCCCCA	0.507																																							uc003apq.2		NA																	0				pancreas(1)	1						c.(598-600)GAA>AAA		eukaryotic translation initiation factor 3							198.0	169.0	179.0					22																	36915565		2203	4300	6503	SO:0001583	missense	8664					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr22:36915565C>T	U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.598G>A	22.37:g.36915565C>T	ENSP00000216190:p.Glu200Lys		Somatic				EIF3D_uc011amr.1_Missense_Mutation_p.E27K|EIF3D_uc003apr.2_Missense_Mutation_p.E200K|EIF3D_uc011ams.1_Missense_Mutation_p.E103K|EIF3D_uc011amt.1_Missense_Mutation_p.E151K	p.E200K	NM_003753	NP_003744	WXS	Illumina HiSeq	Unspecified	O15371	EIF3D_HUMAN			8	714	-			200						Missense_Mutation	SNP	ENST00000216190.8	37	c.598G>A	CCDS13930.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253765	0.80135	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000455547	.	.	.	6.04	6.04	0.98038	.	0.150831	0.64402	D	0.000014	T	0.75443	0.3850	M	0.62723	1.935	0.80722	D	1	B;P	0.35575	0.067;0.51	B;P	0.48982	0.077;0.597	T	0.66260	-0.5968	9	0.14252	T	0.57	-14.4206	20.5792	0.99380	0.0:1.0:0.0:0.0	.	151;200	B4DVY1;O15371	.;EIF3D_HUMAN	K	200;185;151;200;200	.	ENSP00000216190:E200K	E	-	1	0	EIF3D	35245511	1.000000	0.71417	0.857000	0.33713	0.024000	0.10985	7.419000	0.80179	2.873000	0.98535	0.561000	0.74099	GAA		0.507	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1			12	73	0	0	0	0.013537	0	12	73				
CYTH4	27128	broad.mit.edu	37	22	37692042	37692042	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr22:37692042G>A	ENST00000248901.6	+	4	357	c.170G>A	c.(169-171)cGg>cAg	p.R57Q	CYTH4_ENST00000405206.3_Missense_Mutation_p.R57Q|CYTH4_ENST00000402997.1_Missense_Mutation_p.R57Q|CYTH4_ENST00000439667.1_3'UTR	NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	57	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						GTCCACAGCCGGATGGCCCAG	0.627																																							uc003arf.2		NA																	0				ovary(2)	2						c.(169-171)CGG>CAG		cytohesin 4							100.0	74.0	82.0					22																	37692042		2203	4300	6503	SO:0001583	missense	27128				regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity	g.chr22:37692042G>A	AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.170G>A	22.37:g.37692042G>A	ENSP00000248901:p.Arg57Gln		Somatic				CYTH4_uc003ard.3_Missense_Mutation_p.R57Q|CYTH4_uc003are.2_Missense_Mutation_p.R57Q|CYTH4_uc011amw.1_5'UTR|CYTH4_uc010gxe.2_Intron	p.R57Q	NM_013385	NP_037517	WXS	Illumina HiSeq	Unspecified	Q9UIA0	CYH4_HUMAN			4	286	+			57			Potential.|SEC7.		Q5R3F9|Q9UGT6	Missense_Mutation	SNP	ENST00000248901.6	37	c.170G>A	CCDS13946.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326732	0.60743	.	.	ENSG00000100055	ENST00000457992;ENST00000248901;ENST00000422721;ENST00000402997;ENST00000405206	T;T;T;T	0.44881	0.92;3.23;0.92;0.91	5.06	5.06	0.68205	SEC7-like (2);	0.362413	0.29529	N	0.011883	T	0.37705	0.1013	L	0.50919	1.6	0.80722	D	1	B;B	0.32717	0.301;0.381	B;B	0.29598	0.028;0.104	T	0.17592	-1.0364	10	0.29301	T	0.29	.	15.9216	0.79580	0.0:0.0:1.0:0.0	.	57;70	Q9UIA0;Q9H7Q0	CYH4_HUMAN;.	Q	57;57;70;57;57	ENSP00000405442:R57Q;ENSP00000248901:R57Q;ENSP00000385997:R57Q;ENSP00000384280:R57Q	ENSP00000248901:R57Q	R	+	2	0	CYTH4	36021988	1.000000	0.71417	0.988000	0.46212	0.941000	0.58515	4.614000	0.61183	2.337000	0.79520	0.563000	0.77884	CGG		0.627	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1			3	18	0	0	0	0.004672	0	3	18				
NOL12	79159	broad.mit.edu	37	22	38084913	38084913	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr22:38084913G>A	ENST00000359114.4	+	4	365	c.295G>A	c.(295-297)Gac>Aac	p.D99N	NOL12_ENST00000493862.1_3'UTR	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	99						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					GGTGCAGTATGACCACCCCAA	0.632																																							uc003atp.2		NA																	0					0						c.(295-297)GAC>AAC		nucleolar protein 12							203.0	175.0	184.0					22																	38084913		2203	4300	6503	SO:0001583	missense	79159					nucleolus	rRNA binding	g.chr22:38084913G>A	Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.295G>A	22.37:g.38084913G>A	ENSP00000352021:p.Asp99Asn		Somatic				NOL12_uc011anm.1_Missense_Mutation_p.D99N|NOL12_uc003ato.1_RNA|TRIOBP_uc003atq.1_5'UTR	p.D99N	NM_024313	NP_077289	WXS	Illumina HiSeq	Unspecified	Q9UGY1	NOL12_HUMAN			4	351	+	Melanoma(58;0.0574)		99						Missense_Mutation	SNP	ENST00000359114.4	37	c.295G>A	CCDS13955.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882100	0.91740	.	.	ENSG00000256872	ENST00000359114	D	0.83992	-1.79	5.58	4.57	0.56435	.	0.086313	0.85682	D	0.000000	T	0.81356	0.4805	M	0.63169	1.94	0.58432	D	0.999993	P	0.42785	0.79	B	0.40901	0.343	T	0.83158	-0.0100	10	0.87932	D	0	-14.6827	12.8314	0.57748	0.0755:0.0:0.9245:0.0	.	99	Q9UGY1	NOL12_HUMAN	N	99	ENSP00000352021:D99N	ENSP00000352021:D99N	D	+	1	0	Z83844.2	36414859	1.000000	0.71417	0.924000	0.36721	0.962000	0.63368	9.029000	0.93718	1.370000	0.46153	0.655000	0.94253	GAC		0.632	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319476.1	NM_024313		10	137	0	0	0	0.008291	0	10	137				
WNT7B	7477	broad.mit.edu	37	22	46345949	46345949	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr22:46345949G>A	ENST00000339464.4	-	2	523	c.149C>T	c.(148-150)gCc>gTc	p.A50V	WNT7B_ENST00000409496.3_Missense_Mutation_p.A54V|WNT7B_ENST00000410058.1_Missense_Mutation_p.A50V|WNT7B_ENST00000410089.1_Missense_Mutation_p.A34V	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	50					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		CTGGCAGATGGCACGCTGCCG	0.622																																							uc003bgo.2		NA																	0				lung(1)	1						c.(148-150)GCC>GTC		wingless-type MMTV integration site family,							48.0	48.0	48.0					22																	46345949		2203	4300	6503	SO:0001583	missense	7477				activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity	g.chr22:46345949G>A	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.149C>T	22.37:g.46345949G>A	ENSP00000341032:p.Ala50Val		Somatic				WNT7B_uc010haa.2_Missense_Mutation_p.A54V	p.A50V	NM_058238	NP_478679	WXS	Illumina HiSeq	Unspecified	P56706	WNT7B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)	2	523	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	50					B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	c.149C>T	CCDS33667.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466756	0.84425	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496;ENST00000410058	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	3.82	3.82	0.43975	.	0.000000	0.85682	U	0.000000	T	0.67887	0.2941	L	0.45051	1.395	0.80722	D	1	P;P	0.36712	0.566;0.566	B;B	0.36766	0.232;0.17	T	0.73525	-0.3955	10	0.62326	D	0.03	.	14.8554	0.70332	0.0:0.0:1.0:0.0	.	54;50	A8K0G1;P56706	.;WNT7B_HUMAN	V	50;34;54;50	ENSP00000341032:A50V;ENSP00000386781:A34V;ENSP00000386546:A54V;ENSP00000387217:A50V	ENSP00000341032:A50V	A	-	2	0	WNT7B	44724613	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.280000	0.95786	1.961000	0.56991	0.561000	0.74099	GCC		0.622	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238		5	33	0	0	0	0.000602	0	5	33				
CTNNB1	1499	broad.mit.edu	37	3	41266100	41266101	+	Missense_Mutation	DNP	TC	TC	AA	rs121913416|rs121913400		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr3:41266100_41266101TC>AA	ENST00000349496.5	+	3	377_378	c.97_98TC>AA	c.(97-99)TCt>AAt	p.S33N	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26N|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33N|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33N|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33N	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCAT	0.49	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	Colon(6;3 56 14213 18255)	uc010hia.1	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15		Dom	yes		3	3p22-p21.3	1499	H|Mis|T	"""catenin (cadherin-associated protein), beta 1"""			"""E, M, O"""	PLAG1		colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma	CTNNB1/PLAG1(60)	537	Substitution - Missense(395)|Deletion - In frame(115)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	p.S33C(131)|p.S33F(79)|p.A5_A80del(63)|p.S33Y(52)|p.S33P(37)|p.S33A(14)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.S33L(4)|p.W25_D32del(4)|p.W25_I140del(4)|p.S33N(3)|p.S23_S33del(3)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.W25_H36del(2)|p.Y30_S33del(2)|p.V22_S33del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.S33T(1)|p.S33S(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.W25_I35del(1)|p.V22_G80>NNNNN(1)|p.A5_I35del(1)|p.E9_A80del(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.S33_G34del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.D32_H36>D(1)|p.S33_G34insGTS(1)|p.P16_K133del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.W25_A80del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.D32_S33insS(1)|p.S33_G34insS(1)|p.Y30_T40del(1)|p.S33_G34insGI(1)|p.M1_T42del(1)|p.A5_Q143>E(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.S23_I35del(1)|p.V22_S71>A(1)|p.V22_Y64del(1)|p.A20_Q72del(1)|p.A20_S111del(1)|p.D32_H36del(1)	liver(188)|central_nervous_system(90)|endometrium(50)|large_intestine(41)|stomach(35)|pituitary(28)|skin(21)|ovary(21)|pancreas(20)|lung(7)|biliary_tract(6)|soft_tissue(5)|bone(4)|breast(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|adrenal_gland(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166						c.(97-99)TCT>AAT		beta-catenin	Lithium(DB01356)																																			SO:0001583	missense	1499	Pilomatrixoma_Familial_Clustering_of	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	g.chr3:41266100_41266101TC>AA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	Exception_encountered	3.37:g.41266100_41266101delinsAA	ENSP00000344456:p.Ser33Asn		Somatic				CTNNB1_uc003ckp.2_Missense_Mutation_p.S33N|CTNNB1_uc003ckq.2_Missense_Mutation_p.S33N|CTNNB1_uc003ckr.2_Missense_Mutation_p.S33N|CTNNB1_uc011azf.1_Missense_Mutation_p.S26N|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	p.S33N	NM_001904	NP_001895	WXS	Illumina HiSeq	Unspecified	P35222	CTNB1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	4	253_254	+			33		S -> F (in PTR, MDB and hepatocellular carcinoma).|Missing (in hepatocellular carcinoma).|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes).|S -> L (in hepatocellular carcinoma).			A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	DNP	ENST00000349496.5	37	c.97_98TC>AA	CCDS2694.1																																																																																				0.490	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210		7	36	0	0	0	0.004672	0	7	36				
DRD3	1814	broad.mit.edu	37	3	113850231	113850231	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr3:113850231G>A	ENST00000460779.1	-	7	1029	c.740C>T	c.(739-741)cCg>cTg	p.P247L	DRD3_ENST00000295881.7_Missense_Mutation_p.P247L|DRD3_ENST00000467632.1_Missense_Mutation_p.P247L|DRD3_ENST00000383673.2_Missense_Mutation_p.P247L	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	247					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CAGATGTGCCGGGTCAGGAGA	0.507																																							uc003ebd.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(739-741)CCG>CTG		dopamine receptor D3 isoform a	Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)						100.0	105.0	103.0					3																	113850231		2203	4300	6503	SO:0001583	missense	1814				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding	g.chr3:113850231G>A		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.740C>T	3.37:g.113850231G>A	ENSP00000419402:p.Pro247Leu		Somatic				DRD3_uc010hqn.1_Missense_Mutation_p.P247L|DRD3_uc003ebb.1_Missense_Mutation_p.P247L|DRD3_uc003ebc.1_Missense_Mutation_p.P247L	p.P247L	NM_000796	NP_000787	WXS	Illumina HiSeq	Unspecified	P35462	DRD3_HUMAN			7	1163	-			247			Cytoplasmic.		A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	c.740C>T	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	G	5.548	0.286081	0.10513	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.59	5.64	-3.77	0.04346	GPCR, rhodopsin-like superfamily (1);	1.188910	0.05883	N	0.626871	T	0.56455	0.1986	L	0.28504	0.86	0.09310	N	0.999998	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.0;0.002	T	0.41592	-0.9500	10	0.38643	T	0.18	.	9.9084	0.41390	0.0:0.2315:0.111:0.6576	.	247;247;247;247	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	L	247	ENSP00000419402:P247L;ENSP00000420662:P247L;ENSP00000373169:P247L;ENSP00000295881:P247L	ENSP00000281274:P247L	P	-	2	0	DRD3	115332921	0.001000	0.12720	0.043000	0.18650	0.374000	0.29953	-0.488000	0.06497	-1.051000	0.03226	-0.806000	0.03193	CCG		0.507	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		4	74	0	0	0	0.000602	0	4	74				
PIK3CA	5290	broad.mit.edu	37	3	178921404	178921404	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr3:178921404C>G	ENST00000263967.3	+	5	1043	c.886C>G	c.(886-888)Caa>Gaa	p.Q296E		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	296					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTTTATTCTCAACTGCCAAT	0.403		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2		57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		0				breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(886-888)CAA>GAA		phosphoinositide-3-kinase, catalytic, alpha							94.0	90.0	92.0					3																	178921404		1872	4104	5976	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178921404C>G		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.886C>G	3.37:g.178921404C>G	ENSP00000263967:p.Gln296Glu	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.Q296E	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		5	1043	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		296					Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.886C>G	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	8.125	0.781694	0.16120	.	.	ENSG00000121879	ENST00000263967	T	0.43294	0.95	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.26629	0.0651	N	0.24115	0.695	0.80722	D	1	B	0.32040	0.353	B	0.23852	0.049	T	0.13872	-1.0493	10	0.02654	T	1	-13.575	19.2153	0.93774	0.0:1.0:0.0:0.0	.	296	P42336	PK3CA_HUMAN	E	296	ENSP00000263967:Q296E	ENSP00000263967:Q296E	Q	+	1	0	PIK3CA	180404098	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.363000	0.79516	2.624000	0.88883	0.467000	0.42956	CAA		0.403	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			5	45	0	0	0	0.001168	0	5	45				
ZBTB49	166793	broad.mit.edu	37	4	4317644	4317644	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:4317644T>G	ENST00000337872.4	+	7	1689	c.1568T>G	c.(1567-1569)gTa>gGa	p.V523G	ZBTB49_ENST00000538529.1_Missense_Mutation_p.V6G|ZBTB49_ENST00000355834.3_Intron	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						AGGAAGTTAGTAAAGCACAGA	0.478																																							uc003ghu.2		NA																	0				ovary(1)|skin(1)	2						c.(1567-1569)GTA>GGA		zinc finger protein 509							82.0	86.0	85.0					4																	4317644		2203	4300	6503	SO:0001583	missense	166793				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:4317644T>G	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.1568T>G	4.37:g.4317644T>G	ENSP00000338807:p.Val523Gly		Somatic				ZBTB49_uc003ghv.2_Missense_Mutation_p.V6G|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Intron	p.V523G	NM_145291	NP_660334	WXS	Illumina HiSeq	Unspecified	Q6ZSB9	ZBT49_HUMAN			7	1743	+			523			C2H2-type 5.		Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	c.1568T>G	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360276	0.82353	.	.	ENSG00000168826	ENST00000337872;ENST00000538529	T;T	0.19105	2.17;2.17	5.56	5.56	0.83823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.140048	0.33075	N	0.005309	T	0.31136	0.0787	L	0.45744	1.44	0.80722	D	1	B	0.31485	0.325	B	0.43575	0.424	T	0.10613	-1.0622	10	0.87932	D	0	.	15.7213	0.77713	0.0:0.0:0.0:1.0	.	523	Q6ZSB9	ZBT49_HUMAN	G	523;6	ENSP00000338807:V523G;ENSP00000445653:V6G	ENSP00000338807:V523G	V	+	2	0	ZBTB49	4368545	1.000000	0.71417	0.937000	0.37676	0.973000	0.67179	5.898000	0.69838	2.127000	0.65507	0.379000	0.24179	GTA		0.478	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291		9	67	0	0	0	0.004482	0	9	67				
