#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NPHP4	261734	broad.mit.edu	37	1	5935129	5935129	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:5935129C>T	ENST00000378156.4	-	21	3114	c.2849G>A	c.(2848-2850)cGg>cAg	p.R950Q	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	950					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CTGTAGGTCCCGCAAGTGCTG	0.657																																							uc001alq.1		NA																	0				pancreas(1)	1						c.(2848-2850)CGG>CAG		nephroretinin							43.0	52.0	49.0					1																	5935129		2187	4278	6465	SO:0001583	missense	261734				actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity	g.chr1:5935129C>T	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2849G>A	1.37:g.5935129C>T	ENSP00000367398:p.Arg950Gln		Somatic					p.R950Q	NM_015102	NP_055917	WXS	Illumina HiSeq	Unspecified	O75161	NPHP4_HUMAN		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)	21	3115	-	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)	950					Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	37	c.2849G>A	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	c	16.52	3.145187	0.57044	.	.	ENSG00000131697	ENST00000378156	D	0.87412	-2.25	4.88	4.88	0.63580	.	0.084611	0.44688	D	0.000421	D	0.87406	0.6169	M	0.64404	1.975	0.40122	D	0.976612	D	0.55800	0.973	P	0.48304	0.573	D	0.88479	0.3067	10	0.52906	T	0.07	.	12.585	0.56412	0.0:0.9169:0.0:0.0831	.	950	O75161	NPHP4_HUMAN	Q	950	ENSP00000367398:R950Q	ENSP00000367398:R950Q	R	-	2	0	NPHP4	5857716	0.264000	0.24093	0.803000	0.32268	0.590000	0.36582	2.098000	0.41757	2.272000	0.75746	0.550000	0.68814	CGG		0.657	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2			12	10	0	0	0	0.001855	0	12	10				
TNFRSF9	3604	broad.mit.edu	37	1	7997783	7997783	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:7997783T>C	ENST00000377507.3	-	5	546	c.380A>G	c.(379-381)gAt>gGt	p.D127G		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	127					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		ACGTTTCTGATCGTTAAATGT	0.328																																							uc001aot.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						c.(379-381)GAT>GGT		tumor necrosis factor receptor superfamily,							117.0	109.0	112.0					1																	7997783		2203	4300	6503	SO:0001583	missense	3604				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity	g.chr1:7997783T>C	L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.380A>G	1.37:g.7997783T>C	ENSP00000366729:p.Asp127Gly		Somatic					p.D127G	NM_001561	NP_001552	WXS	Illumina HiSeq	Unspecified	Q07011	TNR9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)	5	508	-	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	127			Extracellular (Potential).|TNFR-Cys 4.			Missense_Mutation	SNP	ENST00000377507.3	37	c.380A>G	CCDS92.1	.	.	.	.	.	.	.	.	.	.	T	8.910	0.958508	0.18507	.	.	ENSG00000049249	ENST00000377507	T	0.06608	3.28	5.44	4.32	0.51571	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.128825	0.48286	D	0.000191	T	0.07908	0.0198	M	0.70108	2.13	0.09310	N	0.999999	P	0.36199	0.543	B	0.28385	0.089	T	0.27606	-1.0069	10	0.72032	D	0.01	-9.1579	7.9221	0.29852	0.0:0.094:0.0:0.906	.	127	Q07011	TNR9_HUMAN	G	127	ENSP00000366729:D127G	ENSP00000366729:D127G	D	-	2	0	TNFRSF9	7920370	0.079000	0.21365	0.037000	0.18230	0.242000	0.25591	2.187000	0.42602	0.902000	0.36520	0.397000	0.26171	GAT		0.328	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003622.1			16	36	0	0	0	0.001216	0	16	36				
PRAMEF2	65122	broad.mit.edu	37	1	12920106	12920106	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:12920106G>A	ENST00000240189.2	+	3	933	c.846G>A	c.(844-846)ggG>ggA	p.G282G		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	282					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTCAGTGGGCACCTGGAAC	0.458																																							uc001aum.1		NA																	0					0						c.(844-846)GGG>GGA		PRAME family member 2							80.0	81.0	81.0					1																	12920106		2202	4294	6496	SO:0001819	synonymous_variant	65122							g.chr1:12920106G>A		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.846G>A	1.37:g.12920106G>A			Somatic					p.G282G	NM_023014	NP_075390	WXS	Illumina HiSeq	Unspecified	O60811	PRAM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	933	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	282						Silent	SNP	ENST00000240189.2	37	c.846G>A	CCDS149.1																																																																																				0.458	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014		39	82	0	0	0	0.005524	0	39	82				
AKR7A3	22977	broad.mit.edu	37	1	19609333	19609333	+	Missense_Mutation	SNP	C	C	A	rs528051281		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:19609333C>A	ENST00000361640.4	-	7	1428	c.888G>T	c.(886-888)gaG>gaT	p.E296D		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	296					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCAAGTTCTGCTCCAGCTGCT	0.612																																							uc001bbv.1		NA																	0					0						c.(886-888)GAG>GAT		aldo-keto reductase family 7, member A3							25.0	27.0	27.0					1																	19609333		2197	4276	6473	SO:0001583	missense	22977				cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity	g.chr1:19609333C>A	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.888G>T	1.37:g.19609333C>A	ENSP00000355377:p.Glu296Asp		Somatic					p.E296D	NM_012067	NP_036199	WXS	Illumina HiSeq	Unspecified	O95154	ARK73_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	7	965	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	296			NADP.		Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	ENST00000361640.4	37	c.888G>T	CCDS193.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208926	0.39003	.	.	ENSG00000162482	ENST00000361640	T	0.25085	1.82	3.59	1.32	0.21799	NADP-dependent oxidoreductase domain (3);	0.573781	0.19905	N	0.103428	T	0.25938	0.0632	L	0.57130	1.785	0.29634	N	0.845202	B	0.26041	0.14	B	0.36504	0.226	T	0.23868	-1.0176	10	0.41790	T	0.15	.	5.3165	0.15858	0.0:0.6562:0.1942:0.1496	.	296	O95154	ARK73_HUMAN	D	296	ENSP00000355377:E296D	ENSP00000355377:E296D	E	-	3	2	AKR7A3	19481920	0.998000	0.40836	0.954000	0.39281	0.750000	0.42670	0.450000	0.21762	-0.066000	0.12998	0.205000	0.17691	GAG		0.612	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067		26	10	1	0	9.65963e-10	0.003271	2.08398e-09	26	10				
RAP1GAP	5909	broad.mit.edu	37	1	21928252	21928252	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:21928252C>A	ENST00000374765.4	-	20	1777	c.1577G>T	c.(1576-1578)gGg>gTg	p.G526V	RAP1GAP_ENST00000542643.2_Missense_Mutation_p.G552V|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.G611V|RAP1GAP_ENST00000374761.2_Missense_Mutation_p.G557V|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.G590V	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	526					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		TGAGACGTGCCCGCTGTCTGG	0.667																																							uc001bex.2		NA																	0				breast(2)|ovary(1)	3						c.(1576-1578)GGG>GTG		RAP1 GTPase activating protein isoform c							77.0	70.0	72.0					1																	21928252		2203	4300	6503	SO:0001583	missense	5909				regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding	g.chr1:21928252C>A	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1577G>T	1.37:g.21928252C>A	ENSP00000363897:p.Gly526Val		Somatic				RAP1GAP_uc001bev.2_Missense_Mutation_p.G611V|RAP1GAP_uc001bew.2_Missense_Mutation_p.G590V|RAP1GAP_uc001bey.2_Missense_Mutation_p.G552V	p.G526V	NM_002885	NP_002876	WXS	Illumina HiSeq	Unspecified	P47736	RPGP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)	20	1835	-		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)	526					J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	ENST00000374765.4	37	c.1577G>T	CCDS218.1	.	.	.	.	.	.	.	.	.	.	c	24.5	4.537892	0.85917	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.89485	-2.52;-2.5;-2.5;-2.49	4.72	4.72	0.59763	.	0.522653	0.17423	N	0.174771	D	0.90010	0.6881	M	0.64404	1.975	0.80722	D	1	P;P;B;P	0.48089	0.905;0.483;0.317;0.483	P;B;B;B	0.48189	0.57;0.122;0.124;0.122	D	0.90687	0.4610	10	0.59425	D	0.04	-24.3146	15.211	0.73225	0.0:1.0:0.0:0.0	.	552;526;556;526	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	V	590;557;552;526;556;611	ENSP00000290101:G590V;ENSP00000363893:G557V;ENSP00000441661:G552V;ENSP00000363897:G526V	ENSP00000290101:G590V	G	-	2	0	RAP1GAP	21800839	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.971000	0.76105	2.452000	0.82932	0.556000	0.70494	GGG		0.667	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885		12	16	1	0	9.05144e-12	0.001855	2.04756e-11	12	16				
STPG1	90529	broad.mit.edu	37	1	24687417	24687417	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:24687417G>A	ENST00000374409.1	-	8	1106	c.852C>T	c.(850-852)ttC>ttT	p.F284F	STPG1_ENST00000440416.1_Silent_p.F237F|STPG1_ENST00000468303.1_5'UTR|GRHL3_ENST00000350501.5_Intron|STPG1_ENST00000337248.4_Silent_p.F284F|STPG1_ENST00000003583.8_Silent_p.F237F	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	284					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CACTAGAGATGAAATGCTTGC	0.562																																							uc001bjc.2		NA																	0				ovary(1)|breast(1)	2						c.(850-852)TTC>TTT		RecName: Full=UPF0490 protein C1orf201;							76.0	78.0	77.0					1																	24687417		2203	4300	6503	SO:0001819	synonymous_variant	90529							g.chr1:24687417G>A	BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.852C>T	1.37:g.24687417G>A			Somatic				C1orf201_uc010oej.1_Intron|C1orf201_uc001bja.2_Silent_p.F237F|C1orf201_uc001bjb.2_Silent_p.F192F|C1orf201_uc001bjd.2_Silent_p.F284F|C1orf201_uc001bje.1_Silent_p.F237F	p.F284F			WXS	Illumina HiSeq	Unspecified	Q5TH74	CA201_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.48e-25)|Colorectal(126;7.29e-08)|COAD - Colon adenocarcinoma(152;3.85e-06)|GBM - Glioblastoma multiforme(114;0.000399)|BRCA - Breast invasive adenocarcinoma(304;0.00107)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00393)|READ - Rectum adenocarcinoma(331;0.0672)|Lung(427;0.145)	8	987	-		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0191)|all_lung(284;0.0251)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.056)	284					Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Silent	SNP	ENST00000374409.1	37	c.852C>T	CCDS55581.1																																																																																				0.562	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009172.1	NM_178122		9	85	0	0	0	0.000443	0	9	85				