AFF1	4299	broad.mit.edu	37	4	88035789	88035789	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:88035789C>T	ENST00000307808.6	+	11	2203	c.1783C>T	c.(1783-1785)Cca>Tca	p.P595S	AFF1_ENST00000395146.4_Missense_Mutation_p.P602S|AFF1_ENST00000544085.1_Missense_Mutation_p.P233S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	595					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GCAGGAGCCCCCACAAAGGCA	0.637																																							uc003hqj.3		NA																	0				breast(1)	1						c.(1783-1785)CCA>TCA		myeloid/lymphoid or mixed-lineage leukemia							18.0	23.0	22.0					4																	88035789		2172	4276	6448	SO:0001583	missense	4299					nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:88035789C>T	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1783C>T	4.37:g.88035789C>T	ENSP00000305689:p.Pro595Ser		Somatic				AFF1_uc011ccz.1_Missense_Mutation_p.P602S|AFF1_uc003hqk.3_Missense_Mutation_p.P595S|AFF1_uc011cda.1_Missense_Mutation_p.P233S	p.P595S	NM_005935	NP_005926	WXS	Illumina HiSeq	Unspecified	P51825	AFF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000233)	11	2190	+		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)	595					B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	c.1783C>T	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622054	0.28889	.	.	ENSG00000172493	ENST00000395146;ENST00000541943;ENST00000307808;ENST00000544085	T;T;T	0.62941	-0.01;-0.01;-0.01	6.04	4.26	0.50523	.	0.468130	0.23731	N	0.045132	T	0.49304	0.1549	L	0.46741	1.465	0.09310	N	1	B;B;B	0.24186	0.099;0.099;0.099	B;B;B	0.27608	0.081;0.081;0.081	T	0.35151	-0.9800	10	0.10377	T	0.69	0.0394	7.1077	0.25372	0.0:0.6767:0.1407:0.1826	.	602;595;595	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	S	602;254;595;233	ENSP00000378578:P602S;ENSP00000305689:P595S;ENSP00000440843:P233S	ENSP00000305689:P595S	P	+	1	0	AFF1	88254813	0.000000	0.05858	0.001000	0.08648	0.206000	0.24218	-0.002000	0.12924	0.824000	0.34613	0.561000	0.74099	CCA		0.637	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935		3	27	0	0	0	0.004672	0	3	27				
CCSER1	401145	broad.mit.edu	37	4	91230645	91230645	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:91230645G>A	ENST00000509176.1	+	2	1498	c.1210G>A	c.(1210-1212)Gcg>Acg	p.A404T	CCSER1_ENST00000432775.2_Missense_Mutation_p.A404T|CCSER1_ENST00000333691.8_Missense_Mutation_p.A404T	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	404																	TAAAGCAATAGCGGAACATGT	0.353																																							uc003hsv.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(1210-1212)GCG>ACG		KIAA1680 protein isoform 1							125.0	121.0	123.0					4																	91230645		1854	4091	5945	SO:0001583	missense	401145							g.chr4:91230645G>A		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1210G>A	4.37:g.91230645G>A	ENSP00000425040:p.Ala404Thr		Somatic				FAM190A_uc003hsu.3_Missense_Mutation_p.A404T|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.A404T	p.A404T	NM_001145065	NP_001138537	WXS	Illumina HiSeq	Unspecified	Q9C0I3	F190A_HUMAN			2	1550	+			404					Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	c.1210G>A	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707850	0.30322	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.45668	1.44;0.89;1.44	4.96	3.23	0.37069	.	0.637035	0.15615	N	0.253215	T	0.30262	0.0759	L	0.40543	1.245	0.09310	N	1	B;B;B	0.26809	0.037;0.16;0.16	B;B;B	0.27715	0.013;0.055;0.082	T	0.18209	-1.0344	10	0.30854	T	0.27	-7.75	5.3528	0.16045	0.0809:0.3729:0.4208:0.1254	.	404;404;404	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	T	404	ENSP00000425040:A404T;ENSP00000389283:A404T;ENSP00000329482:A404T	ENSP00000329482:A404T	A	+	1	0	FAM190A	91449668	0.015000	0.18098	0.977000	0.42913	0.926000	0.56050	0.240000	0.18042	0.748000	0.32831	0.585000	0.79938	GCG		0.353	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		21	61	0	0	0	0.00278	0	21	61				
SLC39A8	64116	broad.mit.edu	37	4	103226270	103226270	+	Splice_Site	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:103226270T>A	ENST00000394833.2	-	4	1029		c.e4-2		SLC39A8_ENST00000356736.4_Splice_Site|SLC39A8_ENST00000424970.2_Splice_Site|SLC39A8_ENST00000510255.1_Splice_Site	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8						transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		TCCAAATGCCTAAGGGAGAAA	0.353																																							uc003hwb.1		NA																	0					0						c.e4-1		solute carrier family 39 (zinc transporter),							54.0	54.0	54.0					4																	103226270		2202	4300	6502	SO:0001630	splice_region_variant	64116					integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity	g.chr4:103226270T>A		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.553-2A>T	4.37:g.103226270T>A			Somatic				SLC39A8_uc011ceo.1_Splice_Site_p.A185_splice|SLC39A8_uc003hwa.1_Splice_Site_p.A118_splice|SLC39A8_uc003hwc.2_Splice_Site_p.A185_splice	p.A185_splice	NM_022154	NP_071437	WXS	Illumina HiSeq	Unspecified	Q9C0K1	S39A8_HUMAN		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)	4	1082	-		Hepatocellular(203;0.217)						B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Splice_Site	SNP	ENST00000394833.2	37	c.553_splice	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.100766	0.56183	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0315	0.64617	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC39A8	103445293	1.000000	0.71417	0.890000	0.34922	0.671000	0.39405	7.216000	0.77974	1.917000	0.55516	0.533000	0.62120	.		0.353	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	Intron	3	20	0	0	0	0.004672	0	3	20				
FGG	2266	broad.mit.edu	37	4	155530801	155530801	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:155530801C>A	ENST00000336098.3	-	6	685	c.647G>T	c.(646-648)gGa>gTa	p.G216V	FGG_ENST00000405164.1_Missense_Mutation_p.G224V|FGG_ENST00000407946.1_Missense_Mutation_p.G224V|FGG_ENST00000404648.3_Missense_Mutation_p.G216V	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	216	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CACAGTCCATCCATTTCCAGA	0.393																																							uc003ioj.2		NA																	0					0						c.(646-648)GGA>GTA		fibrinogen, gamma chain isoform gamma-B	Sucralfate(DB00364)						105.0	104.0	104.0					4																	155530801		2203	4300	6503	SO:0001583	missense	2266				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155530801C>A		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.647G>T	4.37:g.155530801C>A	ENSP00000336829:p.Gly216Val		Somatic				FGG_uc003iog.2_Missense_Mutation_p.G216V|FGG_uc003ioh.2_Missense_Mutation_p.G224V|FGG_uc010ipx.2_Missense_Mutation_p.G44V|FGG_uc010ipy.2_5'UTR|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.G224V	p.G216V	NM_021870	NP_068656	WXS	Illumina HiSeq	Unspecified	P02679	FIBG_HUMAN			6	788	-	all_hematologic(180;0.215)	Renal(120;0.0458)	216			Fibrinogen C-terminal.		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	ENST00000336098.3	37	c.647G>T	CCDS3788.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125253	0.77436	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946;ENST00000443553;ENST00000393846	D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	5.99	5.99	0.97316	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.045731	0.85682	D	0.000000	D	0.96337	0.8805	H	0.96489	3.83	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;1.0	D	0.97067	0.9775	10	0.87932	D	0	.	15.5613	0.76249	0.0:0.8627:0.1373:0.0	.	113;224;216;224;216	D3DP16;C9JC84;P02679;C9JEU5;P02679-2	.;.;FIBG_HUMAN;.;.	V	216;224;216;224;113;113	ENSP00000384860:G216V;ENSP00000384101:G224V;ENSP00000336829:G216V;ENSP00000384552:G224V;ENSP00000407562:G113V;ENSP00000377429:G113V	ENSP00000336829:G216V	G	-	2	0	FGG	155750251	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.801000	0.69115	2.840000	0.97914	0.655000	0.94253	GGA		0.393	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870		4	55	1	0	0.00116845	0.001168	0.00125833	4	55				
FGG	2266	broad.mit.edu	37	4	155530817	155530817	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr4:155530817C>T	ENST00000336098.3	-	6	669	c.631G>A	c.(631-633)Gat>Aat	p.D211N	FGG_ENST00000405164.1_Missense_Mutation_p.D219N|FGG_ENST00000407946.1_Missense_Mutation_p.D219N|FGG_ENST00000404648.3_Missense_Mutation_p.D211N	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	211	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CCAGACCCATCGATTTCACAG	0.388																																							uc003ioj.2		NA																	0					0						c.(631-633)GAT>AAT		fibrinogen, gamma chain isoform gamma-B	Sucralfate(DB00364)						108.0	107.0	108.0					4																	155530817		2203	4300	6503	SO:0001583	missense	2266				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155530817C>T		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.631G>A	4.37:g.155530817C>T	ENSP00000336829:p.Asp211Asn		Somatic				FGG_uc003iog.2_Missense_Mutation_p.D211N|FGG_uc003ioh.2_Missense_Mutation_p.D219N|FGG_uc010ipx.2_Missense_Mutation_p.D39N|FGG_uc010ipy.2_5'UTR|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.D219N	p.D211N	NM_021870	NP_068656	WXS	Illumina HiSeq	Unspecified	P02679	FIBG_HUMAN			6	772	-	all_hematologic(180;0.215)	Renal(120;0.0458)	211			Fibrinogen C-terminal.		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	ENST00000336098.3	37	c.631G>A	CCDS3788.1	.	.	.	.	.	.	.	.	.	.	C	31	5.083054	0.94050	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946;ENST00000443553;ENST00000393846	D;D;D;D;T;T	0.97279	-4.32;-4.32;-4.32;-4.32;1.99;1.99	5.89	5.89	0.94794	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.171116	0.64402	D	0.000007	D	0.97920	0.9316	M	0.66439	2.03	0.80722	D	1	D;B;P;D;D	0.60160	0.987;0.107;0.904;0.963;0.974	P;B;P;P;P	0.61800	0.836;0.192;0.792;0.894;0.747	D	0.97306	0.9934	10	0.38643	T	0.18	.	19.868	0.96839	0.0:1.0:0.0:0.0	.	108;219;211;219;211	D3DP16;C9JC84;P02679;C9JEU5;P02679-2	.;.;FIBG_HUMAN;.;.	N	211;219;211;219;108;108	ENSP00000384860:D211N;ENSP00000384101:D219N;ENSP00000336829:D211N;ENSP00000384552:D219N;ENSP00000407562:D108N;ENSP00000377429:D108N	ENSP00000336829:D211N	D	-	1	0	FGG	155750267	1.000000	0.71417	0.270000	0.24601	0.718000	0.41266	7.601000	0.82783	2.783000	0.95769	0.655000	0.94253	GAT		0.388	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870		4	54	0	0	0	0.000602	0	4	54				
MYO10	4651	broad.mit.edu	37	5	16674979	16674979	+	Silent	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:16674979G>C	ENST00000513610.1	-	35	5401	c.4947C>G	c.(4945-4947)ctC>ctG	p.L1649L	MYO10_ENST00000505695.1_Silent_p.L988L|MYO10_ENST00000515803.1_Silent_p.L988L|MYO10_ENST00000427430.2_Silent_p.L1006L|MYO10_ENST00000274203.9_Silent_p.L1006L	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1649	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GATGGAACTTGAGATACTTGA	0.572																																							uc003jft.3		NA																	0				ovary(2)|pancreas(1)	3						c.(4945-4947)CTC>CTG		myosin X							110.0	112.0	111.0					5																	16674979		2051	4208	6259	SO:0001819	synonymous_variant	4651				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity	g.chr5:16674979G>C	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4947C>G	5.37:g.16674979G>C			Somatic				MYO10_uc011cnb.1_Silent_p.L278L|MYO10_uc011cnc.1_Silent_p.L528L|MYO10_uc011cnd.1_Silent_p.L1006L|MYO10_uc011cne.1_Silent_p.L1006L|MYO10_uc010itx.2_Silent_p.L1271L	p.L1649L	NM_012334	NP_036466	WXS	Illumina HiSeq	Unspecified	Q9HD67	MYO10_HUMAN			35	5415	-			1649			MyTH4.		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	c.4947C>G	CCDS54834.1																																																																																				0.572	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334		9	157	0	0	0	0.006214	0	9	157				
SKIV2L2	23517	broad.mit.edu	37	5	54624545	54624545	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:54624545G>C	ENST00000230640.5	+	5	675	c.421G>C	c.(421-423)Gat>Cat	p.D141H	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.D40H	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	141					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GTTCATTCTTGATGCTTTTCA	0.373																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	0				ovary(1)|skin(1)	2						c.(421-423)GAT>CAT		superkiller viralicidic activity 2-like 2							161.0	153.0	156.0					5																	54624545		2203	4300	6503	SO:0001583	missense	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54624545G>C	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.421G>C	5.37:g.54624545G>C	ENSP00000230640:p.Asp141His		Somatic				SKIV2L2_uc011cqi.1_Missense_Mutation_p.D40H	p.D141H	NM_015360	NP_056175	WXS	Illumina HiSeq	Unspecified	P42285	SK2L2_HUMAN			5	687	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	141					Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	c.421G>C	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798848	0.90538	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.44083	0.93;0.97	5.76	5.76	0.90799	DEAD-like helicase (1);	0.228381	0.42964	D	0.000636	T	0.81861	0.4912	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.983;0.999	D	0.89928	0.4064	10	0.87932	D	0	-16.0432	18.734	0.91748	0.0:0.0:1.0:0.0	.	40;141	F5H7E2;P42285	.;SK2L2_HUMAN	H	141;40	ENSP00000230640:D141H;ENSP00000442583:D40H	ENSP00000230640:D141H	D	+	1	0	SKIV2L2	54660302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.269000	0.95684	2.726000	0.93360	0.655000	0.94253	GAT		0.373	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			3	39	0	0	0	0.004672	0	3	39				
APC	324	broad.mit.edu	37	5	112170861	112170861	+	Splice_Site	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:112170861A>T	ENST00000457016.1	+	15	2337	c.1957A>T	c.(1957-1959)Agg>Tgg	p.R653W	APC_ENST00000257430.4_Splice_Site_p.R653W|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Splice_Site_p.R653W			P25054	APC_HUMAN	adenomatous polyposis coli	653	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGAGGACCACAGGTATATATA	0.333		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	uc010jby.2		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	D|Mis|N|F|S	adenomatous polyposis of the colon gene			"""E, M, O"""		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS		1	Unknown(1)	p.?(1)	skin(1)	large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515	GRCh37	CS043358|CS043359	APC	S		c.(1957-1959)AGG>TGG		adenomatous polyposis coli							54.0	48.0	50.0					5																	112170861		2202	4300	6502	SO:0001630	splice_region_variant	324	Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	g.chr5:112170861A>T	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1958+1A>T	5.37:g.112170861A>T		TSP Lung(16;0.13)	Somatic				APC_uc011cvt.1_Missense_Mutation_p.R635W|APC_uc003kpz.3_Missense_Mutation_p.R653W|APC_uc003kpy.3_Missense_Mutation_p.R653W|APC_uc010jbz.2_Missense_Mutation_p.R370W|APC_uc010jca.2_5'UTR	p.R653W	NM_001127511	NP_001120983	WXS	Illumina HiSeq	Unspecified	P25054	APC_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	15	2337	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	653			Leu-rich.|ARM 5.		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	c.1957A>T	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.996725	0.93167	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.22	5.22	0.72569	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83519	0.5272	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85878	0.1420	10	0.87932	D	0	-12.5712	15.1273	0.72493	1.0:0.0:0.0:0.0	.	655;653	Q4LE70;P25054	.;APC_HUMAN	W	653;635;653;653;653	ENSP00000413133:R653W;ENSP00000423224:R635W;ENSP00000257430:R653W;ENSP00000427089:R653W;ENSP00000423828:R653W	ENSP00000257430:R653W	R	+	1	2	APC	112198760	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	1.978000	0.57642	0.533000	0.62120	AGG		0.333	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Missense_Mutation	4	17	0	0	0	0.009096	0	4	17				
FSTL4	23105	broad.mit.edu	37	5	132648445	132648445	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:132648445C>G	ENST00000265342.7	-	6	877	c.628G>C	c.(628-630)Gat>Cat	p.D210H		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	210						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGTCTTCATCCAGGTCCTGC	0.512																																							uc003kyn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(628-630)GAT>CAT		follistatin-like 4 precursor							150.0	123.0	132.0					5																	132648445		2203	4300	6503	SO:0001583	missense	23105					extracellular region	calcium ion binding	g.chr5:132648445C>G	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.628G>C	5.37:g.132648445C>G	ENSP00000265342:p.Asp210His		Somatic					p.D210H	NM_015082	NP_055897	WXS	Illumina HiSeq	Unspecified	Q6MZW2	FSTL4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		6	846	-		all_cancers(142;0.244)	210					Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	c.628G>C	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617994	0.28801	.	.	ENSG00000053108	ENST00000265342	T	0.60299	0.2	5.7	2.75	0.32379	EF-hand-like domain (1);	0.384686	0.30742	N	0.008975	T	0.51975	0.1706	L	0.54323	1.7	0.31766	N	0.63273	P	0.35383	0.498	B	0.37833	0.259	T	0.58521	-0.7622	10	0.52906	T	0.07	-4.3604	9.8442	0.41017	0.0:0.7996:0.0:0.2004	.	210	Q6MZW2	FSTL4_HUMAN	H	210	ENSP00000265342:D210H	ENSP00000265342:D210H	D	-	1	0	FSTL4	132676344	1.000000	0.71417	0.470000	0.27216	0.510000	0.34073	2.859000	0.48364	0.290000	0.22444	0.655000	0.94253	GAT		0.512	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786		4	41	0	0	0	0.009096	0	4	41				