RPS6KA1	6195	broad.mit.edu	37	1	26887564	26887564	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:26887564C>T	ENST00000374168.2	+	16	1524	c.1370C>T	c.(1369-1371)tCa>tTa	p.S457L	RPS6KA1_ENST00000526792.1_Missense_Mutation_p.S365L|RPS6KA1_ENST00000530003.1_Missense_Mutation_p.S441L|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.S365L|RPS6KA1_ENST00000531382.1_Missense_Mutation_p.S466L|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.S446L	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	457	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		CGGGATCCTTCAGAAGAGATT	0.547																																							uc001bmr.1		NA																	0				lung(1)	1						c.(1369-1371)TCA>TTA		ribosomal protein S6 kinase, 90kDa, polypeptide							84.0	84.0	84.0					1																	26887564		2203	4300	6503	SO:0001583	missense	6195				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr1:26887564C>T	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1370C>T	1.37:g.26887564C>T	ENSP00000363283:p.Ser457Leu		Somatic				RPS6KA1_uc010ofe.1_Missense_Mutation_p.S365L|RPS6KA1_uc010off.1_Missense_Mutation_p.S441L|RPS6KA1_uc001bms.1_Missense_Mutation_p.S466L|RPS6KA1_uc009vsl.1_Missense_Mutation_p.S300L	p.S457L	NM_002953	NP_002944	WXS	Illumina HiSeq	Unspecified	Q15418	KS6A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)	16	1533	+		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	457			Protein kinase 2.		A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	c.1370C>T	CCDS284.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536817	0.85812	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000374164;ENST00000531382;ENST00000403732	T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.124181	0.56097	D	0.000028	T	0.50034	0.1592	N	0.05619	-0.005	0.80722	D	1	B;B;B	0.30326	0.028;0.185;0.276	B;B;B	0.36244	0.055;0.136;0.22	T	0.57124	-0.7865	10	0.87932	D	0	.	18.9343	0.92579	0.0:1.0:0.0:0.0	.	441;466;457	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	L	457;446;365;365;441;135;466;73	ENSP00000363283:S457L;ENSP00000363281:S446L;ENSP00000431651:S365L;ENSP00000363277:S365L;ENSP00000432281:S441L;ENSP00000435412:S466L;ENSP00000383967:S73L	ENSP00000363277:S365L	S	+	2	0	RPS6KA1	26760151	1.000000	0.71417	0.961000	0.40146	0.964000	0.63967	7.709000	0.84645	2.480000	0.83734	0.561000	0.74099	TCA		0.547	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953		8	49	0	0	0	0.004482	0	8	49				
RPS6KA1	6195	broad.mit.edu	37	1	26887581	26887581	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:26887581C>T	ENST00000374168.2	+	16	1541	c.1387C>T	c.(1387-1389)Ctt>Ttt	p.L463F	RPS6KA1_ENST00000526792.1_Missense_Mutation_p.L371F|RPS6KA1_ENST00000530003.1_Missense_Mutation_p.L447F|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.L371F|RPS6KA1_ENST00000531382.1_Missense_Mutation_p.L472F|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.L452F	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	463	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		GATTGAGATTCTTCTGCGGTA	0.522																																							uc001bmr.1		NA																	0				lung(1)	1						c.(1387-1389)CTT>TTT		ribosomal protein S6 kinase, 90kDa, polypeptide							82.0	82.0	82.0					1																	26887581		2203	4300	6503	SO:0001583	missense	6195				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr1:26887581C>T	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1387C>T	1.37:g.26887581C>T	ENSP00000363283:p.Leu463Phe		Somatic				RPS6KA1_uc010ofe.1_Missense_Mutation_p.L371F|RPS6KA1_uc010off.1_Missense_Mutation_p.L447F|RPS6KA1_uc001bms.1_Missense_Mutation_p.L472F|RPS6KA1_uc009vsl.1_Missense_Mutation_p.L306F	p.L463F	NM_002953	NP_002944	WXS	Illumina HiSeq	Unspecified	Q15418	KS6A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)	16	1550	+		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	463			Protein kinase 2.		A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	c.1387C>T	CCDS284.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645537	0.87859	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000374164;ENST00000531382;ENST00000403732	T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;1.31	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67562	0.2906	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.997	T	0.69967	-0.5001	10	0.87932	D	0	.	12.2994	0.54866	0.0:0.9226:0.0:0.0774	.	447;472;463	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	F	463;452;371;371;447;141;472;79	ENSP00000363283:L463F;ENSP00000363281:L452F;ENSP00000431651:L371F;ENSP00000363277:L371F;ENSP00000432281:L447F;ENSP00000435412:L472F;ENSP00000383967:L79F	ENSP00000363277:L371F	L	+	1	0	RPS6KA1	26760168	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.091000	0.71406	2.480000	0.83734	0.561000	0.74099	CTT		0.522	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953		10	48	0	0	0	0.000443	0	10	48				
ARID1A	8289	broad.mit.edu	37	1	27105682	27105682	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:27105682G>T	ENST00000324856.7	+	20	5664	c.5293G>T	c.(5293-5295)Gaa>Taa	p.E1765*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.E1548*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.E93*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1382*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1765					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGGGGAAGAAGAAGAAGAACT	0.493			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		0				ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(5293-5295)GAA>TAA		AT rich interactive domain 1A isoform a							67.0	69.0	68.0					1																	27105682		2203	4300	6503	SO:0001587	stop_gained	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27105682G>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5293G>T	1.37:g.27105682G>T	ENSP00000320485:p.Glu1765*		Somatic				ARID1A_uc001bmu.1_Nonsense_Mutation_p.E1548*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.E611*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.E93*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.E7*	p.E1765*	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	5666	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	1765					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	c.5293G>T	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.699813|8.699813	0.98920|0.98920	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	4.0|4.0	4.0|4.0	0.46444|0.46444	.|.	0.669254|.	0.15991|.	N|.	0.234840|.	.|T	.|0.71350	.|0.3329	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71774	.|-0.4491	.|4	0.22109|.	T|.	0.4|.	-1.7733|-1.7733	16.2684|16.2684	0.82601|0.82601	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1765;1548;1382;93|661	.|.	ENSP00000320485:E1765X|.	E|R	+|+	1|2	0|0	ARID1A|ARID1A	26978269|26978269	0.999000|0.999000	0.42202|0.42202	0.994000|0.994000	0.49952|0.49952	0.987000|0.987000	0.75469|0.75469	3.390000|3.390000	0.52523|0.52523	2.234000|2.234000	0.73211|0.73211	0.591000|0.591000	0.81541|0.81541	GAA|AGA		0.493	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		21	56	1	0	1.50039e-11	0.001882	3.38314e-11	21	56				
CSF3R	1441	broad.mit.edu	37	1	36934859	36934859	+	Splice_Site	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:36934859C>T	ENST00000373106.1	-	12	2022		c.e12-1		CSF3R_ENST00000373104.1_Splice_Site|CSF3R_ENST00000373103.1_Splice_Site|CSF3R_ENST00000331941.5_Splice_Site|CSF3R_ENST00000487540.2_Splice_Site|CSF3R_ENST00000418048.2_Splice_Site|CSF3R_ENST00000440588.2_Splice_Site|CSF3R_ENST00000361632.4_Splice_Site|CSF3R_ENST00000338937.5_Splice_Site	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)						cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CTGATGTTCTCTGTAGAGAGA	0.507																																							uc001caw.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.e12-1		colony stimulating factor 3 receptor isoform a	Filgrastim(DB00099)|Pegfilgrastim(DB00019)						99.0	93.0	95.0					1																	36934859		2203	4300	6503	SO:0001630	splice_region_variant	1441				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity	g.chr1:36934859C>T	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1475-1G>A	1.37:g.36934859C>T			Somatic				CSF3R_uc001cat.1_Splice_Site_p.E55_splice|CSF3R_uc009vvc.1_Intron|CSF3R_uc001cau.1_Splice_Site|CSF3R_uc001cav.1_Splice_Site_p.E492_splice|CSF3R_uc001cax.1_Splice_Site_p.E492_splice|CSF3R_uc001cay.1_Splice_Site_p.E492_splice	p.E492_splice	NM_000760	NP_000751	WXS	Illumina HiSeq	Unspecified	Q99062	CSF3R_HUMAN			12	1653	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)							Splice_Site	SNP	ENST00000373106.1	37	c.1475_splice	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607301	0.66558	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5129	0.84290	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSF3R	36707446	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	4.370000	0.59517	2.582000	0.87167	0.462000	0.41574	.		0.507	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	Intron	18	20	0	0	0	0.001882	0	18	20				
MACF1	23499	broad.mit.edu	37	1	39782166	39782166	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:39782166C>T	ENST00000372915.3	+	27	3655	c.3568C>T	c.(3568-3570)Ctc>Ttc	p.L1190F	MACF1_ENST00000564288.1_Missense_Mutation_p.L1185F|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000317713.7_Missense_Mutation_p.L1190F|MACF1_ENST00000539005.1_Missense_Mutation_p.L1190F|MACF1_ENST00000545844.1_Missense_Mutation_p.L1190F|MACF1_ENST00000567887.1_Missense_Mutation_p.L1222F|MACF1_ENST00000361689.2_Missense_Mutation_p.L1190F			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1190					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACTGGCAGATCTCTCAGCTCT	0.433																																							uc010ois.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(3568-3570)CTC>TTC		microfilament and actin filament cross-linker							173.0	168.0	170.0					1																	39782166		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39782166C>T	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.3568C>T	1.37:g.39782166C>T	ENSP00000362006:p.Leu1190Phe		Somatic				MACF1_uc001cda.1_Missense_Mutation_p.L1098F|MACF1_uc001cdc.1_Missense_Mutation_p.L277F|MACF1_uc009vvq.1_Missense_Mutation_p.L247F|MACF1_uc001cdb.1_Missense_Mutation_p.L277F	p.L1190F	NM_012090	NP_036222	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		29	3773	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	1190			LRR 7.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.3568C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.213812|4.213812	0.79352|0.79352	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262|ENST00000372925	T;T;T;T;T;T;T|.	0.80824|.	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42|.	6.06|6.06	5.13|5.13	0.70059|0.70059	.|.	.|.	.|.	.|.	.|.	T|T	0.63885|0.63885	0.2549|0.2549	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	P;D;D|.	0.71674|.	0.792;0.998;0.989|.	P;D;P|.	0.65443|.	0.491;0.935;0.831|.	T|T	0.62695|0.62695	-0.6800|-0.6800	9|5	0.52906|.	T|.	0.07|.	.|.	12.1408|12.1408	0.53996|0.53996	0.1358:0.7338:0.1305:0.0|0.1358:0.7338:0.1305:0.0	.|.	1190;1190;1155|.	F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	.;.;.|.	F|F	1190;1190;1190;1190;1190;1148;1339|323	ENSP00000439537:L1190F;ENSP00000362006:L1190F;ENSP00000354573:L1190F;ENSP00000313438:L1190F;ENSP00000444364:L1190F;ENSP00000435070:L1148F;ENSP00000437059:L1339F|.	ENSP00000313438:L1190F|.	L|S	+|+	1|2	0|0	MACF1|MACF1	39554753|39554753	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.986000|1.986000	0.40677|0.40677	1.542000|1.542000	0.49330|0.49330	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.433	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		40	71	0	0	0	0.002852	0	40	71				
MACF1	23499	broad.mit.edu	37	1	39919444	39919444	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:39919444C>T	ENST00000372915.3	+	87	20592	c.20505C>T	c.(20503-20505)gtC>gtT	p.V6835V	MACF1_ENST00000564288.1_Silent_p.V6936V|MACF1_ENST00000317713.7_Silent_p.V4877V|MACF1_ENST00000539005.1_Silent_p.V4747V|MACF1_ENST00000545844.1_Silent_p.V4877V|MACF1_ENST00000567887.1_Silent_p.V6973V|MACF1_ENST00000361689.2_Silent_p.V4877V|MACF1_ENST00000289893.4_Silent_p.V5379V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6835					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGGGAGAAGTCATCCTGGCTG	0.458																																							uc010oiu.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(16135-16137)GTC>GTT		microfilament and actin filament cross-linker							235.0	221.0	226.0					1																	39919444		2203	4300	6503	SO:0001819	synonymous_variant	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39919444C>T	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.20505C>T	1.37:g.39919444C>T			Somatic				MACF1_uc010ois.1_Silent_p.V4877V	p.V5379V	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		53	16268	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	6835			Spectrin 17.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37	c.16137C>T		.	.	.	.	.	.	.	.	.	.	c	8.929	0.962966	0.18583	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.71	0.0539	0.14308	.	.	.	.	.	T	0.50820	0.1638	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37267	-0.9713	4	.	.	.	.	5.3539	0.16050	0.2348:0.358:0.3427:0.0646	.	.	.	.	Y	3881	.	.	H	+	1	0	MACF1	39692031	0.015000	0.18098	0.995000	0.50966	0.866000	0.49608	-0.301000	0.08232	0.038000	0.15604	-1.123000	0.02005	CAT		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		10	158	0	0	0	0.000443	0	10	158				
CCDC30	728621	broad.mit.edu	37	1	43042823	43042823	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:43042823C>A	ENST00000340612.4	+	6	988	c.988C>A	c.(988-990)Cag>Aag	p.Q330K	CCDC30_ENST00000428554.2_Missense_Mutation_p.Q330K|CCDC30_ENST00000507855.1_Missense_Mutation_p.Q119K|CCDC30_ENST00000390640.4_Missense_Mutation_p.Q119K|CCDC30_ENST00000342022.4_Missense_Mutation_p.Q330K			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	330						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TAAACACACTCAGAGCATTAA	0.403																																							uc009vwk.1		NA																	0					0						c.(988-990)CAG>AAG		coiled-coil domain containing 30							79.0	76.0	77.0					1																	43042823		2203	4300	6503	SO:0001583	missense	728621							g.chr1:43042823C>A	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.988C>A	1.37:g.43042823C>A	ENSP00000340378:p.Gln330Lys		Somatic				CCDC30_uc001chm.2_Missense_Mutation_p.Q28K|CCDC30_uc001chn.2_Missense_Mutation_p.Q119K|CCDC30_uc010oju.1_RNA|CCDC30_uc001chp.2_Missense_Mutation_p.Q144K	p.Q330K	NM_001080850	NP_001074319	WXS	Illumina HiSeq	Unspecified	Q5VVM6	CCD30_HUMAN			7	1098	+			330			Potential.		Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	c.988C>A	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.197735	0.38806	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.88	0.359	0.16088	.	0.598474	0.18355	N	0.143764	T	0.39332	0.1074	L	0.58669	1.825	0.30955	N	0.724333	B;B;B	0.33940	0.211;0.084;0.433	B;B;B	0.30029	0.066;0.025;0.11	T	0.43130	-0.9410	10	0.23302	T	0.38	.	13.3239	0.60449	0.0988:0.4524:0.4488:0.0	.	330;114;119	Q5VVM6;Q6N081;Q5VVM6-2	CCD30_HUMAN;.;.	K	330;119;330;330;119	ENSP00000397035:Q330K;ENSP00000426711:Q119K;ENSP00000340378:Q330K;ENSP00000339280:Q330K;ENSP00000375051:Q119K	ENSP00000340378:Q330K	Q	+	1	0	CCDC30	42815410	0.192000	0.23301	0.998000	0.56505	0.993000	0.82548	0.274000	0.18680	0.356000	0.24157	0.655000	0.94253	CAG		0.403	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030		4	32	1	0	0.000602214	0.000602	0.00115328	4	32				
LRP8	7804	broad.mit.edu	37	1	53746285	53746285	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:53746285C>T	ENST00000306052.6	-	4	571	c.470G>A	c.(469-471)gGa>gAa	p.G157E	LRP8_ENST00000465675.1_5'UTR|LRP8_ENST00000371454.2_Missense_Mutation_p.G157E|LRP8_ENST00000347547.2_Missense_Mutation_p.G157E|LRP8_ENST00000354412.3_Missense_Mutation_p.G157E	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	157	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CTCATCCGCTCCACCCTCGCA	0.632																																							uc001cvi.1		NA																	0					0						c.(469-471)GGA>GAA		low density lipoprotein receptor-related protein							111.0	81.0	91.0					1																	53746285		2203	4300	6503	SO:0001583	missense	7804				cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity	g.chr1:53746285C>T	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.470G>A	1.37:g.53746285C>T	ENSP00000303634:p.Gly157Glu		Somatic				LRP8_uc001cvh.1_5'UTR|LRP8_uc001cvk.1_Missense_Mutation_p.G157E|LRP8_uc001cvj.1_Missense_Mutation_p.G157E|LRP8_uc001cvl.1_Missense_Mutation_p.G157E	p.G157E	NM_004631	NP_004622	WXS	Illumina HiSeq	Unspecified	Q14114	LRP8_HUMAN			4	612	-			157			LDL-receptor class A 3.|Extracellular (Potential).		B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	c.470G>A	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126575	0.77549	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547	D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03	4.26	4.26	0.50523	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	.	.	.	.	D	0.97636	0.9225	M	0.71920	2.185	0.42957	D	0.994393	P;P;D;P	0.69078	0.716;0.713;0.997;0.888	P;P;D;P	0.76575	0.487;0.521;0.988;0.649	D	0.98258	1.0497	9	0.62326	D	0.03	.	15.9821	0.80116	0.0:1.0:0.0:0.0	.	157;157;157;157	Q14114-2;Q14114-4;Q14114-3;Q14114	.;.;.;LRP8_HUMAN	E	157	ENSP00000303634:G157E;ENSP00000360509:G157E;ENSP00000346391:G157E;ENSP00000334522:G157E	ENSP00000303634:G157E	G	-	2	0	LRP8	53518873	0.956000	0.32656	0.086000	0.20670	0.968000	0.65278	3.189000	0.50965	2.400000	0.81607	0.561000	0.74099	GGA		0.632	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631		4	38	0	0	0	0.000248	0	4	38				
C8A	731	broad.mit.edu	37	1	57372339	57372339	+	Splice_Site	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:57372339G>T	ENST00000361249.3	+	8	1192		c.e8-1			NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						CCCTGTTGCAGGTATTACCAG	0.403																																							uc001cyo.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.e8-1		complement component 8, alpha polypeptide							139.0	137.0	138.0					1																	57372339		2203	4300	6503	SO:0001630	splice_region_variant	731				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex		g.chr1:57372339G>T	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1097-1G>T	1.37:g.57372339G>T			Somatic					p.G366_splice	NM_000562	NP_000553	WXS	Illumina HiSeq	Unspecified	P07357	CO8A_HUMAN			8	1229	+								A2RUI4|A2RUI5|Q13668|Q9H130	Splice_Site	SNP	ENST00000361249.3	37	c.1097_splice	CCDS606.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.125972	0.37533	.	.	ENSG00000157131	ENST00000361249	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2219	0.73316	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8A	57144927	0.991000	0.36638	0.272000	0.24630	0.082000	0.17680	4.682000	0.61671	2.711000	0.92665	0.561000	0.74099	.		0.403	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	Intron	34	53	1	0	5.8336e-16	0.003271	1.38227e-15	34	53				