PKD2L2	27039	broad.mit.edu	37	5	137230154	137230154	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:137230154G>A	ENST00000508883.1	+	4	406	c.380G>A	c.(379-381)gGa>gAa	p.G127E	PKD2L2_ENST00000290431.5_Missense_Mutation_p.G127E|PKD2L2_ENST00000350250.4_Missense_Mutation_p.G93E|PKD2L2_ENST00000502810.1_Missense_Mutation_p.G127E|PKD2L2_ENST00000508638.1_Missense_Mutation_p.G127E			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	127					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATACTTCTAGGAGTTCCCAGA	0.383																																							uc003lby.2		NA																	0					0						c.(379-381)GGA>GAA		polycystic kidney disease 2-like 2							111.0	106.0	108.0					5																	137230154		1844	4084	5928	SO:0001583	missense	27039					integral to membrane	calcium ion binding|ion channel activity	g.chr5:137230154G>A	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.380G>A	5.37:g.137230154G>A	ENSP00000424725:p.Gly127Glu		Somatic				PKD2L2_uc010jep.1_Missense_Mutation_p.G67E|PKD2L2_uc003lbw.1_Missense_Mutation_p.G127E|PKD2L2_uc003lbx.2_Missense_Mutation_p.G127E	p.G127E	NM_014386	NP_055201	WXS	Illumina HiSeq	Unspecified	Q9NZM6	PK2L2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		4	436	+			127			Polycystin motif.|Extracellular (Potential).		A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	37	c.380G>A		.	.	.	.	.	.	.	.	.	.	G	32	5.188436	0.94923	.	.	ENSG00000078795	ENST00000503015;ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431;ENST00000511176	D;D;D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47;-3.47;-3.47	5.47	5.47	0.80525	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.64402	D	0.000007	D	0.97776	0.9270	M	0.89214	3.015	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98421	1.0577	10	0.87932	D	0	-12.2478	19.3304	0.94283	0.0:0.0:1.0:0.0	.	127;127;127	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	E	37;93;127;127;127;127;37	ENSP00000424885:G37E;ENSP00000344177:G93E;ENSP00000423382:G127E;ENSP00000425513:G127E;ENSP00000424725:G127E;ENSP00000290431:G127E;ENSP00000423926:G37E	ENSP00000290431:G127E	G	+	2	0	PKD2L2	137258053	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.346000	0.97056	2.553000	0.86117	0.591000	0.81541	GGA		0.383	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386		8	33	0	0	0	0.00308	0	8	33				
SLC25A2	83884	broad.mit.edu	37	5	140682903	140682903	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:140682903A>C	ENST00000239451.4	-	1	709	c.530T>G	c.(529-531)cTa>cGa	p.L177R		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	177					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	TTCTTGAAGTAGAGTACTCGA	0.448																																							uc003ljf.2		NA																	0				ovary(1)	1						c.(529-531)CTA>CGA		solute carrier family 25 member 2	L-Ornithine(DB00129)						73.0	79.0	77.0					5																	140682903		2203	4300	6503	SO:0001583	missense	83884				mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity	g.chr5:140682903A>C	AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.530T>G	5.37:g.140682903A>C	ENSP00000239451:p.Leu177Arg		Somatic					p.L177R	NM_031947	NP_114153	WXS	Illumina HiSeq	Unspecified	Q9BXI2	ORNT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	1	710	-		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	177			Helical; Name=4; (Potential).|Solcar 2.		Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	ENST00000239451.4	37	c.530T>G	CCDS4258.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.018697	0.54576	.	.	ENSG00000120329	ENST00000239451	D	0.82255	-1.59	3.78	3.78	0.43462	Mitochondrial carrier domain (2);	0.130491	0.48286	D	0.000187	D	0.92189	0.7523	H	0.95114	3.625	0.49389	D	0.999786	D	0.57257	0.979	D	0.63283	0.913	D	0.93585	0.6916	10	0.87932	D	0	-14.4629	11.1333	0.48360	1.0:0.0:0.0:0.0	.	177	Q9BXI2	ORNT2_HUMAN	R	177	ENSP00000239451:L177R	ENSP00000239451:L177R	L	-	2	0	SLC25A2	140663087	1.000000	0.71417	0.548000	0.28192	0.497000	0.33675	7.639000	0.83342	1.963000	0.57068	0.528000	0.53228	CTA		0.448	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947		5	110	0	0	0	0.000602	0	5	110				
PPARGC1B	133522	broad.mit.edu	37	5	149215969	149215969	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:149215969G>T	ENST00000309241.5	+	8	1983	c.1951G>T	c.(1951-1953)Gcc>Tcc	p.A651S	PPARGC1B_ENST00000360453.4_Missense_Mutation_p.A612S|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.A651S|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.A587S	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	651					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCCAGGGGCTGCCCACAAGCT	0.612																																							uc003lrc.2		NA																	0					0						c.(1951-1953)GCC>TCC		peroxisome proliferator-activated receptor							67.0	70.0	69.0					5																	149215969		2203	4300	6503	SO:0001583	missense	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149215969G>T	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.1951G>T	5.37:g.149215969G>T	ENSP00000312649:p.Ala651Ser		Somatic				PPARGC1B_uc003lrb.1_Missense_Mutation_p.A651S|PPARGC1B_uc003lrd.2_Missense_Mutation_p.A612S|PPARGC1B_uc003lrf.2_Missense_Mutation_p.A630S|PPARGC1B_uc003lre.1_Missense_Mutation_p.A630S	p.A651S	NM_133263	NP_573570	WXS	Illumina HiSeq	Unspecified	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		8	1993	+			651					A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	c.1951G>T	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.030|0.030	-1.342329|-1.342329	0.01277|0.01277	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750|ENST00000434684	T;T;T;T|.	0.06933|.	3.24;3.24;3.24;3.24|.	4.47|4.47	1.29|1.29	0.21616|0.21616	.|.	0.918805|.	0.09437|.	N|.	0.802274|.	T|T	0.16981|0.16981	0.0408|0.0408	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.15141|.	0.012;0.01;0.012;0.004;0.012|.	B;B;B;B;B|.	0.14578|.	0.01;0.011;0.01;0.004;0.01|.	T|T	0.20405|0.20405	-1.0276|-1.0276	10|5	0.09338|.	T|.	0.73|.	-5.6792|-5.6792	1.6095|1.6095	0.02690|0.02690	0.1757:0.1182:0.3768:0.3293|0.1757:0.1182:0.3768:0.3293	.|.	630;630;612;651;651|.	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3|.	.;.;.;PRGC2_HUMAN;.|.	S|F	612;651;651;587|337	ENSP00000353638:A612S;ENSP00000377855:A651S;ENSP00000312649:A651S;ENSP00000384403:A587S|.	ENSP00000312649:A651S|.	A|C	+|+	1|2	0|0	PPARGC1B|PPARGC1B	149196162|149196162	0.001000|0.001000	0.12720|0.12720	0.962000|0.962000	0.40283|0.40283	0.505000|0.505000	0.33919|0.33919	0.213000|0.213000	0.17521|0.17521	0.391000|0.391000	0.25143|0.25143	0.456000|0.456000	0.33151|0.33151	GCC|TGC		0.612	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		9	112	1	0	2.17888e-05	0.006214	2.40823e-05	9	112				
CCDC69	26112	broad.mit.edu	37	5	150565642	150565642	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr5:150565642G>T	ENST00000355417.2	-	6	611	c.437C>A	c.(436-438)gCc>gAc	p.A146D	CCDC69_ENST00000521308.1_5'UTR	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	146										haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTCATTTTGGCCTGGAAAGC	0.522																																							uc003ltq.2		NA																	0				ovary(2)	2						c.(436-438)GCC>GAC		coiled-coil domain containing 69							141.0	148.0	145.0					5																	150565642		2203	4300	6503	SO:0001583	missense	26112							g.chr5:150565642G>T		CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.437C>A	5.37:g.150565642G>T	ENSP00000347586:p.Ala146Asp		Somatic				CCDC69_uc010jhu.2_5'UTR|CCDC69_uc011dcq.1_RNA	p.A146D	NM_015621	NP_056436	WXS	Illumina HiSeq	Unspecified	A6NI79	CCD69_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	560	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	146			Potential.		A8K9X6	Missense_Mutation	SNP	ENST00000355417.2	37	c.437C>A	CCDS4312.1	.	.	.	.	.	.	.	.	.	.	G	7.485	0.649494	0.14516	.	.	ENSG00000198624	ENST00000355417	T	0.09630	2.96	5.61	4.72	0.59763	.	0.271402	0.31092	N	0.008275	T	0.05227	0.0139	N	0.08118	0	0.32034	N	0.59911	B	0.24721	0.11	B	0.20184	0.028	T	0.21861	-1.0233	10	0.19590	T	0.45	-17.2132	9.5052	0.39042	0.0:0.135:0.6615:0.2034	.	146	A6NI79	CCD69_HUMAN	D	146	ENSP00000347586:A146D	ENSP00000347586:A146D	A	-	2	0	CCDC69	150545835	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.117000	0.41939	1.459000	0.47892	0.655000	0.94253	GCC		0.522	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252435.1	NM_015621		11	176	1	0	4.68919e-08	0.008291	5.43299e-08	11	176				
GPX5	2880	broad.mit.edu	37	6	28500162	28500162	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:28500162G>T	ENST00000412168.2	+	4	513	c.424G>T	c.(424-426)Ggt>Tgt	p.G142C	GPX5_ENST00000469384.1_3'UTR|GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	142					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	GGATGTGAATGGTGAAAAAGA	0.443																																							uc003nll.2		NA																	0				skin(1)	1						c.(424-426)GGT>TGT		glutathione peroxidase 5 isoform 1 precursor	Glutathione(DB00143)						156.0	147.0	150.0					6																	28500162		2203	4300	6503	SO:0001583	missense	2880				lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28500162G>T	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.424G>T	6.37:g.28500162G>T	ENSP00000392398:p.Gly142Cys		Somatic				GPX5_uc003nlm.2_3'UTR|GPX5_uc003nln.2_RNA	p.G142C	NM_001509	NP_001500	WXS	Illumina HiSeq	Unspecified	O75715	GPX5_HUMAN			4	426	+			142					A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	c.424G>T	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630508	0.67015	.	.	ENSG00000224586	ENST00000412168	T	0.33865	1.39	4.16	3.26	0.37387	Thioredoxin-like fold (2);	0.104469	0.64402	D	0.000003	T	0.69797	0.3151	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81872	-0.0733	10	0.87932	D	0	-14.2454	11.9781	0.53105	0.0:0.177:0.823:0.0	.	142	O75715	GPX5_HUMAN	C	142	ENSP00000392398:G142C	ENSP00000392398:G142C	G	+	1	0	GPX5	28608141	1.000000	0.71417	0.987000	0.45799	0.857000	0.48899	8.310000	0.89971	1.280000	0.44463	0.655000	0.94253	GGT		0.443	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2			5	44	1	0	0.00116845	0.001168	0.00125833	5	44				
OR2J2	26707	broad.mit.edu	37	6	29141320	29141320	+	5'UTR	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:29141320T>A	ENST00000377167.2	+	0	10					NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						TGGGATACTTTTGTCTTCAAT	0.358																																							uc011dlm.1		NA																	0					0						c.(-94--90)TTTTG>TTATG		olfactory receptor, family 2, subfamily J,																																				SO:0001623	5_prime_UTR_variant	26707				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29141320T>A		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.-93T>A	6.37:g.29141320T>A			Somatic						NM_030905	NP_112167	WXS	Illumina HiSeq	Unspecified	O76002	OR2J2_HUMAN			1	10	+								A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Translation_Start_Site	SNP	ENST00000377167.2	37	c.-92T>A	CCDS43434.1																																																																																				0.358	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			3	9	0	0	0	0.004672	0	3	9				
MDC1	9656	broad.mit.edu	37	6	30675945	30675945	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:30675945C>A	ENST00000376406.3	-	8	3058	c.2411G>T	c.(2410-2412)gGc>gTc	p.G804V	MDC1_ENST00000376405.2_Intron|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	804				Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CCTCCCTCTGCCTTGAATCCC	0.532								Other conserved DNA damage response genes																															uc003nrg.3		NA																	0				breast(2)|ovary(1)|kidney(1)	4						c.(2410-2412)GGC>GTC	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							212.0	211.0	211.0					6																	30675945		1509	2708	4217	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30675945C>A	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.2411G>T	6.37:g.30675945C>A	ENSP00000365588:p.Gly804Val		Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	p.G804V	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			8	2851	-			804	Missing (in Ref. 2; CAH18685).				A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.2411G>T	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	c	15.74	2.922566	0.52653	.	.	ENSG00000137337	ENST00000376406;ENST00000429610	T	0.04603	3.59	4.96	1.01	0.19927	.	1.054810	0.07573	N	0.918955	T	0.05593	0.0147	L	0.60455	1.87	0.19300	N	0.999972	D	0.89917	1.0	D	0.91635	0.999	T	0.31194	-0.9952	10	0.30078	T	0.28	-0.0022	3.9747	0.09468	0.275:0.4799:0.0:0.2451	.	804	Q14676	MDC1_HUMAN	V	804	ENSP00000365588:G804V	ENSP00000365588:G804V	G	-	2	0	MDC1	30783924	0.000000	0.05858	0.014000	0.15608	0.971000	0.66376	0.061000	0.14366	0.121000	0.18284	0.457000	0.33378	GGC		0.532	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		38	111	1	0	1.30998e-17	0.005524	1.56083e-17	38	111				
NOTCH4	4855	broad.mit.edu	37	6	32168902	32168902	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:32168902G>A	ENST00000375023.3	-	22	4269	c.4131C>T	c.(4129-4131)ctC>ctT	p.L1377L		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1377					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ACCCAGCACTGAGGGAGTCGG	0.592																																							uc003obb.2		NA																	0				lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(4129-4131)CTC>CTT		notch4 preproprotein							75.0	86.0	82.0					6																	32168902		1510	2708	4218	SO:0001819	synonymous_variant	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32168902G>A		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.4131C>T	6.37:g.32168902G>A			Somatic				NOTCH4_uc003oba.2_Silent_p.L40L|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.L1377L	NM_004557	NP_004548	WXS	Illumina HiSeq	Unspecified	Q99466	NOTC4_HUMAN			22	4270	-			1377			Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	c.4131C>T	CCDS34420.1																																																																																				0.592	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			6	66	0	0	0	0.001168	0	6	66				
RGL2	5863	broad.mit.edu	37	6	33263525	33263525	+	Silent	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:33263525G>C	ENST00000497454.1	-	7	1275	c.780C>G	c.(778-780)ctC>ctG	p.L260L	PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000437840.2_5'UTR|RGL2_ENST00000444031.2_Silent_p.L178L	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	260	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						GGATCAAATTGAGAAAAAGTT	0.532																																							uc003odv.2		NA																	0				skin(3)|lung(1)|breast(1)|pancreas(1)	6						c.(778-780)CTC>CTG		ral guanine nucleotide dissociation							52.0	57.0	55.0					6																	33263525		2203	4300	6503	SO:0001819	synonymous_variant	5863				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity	g.chr6:33263525G>C		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.780C>G	6.37:g.33263525G>C			Somatic				RGL2_uc003odu.2_5'UTR|RGL2_uc010jur.2_5'UTR|RGL2_uc003odw.2_Silent_p.L178L|RGL2_uc011drb.1_Silent_p.L178L	p.L260L	NM_004761	NP_004752	WXS	Illumina HiSeq	Unspecified	O15211	RGL2_HUMAN			7	913	-			260			Ras-GEF.		B4DG72|Q5STK0|Q9Y3F3	Silent	SNP	ENST00000497454.1	37	c.780C>G	CCDS4774.1																																																																																				0.532	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2			3	48	0	0	0	0.004672	0	3	48				
TAPBP	6892	broad.mit.edu	37	6	33272909	33272909	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:33272909T>C	ENST00000489157.1	-	3	676	c.464A>G	c.(463-465)gAt>gGt	p.D155G	TAPBP_ENST00000434618.2_Missense_Mutation_p.D242G|TAPBP_ENST00000475304.1_Missense_Mutation_p.D260G|TAPBP_ENST00000426633.2_Missense_Mutation_p.D242G|TAPBP_ENST00000456592.2_Missense_Mutation_p.D242G			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	242					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)			endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						CTCATCATCATCCCAAGCAGC	0.592																																							uc003odx.1		NA																	0				ovary(1)	1						c.(724-726)GAT>GGT		tapasin isoform 1 precursor							74.0	76.0	75.0					6																	33272909		2203	4300	6503	SO:0001583	missense	6892				antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding	g.chr6:33272909T>C	Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.464A>G	6.37:g.33272909T>C	ENSP00000419659:p.Asp155Gly		Somatic				TAPBP_uc010jus.1_Missense_Mutation_p.D260G|TAPBP_uc003ody.2_Missense_Mutation_p.D242G|TAPBP_uc003odz.2_Missense_Mutation_p.D242G|TAPBP_uc010jut.1_Missense_Mutation_p.D155G|TAPBP_uc011drc.1_Missense_Mutation_p.D242G	p.D242G	NM_003190	NP_003181	WXS	Illumina HiSeq	Unspecified	O15533	TPSN_HUMAN			4	896	-			242			Lumenal (Potential).		A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Missense_Mutation	SNP	ENST00000489157.1	37	c.725A>G	CCDS34427.2	.	.	.	.	.	.	.	.	.	.	T	19.32	3.804203	0.70682	.	.	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540;ENST00000437741;ENST00000467025	T;T;T;T;T	0.35236	1.35;1.35;1.39;1.32;1.35	4.96	4.96	0.65561	.	0.437153	0.22620	N	0.057711	T	0.46464	0.1394	M	0.69823	2.125	0.35839	D	0.825871	D;D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.991;0.997;0.999;0.999;0.997	T	0.49716	-0.8910	10	0.40728	T	0.16	-12.1804	10.9588	0.47372	0.0:0.0:0.0:1.0	.	242;155;260;242;242;242	G5E9H8;E9PGM2;A2AB90;O15533-3;G3V0I4;O15533	.;.;.;.;.;TPSN_HUMAN	G	242;260;155;242;242;242;242;185	ENSP00000395701:D242G;ENSP00000417949:D260G;ENSP00000419659:D155G;ENSP00000404833:D242G;ENSP00000387803:D242G	ENSP00000404833:D242G	D	-	2	0	TAPBP	33380887	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	3.760000	0.55235	2.082000	0.62665	0.448000	0.29417	GAT		0.592	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276425.2			32	43	0	0	0	0.012213	0	32	43				