DEPDC1	55635	broad.mit.edu	37	1	68948046	68948046	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:68948046C>A	ENST00000456315.2	-	8	1559	c.1445G>T	c.(1444-1446)gGt>gTt	p.G482V	RP4-694A7.2_ENST00000425820.1_RNA|DEPDC1_ENST00000370966.5_Intron	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	482					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		TCTCTTAAAACCAGCACTGAA	0.368																																							uc001dem.3		NA																	0					0						c.(1444-1446)GGT>GTT		DEP domain containing 1 isoform a							51.0	47.0	49.0					1																	68948046		1568	3582	5150	SO:0001583	missense	55635				intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding	g.chr1:68948046C>A	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1445G>T	1.37:g.68948046C>A	ENSP00000412292:p.Gly482Val		Somatic				DEPDC1_uc001dej.3_5'Flank|DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	p.G482V	NM_001114120	NP_001107592	WXS	Illumina HiSeq	Unspecified	Q5TB30	DEP1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)	8	1562	-			482					A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Missense_Mutation	SNP	ENST00000456315.2	37	c.1445G>T	CCDS44159.1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.280242	0.23392	.	.	ENSG00000024526	ENST00000456315	T	0.10288	2.89	5.61	3.74	0.42951	Rho GTPase activation protein (1);	0.392655	0.29178	N	0.012908	T	0.03651	0.0104	L	0.29908	0.895	0.80722	D	1	P	0.46395	0.877	B	0.41860	0.368	T	0.49370	-0.8947	10	0.34782	T	0.22	-6.1706	10.6806	0.45813	0.1326:0.7992:0.0:0.0682	.	482	Q5TB30	DEP1A_HUMAN	V	482	ENSP00000412292:G482V	ENSP00000412292:G482V	G	-	2	0	DEPDC1	68720634	0.957000	0.32711	0.997000	0.53966	0.603000	0.37013	0.403000	0.20982	0.729000	0.32403	0.650000	0.86243	GGT		0.368	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779		24	34	1	0	6.44725e-10	0.002299	1.39957e-09	24	34				
PTBP2	58155	broad.mit.edu	37	1	97270362	97270362	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:97270362C>T	ENST00000426398.2	+	9	954	c.911C>T	c.(910-912)cCa>cTa	p.P304L	PTBP2_ENST00000609116.1_Missense_Mutation_p.P304L|PTBP2_ENST00000370198.1_Missense_Mutation_p.P309L|PTBP2_ENST00000370197.1_Missense_Mutation_p.P309L|PTBP2_ENST00000541987.1_Missense_Mutation_p.P273L|PTBP2_ENST00000394184.3_Missense_Mutation_p.P320L|PTBP2_ENST00000482253.1_3'UTR	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	304					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GCAGCTGTTCCAGGAGCTCTG	0.483																																							uc001drq.2		NA																	0					0						c.(910-912)CCA>CTA		polypyrimidine tract binding protein 2							65.0	70.0	68.0					1																	97270362		2203	4300	6503	SO:0001583	missense	58155						nucleotide binding	g.chr1:97270362C>T	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.911C>T	1.37:g.97270362C>T	ENSP00000412788:p.Pro304Leu		Somatic				PTBP2_uc001drn.2_Missense_Mutation_p.P309L|PTBP2_uc001dro.2_Missense_Mutation_p.P304L|PTBP2_uc010otz.1_Missense_Mutation_p.P320L|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.P252L|PTBP2_uc001drr.2_Missense_Mutation_p.P309L|PTBP2_uc010oua.1_Missense_Mutation_p.P312L|PTBP2_uc001dru.2_RNA|PTBP2_uc001drs.1_5'UTR|PTBP2_uc001drt.2_5'UTR	p.P304L	NM_021190	NP_067013	WXS	Illumina HiSeq	Unspecified	Q9UKA9	PTBP2_HUMAN		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)	9	1157	+		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)	304					Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	c.911C>T	CCDS754.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.330653	0.41297	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	T;T;T;T;T;T	0.79247	0.77;0.78;0.78;0.76;0.77;-1.25	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.77870	0.4195	N	0.21508	0.67	0.80722	D	1	D;B;B;D;P;P	0.89917	0.957;0.0;0.0;1.0;0.721;0.837	P;B;B;D;B;P	0.74674	0.558;0.0;0.001;0.984;0.26;0.617	T	0.81342	-0.0976	10	0.59425	D	0.04	-3.5373	18.8148	0.92073	0.0:1.0:0.0:0.0	.	312;320;309;304;304;309	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;PTBP2_HUMAN;.;.	L	304;309;309;304;320;273;299	ENSP00000236228:P304L;ENSP00000359217:P309L;ENSP00000359216:P309L;ENSP00000412788:P304L;ENSP00000377738:P320L;ENSP00000442475:P273L	ENSP00000236228:P304L	P	+	2	0	PTBP2	97042950	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.153000	0.77428	2.448000	0.82819	0.591000	0.81541	CCA		0.483	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1			4	51	0	0	0	0.000602	0	4	51				
COL11A1	1301	broad.mit.edu	37	1	103471864	103471864	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:103471864C>T	ENST00000370096.3	-	16	2003	c.1691G>A	c.(1690-1692)cGa>cAa	p.R564Q	COL11A1_ENST00000353414.4_Missense_Mutation_p.R525Q|COL11A1_ENST00000358392.2_Missense_Mutation_p.R576Q|COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000512756.1_Missense_Mutation_p.R448Q	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	564	Collagen-like 2.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGGACGCCTCGAGGGCCCTA	0.398																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(1690-1692)CGA>CAA		alpha 1 type XI collagen isoform A							46.0	53.0	50.0					1																	103471864		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103471864C>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1691G>A	1.37:g.103471864C>T	ENSP00000359114:p.Arg564Gln		Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.R576Q|COL11A1_uc001dun.2_Missense_Mutation_p.R525Q|COL11A1_uc009weh.2_Missense_Mutation_p.R448Q	p.R564Q	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	16	2009	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	564			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.1691G>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125768	0.77436	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.25	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.94095	0.8107	L	0.37630	1.12	0.58432	D	0.999999	D;D;D;D	0.71674	0.982;0.978;0.997;0.998	P;P;P;P	0.58172	0.59;0.455;0.744;0.834	D	0.94797	0.7967	10	0.72032	D	0.01	.	18.9909	0.92791	0.0:1.0:0.0:0.0	.	448;525;576;564	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	Q	564;576;525;448	ENSP00000359114:R564Q;ENSP00000351163:R576Q;ENSP00000302551:R525Q;ENSP00000426533:R448Q	ENSP00000302551:R525Q	R	-	2	0	COL11A1	103244452	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.900000	0.75687	2.484000	0.83849	0.563000	0.77884	CGA		0.398	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		5	45	0	0	0	0.000602	0	5	45				
AMPD1	270	broad.mit.edu	37	1	115218551	115218551	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:115218551C>G	ENST00000520113.2	-	11	1576	c.1561G>C	c.(1561-1563)Gag>Cag	p.E521Q	AMPD1_ENST00000369538.3_Missense_Mutation_p.E517Q|AMPD1_ENST00000353928.6_Missense_Mutation_p.E488Q			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	521					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	ATGGTGGCCTCAAACACTGGC	0.463																																							uc001efe.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(1462-1464)GAG>CAG		adenosine monophosphate deaminase 1 (isoform M)	Adenosine monophosphate(DB00131)						149.0	148.0	148.0					1																	115218551		2203	4300	6503	SO:0001583	missense	270				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:115218551C>G	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1561G>C	1.37:g.115218551C>G	ENSP00000430075:p.Glu521Gln		Somatic				AMPD1_uc001eff.1_Missense_Mutation_p.E484Q	p.E488Q	NM_000036	NP_000027	WXS	Illumina HiSeq	Unspecified	P23109	AMPD1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	11	1546	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	488					A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	c.1462G>C	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448731	0.43531	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.84442	-1.85;-1.85;-1.85	5.58	5.58	0.84498	Adenosine/AMP deaminase (1);	0.139892	0.64402	D	0.000004	T	0.81192	0.4771	M	0.78456	2.415	0.54753	D	0.999987	B;B	0.24186	0.08;0.099	B;B	0.23419	0.015;0.046	T	0.80046	-0.1546	10	0.49607	T	0.09	-24.0057	15.8911	0.79299	0.0:0.8646:0.1354:0.0	.	517;488	Q5TF02;P23109	.;AMPD1_HUMAN	Q	521;517;488	ENSP00000430075:E521Q;ENSP00000358551:E517Q;ENSP00000316520:E488Q	ENSP00000316520:E488Q	E	-	1	0	AMPD1	115020074	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.645000	0.46621	2.626000	0.88956	0.561000	0.74099	GAG		0.463	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4			7	97	0	0	0	0.001984	0	7	97				
IGSF3	3321	broad.mit.edu	37	1	117150605	117150605	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:117150605C>A	ENST00000369486.3	-	5	1946	c.1181G>T	c.(1180-1182)aGc>aTc	p.S394I	IGSF3_ENST00000369483.1_Missense_Mutation_p.S394I|IGSF3_ENST00000318837.6_Missense_Mutation_p.S394I	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	394					lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGGACGCTTGCTCTCCTTATC	0.507																																							uc001egr.1		NA																	0				ovary(2)	2						c.(1180-1182)AGC>ATC		immunoglobulin superfamily, member 3 isoform 2							102.0	108.0	106.0					1																	117150605		2203	4300	6503	SO:0001583	missense	3321					integral to membrane		g.chr1:117150605C>A	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1181G>T	1.37:g.117150605C>A	ENSP00000358498:p.Ser394Ile		Somatic				IGSF3_uc001egq.1_Missense_Mutation_p.S394I|IGSF3_uc001egs.1_Missense_Mutation_p.S67I	p.S394I	NM_001007237	NP_001007238	WXS	Illumina HiSeq	Unspecified	O75054	IGSF3_HUMAN		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)	5	1886	-	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)	394			Extracellular (Potential).		A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	c.1181G>T	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219721	0.79464	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03330	3.97;3.97;3.97	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.298435	0.40469	N	0.001092	T	0.05410	0.0143	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.967;1.0;0.973	P;D;P	0.91635	0.756;0.999;0.843	T	0.50841	-0.8780	10	0.66056	D	0.02	-43.2094	15.4322	0.75108	0.0:1.0:0.0:0.0	.	394;394;394	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	I	394	ENSP00000358498:S394I;ENSP00000358495:S394I;ENSP00000321184:S394I	ENSP00000321184:S394I	S	-	2	0	IGSF3	116952128	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.965000	0.76067	2.571000	0.86741	0.557000	0.71058	AGC		0.507	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		6	127	1	0	0.00307968	0.00308	0.00574052	6	127				
NBPF15	284565	broad.mit.edu	37	1	148594619	148594619	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:148594619G>T	ENST00000369187.3	+	19	2481	c.1992G>T	c.(1990-1992)atG>atT	p.M664I	NBPF15_ENST00000442702.2_Missense_Mutation_p.M664I	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	664	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					TGTTCCAGATGGGAGTCATAT	0.443																																							uc001esc.2		NA																	0					0						c.(1990-1992)ATG>ATT		hypothetical protein LOC284565							23.0	30.0	28.0					1																	148594619		1912	4140	6052	SO:0001583	missense	284565					cytoplasm		g.chr1:148594619G>T	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1992G>T	1.37:g.148594619G>T	ENSP00000358188:p.Met664Ile		Somatic					p.M664I	NM_173638	NP_775909	WXS	Illumina HiSeq	Unspecified	Q8N660	NBPFF_HUMAN			19	2481	+	all_hematologic(923;0.032)		664			NBPF 6.		Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	c.1992G>T	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	0.106	-1.145689	0.01714	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.02395	4.31;4.31	.	.	.	DUF1220 (1);	.	.	.	.	T	0.00695	0.0023	L	0.31207	0.915	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.45833	-0.9234	7	0.56958	D	0.05	.	.	.	.	.	664	Q8N660	NBPFF_HUMAN	I	664	ENSP00000416864:M664I;ENSP00000358188:M664I	ENSP00000358188:M664I	M	+	3	0	NBPF15	146861243	0.025000	0.19082	0.004000	0.12327	0.007000	0.05969	-0.044000	0.12023	-0.575000	0.05982	-0.561000	0.04177	ATG		0.443	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638		55	125	1	0	1.16018e-38	0.00361	3.01475e-38	55	125				
PI4KB	5298	broad.mit.edu	37	1	151288555	151288555	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:151288555C>G	ENST00000368873.1	-	2	571	c.403G>C	c.(403-405)Gag>Cag	p.E135Q	PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000271657.5_Missense_Mutation_p.E147Q|PI4KB_ENST00000368875.2_Missense_Mutation_p.E147Q|PI4KB_ENST00000368874.4_Missense_Mutation_p.E135Q|PI4KB_ENST00000368872.1_Missense_Mutation_p.E135Q			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	135	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGTTTTGACTCAAACAGCCTC	0.522																																					Colon(154;765 1838 9854 28443 37492)	Colon(154;765 1838 9854 28443 37492)	uc001ext.2		NA																	0				ovary(2)|skin(2)	4						c.(403-405)GAG>CAG		catalytic phosphatidylinositol 4-kinase beta							78.0	76.0	77.0					1																	151288555		2203	4300	6503	SO:0001583	missense	5298				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr1:151288555C>G	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.403G>C	1.37:g.151288555C>G	ENSP00000357867:p.Glu135Gln		Somatic				PI4KB_uc001exr.2_Missense_Mutation_p.E147Q|PI4KB_uc001exs.2_Missense_Mutation_p.E135Q|PI4KB_uc001exu.2_Missense_Mutation_p.E135Q|PI4KB_uc010pcw.1_Intron|PI4KB_uc009wmq.1_Missense_Mutation_p.E147Q	p.E135Q	NM_002651	NP_002642	WXS	Illumina HiSeq	Unspecified	Q9UBF8	PI4KB_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		2	818	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		135					B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37	c.403G>C		.	.	.	.	.	.	.	.	.	.	C	24.9	4.586562	0.86851	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872;ENST00000438243	T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.991;0.991;0.998	T	0.52132	-0.8616	10	0.51188	T	0.08	-5.667	18.0325	0.89289	0.0:1.0:0.0:0.0	.	135;135;135	E9PIH4;Q9UBF8;Q9UBF8-2	.;PI4KB_HUMAN;.	Q	135;147;147;135;135;135	ENSP00000357868:E135Q;ENSP00000357869:E147Q;ENSP00000271657:E147Q;ENSP00000357867:E135Q;ENSP00000357866:E135Q;ENSP00000394719:E135Q	ENSP00000271657:E147Q	E	-	1	0	PI4KB	149555179	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.567000	0.82357	2.843000	0.97960	0.650000	0.86243	GAG		0.522	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651		4	98	0	0	0	0.000248	0	4	98				
TCHH	7062	broad.mit.edu	37	1	152083562	152083562	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:152083562C>T	ENST00000368804.1	-	2	2130	c.2131G>A	c.(2131-2133)Gag>Aag	p.E711K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	711					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGTCGGCCTCGCTTTCTAGC	0.652																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(2131-2133)GAG>AAG		trichohyalin							64.0	76.0	72.0					1																	152083562		2018	4182	6200	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152083562C>T	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2131G>A	1.37:g.152083562C>T	ENSP00000357794:p.Glu711Lys		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.E711K	p.E711K	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	2131	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		711					Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.2131G>A	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	14.60	2.584713	0.46110	.	.	ENSG00000159450	ENST00000368804	T	0.11821	2.74	5.32	4.4	0.53042	.	.	.	.	.	T	0.07548	0.0190	L	0.27053	0.805	0.09310	N	1	D	0.76494	0.999	P	0.60415	0.874	T	0.07347	-1.0777	9	0.07482	T	0.82	-4.5816	11.0057	0.47633	0.0:0.9098:0.0:0.0902	.	711	Q07283	TRHY_HUMAN	K	711	ENSP00000357794:E711K	ENSP00000357794:E711K	E	-	1	0	TCHH	150350186	0.000000	0.05858	0.261000	0.24466	0.285000	0.27093	-0.137000	0.10389	2.502000	0.84385	0.457000	0.33378	GAG		0.652	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		24	209	0	0	0	0.00333	0	24	209				
FLG	2312	broad.mit.edu	37	1	152281732	152281732	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:152281732C>A	ENST00000368799.1	-	3	5665	c.5630G>T	c.(5629-5631)gGc>gTc	p.G1877V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1877	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGCCTGGAGCCGTCTCCTGA	0.582									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(5629-5631)GGC>GTC		filaggrin							298.0	298.0	298.0					1																	152281732		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152281732C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5630G>T	1.37:g.152281732C>A	ENSP00000357789:p.Gly1877Val		Somatic					p.G1877V	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5666	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1877			Ser-rich.|Filaggrin 11.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.5630G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	8.003	0.755794	0.15846	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01705	4.68	2.54	1.56	0.23342	.	.	.	.	.	T	0.03348	0.0097	M	0.79123	2.44	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34925	-0.9809	9	0.62326	D	0.03	-2.5665	6.4069	0.21670	0.2925:0.7075:0.0:0.0	.	1877	P20930	FILA_HUMAN	V	1877;112	ENSP00000357789:G1877V	ENSP00000271820:G112V	G	-	2	0	FLG	150548356	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.601000	0.02081	0.362000	0.24319	-0.302000	0.09304	GGC		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		136	367	1	0	1.56226e-53	0.00361	4.07471e-53	136	367				
OR10Z1	128368	broad.mit.edu	37	1	158576487	158576487	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:158576487G>T	ENST00000361284.1	+	1	259	c.259G>T	c.(259-261)Ggg>Tgg	p.G87W		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TGGCCTGGCTGGGGGGGACCA	0.552																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(259-261)GGG>TGG		olfactory receptor, family 10, subfamily Z,							183.0	191.0	188.0					1																	158576487		2203	4300	6503	SO:0001583	missense	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158576487G>T	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.259G>T	1.37:g.158576487G>T	ENSP00000354707:p.Gly87Trp		Somatic					p.G87W	NM_001004478	NP_001004478	WXS	Illumina HiSeq	Unspecified	Q8NGY1	O10Z1_HUMAN			1	259	+	all_hematologic(112;0.0378)		87			Extracellular (Potential).		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	37	c.259G>T	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	G	3.216	-0.160560	0.06502	.	.	ENSG00000198967	ENST00000361284	T	0.00408	7.54	5.36	-10.1	0.00402	GPCR, rhodopsin-like superfamily (1);	1.046430	0.07556	N	0.916184	T	0.00073	0.0002	L	0.60904	1.88	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.44298	-0.9337	10	0.59425	D	0.04	.	1.0253	0.01526	0.3242:0.2601:0.2453:0.1704	.	87	Q8NGY1	O10Z1_HUMAN	W	87	ENSP00000354707:G87W	ENSP00000354707:G87W	G	+	1	0	OR10Z1	156843111	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.937000	0.00330	-1.840000	0.01184	-1.235000	0.01560	GGG		0.552	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		162	135	1	0	5.70063e-59	0.00361	1.50368e-58	162	135				