ZBTB9	221504	broad.mit.edu	37	6	33423463	33423463	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:33423463G>C	ENST00000395064.2	+	2	854	c.586G>C	c.(586-588)Gtg>Ctg	p.V196L		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TGAGAGCCCTGTGGGAGGGGA	0.547																																							uc003oeq.2		NA																	0					0						c.(586-588)GTG>CTG		zinc finger and BTB domain containing 9							72.0	78.0	76.0					6																	33423463		2203	4300	6503	SO:0001583	missense	221504				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:33423463G>C	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.586G>C	6.37:g.33423463G>C	ENSP00000378503:p.Val196Leu		Somatic					p.V196L	NM_152735	NP_689948	WXS	Illumina HiSeq	Unspecified	Q96C00	ZBTB9_HUMAN			2	854	+			196					A2AB19	Missense_Mutation	SNP	ENST00000395064.2	37	c.586G>C	CCDS4780.1	.	.	.	.	.	.	.	.	.	.	G	6.084	0.383852	0.11524	.	.	ENSG00000213588	ENST00000395064	T	0.06528	3.29	3.6	-0.376	0.12505	.	10.323900	0.00357	U	0.000035	T	0.01353	0.0044	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.44421	-0.9329	10	0.10902	T	0.67	.	8.0751	0.30712	0.3417:0.0:0.6583:0.0	.	196	Q96C00	ZBTB9_HUMAN	L	196	ENSP00000378503:V196L	ENSP00000378503:V196L	V	+	1	0	ZBTB9	33531441	0.000000	0.05858	0.106000	0.21319	0.992000	0.81027	0.137000	0.15995	-0.378000	0.07918	0.563000	0.77884	GTG		0.547	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735		8	81	0	0	0	0.00308	0	8	81				
CUL9	23113	broad.mit.edu	37	6	43171224	43171224	+	Missense_Mutation	SNP	C	C	T	rs374291463		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:43171224C>T	ENST00000252050.4	+	19	4003	c.3919C>T	c.(3919-3921)Cgg>Tgg	p.R1307W	CUL9_ENST00000354495.3_Missense_Mutation_p.R1197W|CUL9_ENST00000372647.2_Missense_Mutation_p.R1307W	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1307	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GCCACTGTTCCGGGAGCAGCT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		19216	0.001		0.0	False		,,,				2504	0.0						uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(3919-3921)CGG>TGG		p53-associated parkin-like cytoplasmic protein		C	TRP/ARG	0,4406		0,0,2203	71.0	72.0	72.0		3919	5.2	1.0	6		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	CUL9	NM_015089.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1307/2518	43171224	1,13005	2203	4300	6503	SO:0001583	missense	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43171224C>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.3919C>T	6.37:g.43171224C>T	ENSP00000252050:p.Arg1307Trp		Somatic				CUL9_uc003oul.2_Missense_Mutation_p.R1307W|CUL9_uc010jyk.2_Missense_Mutation_p.R459W	p.R1307W	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			19	3994	+			1307			DOC.		O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	c.3919C>T	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322968	0.81580	0.0	1.16E-4	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74842	-0.88;-0.88;-0.77	5.19	5.19	0.71726	Anaphase-promoting complex, subunit 10/DOC domain (1);	0.055441	0.64402	D	0.000002	T	0.72590	0.3479	L	0.49350	1.555	0.42214	D	0.991829	P;P;P	0.48407	0.89;0.91;0.91	B;P;P	0.54965	0.428;0.658;0.765	T	0.75682	-0.3233	10	0.59425	D	0.04	-27.8329	12.2983	0.54860	0.2841:0.7159:0.0:0.0	.	1197;1307;1307	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	W	1307;1197;1307	ENSP00000252050:R1307W;ENSP00000346490:R1197W;ENSP00000361730:R1307W	ENSP00000252050:R1307W	R	+	1	2	CUL9	43279202	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.447000	0.60020	2.577000	0.86979	0.561000	0.74099	CGG		0.612	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		35	61	0	0	0	0.004289	0	35	61				
ULBP2	80328	broad.mit.edu	37	6	150267642	150267642	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr6:150267642C>T	ENST00000367351.3	+	3	557	c.484C>T	c.(484-486)Cat>Tat	p.H162Y		NM_025217.2	NP_079493.1	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2	162	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular space (GO:0005615)	natural killer cell lectin-like receptor binding (GO:0046703)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		GACAACGGTTCATCCTGGAGC	0.473																																							uc003qno.2		NA																	0					0						c.(484-486)CAT>TAT		UL16 binding protein 2 precursor							232.0	214.0	220.0					6																	150267642		2203	4300	6503	SO:0001583	missense	80328				antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|cell surface|extracellular space|MHC class I protein complex	MHC class I receptor activity	g.chr6:150267642C>T	AF304378	CCDS5222.1	6q25	2008-04-11			ENSG00000131015	ENSG00000131015			14894	protein-coding gene	gene with protein product		605698				11239445	Standard	NM_025217		Approved	RAET1H	uc003qno.3	Q9BZM5	OTTHUMG00000015803	ENST00000367351.3:c.484C>T	6.37:g.150267642C>T	ENSP00000356320:p.His162Tyr		Somatic				ULBP2_uc011eeh.1_Missense_Mutation_p.H162Y|ULBP2_uc010kij.2_Missense_Mutation_p.H162Y	p.H162Y	NM_025217	NP_079493	WXS	Illumina HiSeq	Unspecified	Q9BZM5	N2DL2_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)	3	557	+		Ovarian(120;0.0907)	162			MHC class I alpha-2 like.		Q5VUN4	Missense_Mutation	SNP	ENST00000367351.3	37	c.484C>T	CCDS5222.1	.	.	.	.	.	.	.	.	.	.	-	13.59	2.283195	0.40394	.	.	ENSG00000131015	ENST00000367351	T	0.07021	3.23	2.26	-1.86	0.07760	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.06325	0.0163	M	0.79258	2.445	0.09310	N	1	P;P	0.47106	0.801;0.89	P;P	0.52424	0.553;0.698	T	0.13656	-1.0501	9	0.72032	D	0.01	.	0.9043	0.01281	0.2574:0.3804:0.2058:0.1564	.	162;162	B4DSS7;Q9BZM5	.;N2DL2_HUMAN	Y	162	ENSP00000356320:H162Y	ENSP00000356320:H162Y	H	+	1	0	ULBP2	150309335	0.000000	0.05858	0.000000	0.03702	0.346000	0.29079	-0.425000	0.07017	-0.665000	0.05317	0.184000	0.17185	CAT		0.473	ULBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042669.1			18	92	0	0	0	0.006122	0	18	92				
SDK1	221935	broad.mit.edu	37	7	4167093	4167093	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:4167093G>A	ENST00000404826.2	+	26	4043	c.3904G>A	c.(3904-3906)Gaa>Aaa	p.E1302K	SDK1_ENST00000389531.3_Missense_Mutation_p.E1302K	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1302	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ATCCGTGCCGGAACAGGACCA	0.537																																							uc003smx.2		NA																	0				large_intestine(3)|ovary(2)|skin(1)	6						c.(3904-3906)GAA>AAA		sidekick 1 precursor							136.0	123.0	127.0					7																	4167093		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4167093G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3904G>A	7.37:g.4167093G>A	ENSP00000385899:p.Glu1302Lys		Somatic				SDK1_uc010kso.2_Missense_Mutation_p.E578K|SDK1_uc003smy.2_5'Flank	p.E1302K	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	26	4043	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1302			Fibronectin type-III 7.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.3904G>A	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300136	0.40694	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.61392	0.11;0.13	5.88	5.0	0.66597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.57227	0.2039	N	0.24115	0.695	0.51482	D	0.999921	D;P	0.54397	0.966;0.941	P;P	0.59115	0.852;0.577	T	0.54043	-0.8352	10	0.25751	T	0.34	.	13.0846	0.59133	0.0737:0.0:0.9263:0.0	.	1302;1302	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	K	1302	ENSP00000385899:E1302K;ENSP00000374182:E1302K	ENSP00000374182:E1302K	E	+	1	0	SDK1	4133619	1.000000	0.71417	0.471000	0.27229	0.272000	0.26649	5.620000	0.67736	1.489000	0.48450	0.650000	0.86243	GAA		0.537	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		11	80	0	0	0	0.010729	0	11	80				
HOXA11	3207	broad.mit.edu	37	7	27224464	27224464	+	Silent	SNP	G	G	A	rs200352994	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:27224464G>A	ENST00000006015.3	-	1	371	c.300C>T	c.(298-300)gcC>gcT	p.A100A	HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000522863.1_RNA|RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000520360.1_RNA|HOXA11-AS_ENST00000479766.1_RNA|HOXA11-AS_ENST00000520395.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	100					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						CAGGCACGCCGGCCGCGCTGG	0.672			T	NUP98	CML								G|||	11	0.00219649	0.0	0.0	5008	,	,		11363	0.0		0.0	False		,,,				2504	0.0112						uc003syx.2		NA		Dom	yes		7	7p15-p14.2	3207	T	homeo box A11			L	NUP98		CML		0				lung(1)|breast(1)	2						c.(298-300)GCC>GCT		homeobox A11							32.0	38.0	36.0					7																	27224464		2202	4298	6500	SO:0001819	synonymous_variant	3207				branching involved in ureteric bud morphogenesis|cartilage development involved in endochondral bone morphogenesis|developmental growth|dorsal/ventral pattern formation|mesodermal cell fate specification|positive regulation of cell development|positive regulation of chondrocyte differentiation	protein-DNA complex|transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27224464G>A		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.300C>T	7.37:g.27224464G>A			Somatic				HOXA11_uc003syy.2_RNA|HOXA11AS_uc003syz.1_5'Flank	p.A100A	NM_005523	NP_005514	WXS	Illumina HiSeq	Unspecified	P31270	HXA11_HUMAN			1	372	-			100					A4D190	Silent	SNP	ENST00000006015.3	37	c.300C>T	CCDS5411.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067148	0.36470	.	.	ENSG00000005073	ENST00000517402	.	.	.	5.29	4.36	0.52297	.	.	.	.	.	T	0.57373	0.2049	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54563	-0.8275	4	.	.	.	.	7.6022	0.28083	0.189:0.1562:0.6548:0.0	.	.	.	.	L	70	.	.	P	-	2	0	HOXA11	27190989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.458000	0.35223	2.463000	0.83235	0.650000	0.86243	CCG		0.672	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1			8	57	0	0	0	0.00308	0	8	57				
AEBP1	165	broad.mit.edu	37	7	44152266	44152266	+	Missense_Mutation	SNP	C	C	T	rs144799697	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:44152266C>T	ENST00000223357.3	+	18	2632	c.2327C>T	c.(2326-2328)gCc>gTc	p.A776V	AEBP1_ENST00000450684.2_Missense_Mutation_p.A351V|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	776	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A776V(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						TACGATATGGCCCGCACGCCT	0.652													C|||	2	0.000399361	0.0	0.0	5008	,	,		14297	0.0		0.0	False		,,,				2504	0.002						uc003tkb.2		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(2326-2328)GCC>GTC		adipocyte enhancer binding protein 1 precursor		C	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	34.0	39.0	37.0		2327	5.1	1.0	7	dbSNP_134	37	21,8577	14.6+/-50.1	1,19,4279	yes	missense	AEBP1	NM_001129.3	64	1,21,6480	TT,TC,CC		0.2442,0.0454,0.1769	benign	776/1159	44152266	23,12981	2203	4299	6502	SO:0001583	missense	165				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:44152266C>T	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2327C>T	7.37:g.44152266C>T	ENSP00000223357:p.Ala776Val		Somatic				AEBP1_uc003tkc.3_Missense_Mutation_p.A351V|AEBP1_uc003tkd.2_Missense_Mutation_p.A26V	p.A776V	NM_001129	NP_001120	WXS	Illumina HiSeq	Unspecified	Q8IUX7	AEBP1_HUMAN			18	2632	+			776			Interaction with PTEN (By similarity).		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	c.2327C>T	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339926	0.41398	4.54E-4	0.002442	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.03413	3.94;3.94	5.08	5.08	0.68730	Peptidase M14, carboxypeptidase A (2);	0.283952	0.36665	N	0.002469	T	0.03136	0.0092	N	0.21282	0.65	0.29596	N	0.848067	P;B	0.35774	0.519;0.127	B;B	0.37989	0.112;0.262	T	0.35201	-0.9798	10	0.26408	T	0.33	-34.3984	7.9417	0.29963	0.1608:0.757:0.0:0.0821	.	351;776	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	V	776;351	ENSP00000223357:A776V;ENSP00000398878:A351V	ENSP00000223357:A776V	A	+	2	0	AEBP1	44118791	0.895000	0.30542	1.000000	0.80357	0.094000	0.18550	1.631000	0.37092	2.533000	0.85409	0.491000	0.48974	GCC		0.652	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129		4	38	0	0	0	0.009096	0	4	38				
PILRA	29992	broad.mit.edu	37	7	99987664	99987664	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:99987664C>T	ENST00000198536.2	+	3	820	c.608C>T	c.(607-609)gCt>gTt	p.A203V	PILRA_ENST00000394000.2_Intron|PILRA_ENST00000350573.2_Intron|PILRA_ENST00000453419.1_Intron	NM_013439.2	NP_038467.2	Q9UKJ1	PILRA_HUMAN	paired immunoglobin-like type 2 receptor alpha	203					signal transduction (GO:0007165)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	15	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGGCAGTGGCTGTCACTGTG	0.582																																							uc003uuo.1		NA																	0				skin(1)	1						c.(607-609)GCT>GTT		paired immunoglobulin-like type 2 receptor alpha							142.0	114.0	123.0					7																	99987664		2203	4300	6503	SO:0001583	missense	29992				interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity	g.chr7:99987664C>T	AF161080	CCDS5691.1, CCDS5692.1, CCDS47660.1	7q22.1	2013-01-11			ENSG00000085514	ENSG00000085514		"""Immunoglobulin superfamily / V-set domain containing"""	20396	protein-coding gene	gene with protein product		605341				10660620	Standard	NM_178272		Approved	FDF03	uc003uuo.1	Q9UKJ1	OTTHUMG00000155248	ENST00000198536.2:c.608C>T	7.37:g.99987664C>T	ENSP00000198536:p.Ala203Val		Somatic				PILRA_uc011kjo.1_Intron|PILRA_uc003uup.1_Intron|PILRA_uc003uuq.1_Intron	p.A203V	NM_013439	NP_038467	WXS	Illumina HiSeq	Unspecified	Q9UKJ1	PILRA_HUMAN			3	820	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		203			Helical; (Potential).		Q8NHI1	Missense_Mutation	SNP	ENST00000198536.2	37	c.608C>T	CCDS5691.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027774	0.54790	.	.	ENSG00000085514	ENST00000198536	T	0.20598	2.06	3.72	2.84	0.33178	.	0.509100	0.16626	N	0.206252	T	0.21103	0.0508	L	0.60455	1.87	0.41414	D	0.987751	D	0.56968	0.978	B	0.43950	0.437	T	0.03739	-1.1008	9	.	.	.	.	7.1319	0.25507	0.0:0.8774:0.0:0.1226	.	203	Q9UKJ1	PILRA_HUMAN	V	203	ENSP00000198536:A203V	.	A	+	2	0	PILRA	99825600	0.846000	0.29590	0.418000	0.26571	0.021000	0.10359	1.331000	0.33793	1.146000	0.42352	0.650000	0.86243	GCT		0.582	PILRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339016.1	NM_013439		5	68	0	0	0	0.001168	0	5	68				
RELN	5649	broad.mit.edu	37	7	103155858	103155858	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:103155858A>G	ENST00000428762.1	-	50	8052	c.7893T>C	c.(7891-7893)gcT>gcC	p.A2631A	RELN_ENST00000343529.5_Silent_p.A2631A|RELN_ENST00000424685.2_Silent_p.A2631A|CTB-107G13.1_ENST00000422488.1_RNA	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2631					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAATCTCTTTAGCATCAGGAG	0.483																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(7891-7893)GCT>GCC		reelin isoform a							49.0	50.0	50.0					7																	103155858		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103155858A>G		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7893T>C	7.37:g.103155858A>G			Somatic				RELN_uc010liz.2_Silent_p.A2631A	p.A2631A	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	50	8053	-			2631					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.7893T>C	CCDS47680.1																																																																																				0.483	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		3	41	0	0	0	0.000602	0	3	41				
NDUFB2	4708	broad.mit.edu	37	7	140396598	140396598	+	Silent	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:140396598C>T	ENST00000476279.1	+	1	128	c.54C>T	c.(52-54)ttC>ttT	p.F18F	NDUFB2_ENST00000465506.1_Silent_p.F18F|NDUFB2-AS1_ENST00000465466.1_RNA|NDUFB2_ENST00000460088.1_5'Flank|NDUFB2_ENST00000247866.4_Silent_p.F18F|NDUFB2_ENST00000476470.1_5'Flank|NDUFB2_ENST00000482954.1_Intron|NDUFB2_ENST00000472695.1_5'Flank|NDUFB2_ENST00000204307.5_5'UTR|NDUFB2_ENST00000464564.2_3'UTR|NDUFB2_ENST00000461457.1_Silent_p.F18F|NDUFB2_ENST00000471136.1_5'Flank			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa	18					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					GCCGCCTTTTCAGAAGCGGCT	0.706																																							uc003vwa.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(52-54)TTC>TTT		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						24.0	23.0	23.0					7																	140396598		2203	4299	6502	SO:0001819	synonymous_variant	4708				mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr7:140396598C>T	AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424	ENST00000476279.1:c.54C>T	7.37:g.140396598C>T			Somatic				LOC100134713_uc011krf.1_RNA|NDUFB2_uc010lnl.2_RNA	p.F18F	NM_004546	NP_004537	WXS	Illumina HiSeq	Unspecified	O95178	NDUB2_HUMAN			1	118	+	Melanoma(164;0.00956)		18					Q6FGI6	Silent	SNP	ENST00000476279.1	37	c.54C>T	CCDS5862.1																																																																																				0.706	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348784.1	NM_004546		4	16	0	0	0	0.000602	0	4	16				
BRAF	673	broad.mit.edu	37	7	140481411	140481411	+	Missense_Mutation	SNP	C	C	G	rs121913351		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr7:140481411C>G	ENST00000288602.6	-	11	1457	c.1397G>C	c.(1396-1398)gGa>gCa	p.G466A		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	466	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		G -> A (in melanoma). {ECO:0000269|PubMed:12068308}.|G -> E (in melanoma). {ECO:0000269|PubMed:12068308}.|G -> V (in LNCR). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12460919}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G466V(15)|p.G466E(5)|p.G466A(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCCAAATGATCCAGATCCAAT	0.378	G466V(CAL12T_LUNG)|G466V(NCIH1666_LUNG)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3	G466V(NCIH1666_LUNG)|G466V(CAL12T_LUNG)	61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	21	Substitution - Missense(21)	p.G466V(12)|p.G466E(5)|p.G466A(3)|p.G466R(2)	lung(10)|skin(7)|ovary(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1396-1398)GGA>GCA		B-Raf	Sorafenib(DB00398)						173.0	148.0	156.0					7																	140481411		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140481411C>G	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1397G>C	7.37:g.140481411C>G	ENSP00000288602:p.Gly466Ala		Somatic					p.G466A	NM_004333	NP_004324	WXS	Illumina HiSeq	Unspecified	P15056	BRAF_HUMAN			11	1458	-	Melanoma(164;0.00956)		466		G -> V (in LNCR).|G -> A (in melanoma).|G -> E (in melanoma).	ATP (By similarity).|Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1397G>C	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.5|28.5	4.921764|4.921764	0.92319|0.92319	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|D	.|0.99930	.|-8.15	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.100477	.|0.64402	.|D	.|0.000002	D|D	0.99937|0.99937	0.9972|0.9972	H|H	0.97023|0.97023	3.925|3.925	0.80722|0.80722	D|D	1|1	.|D	.|0.59767	.|0.986	.|P	.|0.60012	.|0.867	D|D	0.96235|0.96235	0.9171|0.9171	5|10	.|0.87932	.|D	.|0	.|.	17.8428|17.8428	0.88720|0.88720	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|466	.|P15056	.|BRAF_HUMAN	H|A	74|466	.|ENSP00000288602:G466A	.|ENSP00000288602:G466A	D|G	-|-	1|2	0|0	BRAF|BRAF	140127880|140127880	1.000000|1.000000	0.71417|0.71417	0.926000|0.926000	0.36857|0.36857	0.983000|0.983000	0.72400|0.72400	7.818000|7.818000	0.86416|0.86416	2.637000|2.637000	0.89404|0.89404	0.585000|0.585000	0.79938|0.79938	GAT|GGA		0.378	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		19	44	0	0	0	0.007413	0	19	44				
RP1L1	94137	broad.mit.edu	37	8	10466111	10466111	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:10466111C>T	ENST00000382483.3	-	4	5720	c.5497G>A	c.(5497-5499)Gaa>Aaa	p.E1833K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1913					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCTATGCCTTCGGCCCCATCA	0.627																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(5497-5499)GAA>AAA		retinitis pigmentosa 1-like 1							147.0	164.0	159.0					8																	10466111		2008	4160	6168	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10466111C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5497G>A	8.37:g.10466111C>T	ENSP00000371923:p.Glu1833Lys		Somatic					p.E1833K	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5726	-			1833					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.5497G>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	9.510	1.105387	0.20632	.	.	ENSG00000183638	ENST00000382483	T	0.04049	3.72	3.96	0.953	0.19590	.	.	.	.	.	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	P	0.35011	0.48	B	0.15484	0.013	T	0.47209	-0.9135	9	0.30078	T	0.28	6.2257	3.7972	0.08744	0.0:0.4886:0.1845:0.3268	.	1833	A6NKC6	.	K	1833	ENSP00000371923:E1833K	ENSP00000371923:E1833K	E	-	1	0	RP1L1	10503521	.	.	0.000000	0.03702	0.009000	0.06853	.	.	-0.141000	0.11374	0.455000	0.32223	GAA		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			14	194	0	0	0	0.004007	0	14	194				
EXTL3	2137	broad.mit.edu	37	8	28600645	28600645	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:28600645C>T	ENST00000220562.4	+	6	3366	c.2464C>T	c.(2464-2466)Cgg>Tgg	p.R822W	EXTL3_ENST00000523149.1_Missense_Mutation_p.R438W|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	822					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CCAGGCCATCCGGGACATGGT	0.493																																							uc003xgz.1		NA																	0				skin(2)	2						c.(2464-2466)CGG>TGG		exostoses-like 3							226.0	197.0	207.0					8																	28600645		2203	4300	6503	SO:0001583	missense	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28600645C>T	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2464C>T	8.37:g.28600645C>T	ENSP00000220562:p.Arg822Trp		Somatic					p.R822W	NM_001440	NP_001431	WXS	Illumina HiSeq	Unspecified	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	6	3057	+		Ovarian(32;0.069)	822			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	c.2464C>T	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232042	0.79688	.	.	ENSG00000012232	ENST00000523149;ENST00000220562;ENST00000521532;ENST00000517738	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	4.89	4.89	0.63831	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.91280	0.7251	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93488	0.6833	10	0.87932	D	0	-9.1677	18.2842	0.90108	0.0:1.0:0.0:0.0	.	822	O43909	EXTL3_HUMAN	W	438;822;120;68	ENSP00000428691:R438W;ENSP00000220562:R822W;ENSP00000431013:R120W;ENSP00000430652:R68W	ENSP00000220562:R822W	R	+	1	2	EXTL3	28656564	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.011000	0.49567	2.542000	0.85734	0.650000	0.86243	CGG		0.493	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		23	127	0	0	0	0.014323	0	23	127				
ASH2L	9070	broad.mit.edu	37	8	37993278	37993278	+	Silent	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:37993278C>T	ENST00000343823.6	+	14	2022	c.1713C>T	c.(1711-1713)agC>agT	p.S571S	ASH2L_ENST00000545394.1_Silent_p.S432S|ASH2L_ENST00000428278.2_Silent_p.S477S|ASH2L_ENST00000521652.1_Intron|ASH2L_ENST00000250635.7_Intron	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	571	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				TGTACAAGAGCTGCACGGTAC	0.408																																							uc003xkt.3		NA																	0				ovary(1)|lung(1)	2						c.(1711-1713)AGC>AGT		ash2-like isoform a							65.0	65.0	65.0					8																	37993278		2203	4300	6503	SO:0001819	synonymous_variant	9070				hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding	g.chr8:37993278C>T	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.1713C>T	8.37:g.37993278C>T			Somatic				ASH2L_uc011lbk.1_Silent_p.S432S|ASH2L_uc003xku.3_Silent_p.S477S|ASH2L_uc010lwa.2_Intron	p.S571S	NM_004674	NP_004665	WXS	Illumina HiSeq	Unspecified	Q9UBL3	ASH2L_HUMAN			14	1771	+	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)	571			B30.2/SPRY.		A8K7C3|D3DSW9|O60659|O60660|Q96B62	Silent	SNP	ENST00000343823.6	37	c.1713C>T	CCDS6101.1																																																																																				0.408	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674		13	37	0	0	0	0.013537	0	13	37				
CHD7	55636	broad.mit.edu	37	8	61748804	61748804	+	Silent	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:61748804C>T	ENST00000423902.2	+	16	4430	c.3951C>T	c.(3949-3951)cgC>cgT	p.R1317R	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1317	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.		R -> C (in patients with CHARGES; unknown pathological significance). {ECO:0000269|PubMed:22461308}.		adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGATGGTGCGCTGCTTGGACA	0.478																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(3949-3951)CGC>CGT		chromodomain helicase DNA binding protein 7							73.0	70.0	71.0					8																	61748804		2006	4181	6187	SO:0001819	synonymous_variant	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61748804C>T	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3951C>T	8.37:g.61748804C>T			Somatic					p.R1317R	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		16	4428	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	1317			Helicase C-terminal.		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	c.3951C>T	CCDS47865.1																																																																																				0.478	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		9	147	0	0	0	0.006214	0	9	147				
PABPC1	26986	broad.mit.edu	37	8	101733732	101733732	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:101733732A>G	ENST00000318607.5	-	1	1208	c.80T>C	c.(79-81)cTc>cCc	p.L27P	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Missense_Mutation_p.L27P	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	27	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CTTCTCGTAGAGCATCGCCTC	0.667																																							uc003yjs.1		NA																	0					0						c.(79-81)CTC>CCC		poly(A) binding protein, cytoplasmic 1							28.0	30.0	29.0					8																	101733732		2202	4299	6501	SO:0001583	missense	26986				mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity	g.chr8:101733732A>G	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.80T>C	8.37:g.101733732A>G	ENSP00000313007:p.Leu27Pro		Somatic				PABPC1_uc011lhc.1_Missense_Mutation_p.L27P|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Missense_Mutation_p.L27P|PABPC1_uc003yju.2_RNA	p.L27P	NM_002568	NP_002559	WXS	Illumina HiSeq	Unspecified	P11940	PABP1_HUMAN	Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)		1	584	-	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		27			RRM 1.		Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	c.80T>C	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.746757	0.69418	.	.	ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000522387;ENST00000521865;ENST00000520142;ENST00000522720;ENST00000521067;ENST00000520804;ENST00000519363	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	3.45	3.45	0.39498	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.43260	U	0.000596	T	0.79690	0.4489	H	0.98866	4.355	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	D	0.86258	0.1653	10	0.87932	D	0	.	11.9042	0.52701	1.0:0.0:0.0:0.0	.	27;27;27	E7ERJ7;B3KT93;P11940	.;.;PABP1_HUMAN	P	27	ENSP00000313007:L27P;ENSP00000429395:L27P;ENSP00000429119:L27P;ENSP00000430012:L27P;ENSP00000429790:L27P;ENSP00000428937:L27P;ENSP00000428749:L27P;ENSP00000429032:L27P	ENSP00000313007:L27P	L	-	2	0	PABPC1	101802908	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.440000	0.90311	1.343000	0.45638	0.455000	0.32223	CTC		0.667	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568		3	44	0	0	0	0.009096	0	3	44				
FAM91A1	157769	broad.mit.edu	37	8	124792255	124792255	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:124792255G>C	ENST00000334705.7	+	7	826	c.580G>C	c.(580-582)Gat>Cat	p.D194H	FAM91A1_ENST00000521166.1_Missense_Mutation_p.D194H	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	194										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			ATGCGCTGTTGATAAGATCAT	0.328																																							uc003yqv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(580-582)GAT>CAT		hypothetical protein LOC157769							124.0	113.0	116.0					8																	124792255		1863	4103	5966	SO:0001583	missense	157769							g.chr8:124792255G>C	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.580G>C	8.37:g.124792255G>C	ENSP00000335082:p.Asp194His		Somatic				FAM91A1_uc011lik.1_Missense_Mutation_p.D194H|FAM91A1_uc011lil.1_5'UTR	p.D194H	NM_144963	NP_659400	WXS	Illumina HiSeq	Unspecified	Q658Y4	F91A1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00192)		7	641	+	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		194					B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	37	c.580G>C	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852014	0.91355	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.57595	0.39;0.95	5.51	5.51	0.81932	.	0.000000	0.85682	U	0.000000	T	0.77850	0.4192	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.81097	-0.1087	10	0.66056	D	0.02	.	19.4284	0.94754	0.0:0.0:1.0:0.0	.	194;194	E7ER68;Q658Y4	.;F91A1_HUMAN	H	194	ENSP00000429491:D194H;ENSP00000335082:D194H	ENSP00000335082:D194H	D	+	1	0	FAM91A1	124861436	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.673000	0.98631	2.604000	0.88044	0.579000	0.79373	GAT		0.328	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963		5	43	0	0	0	0.000602	0	5	43				
NDUFB9	4715	broad.mit.edu	37	8	125559309	125559309	+	Silent	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:125559309G>A	ENST00000276689.3	+	3	447	c.363G>A	c.(361-363)aaG>aaA	p.K121K	NDUFB9_ENST00000518008.1_Silent_p.K121K|NDUFB9_ENST00000517367.1_Silent_p.K110K|NDUFB9_ENST00000522532.1_Silent_p.K121K	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	121					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ACTTTGCCAAGAGAGAACAGT	0.453																																							uc003yrg.3		NA																	0				ovary(1)|skin(1)	2						c.(361-363)AAG>AAA		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						227.0	228.0	228.0					8																	125559309		2203	4300	6503	SO:0001819	synonymous_variant	4715				mitochondrial electron transport, NADH to ubiquinone|sensory perception of sound|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr8:125559309G>A	AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.363G>A	8.37:g.125559309G>A			Somatic				NDUFB9_uc011lim.1_Silent_p.K121K	p.K121K	NM_005005	NP_004996	WXS	Illumina HiSeq	Unspecified	Q9Y6M9	NDUB9_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		3	448	+	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		121					B2R8M6|Q9UQE8	Silent	SNP	ENST00000276689.3	37	c.363G>A	CCDS6352.1																																																																																				0.453	NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381606.1	NM_005005		13	462	0	0	0	0.001855	0	13	462				
ASAP1	50807	broad.mit.edu	37	8	131226829	131226829	+	Silent	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:131226829C>T	ENST00000518721.1	-	5	605	c.378G>A	c.(376-378)aaG>aaA	p.K126K	ASAP1_ENST00000357668.1_Silent_p.K126K	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	126					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TGGACAGTTCCTTTGTAAGAG	0.363																																							uc003yta.1		NA																	0				ovary(4)	4						c.(376-378)AAG>AAA		development and differentiation enhancing factor							85.0	89.0	88.0					8																	131226829		2203	4300	6503	SO:0001819	synonymous_variant	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131226829C>T	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.378G>A	8.37:g.131226829C>T			Somatic				ASAP1_uc011liw.1_Silent_p.K119K	p.K126K	NM_018482	NP_060952	WXS	Illumina HiSeq	Unspecified	Q9ULH1	ASAP1_HUMAN			4	406	-			126					B2RNV3	Silent	SNP	ENST00000518721.1	37	c.378G>A	CCDS6362.1																																																																																				0.363	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		16	198	0	0	0	0.006122	0	16	198				
FAM135B	51059	broad.mit.edu	37	8	139163899	139163899	+	Missense_Mutation	SNP	G	G	A	rs200201819		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:139163899G>A	ENST00000395297.1	-	13	2989	c.2819C>T	c.(2818-2820)aCg>aTg	p.T940M		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	940								p.T940M(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGCAGCTGACGTACAGCTCAA	0.478										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		endometrium(2)	ovary(7)|skin(2)	9						c.(2818-2820)ACG>ATG		hypothetical protein LOC51059							142.0	120.0	127.0					8																	139163899		2203	4300	6503	SO:0001583	missense	51059							g.chr8:139163899G>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2819C>T	8.37:g.139163899G>A	ENSP00000378710:p.Thr940Met	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.T841M|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.T502M|FAM135B_uc003yvb.2_Missense_Mutation_p.T502M	p.T940M	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	2990	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		940					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.2819C>T	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538259	0.27475	.	.	ENSG00000147724	ENST00000395297	T	0.15487	2.42	5.24	0.0264	0.14150	.	2.129060	0.01595	N	0.021756	T	0.09247	0.0228	L	0.27053	0.805	0.09310	N	1	P;B;B	0.38280	0.625;0.186;0.113	B;B;B	0.21360	0.034;0.014;0.006	T	0.21895	-1.0232	10	0.46703	T	0.11	5.1208	2.0977	0.03672	0.2419:0.2512:0.3898:0.1171	.	940;940;940	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	M	940	ENSP00000378710:T940M	ENSP00000276737:T940M	T	-	2	0	FAM135B	139233081	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.042000	0.13949	0.217000	0.20800	-0.175000	0.13238	ACG		0.478	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		19	308	0	0	0	0.007413	0	19	308				