SPTA1	6708	broad.mit.edu	37	1	158596715	158596715	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:158596715G>C	ENST00000368147.4	-	41	5927	c.5747C>G	c.(5746-5748)gCa>gGa	p.A1916G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1916					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGCAGCTATTGCCTTAGCCAG	0.458																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(5746-5748)GCA>GGA		spectrin, alpha, erythrocytic 1							173.0	170.0	171.0					1																	158596715		1870	4105	5975	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158596715G>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5747C>G	1.37:g.158596715G>C	ENSP00000357129:p.Ala1916Gly		Somatic					p.A1916G	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			41	5946	-	all_hematologic(112;0.0378)		1916			Spectrin 18.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.5747C>G	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990034	0.74589	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54279	0.58;0.58	5.41	5.41	0.78517	.	0.602234	0.12621	N	0.453017	T	0.58206	0.2106	M	0.68952	2.095	0.45239	D	0.998248	P	0.36438	0.553	P	0.49226	0.603	T	0.52997	-0.8500	10	0.39692	T	0.17	.	17.9494	0.89047	0.0:0.0:1.0:0.0	.	1916	P02549	SPTA1_HUMAN	G	1916;1913	ENSP00000357130:A1916G;ENSP00000357129:A1913G	ENSP00000357129:A1913G	A	-	2	0	SPTA1	156863339	1.000000	0.71417	0.014000	0.15608	0.975000	0.68041	8.970000	0.93415	2.816000	0.96949	0.563000	0.77884	GCA		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		113	86	0	0	0	0.00361	0	113	86				
ACKR1	2532	broad.mit.edu	37	1	159175306	159175306	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:159175306G>A	ENST00000368122.2	+	2	756	c.77G>A	c.(76-78)tGg>tAg	p.W26*	DARC_ENST00000368121.2_Nonsense_Mutation_p.W28*|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Nonsense_Mutation_p.W26*	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		26					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					GAAGATGTATGGAATTCTTCC	0.537																																							uc001fto.2		NA																	0				ovary(1)|lung(1)	2						c.(76-78)TGG>TAG		Duffy blood group antigen isoform b							90.0	88.0	88.0					1																	159175306		2203	4300	6503	SO:0001587	stop_gained	2532				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity	g.chr1:159175306G>A																												ENST00000368122.2:c.77G>A	1.37:g.159175306G>A	ENSP00000357104:p.Trp26*		Somatic				DARC_uc001ftp.3_Nonsense_Mutation_p.W28*	p.W26*	NM_002036	NP_002027	WXS	Illumina HiSeq	Unspecified	Q16570	DUFFY_HUMAN			2	317	+	all_hematologic(112;0.0429)		26			Extracellular (Potential).		A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Nonsense_Mutation	SNP	ENST00000368122.2	37	c.77G>A	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	G	39	7.882606	0.98542	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000435307;ENST00000368121	.	.	.	3.03	1.03	0.20045	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.2506	3.0566	0.06186	0.1508:0.0:0.5804:0.2688	.	.	.	.	X	26;26;26;28;28	.	ENSP00000352341:W26X	W	+	2	0	DARC	157441930	0.262000	0.24073	0.024000	0.17045	0.013000	0.08279	0.448000	0.21726	0.554000	0.29061	0.561000	0.74099	TGG		0.537	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2			39	34	0	0	0	0.001951	0	39	34				
ATP1A4	480	broad.mit.edu	37	1	160134152	160134152	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:160134152A>C	ENST00000368081.4	+	7	1456	c.985A>C	c.(985-987)Atc>Ctc	p.I329L		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	329					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCTGGAGGCTATCATTTTTCT	0.512																																							uc001fve.3		NA																	0				ovary(2)|skin(2)	4						c.(985-987)ATC>CTC		Na+/K+ -ATPase alpha 4 subunit isoform 1							325.0	283.0	297.0					1																	160134152		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160134152A>C	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.985A>C	1.37:g.160134152A>C	ENSP00000357060:p.Ile329Leu		Somatic				ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'Flank	p.I329L	NM_144699	NP_653300	WXS	Illumina HiSeq	Unspecified	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		7	1464	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		329			Helical; (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.985A>C	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.861920	0.51482	.	.	ENSG00000132681	ENST00000368081	D	0.87179	-2.22	4.69	0.718	0.18202	ATPase, P-type, ATPase-associated domain (1);	0.253705	0.37906	N	0.001896	T	0.54711	0.1875	N	0.03177	-0.4	0.80722	D	1	B	0.26363	0.147	B	0.29267	0.1	T	0.52689	-0.8542	10	0.87932	D	0	.	7.1327	0.25510	0.5059:0.0:0.4941:0.0	.	329	Q13733	AT1A4_HUMAN	L	329	ENSP00000357060:I329L	ENSP00000357060:I329L	I	+	1	0	ATP1A4	158400776	0.624000	0.27102	0.996000	0.52242	0.995000	0.86356	0.381000	0.20619	0.040000	0.15660	-0.242000	0.12053	ATC		0.512	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		4	272	0	0	0	0.000602	0	4	272				
CASQ1	844	broad.mit.edu	37	1	160160688	160160688	+	Silent	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:160160688G>C	ENST00000368078.3	+	1	343	c.147G>C	c.(145-147)gtG>gtC	p.V49V	CASQ1_ENST00000368079.3_Silent_p.V43V			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	49					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGACCGTGTGATCAATGTCA	0.542																																							uc010pja.1		NA																	0				central_nervous_system(1)	1						c.(145-147)GTG>GTC		calsequestrin 1							167.0	153.0	158.0					1																	160160688		2203	4300	6503	SO:0001819	synonymous_variant	844					mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding	g.chr1:160160688G>C	S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.147G>C	1.37:g.160160688G>C			Somatic					p.V49V	NM_001231	NP_001222	WXS	Illumina HiSeq	Unspecified	P31415	CASQ1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		1	404	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		49					B1AKZ2|B2R863|Q8TBW7	Silent	SNP	ENST00000368078.3	37	c.147G>C	CCDS1198.2																																																																																				0.542	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231		5	90	0	0	0	0.001168	0	5	90				
ITLN1	55600	broad.mit.edu	37	1	160846509	160846509	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:160846509C>G	ENST00000326245.3	-	8	1002	c.887G>C	c.(886-888)gGt>gCt	p.G296A	ITLN1_ENST00000487531.1_5'Flank	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	296					positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GCTGCTGTAACCAACATGAGT	0.502																																							uc001fxc.2		NA																	0				ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7						c.(886-888)GGT>GCT		intelectin precursor							101.0	95.0	97.0					1																	160846509		2203	4300	6503	SO:0001583	missense	55600				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding	g.chr1:160846509C>G	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.887G>C	1.37:g.160846509C>G	ENSP00000323587:p.Gly296Ala		Somatic					p.G296A	NM_017625	NP_060095	WXS	Illumina HiSeq	Unspecified	Q8WWA0	ITLN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		8	1003	-	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		296					Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	c.887G>C	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	C	0.736	-0.778198	0.02929	.	.	ENSG00000179914	ENST00000326245	T	0.18174	2.23	4.17	0.167	0.15006	.	0.237166	0.26394	U	0.024630	T	0.04588	0.0125	L	0.45581	1.43	0.09310	N	1	B	0.10296	0.003	B	0.15052	0.012	T	0.39440	-0.9614	10	0.34782	T	0.22	.	7.7184	0.28719	0.0:0.6239:0.0:0.3761	.	296	Q8WWA0	ITLN1_HUMAN	A	296	ENSP00000323587:G296A	ENSP00000323587:G296A	G	-	2	0	ITLN1	159113133	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.300000	0.02751	-0.149000	0.11215	-0.150000	0.13652	GGT		0.502	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625		43	35	0	0	0	0.001706	0	43	35				
TNN	63923	broad.mit.edu	37	1	175046636	175046636	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:175046636C>G	ENST00000239462.4	+	2	195	c.82C>G	c.(82-84)Ctg>Gtg	p.L28V		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	28					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCCAGCCACTCTGGAGCCTCC	0.592																																							uc001gkl.1		NA																	0				large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(82-84)CTG>GTG		tenascin N precursor							55.0	52.0	53.0					1																	175046636		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175046636C>G	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.82C>G	1.37:g.175046636C>G	ENSP00000239462:p.Leu28Val		Somatic				TNN_uc010pmx.1_Missense_Mutation_p.L28V	p.L28V	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	2	195	+		Breast(1374;0.000962)	28					B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.82C>G	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	7.406	0.633794	0.14322	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.25579	1.79	5.51	3.26	0.37387	.	1.161920	0.06317	N	0.703764	T	0.19725	0.0474	N	0.22421	0.69	0.09310	N	1	B;B	0.23937	0.049;0.094	B;B	0.24541	0.016;0.054	T	0.31308	-0.9948	10	0.36615	T	0.2	.	8.6891	0.34256	0.0:0.8022:0.0:0.1978	.	28;28	B3KXB6;Q9UQP3	.;TENN_HUMAN	V	28	ENSP00000239462:L28V	ENSP00000239462:L28V	L	+	1	2	TNN	173313259	0.000000	0.05858	0.001000	0.08648	0.321000	0.28281	0.297000	0.19101	0.617000	0.30160	0.655000	0.94253	CTG		0.592	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		9	66	0	0	0	0.004482	0	9	66				
LAX1	54900	broad.mit.edu	37	1	203743051	203743051	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:203743051G>A	ENST00000442561.2	+	5	829	c.439G>A	c.(439-441)Gcc>Acc	p.A147T	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.A131T	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	147					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CCACATCCATGCCACAGAGTA	0.537																																							uc001haa.2		NA																	0				central_nervous_system(2)	2						c.(439-441)GCC>ACC		lymphocyte transmembrane adaptor 1 isoform a							77.0	71.0	73.0					1																	203743051		2203	4300	6503	SO:0001583	missense	54900				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding	g.chr1:203743051G>A	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.439G>A	1.37:g.203743051G>A	ENSP00000406970:p.Ala147Thr		Somatic				LAX1_uc010pql.1_Missense_Mutation_p.A131T|LAX1_uc001hab.2_Missense_Mutation_p.A71T	p.A147T	NM_017773	NP_060243	WXS	Illumina HiSeq	Unspecified	Q8IWV1	LAX1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		5	849	+	all_cancers(21;0.0915)		147			Cytoplasmic (Potential).		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	c.439G>A	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443520	0.25987	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.48	-4.76	0.03229	.	1.320840	0.04774	N	0.428588	T	0.24547	0.0595	L	0.39020	1.185	0.09310	N	1	B;B	0.19331	0.035;0.035	B;B	0.16289	0.015;0.015	T	0.12889	-1.0530	9	0.16420	T	0.52	-1.733	1.5615	0.02596	0.3745:0.23:0.2785:0.117	.	131;147	B7Z744;Q8IWV1	.;LAX1_HUMAN	T	147;131	.	ENSP00000356186:A131T	A	+	1	0	LAX1	202009674	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.421000	0.02455	-0.546000	0.06216	0.655000	0.94253	GCC		0.537	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773		31	65	0	0	0	0.002836	0	31	65				