JRK	8629	broad.mit.edu	37	8	143740275	143740275	+	RNA	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:143740275C>G	ENST00000507178.2	-	0	7535							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				CATTATGTCTCTGTAGAGGCC	0.532																																							uc003ywo.2		NA																	0					0						c.(1663-1665)GAG>CAG		jerky isoform b							56.0	57.0	57.0					8																	143740275		2017	4156	6173			8629							g.chr8:143740275C>G	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143740275C>G			Somatic				JRK_uc003ywp.2_3'UTR	p.E555Q	NM_001077527	NP_001070995	WXS	Illumina HiSeq	Unspecified					4	2177	-	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)						O75565	Missense_Mutation	SNP	ENST00000507178.2	37	c.1663G>C																																																																																					0.532	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724		4	90	0	0	0	0.009096	0	4	90				
MROH6	642475	broad.mit.edu	37	8	144654722	144654722	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:144654722C>G	ENST00000398882.3	-	1	419	c.163G>C	c.(163-165)Gag>Cag	p.E55Q	MROH6_ENST00000533679.1_5'Flank|RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	55																	GTCTGTGGCTCAGCCTCAGGT	0.682																																							uc010mff.2		NA																	0				ovary(1)	1						c.(163-165)GAG>CAG		hypothetical protein LOC642475							16.0	21.0	19.0					8																	144654722		1963	4142	6105	SO:0001583	missense	642475						binding	g.chr8:144654722C>G	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.163G>C	8.37:g.144654722C>G	ENSP00000381857:p.Glu55Gln		Somatic				C8orf73_uc010mfg.1_Missense_Mutation_p.E55Q	p.E55Q	NM_001100878	NP_001094348	WXS	Illumina HiSeq	Unspecified	A6NGR9	CH073_HUMAN	Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)		1	207	-	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		55					A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	37	c.163G>C	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	c	14.77	2.634801	0.47049	.	.	ENSG00000204839	ENST00000398882;ENST00000529971	T;T	0.39406	3.21;1.08	4.54	1.73	0.24493	.	.	.	.	.	T	0.23532	0.0569	N	0.14661	0.345	0.20638	N	0.999877	B;B	0.22746	0.06;0.074	B;B	0.23419	0.046;0.021	T	0.20505	-1.0273	9	0.45353	T	0.12	-1.7701	4.7585	0.13095	0.0:0.5795:0.2077:0.2128	.	55;55	E9PPP7;A6NGR9	.;CH073_HUMAN	Q	55	ENSP00000381857:E55Q;ENSP00000436959:E55Q	ENSP00000381857:E55Q	E	-	1	0	C8orf73	144725865	0.000000	0.05858	0.002000	0.10522	0.197000	0.23852	0.216000	0.17585	0.114000	0.18032	0.461000	0.40582	GAG		0.682	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878		5	54	0	0	0	0.000602	0	5	54				
TLE1	7088	broad.mit.edu	37	9	84267154	84267154	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr9:84267154A>T	ENST00000376499.3	-	6	1411	c.347T>A	c.(346-348)aTg>aAg	p.M116K	TLE1_ENST00000376472.1_5'UTR|TLE1_ENST00000376463.1_Missense_Mutation_p.M60K	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	116	Gln-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CAATTCTGCCATGGTCACCTG	0.453																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	uc004aly.2		NA																	0				ovary(1)|skin(1)	2						c.(346-348)ATG>AAG		transducin-like enhancer protein 1							232.0	194.0	207.0					9																	84267154		2203	4300	6503	SO:0001583	missense	7088				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding	g.chr9:84267154A>T		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.347T>A	9.37:g.84267154A>T	ENSP00000365682:p.Met116Lys		Somatic				TLE1_uc004alz.2_Missense_Mutation_p.M116K|TLE1_uc011lsr.1_Missense_Mutation_p.M116K|TLE1_uc004ama.1_Missense_Mutation_p.M116K|TLE1_uc011lss.1_Missense_Mutation_p.M116K|TLE1_uc004amb.2_Missense_Mutation_p.M116K	p.M116K	NM_005077	NP_005068	WXS	Illumina HiSeq	Unspecified	Q04724	TLE1_HUMAN			6	788	-			116			Gln-rich.		A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	c.347T>A	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.940349	0.73557	.	.	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319;ENST00000376463	T;T;T	0.54675	0.56;1.18;0.67	5.73	5.73	0.89815	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.78432	0.4282	M	0.92880	3.355	0.80722	D	1	D;B;D;B;P;B	0.60160	0.968;0.248;0.987;0.169;0.873;0.248	D;P;P;B;P;B	0.67900	0.954;0.531;0.9;0.233;0.723;0.428	D	0.84042	0.0365	10	0.72032	D	0.01	-27.8902	16.0209	0.80493	1.0:0.0:0.0:0.0	.	116;116;116;143;116;116	B4E345;B4DEF9;A6NFH2;Q59EF7;Q5T3G3;Q04724	.;.;.;.;.;TLE1_HUMAN	K	116;116;116;60	ENSP00000365682:M116K;ENSP00000391347:M116K;ENSP00000365646:M60K	ENSP00000347102:M116K	M	-	2	0	TLE1	83456974	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.339000	0.96797	2.186000	0.69663	0.459000	0.35465	ATG		0.453	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077		43	99	0	0	0	0.01441	0	43	99				
MSANTD3	91283	broad.mit.edu	37	9	103204575	103204575	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr9:103204575C>T	ENST00000395067.2	+	2	626	c.355C>T	c.(355-357)Ctc>Ttc	p.L119F	MSANTD3_ENST00000374885.1_Missense_Mutation_p.L119F|MSANTD3_ENST00000489377.1_3'UTR|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.A8V|TMEFF1_ENST00000334943.6_Missense_Mutation_p.L6F	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	119										endometrium(2)|lung(2)	4						GCCGGAGCAGCTCTACTTCCT	0.612																																							uc004bay.1		NA																	0					0						c.(355-357)CTC>TTC		transmembrane protein with EGF-like and two							44.0	44.0	44.0					9																	103204575		2203	4300	6503	SO:0001583	missense	8577				multicellular organismal development	integral to membrane|plasma membrane		g.chr9:103204575C>T	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.355C>T	9.37:g.103204575C>T	ENSP00000378506:p.Leu119Phe		Somatic				C9orf30_uc004baw.2_Missense_Mutation_p.L119F|C9orf30_uc004bax.2_RNA	p.L119F	NM_003692	NP_003683	WXS	Illumina HiSeq	Unspecified	Q8IYR6	TEFF1_HUMAN			1	388	+		Acute lymphoblastic leukemia(62;0.0452)	Error:Variant_position_missing_in_Q8IYR6_after_alignment					B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	ENST00000395067.2	37	c.355C>T	CCDS6749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.52|17.52	3.409156|3.409156	0.62399|0.62399	.|.	.|.	ENSG00000251349|ENSG00000066697;ENSG00000066697;ENSG00000066697;ENSG00000066697;ENSG00000241697	ENST00000502978|ENST00000395067;ENST00000398977;ENST00000374885;ENST00000374886;ENST00000334943	.|T	.|0.63096	.|-0.02	5.92|5.92	4.96|4.96	0.65561|0.65561	.|.	.|.	.|.	.|.	.|.	T|T	0.41858|0.41858	0.1177|0.1177	N|N	0.19112|0.19112	0.55|0.55	0.22873|0.22873	N|N	0.998625|0.998625	.|P;B	.|0.35908	.|0.527;0.151	.|B;B	.|0.29353	.|0.101;0.025	T|T	0.14924|0.14924	-1.0455|-1.0455	5|9	.|0.09084	.|T	.|0.74	-6.7711|-6.7711	13.5788|13.5788	0.61890|0.61890	0.2108:0.7892:0.0:0.0|0.2108:0.7892:0.0:0.0	.|.	.|6;119	.|Q8IYR6-2;Q96H12	.|.;CI030_HUMAN	V|F	8|119;119;119;119;6	.|ENSP00000334447:L6F	.|ENSP00000364020:L119F	A|L	+|+	2|1	0|0	C9orf30-TMEFF1|TMEFF1;C9orf30	102244396|102244396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.567000|2.567000	0.45956|0.45956	2.818000|2.818000	0.97014|0.97014	0.655000|0.655000	0.94253|0.94253	GCT|CTC		0.612	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655		6	51	0	0	0	0.001168	0	6	51				
ARSD	414	broad.mit.edu	37	X	2835948	2835948	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:2835948A>T	ENST00000381154.1	-	5	835	c.760T>A	c.(760-762)Tgg>Agg	p.W254R	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	254					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATACAGTTCCAGCGTCGCACA	0.522																																							uc004cqy.2		NA																	0					0						c.(760-762)TGG>AGG		arylsulfatase D isoform a precursor							40.0	40.0	40.0					X																	2835948		2203	4300	6503	SO:0001583	missense	414					lysosome	arylsulfatase activity|metal ion binding	g.chrX:2835948A>T	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.760T>A	X.37:g.2835948A>T	ENSP00000370546:p.Trp254Arg		Somatic				ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Missense_Mutation_p.W254R	p.W254R	NM_001669	NP_001660	WXS	Illumina HiSeq	Unspecified	P51689	ARSD_HUMAN			5	836	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	254					Q9UHJ8	Missense_Mutation	SNP	ENST00000381154.1	37	c.760T>A	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	a	11.91	1.779853	0.31502	.	.	ENSG00000006756	ENST00000381154;ENST00000217890	D	0.93604	-3.25	3.36	2.11	0.27256	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.506448	0.20750	U	0.086375	D	0.95242	0.8457	M	0.73372	2.23	0.45822	D	0.998695	D;D	0.89917	1.0;0.994	D;D	0.83275	0.996;0.981	D	0.93113	0.6518	10	0.66056	D	0.02	.	8.1144	0.30933	0.8166:0.0:0.0:0.1833	.	254;254	E9PAW5;P51689	.;ARSD_HUMAN	R	254	ENSP00000370546:W254R	ENSP00000217890:W254R	W	-	1	0	ARSD	2845948	1.000000	0.71417	0.005000	0.12908	0.317000	0.28152	7.504000	0.81646	0.132000	0.18615	0.233000	0.17823	TGG		0.522	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			5	25	0	0	0	0.001168	0	5	25				
PNPLA4	8228	broad.mit.edu	37	X	7870079	7870079	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:7870079T>A	ENST00000381042.4	-	6	751	c.581A>T	c.(580-582)gAc>gTc	p.D194V	PNPLA4_ENST00000444736.1_Missense_Mutation_p.D194V|PNPLA4_ENST00000537427.1_Missense_Mutation_p.D107V	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	194					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				CTGCCCTTTGTCCTGCGGGGA	0.498																																							uc011mhq.1		NA																	0					0						c.(580-582)GAC>GTC		patatin-like phospholipase domain containing 4							130.0	113.0	119.0					X																	7870079		2203	4299	6502	SO:0001583	missense	8228				lipid catabolic process		triglyceride lipase activity	g.chrX:7870079T>A	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.581A>T	X.37:g.7870079T>A	ENSP00000370430:p.Asp194Val		Somatic				PNPLA4_uc011mhr.1_Missense_Mutation_p.D194V|PNPLA4_uc011mhs.1_Missense_Mutation_p.D107V	p.D194V	NM_004650	NP_004641	WXS	Illumina HiSeq	Unspecified	P41247	PLPL4_HUMAN			6	743	-		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)	194					A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	c.581A>T	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329813	0.60743	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.76448	-1.02;-1.02;-1.02	3.94	3.94	0.45596	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.058596	0.64402	D	0.000002	T	0.72003	0.3407	M	0.73217	2.22	0.54753	D	0.99998	P	0.41188	0.741	B	0.36504	0.226	T	0.72530	-0.4265	10	0.42905	T	0.14	-33.8774	8.4877	0.33082	0.0:0.0:0.0:1.0	.	194	P41247	PLPL4_HUMAN	V	194;194;107	ENSP00000370430:D194V;ENSP00000415245:D194V;ENSP00000443157:D107V	ENSP00000370430:D194V	D	-	2	0	PNPLA4	7830079	1.000000	0.71417	0.144000	0.22314	0.677000	0.39632	5.333000	0.65917	1.597000	0.50072	0.486000	0.48141	GAC		0.498	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650		19	57	0	0	0	0.010504	0	19	57				
MAGEB3	4114	broad.mit.edu	37	X	30254547	30254547	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:30254547A>T	ENST00000361644.2	+	5	1243	c.506A>T	c.(505-507)aAg>aTg	p.K169M		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	169	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						GTTGATTTAAAGAAAGTTGAT	0.413																																							uc004dca.1		NA																	0					0						c.(505-507)AAG>ATG		melanoma antigen family B, 3							83.0	78.0	80.0					X																	30254547		2202	4300	6502	SO:0001583	missense	4114							g.chrX:30254547A>T	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.506A>T	X.37:g.30254547A>T	ENSP00000355198:p.Lys169Met		Somatic					p.K169M	NM_002365	NP_002356	WXS	Illumina HiSeq	Unspecified	O15480	MAGB3_HUMAN			5	1243	+			169			MAGE.		A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	c.506A>T	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.393994	0.42410	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.05925	3.37;3.37	4.1	2.9	0.33743	.	0.380247	0.23591	U	0.046552	T	0.22589	0.0545	M	0.85462	2.755	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.04522	-1.0945	10	0.87932	D	0	.	5.8575	0.18728	0.7623:0.0:0.0:0.2377	.	169	O15480	MAGB3_HUMAN	M	169	ENSP00000368271:K169M;ENSP00000355198:K169M	ENSP00000355198:K169M	K	+	2	0	MAGEB3	30164468	0.648000	0.27313	0.002000	0.10522	0.035000	0.12851	0.548000	0.23314	0.679000	0.31345	0.486000	0.48141	AAG		0.413	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365		5	68	0	0	0	0.000602	0	5	68				
DMD	1756	broad.mit.edu	37	X	31496492	31496492	+	Splice_Site	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:31496492C>T	ENST00000357033.4	-	59	8875		c.e59-1		DMD_ENST00000474231.1_Splice_Site|DMD_ENST00000343523.2_Splice_Site|DMD_ENST00000445312.1_Splice_Site|DMD_ENST00000378707.3_Splice_Site|DMD_ENST00000359836.1_Splice_Site|DMD_ENST00000541735.1_Splice_Site|DMD_ENST00000378677.2_Splice_Site	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGAGGCAGCTCTAAATTGGCA	0.433																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.e59-1		dystrophin Dp427m isoform							63.0	61.0	61.0					X																	31496492		2202	4300	6502	SO:0001630	splice_region_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31496492C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8669-1G>A	X.37:g.31496492C>T			Somatic				DMD_uc004dcq.1_Splice_Site_p.E161_splice|DMD_uc004dcr.1_Splice_Site_p.E430_splice|DMD_uc004dcs.1_Splice_Site_p.E430_splice|DMD_uc004dct.1_Splice_Site_p.E430_splice|DMD_uc004dcu.1_Splice_Site_p.E430_splice|DMD_uc004dcv.1_Splice_Site_p.E430_splice|DMD_uc004dcw.2_Splice_Site_p.E1546_splice|DMD_uc004dcx.2_Splice_Site_p.E1549_splice|DMD_uc004dcz.2_Splice_Site_p.E2767_splice|DMD_uc004dcy.1_Splice_Site_p.E2886_splice|DMD_uc004ddb.1_Splice_Site_p.E2882_splice	p.E2890_splice	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			59	8913	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)						E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	ENST00000357033.4	37	c.8669_splice	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698947	0.68501	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000465285;ENST00000474231	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4706	0.87645	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	31406413	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.777000	0.75028	2.397000	0.81536	0.529000	0.55759	.		0.433	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	Intron	10	68	0	0	0	0.008291	0	10	68				
FAM47A	158724	broad.mit.edu	37	X	34149740	34149740	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:34149740G>A	ENST00000346193.3	-	1	707	c.656C>T	c.(655-657)cCg>cTg	p.P219L		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	219	Pro-rich.							p.P219L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTGGACACCGGAGTCTTGGG	0.657																																							uc004ddg.2		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	ovary(4)|central_nervous_system(1)	5						c.(655-657)CCG>CTG		hypothetical protein LOC158724							32.0	35.0	34.0					X																	34149740		2200	4298	6498	SO:0001583	missense	158724							g.chrX:34149740G>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.656C>T	X.37:g.34149740G>A	ENSP00000345029:p.Pro219Leu		Somatic					p.P219L	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	689	-			219			Pro-rich.		A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.656C>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	3.688	-0.064184	0.07273	.	.	ENSG00000185448	ENST00000346193	T	0.13196	2.61	0.158	-0.317	0.12736	.	.	.	.	.	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	D	0.56287	0.975	B	0.40940	0.344	T	0.22277	-1.0221	8	0.32370	T	0.25	.	.	.	.	.	219	Q5JRC9	FA47A_HUMAN	L	219	ENSP00000345029:P219L	ENSP00000345029:P219L	P	-	2	0	FAM47A	34059661	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.493000	0.22451	-1.159000	0.02807	-1.162000	0.01777	CCG		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		17	82	0	0	0	0.008871	0	17	82				
KRBOX4	55634	broad.mit.edu	37	X	46322632	46322632	+	Splice_Site	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:46322632G>T	ENST00000344302.4	+	5	773		c.e5-1		KRBOX4_ENST00000377919.2_Splice_Site|KRBOX4_ENST00000487081.1_Splice_Site|KRBOX4_ENST00000478600.1_Splice_Site|KRBOX4_ENST00000298190.6_Splice_Site|KRBOX4_ENST00000360017.5_Splice_Site	NM_001129898.1|NM_017776.2	NP_001123370.1|NP_060246.2	Q5JUW0	KRBX4_HUMAN	KRAB box domain containing 4						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)										CCCCCGAACAGGGTATCTAGT	0.557																																							uc004dgn.3		NA																	0					0						c.e5-1		zinc finger family member 673 isoform 1							81.0	74.0	76.0					X																	46322632		2203	4300	6503	SO:0001630	splice_region_variant	55634				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding	g.chrX:46322632G>T		CCDS14267.1, CCDS48097.1, CCDS48098.1	Xp11.3	2013-01-08	2013-01-08	2013-01-08	ENSG00000147121	ENSG00000147121		"""-"""	26007	protein-coding gene	gene with protein product	"""hypothetical protein FLJ20344"""	300585	"""zinc finger protein 673"", ""zinc finger family member 673"""	ZNF673		11944989	Standard	NM_001129898		Approved	FLJ20344	uc004dgn.4	Q5JUW0	OTTHUMG00000021421	ENST00000344302.4:c.143-1G>T	X.37:g.46322632G>T			Somatic				ZNF673_uc004dgp.3_Splice_Site_p.G48_splice|ZNF673_uc010nhl.2_Splice_Site_p.G48_splice|ZNF673_uc004dgm.3_Splice_Site_p.G48_splice	p.G48_splice	NM_001129898	NP_001123370	WXS	Illumina HiSeq	Unspecified	Q5JUW0	ZN673_HUMAN			5	442	+								A8K0Y8|B3KU22|Q96EA3|Q9NXB1	Splice_Site	SNP	ENST00000344302.4	37	c.143_splice	CCDS48097.1	.	.	.	.	.	.	.	.	.	.	G	8.462	0.855561	0.17106	.	.	ENSG00000147121	ENST00000344302;ENST00000360017;ENST00000298190;ENST00000377919;ENST00000476762;ENST00000478600;ENST00000487081;ENST00000397212	.	.	.	3.32	2.45	0.29901	.	.	.	.	.	.	.	.	.	.	.	0.35299	D	0.782875	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8412	0.29400	0.1326:0.0:0.8674:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF673	46207576	1.000000	0.71417	0.034000	0.17996	0.058000	0.15608	2.240000	0.43088	0.782000	0.33613	0.513000	0.50165	.		0.557	KRBOX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056359.2	NM_017776	Intron	19	41	1	0	8.34094e-07	0.008871	9.46809e-07	19	41				
ZC3H12B	340554	broad.mit.edu	37	X	64721936	64721936	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:64721936T>C	ENST00000338957.4	+	5	1425	c.1358T>C	c.(1357-1359)aTt>aCt	p.I453T	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.I442T	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	453							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.I303T(1)|p.I389T(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGCTGTCCATTGCCCGTAAG	0.567																																							uc010nko.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|kidney(1)|pancreas(1)	3						c.(1324-1326)ATT>ACT		zinc finger CCCH-type containing 12B							72.0	77.0	75.0					X																	64721936		2073	4186	6259	SO:0001583	missense	340554						endonuclease activity|nucleic acid binding|zinc ion binding	g.chrX:64721936T>C	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.1358T>C	X.37:g.64721936T>C	ENSP00000340839:p.Ile453Thr		Somatic					p.I442T	NM_001010888	NP_001010888	WXS	Illumina HiSeq	Unspecified	Q5HYM0	ZC12B_HUMAN			5	1334	+			442					B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	c.1325T>C	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.692446	0.00731	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.21932	1.99;1.98	4.56	4.56	0.56223	.	0.423542	0.25890	N	0.027637	T	0.07052	0.0179	N	0.04508	-0.205	0.09310	N	1	B	0.29716	0.255	B	0.19666	0.026	T	0.28170	-1.0052	10	0.15066	T	0.55	-57.4883	5.0393	0.14451	0.0:0.2135:0.0:0.7865	.	442	Q5HYM0	ZC12B_HUMAN	T	453;442;389	ENSP00000340839:I453T;ENSP00000408077:I442T	ENSP00000218172:I389T	I	+	2	0	ZC3H12B	64638661	0.482000	0.25948	0.987000	0.45799	0.964000	0.63967	1.587000	0.36622	1.683000	0.51011	0.417000	0.27973	ATT		0.567	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		8	70	0	0	0	0.004482	0	8	70				
FOXO4	4303	broad.mit.edu	37	X	70320855	70320855	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:70320855C>T	ENST00000374259.3	+	2	1107	c.775C>T	c.(775-777)Cga>Tga	p.R259*	FOXO4_ENST00000341558.3_Nonsense_Mutation_p.R204*	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	259					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					CTTCCGTCCACGAAGCAGTTC	0.582											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dys.1		NA																	0				central_nervous_system(2)|prostate(1)	3						c.(775-777)CGA>TGA		forkhead box O4							42.0	41.0	41.0					X																	70320855		2047	4183	6230	SO:0001587	stop_gained	4303				cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chrX:70320855C>T		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.775C>T	X.37:g.70320855C>T	ENSP00000363377:p.Arg259*		Somatic	OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1121	FOXO4_uc010nkz.2_Nonsense_Mutation_p.R259*|FOXO4_uc004dyt.1_Nonsense_Mutation_p.R204*	p.R259*	NM_005938	NP_005929	WXS	Illumina HiSeq	Unspecified	P98177	FOXO4_HUMAN			2	1128	+	Renal(35;0.156)		259					B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Nonsense_Mutation	SNP	ENST00000374259.3	37	c.775C>T	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	C	32	5.188148	0.94923	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	.	.	.	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.8929	16.2995	0.82801	0.0:1.0:0.0:0.0	.	.	.	.	X	259;204	.	ENSP00000342209:R204X	R	+	1	2	FOXO4	70237580	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.498000	0.66931	2.307000	0.77673	0.519000	0.50382	CGA		0.582	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938		7	22	0	0	0	0.001984	0	7	22				
KLHL4	56062	broad.mit.edu	37	X	86888891	86888891	+	Silent	SNP	T	T	A			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:86888891T>A	ENST00000373119.4	+	8	1837	c.1692T>A	c.(1690-1692)ggT>ggA	p.G564G	KLHL4_ENST00000373114.4_Silent_p.G564G	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	564						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GCACAGTTGGTGTTGTTGCAT	0.418																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1690-1692)GGT>GGA		kelch-like 4 isoform 1							151.0	121.0	131.0					X																	86888891		2203	4300	6503	SO:0001819	synonymous_variant	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86888891T>A	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1692T>A	X.37:g.86888891T>A			Somatic				KLHL4_uc004efa.2_Silent_p.G564G	p.G564G	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			8	1874	+			564			Kelch 3.		B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	37	c.1692T>A	CCDS14457.1																																																																																				0.418	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			4	43	0	0	0	0.001984	0	4	43				
RGAG1	57529	broad.mit.edu	37	X	109694853	109694853	+	Silent	SNP	A	A	G			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:109694853A>G	ENST00000465301.2	+	3	1254	c.1008A>G	c.(1006-1008)ttA>ttG	p.L336L	RGAG1_ENST00000540313.1_Silent_p.L336L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	336										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGTCCACATTACCAAAGCCAG	0.522																																							uc004eor.1		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1006-1008)TTA>TTG		retrotransposon gag domain containing 1							246.0	228.0	234.0					X																	109694853		2203	4300	6503	SO:0001819	synonymous_variant	57529							g.chrX:109694853A>G	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1008A>G	X.37:g.109694853A>G			Somatic				RGAG1_uc011msr.1_Silent_p.L336L	p.L336L	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	1254	+			336					Q9P2M8	Silent	SNP	ENST00000465301.2	37	c.1008A>G	CCDS14552.1																																																																																				0.522	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		32	375	0	0	0	0.008361	0	32	375				
LRCH2	57631	broad.mit.edu	37	X	114357660	114357660	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:114357660T>C	ENST00000317135.8	-	18	1975	c.1945A>G	c.(1945-1947)Ata>Gta	p.I649V	LRCH2_ENST00000538422.1_Missense_Mutation_p.I632V	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	649	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						AGTTGTCGTATTTGCTCTCGC	0.408																																							uc010nqe.2		NA																	0				ovary(1)	1						c.(1945-1947)ATA>GTA		leucine-rich repeats and calponin homology (CH)							160.0	134.0	142.0					X																	114357660		1909	4112	6021	SO:0001583	missense	57631							g.chrX:114357660T>C	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.1945A>G	X.37:g.114357660T>C	ENSP00000325091:p.Ile649Val		Somatic				LRCH2_uc004epz.2_Missense_Mutation_p.I632V	p.I649V	NM_020871	NP_065922	WXS	Illumina HiSeq	Unspecified	Q5VUJ6	LRCH2_HUMAN			18	1976	-			649			CH.		F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	ENST00000317135.8	37	c.1945A>G	CCDS48155.1	.	.	.	.	.	.	.	.	.	.	T	7.467	0.645922	0.14451	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	T;T	0.00902	5.6;5.56	5.31	5.31	0.75309	Calponin homology domain (4);	0.000000	0.85682	D	0.000000	T	0.00845	0.0028	N	0.11364	0.135	0.48901	D	0.999722	B;B	0.31548	0.129;0.328	B;B	0.36186	0.103;0.219	T	0.76446	-0.2956	10	0.18276	T	0.48	-17.1416	13.0407	0.58897	0.0:0.0:0.0:1.0	.	649;632	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	V	649;128;632	ENSP00000325091:I649V;ENSP00000439366:I632V	ENSP00000325091:I649V	I	-	1	0	LRCH2	114263916	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.426000	0.59882	1.959000	0.56917	0.441000	0.28932	ATA		0.408	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057971.2	NM_020871		4	26	0	0	0	0.000602	0	4	26				
IGSF1	3547	broad.mit.edu	37	X	130408758	130408758	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:130408758C>T	ENST00000361420.3	-	18	3645	c.3566G>A	c.(3565-3567)gGt>gAt	p.G1189D	IGSF1_ENST00000370903.3_Missense_Mutation_p.G1194D|IGSF1_ENST00000370910.1_Missense_Mutation_p.G1180D|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370904.1_Missense_Mutation_p.G1180D			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1189	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						AAATTCAACACCTGGCAGGGG	0.502																																							uc004ewd.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)	5						c.(3565-3567)GGT>GAT		immunoglobulin superfamily, member 1 isoform 1							150.0	149.0	149.0					X																	130408758		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130408758C>T	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3566G>A	X.37:g.130408758C>T	ENSP00000355010:p.Gly1189Asp		Somatic				IGSF1_uc004ewe.3_Missense_Mutation_p.G1183D|IGSF1_uc004ewf.2_Missense_Mutation_p.G1169D	p.G1189D	NM_001555	NP_001546	WXS	Illumina HiSeq	Unspecified	Q8N6C5	IGSF1_HUMAN			18	3804	-			1189			Extracellular (Potential).|Ig-like C2-type 12.		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.3566G>A	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623260	0.46840	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	5.35	4.49	0.54785	Immunoglobulin-like fold (1);	0.273612	0.26867	N	0.022085	T	0.19604	0.0471	L	0.34521	1.04	0.32584	N	0.528042	D;P;D	0.89917	0.991;0.592;1.0	D;P;D	0.91635	0.959;0.573;0.999	T	0.11421	-1.0588	10	0.38643	T	0.18	.	9.3549	0.38159	0.0:0.8983:0.0:0.1017	.	1180;633;1189	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	D	1180;1189;1180;1194	ENSP00000359947:G1180D;ENSP00000355010:G1189D;ENSP00000359941:G1180D;ENSP00000359940:G1194D	ENSP00000355010:G1189D	G	-	2	0	IGSF1	130236439	0.156000	0.22821	1.000000	0.80357	0.997000	0.91878	0.670000	0.25157	1.154000	0.42482	0.594000	0.82650	GGT		0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			16	200	0	0	0	0.004007	0	16	200				
MAP7D3	79649	broad.mit.edu	37	X	135323326	135323326	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:135323326G>T	ENST00000316077.9	-	5	748	c.528C>A	c.(526-528)agC>agA	p.S176R	MAP7D3_ENST00000370663.5_Missense_Mutation_p.S158R|MAP7D3_ENST00000370661.1_Missense_Mutation_p.S176R	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	176					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TACCAGTTTTGCTCTCAGAAT	0.368																																							uc004ezt.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(526-528)AGC>AGA		MAP7 domain containing 3							62.0	57.0	59.0					X																	135323326		1851	4102	5953	SO:0001583	missense	79649					cytoplasm|spindle		g.chrX:135323326G>T	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.528C>A	X.37:g.135323326G>T	ENSP00000318086:p.Ser176Arg		Somatic				MAP7D3_uc004ezs.2_Missense_Mutation_p.S175R|MAP7D3_uc011mwc.1_Missense_Mutation_p.S158R|MAP7D3_uc010nsa.1_Missense_Mutation_p.S175R	p.S176R	NM_024597	NP_078873	WXS	Illumina HiSeq	Unspecified	Q8IWC1	MA7D3_HUMAN			5	619	-	Acute lymphoblastic leukemia(192;0.000127)		176					A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	c.528C>A	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630550	0.28978	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.09255	3.0;3.87;3.87;3.87	5.15	2.05	0.26809	.	.	.	.	.	T	0.10594	0.0259	L	0.28400	0.85	0.09310	N	1	P;P;B;D	0.61080	0.543;0.822;0.401;0.989	B;B;B;P	0.53185	0.164;0.38;0.164;0.72	T	0.20505	-1.0273	9	0.16896	T	0.51	-0.3265	3.9519	0.09372	0.1006:0.1552:0.5812:0.163	.	158;176;176;176	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	R	176;176;158;176	ENSP00000359695:S176R;ENSP00000318086:S176R;ENSP00000359697:S158R;ENSP00000359694:S176R	ENSP00000318086:S176R	S	-	3	2	MAP7D3	135150992	0.097000	0.21791	0.000000	0.03702	0.059000	0.15707	0.775000	0.26689	-0.033000	0.13736	0.538000	0.68166	AGC		0.368	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2			4	32	1	0	0.00909568	0.009096	0.00949114	4	32				
MCF2	4168	broad.mit.edu	37	X	138699760	138699760	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:138699760C>T	ENST00000370576.4	-	8	1120	c.911G>A	c.(910-912)cGt>cAt	p.R304H	MCF2_ENST00000338585.6_Missense_Mutation_p.R304H|MCF2_ENST00000519895.1_Missense_Mutation_p.R364H|MCF2_ENST00000483690.1_5'Flank|MCF2_ENST00000370573.4_Missense_Mutation_p.R304H|MCF2_ENST00000414978.1_Missense_Mutation_p.R364H|MCF2_ENST00000520602.1_Missense_Mutation_p.R364H|MCF2_ENST00000370578.4_Missense_Mutation_p.R449H|MCF2_ENST00000536274.1_Missense_Mutation_p.R265H	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	304					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					AGAAAGGTAACGTAGCTCATT	0.393																																							uc004fau.2		NA																	0				lung(1)|pleura(1)	2						c.(910-912)CGT>CAT		MCF.2 cell line derived transforming sequence							247.0	211.0	223.0					X																	138699760		2203	4300	6503	SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138699760C>T		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.911G>A	X.37:g.138699760C>T	ENSP00000359608:p.Arg304His		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.R304H|MCF2_uc011mwl.1_Missense_Mutation_p.R265H|MCF2_uc010nsh.1_Missense_Mutation_p.R304H|MCF2_uc011mwm.1_Missense_Mutation_p.R265H|MCF2_uc011mwn.1_Missense_Mutation_p.R449H|MCF2_uc004faw.2_Missense_Mutation_p.R364H|MCF2_uc011mwo.1_Missense_Mutation_p.R364H	p.R304H	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			8	1205	-	Acute lymphoblastic leukemia(192;0.000127)		304			Spectrin.		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	c.911G>A	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577651	0.65878	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.98	5.13	0.70059	.	0.046583	0.85682	N	0.000000	T	0.47322	0.1439	M	0.73962	2.25	0.37321	D	0.909534	B;P;B;B;B;B;P;B	0.40834	0.026;0.611;0.021;0.012;0.209;0.023;0.73;0.133	B;B;B;B;B;B;B;B	0.35353	0.046;0.139;0.073;0.033;0.099;0.049;0.201;0.046	T	0.58470	-0.7631	10	0.51188	T	0.08	.	13.3095	0.60371	0.0:0.9229:0.0:0.0771	.	364;449;265;304;304;449;304;304	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	H	364;304;265;449;364;364;304;304	ENSP00000427745:R364H;ENSP00000359608:R304H;ENSP00000438155:R265H;ENSP00000359610:R449H;ENSP00000397055:R364H;ENSP00000430276:R364H;ENSP00000359605:R304H;ENSP00000342204:R304H	ENSP00000342204:R304H	R	-	2	0	MCF2	138527426	1.000000	0.71417	0.991000	0.47740	0.927000	0.56198	5.542000	0.67218	1.275000	0.44379	0.544000	0.68410	CGT		0.393	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		73	117	0	0	0	0.01441	0	73	117				