MIA3	375056	broad.mit.edu	37	1	222805617	222805617	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:222805617C>G	ENST00000344922.5	+	5	3305	c.3280C>G	c.(3280-3282)Cat>Gat	p.H1094D	MIA3_ENST00000344441.6_Missense_Mutation_p.H1094D|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1094					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TGGGGACACTCATGCCTCAGA	0.443																																							uc001hnl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(3280-3282)CAT>GAT		melanoma inhibitory activity family, member 3							120.0	114.0	116.0					1																	222805617		1896	4113	6009	SO:0001583	missense	375056				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:222805617C>G		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3280C>G	1.37:g.222805617C>G	ENSP00000340900:p.His1094Asp		Somatic				MIA3_uc009xea.1_Missense_Mutation_p.H930D	p.H1094D	NM_198551	NP_940953	WXS	Illumina HiSeq	Unspecified	Q5JRA6	MIA3_HUMAN		GBM - Glioblastoma multiforme(131;0.0199)	5	3289	+			1094			Extracellular (Potential).		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	c.3280C>G	CCDS41470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.707|2.707	-0.269608|-0.269608	0.05716|0.05716	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831|ENST00000354906	T;T|.	0.04049|.	3.72;3.72|.	3.81|3.81	-1.88|-1.88	0.07713|0.07713	.|.	.|.	.|.	.|.	.|.	T|.	0.20414|.	0.0491|.	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.0;0.009|.	B;B|.	0.04013|.	0.0;0.001|.	T|.	0.27938|.	-1.0059|.	9|.	0.14252|.	T|.	0.57|.	.|.	4.2798|4.2798	0.10827|0.10827	0.3601:0.3541:0.2858:0.0|0.3601:0.3541:0.2858:0.0	.|.	1094;1094|.	Q5JRA6-2;Q5JRA6|.	.;MIA3_HUMAN|.	D|X	1094|676	ENSP00000340900:H1094D;ENSP00000340587:H1094D|.	ENSP00000325973:H1094D|.	H|S	+|+	1|2	0|0	MIA3|MIA3	220872240|220872240	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.199000|0.199000	0.17237|0.17237	-0.371000|-0.371000	0.08004|0.08004	-0.357000|-0.357000	0.07601|0.07601	CAT|TCA		0.443	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		9	117	0	0	0	0.000978	0	9	117				
HIST3H3	8290	broad.mit.edu	37	1	228612884	228612884	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:228612884G>T	ENST00000366696.1	-	1	142	c.143C>A	c.(142-144)gCg>gAg	p.A48E		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	48					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				CTCGCGAAGCGCCACCGTGCC	0.657																																							uc001hsx.1		NA																	0					0						c.(142-144)GCG>GAG		histone cluster 3, H3							54.0	60.0	58.0					1																	228612884		2203	4300	6503	SO:0001583	missense	8290				nucleosome assembly|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr1:228612884G>T	Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.143C>A	1.37:g.228612884G>T	ENSP00000355657:p.Ala48Glu		Somatic					p.A48E	NM_003493	NP_003484	WXS	Illumina HiSeq	Unspecified	Q16695	H31T_HUMAN			1	143	-		Prostate(94;0.0724)	48					B2R5K3|Q6FGU4	Missense_Mutation	SNP	ENST00000366696.1	37	c.143C>A	CCDS1572.1	.	.	.	.	.	.	.	.	.	.	g	13.57	2.277024	0.40294	.	.	ENSG00000168148	ENST00000366696	T	0.50277	0.75	3.79	3.79	0.43588	Histone-fold (2);	0.000000	0.39407	N	0.001374	T	0.81009	0.4734	H	0.99740	4.74	0.49915	D	0.99983	D	0.76494	0.999	D	0.65773	0.938	D	0.89104	0.3491	10	0.87932	D	0	.	13.9929	0.64378	0.0:0.0:1.0:0.0	.	48	Q16695	H31T_HUMAN	E	48	ENSP00000355657:A48E	ENSP00000355657:A48E	A	-	2	0	HIST3H3	226679507	1.000000	0.71417	0.898000	0.35279	0.008000	0.06430	5.970000	0.70431	2.381000	0.81170	0.645000	0.84053	GCG		0.657	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096595.2	NM_003493		67	64	1	0	2.36135e-34	0.00361	6.06833e-34	67	64				
CAPN9	10753	broad.mit.edu	37	1	230904925	230904925	+	Splice_Site	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:230904925G>C	ENST00000271971.2	+	6	818		c.e6-1		CAPN9_ENST00000354537.1_Splice_Site|CAPN9_ENST00000366666.2_Splice_Site|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9						digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CCATGTTTTAGACCAGAAGTG	0.547																																							uc001htz.1		NA																	0				ovary(1)	1						c.e6-1		calpain 9 isoform 1							160.0	154.0	156.0					1																	230904925		2203	4300	6503	SO:0001630	splice_region_variant	10753				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity	g.chr1:230904925G>C	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.706-1G>C	1.37:g.230904925G>C			Somatic				CAPN9_uc009xfg.1_Splice_Site_p.T173_splice|CAPN9_uc001hua.1_Splice_Site_p.T236_splice	p.T236_splice	NM_006615	NP_006606	WXS	Illumina HiSeq	Unspecified	O14815	CAN9_HUMAN			6	819	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)						B1APS1|B1AQI0|Q9NS74	Splice_Site	SNP	ENST00000271971.2	37	c.706_splice	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797618	0.31777	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9137	0.92496	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPN9	228971548	1.000000	0.71417	0.057000	0.19452	0.027000	0.11550	9.203000	0.95033	2.458000	0.83093	0.455000	0.32223	.		0.547	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	Intron	3	144	0	0	0	0.000248	0	3	144				
OR2G3	81469	broad.mit.edu	37	1	247769413	247769413	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr1:247769413C>T	ENST00000320002.2	+	1	558	c.526C>T	c.(526-528)Cat>Tat	p.H176Y	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TAGGCTGGACCATTTTATTTG	0.448																																							uc010pyz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(526-528)CAT>TAT		olfactory receptor, family 2, subfamily G,							168.0	155.0	159.0					1																	247769413		2203	4300	6503	SO:0001583	missense	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769413C>T	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.526C>T	1.37:g.247769413C>T	ENSP00000326301:p.His176Tyr		Somatic					p.H176Y	NM_001001914	NP_001001914	WXS	Illumina HiSeq	Unspecified	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	526	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		176			Extracellular (Potential).		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	37	c.526C>T	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	8.214	0.801023	0.16397	.	.	ENSG00000177476	ENST00000320002	T	0.00183	8.6	3.65	1.63	0.23807	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37577	U	0.002026	T	0.00552	0.0018	M	0.86651	2.83	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28870	-1.0030	10	0.87932	D	0	.	9.9077	0.41386	0.3675:0.6325:0.0:0.0	.	176	Q8NGZ4	OR2G3_HUMAN	Y	176	ENSP00000326301:H176Y	ENSP00000326301:H176Y	H	+	1	0	OR2G3	245836036	0.003000	0.15002	0.007000	0.13788	0.026000	0.11368	0.353000	0.20130	0.284000	0.22305	-0.478000	0.04885	CAT		0.448	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			67	48	0	0	0	0.00361	0	67	48				
AKR1C1	1645	broad.mit.edu	37	10	5008225	5008225	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:5008225G>C	ENST00000380872.4	+	2	396	c.204G>C	c.(202-204)aaG>aaC	p.K68N	AKR1C1_ENST00000380859.1_Missense_Mutation_p.K70N|AKR1C1_ENST00000434459.2_Missense_Mutation_p.K68N|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	68					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	TCCGAAGCAAGATTGCAGATG	0.433																																					Colon(130;2054 2316 13360 15380)	Colon(130;2054 2316 13360 15380)	uc001iho.2		NA																	0				ovary(2)	2						c.(202-204)AAG>AAC		aldo-keto reductase family 1, member C1	NADH(DB00157)						90.0	80.0	83.0					10																	5008225		2203	4297	6500	SO:0001583	missense	1645				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity	g.chr10:5008225G>C	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.204G>C	10.37:g.5008225G>C	ENSP00000370254:p.Lys68Asn		Somatic				AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Missense_Mutation_p.K68N|AKR1C1_uc009xhx.2_Missense_Mutation_p.K68N|AKR1C1_uc001ihq.2_Missense_Mutation_p.K68N	p.K68N	NM_001353	NP_001344	WXS	Illumina HiSeq	Unspecified	Q04828	AK1C1_HUMAN			7	1045	+			68					P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	37	c.204G>C	CCDS7061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.26|11.26	1.586868|1.586868	0.28268|0.28268	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859|ENST00000442997	T;T;T|.	0.51574|.	0.7;0.7;0.7|.	2.48|2.48	1.56|1.56	0.23342|0.23342	NADP-dependent oxidoreductase domain (3);|.	0.093040|.	0.43747|.	D|.	0.000524|.	T|T	0.58148|0.58148	0.2102|0.2102	M|M	0.75264|0.75264	2.295|2.295	0.32453|0.32453	N|N	0.54516|0.54516	D;D;D|.	0.69078|.	0.997;0.996;0.968|.	D;D;P|.	0.74348|.	0.959;0.983;0.863|.	T|T	0.63148|0.63148	-0.6702|-0.6702	10|5	0.66056|.	D|.	0.02|.	.|.	7.1903|7.1903	0.25822|0.25822	0.1479:0.0:0.8521:0.0|0.1479:0.0:0.8521:0.0	.|.	68;68;68|.	B4E0M1;Q2XPP3;Q04828|.	.;.;AK1C1_HUMAN|.	N|T	68;68;70|35	ENSP00000412248:K68N;ENSP00000370254:K68N;ENSP00000370240:K70N|.	ENSP00000370240:K70N|.	K|R	+|+	3|2	2|0	AKR1C1|AKR1C1	4998225|4998225	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.217000|0.217000	0.24651|0.24651	1.458000|1.458000	0.35223|0.35223	0.372000|0.372000	0.24591|0.24591	0.305000|0.305000	0.20034|0.20034	AAG|AGA		0.433	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353		32	35	0	0	0	0.003755	0	32	35				