FMR1	2332	broad.mit.edu	37	X	147018985	147018985	+	Splice_Site	SNP	G	G	C			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chrX:147018985G>C	ENST00000370475.4	+	11	1119	c.991G>C	c.(991-993)Gaa>Caa	p.E331Q	FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000370471.3_Splice_Site_p.E331Q|FMR1_ENST00000370470.1_Splice_Site_p.E331Q|FMR1_ENST00000439526.2_Splice_Site_p.E329Q|FMR1_ENST00000370477.1_Splice_Site_p.E331Q|FMR1_ENST00000218200.8_Splice_Site_p.E331Q	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	331					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E331K(1)		NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTACCAAGGAAATTATGCC	0.308									Fragile X syndrome																														uc010nst.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|pancreas(1)	3						c.(991-993)GAA>CAA		fragile X mental retardation 1							63.0	64.0	64.0					X																	147018985		2199	4294	6493	SO:0001630	splice_region_variant	2332	Fragile_X_syndrome	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding	g.chrX:147018985G>C	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.991-1G>C	X.37:g.147018985G>C			Somatic				FMR1_uc004fcj.2_Missense_Mutation_p.E329Q|FMR1_uc004fck.3_Missense_Mutation_p.E331Q|FMR1_uc004fcl.3_Missense_Mutation_p.E192Q|FMR1_uc011mxa.1_5'UTR	p.E331Q	NM_002024	NP_002015	WXS	Illumina HiSeq	Unspecified	Q06787	FMR1_HUMAN			11	1180	+	Acute lymphoblastic leukemia(192;6.56e-05)		331					A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	c.991G>C	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405350	0.42715	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470	T;T;T;T;T;T	0.57107	1.23;0.42;1.24;1.23;1.25;1.24	5.26	5.26	0.73747	K Homology (1);K Homology, type 1 (1);	0.247227	0.34603	N	0.003837	T	0.60996	0.2312	L	0.38175	1.15	0.80722	D	1	P;B;P;D	0.61080	0.601;0.02;0.807;0.989	P;B;B;D	0.70487	0.505;0.035;0.349;0.969	T	0.58358	-0.7650	9	.	.	.	-35.8459	13.4146	0.60961	0.0:0.0:1.0:0.0	.	331;247;331;329	Q06787;Q59GC1;Q06787-8;G3V0J0	FMR1_HUMAN;.;.;.	Q	331;331;331;331;329;331	ENSP00000218200:E331Q;ENSP00000359502:E331Q;ENSP00000359508:E331Q;ENSP00000359506:E331Q;ENSP00000395923:E329Q;ENSP00000359501:E331Q	.	E	+	1	0	FMR1	146826677	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.046000	0.64226	2.320000	0.78422	0.506000	0.49869	GAA		0.308	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	Missense_Mutation	4	66	0	0	0	0.009096	0	4	66				
CBL	867	broad.mit.edu	37	11	119149277	119149288	+	In_Frame_Del	DEL	ATCGTGGTAGAT	ATCGTGGTAGAT	-	rs148368481		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	ATCGTGGTAGAT	ATCGTGGTAGAT	-	-	ATCGTGGTAGAT	ATCGTGGTAGAT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:119149277_119149288delATCGTGGTAGAT	ENST00000264033.4	+	9	1661_1672	c.1285_1296delATCGTGGTAGAT	c.(1285-1296)atcgtggtagatdel	p.IVVD429del		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	429	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G397_I429del(1)|p.I429_F434del(1)|p.I429I(1)|p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		TACTGAACCCATCGTGGTAGATCCGTTTGATC	0.462			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																														uc001pwe.2		NA		"""Dom, Rec"""	yes		11	11q23.3	867		Cas-Br-M (murine) ecotropic retroviral transforming			L					4	Deletion - In frame(3)|Substitution - coding silent(1)	p.G397_I429del(1)|p.I429_F434del(1)|p.E366_K477del(1)	haematopoietic_and_lymphoid_tissue(3)|endometrium(1)	haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149						c.(1285-1296)ATCGTGGTAGATdel		Cas-Br-M (murine) ecotropic retroviral																																				SO:0001651	inframe_deletion	867	CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:119149277_119149288delATCGTGGTAGAT	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1285_1296delATCGTGGTAGAT	11.37:g.119149277_119149288delATCGTGGTAGAT	ENSP00000264033:p.Ile429_Asp432del		Somatic					p.IVVD429del	NM_005188	NP_005179	WXS	Illumina HiSeq	Unspecified	P22681	CBL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)	9	1423_1434	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	429_432			Asp/Glu-rich (acidic).		A3KMP8	In_Frame_Del	DEL	ENST00000264033.4	37	c.1285_1296delATCGTGGTAGAT	CCDS8418.1																																																																																				0.462	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188		22	68	NA	NA	NA	NA	NA	22	68	---	---	---	---
SNX19	399979	broad.mit.edu	37	11	130784287	130784287	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr11:130784287delG	ENST00000265909.4	-	1	2117	c.1548delC	c.(1546-1548)ttcfs	p.F516fs	SNX19_ENST00000539184.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533214.1_Frame_Shift_Del_p.F516fs|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	516					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GCTCAAAGCTGAAGGTGGCTG	0.537																																							uc001qgk.3		NA																	0				ovary(2)|lung(2)	4						c.(1546-1548)TTCfs		sorting nexin 19							100.0	90.0	93.0					11																	130784287		2201	4297	6498	SO:0001589	frameshift_variant	399979				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr11:130784287delG	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1548delC	11.37:g.130784287delG	ENSP00000265909:p.Phe516fs		Somatic				SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Frame_Shift_Del_p.F516fs|SNX19_uc009zcx.1_Intron	p.F516fs	NM_014758	NP_055573	WXS	Illumina HiSeq	Unspecified	Q92543	SNX19_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)	1	2096	-	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)	516					E9PKB9|Q8IV55	Frame_Shift_Del	DEL	ENST00000265909.4	37	c.1548delC	CCDS31721.1																																																																																				0.537	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		8	74	NA	NA	NA	NA	NA	8	74	---	---	---	---
BTG1	694	broad.mit.edu	37	12	92538035	92538041	+	Frame_Shift_Del	DEL	AGGACAC	AGGACAC	-			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	AGGACAC	AGGACAC	-	-	AGGACAC	AGGACAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr12:92538035_92538041delAGGACAC	ENST00000256015.3	-	2	692_698	c.331_337delGTGTCCT	c.(331-339)gtgtcctacfs	p.VSY111fs	C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000546975.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	111					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CCAATTCTGTAGGACACTTCATAGGGG	0.531			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001tby.3		NA		Dom	yes		12	12q22	694	T	"""B-cell translocation gene 1, anti-proliferative"""			L	MYC		BCLL		0					0						c.(331-339)GTGTCCTACfs		B-cell translocation protein 1																																				SO:0001589	frameshift_variant	694				cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity	g.chr12:92538035_92538041delAGGACAC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.331_337delGTGTCCT	12.37:g.92538035_92538041delAGGACAC	ENSP00000256015:p.Val111fs		Somatic	OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1291	BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	p.V111fs	NM_001731	NP_001722	WXS	Illumina HiSeq	Unspecified	P62324	BTG1_HUMAN			2	693_699	-		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)	111_113					P31607	Frame_Shift_Del	DEL	ENST00000256015.3	37	c.331_337delGTGTCCT	CCDS9043.1																																																																																				0.531	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1			18	63	NA	NA	NA	NA	NA	18	63	---	---	---	---
IL32	9235	broad.mit.edu	37	16	3119304	3119305	+	Frame_Shift_Ins	INS	-	-	G	rs398100042|rs2981599		TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr16:3119304_3119305insG	ENST00000534507.1	+	6	864_865	c.653_654insG	c.(652-657)gacaagfs	p.DK218fs	IL32_ENST00000549213.1_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000548246.1_Frame_Shift_Ins_p.DK132fs|IL32_ENST00000440815.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000444393.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000552664.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000529550.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000548476.1_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000530538.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000551513.1_Frame_Shift_Ins_p.DK209fs|IL32_ENST00000533097.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000008180.9_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000526464.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000382213.3_Frame_Shift_Ins_p.DK163fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000396887.3_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000396890.2_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000531965.1_Frame_Shift_Ins_p.DK162fs|IL32_ENST00000530890.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000529699.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000552936.1_Frame_Shift_Ins_p.DK196fs|IL32_ENST00000551122.1_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000552356.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000525643.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000548652.1_Frame_Shift_Ins_p.DK163fs|IL32_ENST00000528163.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000325568.5_Frame_Shift_Ins_p.DK172fs			P24001	IL32_HUMAN	interleukin 32	218					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CCACGGGGGGACAAGGAGGAGC	0.574																																							uc002cto.2		NA																	0				pancreas(1)	1						c.(652-654)GACfs		interleukin 32 isoform B																																				SO:0001589	frameshift_variant	9235				cell adhesion|defense response|immune response	extracellular space	cytokine activity	g.chr16:3119304_3119305insG	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	Exception_encountered	16.37:g.3119304_3119305insG	ENSP00000431775:p.Asp218fs		Somatic				IL32_uc002ctk.2_Frame_Shift_Ins_p.D115fs|IL32_uc010uwp.1_Frame_Shift_Ins_p.D152fs|IL32_uc010btb.2_Frame_Shift_Ins_p.D162fs|IL32_uc002ctl.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctm.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctn.2_Frame_Shift_Ins_p.D172fs|IL32_uc002cts.3_Frame_Shift_Ins_p.D172fs|IL32_uc002ctp.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctq.2_Frame_Shift_Ins_p.D218fs|IL32_uc002ctr.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctt.2_Frame_Shift_Ins_p.D172fs|IL32_uc010uwr.1_Frame_Shift_Ins_p.D132fs|IL32_uc002ctu.2_Frame_Shift_Ins_p.D163fs	p.D218fs	NM_004221	NP_004212	WXS	Illumina HiSeq	Unspecified	P24001	IL32_HUMAN			6	864_865	+			218					A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Ins	INS	ENST00000534507.1	37	c.653_654insG																																																																																					0.574	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221		9	240	NA	NA	NA	NA	NA	9	240	---	---	---	---
ARHGAP35	2909	broad.mit.edu	37	19	47503733	47503735	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr19:47503733_47503735delCAG	ENST00000404338.3	+	6	4288_4290	c.4288_4290delCAG	c.(4288-4290)cagdel	p.Q1431del		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1431	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										ACTCTTTATCCAGCAGTGCCCCT	0.596																																							uc010ekv.2		NA																	0				central_nervous_system(1)	1						c.(4288-4290)CAGdel		glucocorticoid receptor DNA binding factor 1																																				SO:0001651	inframe_deletion	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47503733_47503735delCAG	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.4288_4290delCAG	19.37:g.47503736_47503738delCAG	ENSP00000385720:p.Gln1431del		Somatic					p.Q1431del	NM_004491	NP_004482	WXS	Illumina HiSeq	Unspecified	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	6	4288_4290	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	1431			Rho-GAP.		A7E2A4|Q14452|Q9C0E1	In_Frame_Del	DEL	ENST00000404338.3	37	c.4288_4290delCAG	CCDS46127.1																																																																																				0.596	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		42	119	NA	NA	NA	NA	NA	42	119	---	---	---	---
MED15	51586	broad.mit.edu	37	22	20920814	20920816	+	In_Frame_Del	DEL	CAG	CAG	-	rs67182670|rs535773989	byFrequency	TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr22:20920814_20920816delCAG	ENST00000263205.7	+	7	820_822	c.751_753delCAG	c.(751-753)cagdel	p.Q262del	MED15_ENST00000425759.2_In_Frame_Del_p.Q151del|MED15_ENST00000292733.7_In_Frame_Del_p.Q262del|MED15_ENST00000542773.1_In_Frame_Del_p.Q67del|MED15_ENST00000382974.2_In_Frame_Del_p.Q191del|MED15_ENST00000541476.1_In_Frame_Del_p.Q236del|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000406969.1_In_Frame_Del_p.Q236del	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	262	Poly-Gln.		Missing.	Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q250_Q251insQ(4)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			acaacagcaacagcagcagcagc	0.591																																							uc002zsp.2		NA																	4	Insertion - In frame(4)		ovary(2)|large_intestine(2)	skin(1)	1						c.(751-753)CAGdel		mediator complex subunit 15 isoform a																																				SO:0001651	inframe_deletion	51586				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding	g.chr22:20920814_20920816delCAG	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.751_753delCAG	22.37:g.20920823_20920825delCAG	ENSP00000263205:p.Gln262del		Somatic				MED15_uc002zso.2_In_Frame_Del_p.Q191del|MED15_uc002zsq.2_In_Frame_Del_p.Q262del|MED15_uc010gso.2_In_Frame_Del_p.Q262del|MED15_uc002zsr.2_In_Frame_Del_p.Q236del|MED15_uc011ahs.1_In_Frame_Del_p.Q236del|MED15_uc002zss.2_In_Frame_Del_p.Q181del|MED15_uc011ahu.1_5'UTR	p.Q262del	NM_001003891	NP_001003891	WXS	Illumina HiSeq	Unspecified	Q96RN5	MED15_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)		7	831_833	+	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	262	Missing (in Ref. 3; BAB85034).	Missing.	Poly-Gln.		D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	In_Frame_Del	DEL	ENST00000263205.7	37	c.751_753delCAG	CCDS33602.1																																																																																				0.591	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889		7	55	NA	NA	NA	NA	NA	7	55	---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108366847	108366847	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr3:108366847delA	ENST00000361582.3	+	16	2080	c.1850delA	c.(1849-1851)gagfs	p.E617fs	DZIP3_ENST00000463306.1_Frame_Shift_Del_p.E617fs	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	617					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						CCTCTCATGGAGTACAATATA	0.333																																							uc003dxd.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1849-1851)GAGfs		DAZ interacting protein 3, zinc finger							109.0	114.0	112.0					3																	108366847		2203	4300	6503	SO:0001589	frameshift_variant	9666				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:108366847delA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1850delA	3.37:g.108366847delA	ENSP00000355028:p.Glu617fs		Somatic				DZIP3_uc003dxf.1_Frame_Shift_Del_p.E617fs|DZIP3_uc011bhm.1_Frame_Shift_Del_p.E68fs|DZIP3_uc003dxe.1_Frame_Shift_Del_p.E617fs|DZIP3_uc003dxg.1_Frame_Shift_Del_p.E340fs	p.E617fs	NM_014648	NP_055463	WXS	Illumina HiSeq	Unspecified	Q86Y13	DZIP3_HUMAN			16	2272	+			617					B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Frame_Shift_Del	DEL	ENST00000361582.3	37	c.1850delA	CCDS2952.1																																																																																				0.333	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648		12	68	NA	NA	NA	NA	NA	12	68	---	---	---	---
SULF1	23213	broad.mit.edu	37	8	70514026	70514026	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7153-01A-11D-2036-08	TCGA-78-7153-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	03e4e53c-0d21-4492-af79-b70a90d32dff	7be9ef7a-2d28-474f-8c51-c17dabed684c	g.chr8:70514026delT	ENST00000260128.4	+	10	1740	c.1023delT	c.(1021-1023)cctfs	p.P341fs	SULF1_ENST00000458141.2_Frame_Shift_Del_p.P341fs|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000402687.4_Frame_Shift_Del_p.P341fs|SULF1_ENST00000419716.3_Frame_Shift_Del_p.P341fs	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	341					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTCGTGTGCCTTTTTTTATTC	0.408																																							uc010lza.1		NA																	0				central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(1021-1023)CCTfs		sulfatase 1 precursor							396.0	343.0	361.0					8																	70514026		2203	4300	6503	SO:0001589	frameshift_variant	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70514026delT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1023delT	8.37:g.70514026delT	ENSP00000260128:p.Pro341fs		Somatic				SULF1_uc003xyd.2_Frame_Shift_Del_p.P341fs|SULF1_uc003xye.2_Frame_Shift_Del_p.P341fs|SULF1_uc003xyf.2_Frame_Shift_Del_p.P341fs|SULF1_uc003xyg.2_Frame_Shift_Del_p.P341fs|SULF1_uc003xyh.1_RNA	p.P341fs	NM_015170	NP_055985	WXS	Illumina HiSeq	Unspecified	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		10	1740	+	Breast(64;0.0654)		341					Q86YV8|Q8NCA2|Q9UPS5	Frame_Shift_Del	DEL	ENST00000260128.4	37	c.1023delT	CCDS6204.1																																																																																				0.408	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		8	1371	NA	NA	NA	NA	NA	8	1371	---	---	---	---