APBB1IP	54518	broad.mit.edu	37	10	26785270	26785270	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:26785270A>T	ENST00000376236.4	+	4	565	c.110A>T	c.(109-111)aAt>aTt	p.N37I	APBB1IP_ENST00000356785.4_Missense_Mutation_p.N37I	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	37					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						CCTGACCCTAATCCACCCAGA	0.353																																							uc001iss.2		NA																	0				lung(4)|skin(2)|central_nervous_system(1)	7						c.(109-111)AAT>ATT		amyloid beta (A4) precursor protein-binding,							96.0	98.0	97.0					10																	26785270		2203	4300	6503	SO:0001583	missense	54518				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium		g.chr10:26785270A>T	AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.110A>T	10.37:g.26785270A>T	ENSP00000365411:p.Asn37Ile		Somatic				APBB1IP_uc001isr.2_Missense_Mutation_p.N37I|APBB1IP_uc009xks.1_Missense_Mutation_p.N37I	p.N37I	NM_019043	NP_061916	WXS	Illumina HiSeq	Unspecified	Q7Z5R6	AB1IP_HUMAN			4	431	+			37					Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	c.110A>T	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.799836	0.31869	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.30448	1.53	5.87	3.53	0.40419	.	0.725708	0.14918	N	0.290822	T	0.11452	0.0279	N	0.03608	-0.345	0.09310	N	1	P;B;B	0.36535	0.557;0.055;0.091	B;B;B	0.27887	0.084;0.015;0.034	T	0.10590	-1.0623	10	0.40728	T	0.16	.	7.7472	0.28875	0.7904:0.1397:0.0699:0.0	.	37;37;37	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	I	37	ENSP00000365411:N37I	ENSP00000349237:N37I	N	+	2	0	APBB1IP	26825276	0.001000	0.12720	0.001000	0.08648	0.871000	0.50021	1.245000	0.32790	0.560000	0.29169	0.533000	0.62120	AAT		0.353	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043		19	42	0	0	0	0.002299	0	19	42				
ANKRD26	22852	broad.mit.edu	37	10	27366275	27366275	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:27366275G>C	ENST00000376087.4	-	9	1234	c.1069C>G	c.(1069-1071)Ctt>Gtt	p.L357V	ANKRD26_ENST00000466890.1_5'UTR|ANKRD26_ENST00000436985.2_Missense_Mutation_p.L406V	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	357					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						ACCTTCATAAGACCAGGGTTT	0.393																																							uc001ith.2		NA																	0				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(1069-1071)CTT>GTT		ankyrin repeat domain 26							196.0	176.0	182.0					10																	27366275		1839	4098	5937	SO:0001583	missense	22852					centrosome		g.chr10:27366275G>C	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1069C>G	10.37:g.27366275G>C	ENSP00000365255:p.Leu357Val		Somatic				ANKRD26_uc001itg.2_Missense_Mutation_p.L76V|ANKRD26_uc009xku.1_Missense_Mutation_p.L357V	p.L357V	NM_014915	NP_055730	WXS	Illumina HiSeq	Unspecified	Q9UPS8	ANR26_HUMAN			9	1241	-			357					A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.1069C>G	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	G	6.941	0.543353	0.13250	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.29655	1.56;1.6	3.97	-4.06	0.03986	.	2.043820	0.03130	N	0.165106	T	0.17619	0.0423	N	0.25647	0.755	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.10567	-1.0624	10	0.29301	T	0.29	.	1.9307	0.03326	0.2156:0.4191:0.197:0.1683	.	357;357;406	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	V	357;406	ENSP00000365255:L357V;ENSP00000405112:L406V	ENSP00000365255:L357V	L	-	1	0	ANKRD26	27406281	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.104000	0.10923	-0.709000	0.05008	-0.150000	0.13652	CTT		0.393	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			8	62	0	0	0	0.00308	0	8	62				
PTCHD3	374308	broad.mit.edu	37	10	27702381	27702381	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:27702381G>T	ENST00000438700.3	-	1	916	c.799C>A	c.(799-801)Ccg>Acg	p.P267T		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	267					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TACAGGATCGGGTTGGGGGGC	0.647																																							uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(799-801)CCG>ACG		patched domain containing 3							45.0	50.0	49.0					10																	27702381		2203	4300	6503	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27702381G>T	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.799C>A	10.37:g.27702381G>T	ENSP00000417658:p.Pro267Thr		Somatic					p.P267T	NM_001034842	NP_001030014	WXS	Illumina HiSeq	Unspecified	Q3KNS1	PTHD3_HUMAN			1	917	-			267					I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.799C>A	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	9.945	1.218458	0.22373	.	.	ENSG00000182077	ENST00000438700	D	0.84873	-1.91	3.93	3.02	0.34903	.	0.270945	0.39146	N	0.001442	D	0.83422	0.5251	M	0.71581	2.175	0.29297	N	0.868923	P	0.37548	0.599	B	0.42062	0.374	T	0.75065	-0.3449	10	0.22109	T	0.4	-22.0639	9.878	0.41216	0.0969:0.0:0.9031:0.0	.	267	Q3KNS1	PTHD3_HUMAN	T	267	ENSP00000417658:P267T	ENSP00000417658:P267T	P	-	1	0	PTCHD3	27742387	0.976000	0.34144	0.153000	0.22517	0.052000	0.14988	0.885000	0.28227	0.873000	0.35799	0.561000	0.74099	CCG		0.647	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		12	21	1	0	0.000978159	0.000978	0.00185294	12	21				
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																							uc010qex.1		NA																	0					0						c.(523-525)AAT>AGT		SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);																																						158160							g.chr10:38654432A>G			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G			Somatic				HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S	p.N175S			WXS	Illumina HiSeq	Unspecified					5	599	+									Missense_Mutation	SNP	ENST00000494540.1	37	c.524A>G																																																																																					0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086		4	38	0	0	0	0.000248	0	4	38				
RBP3	5949	broad.mit.edu	37	10	48388286	48388286	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:48388286C>A	ENST00000224600.4	-	1	2705	c.2592G>T	c.(2590-2592)cgG>cgT	p.R864R	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	864	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TGACCGTGGCCCGCTGCAGGT	0.642																																							uc001jez.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(2590-2592)CGG>CGT		retinol-binding protein 3 precursor	Vitamin A(DB00162)						17.0	19.0	18.0					10																	48388286		2199	4293	6492	SO:0001819	synonymous_variant	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48388286C>A	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2592G>T	10.37:g.48388286C>A			Somatic					p.R864R	NM_002900	NP_002891	WXS	Illumina HiSeq	Unspecified	P10745	RET3_HUMAN			1	2706	-			864			4 X approximate tandem repeats.|3.		Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	c.2592G>T	CCDS7218.1																																																																																				0.642	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		6	17	1	0	0.00116845	0.001168	0.00220741	6	17				
PPA1	5464	broad.mit.edu	37	10	71966081	71966081	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:71966081G>A	ENST00000373232.3	-	9	833	c.734C>T	c.(733-735)aCa>aTa	p.T245I		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	245					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						AGACAAAGTTGTATTCATGCT	0.343																																							uc001jqv.1		NA																	0				breast(1)	1						c.(733-735)ACA>ATA		pyrophosphatase 1							47.0	50.0	48.0					10																	71966081		2203	4300	6503	SO:0001583	missense	5464				diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding	g.chr10:71966081G>A	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.734C>T	10.37:g.71966081G>A	ENSP00000362329:p.Thr245Ile		Somatic					p.T245I	NM_021129	NP_066952	WXS	Illumina HiSeq	Unspecified	Q15181	IPYR_HUMAN			9	841	-			245					Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	ENST00000373232.3	37	c.734C>T	CCDS7299.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633933	0.29068	.	.	ENSG00000180817	ENST00000373232	T	0.42900	0.96	5.46	4.53	0.55603	.	0.198625	0.53938	D	0.000060	T	0.39489	0.1080	M	0.76170	2.325	0.28158	N	0.929103	B	0.06786	0.001	B	0.08055	0.003	T	0.37619	-0.9698	10	0.39692	T	0.17	-7.6762	5.9378	0.19175	0.1561:0.1683:0.6756:0.0	.	245	Q15181	IPYR_HUMAN	I	245	ENSP00000362329:T245I	ENSP00000362329:T245I	T	-	2	0	PPA1	71636087	0.997000	0.39634	0.811000	0.32455	0.957000	0.61999	3.549000	0.53681	1.268000	0.44264	0.591000	0.81541	ACA		0.343	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129		11	15	0	0	0	0.000978	0	11	15				
MYOZ1	58529	broad.mit.edu	37	10	75397659	75397659	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:75397659A>G	ENST00000359322.4	-	3	459	c.95T>C	c.(94-96)tTg>tCg	p.L32S		NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					GCCCAGGTTCAAGCCTGAGCT	0.512																																							uc001jur.2		NA																	0				ovary(2)	2						c.(94-96)TTG>TCG		myozenin 1							167.0	159.0	162.0					10																	75397659		2203	4300	6503	SO:0001583	missense	58529				myofibril assembly	nucleus|pseudopodium	FATZ binding	g.chr10:75397659A>G	AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.95T>C	10.37:g.75397659A>G	ENSP00000352272:p.Leu32Ser		Somatic					p.L32S	NM_021245	NP_067068	WXS	Illumina HiSeq	Unspecified	Q9NP98	MYOZ1_HUMAN			3	460	-	Prostate(51;0.0112)		32						Missense_Mutation	SNP	ENST00000359322.4	37	c.95T>C	CCDS7330.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684678	0.88639	.	.	ENSG00000177791	ENST00000359322	T	0.74737	-0.87	6.17	6.17	0.99709	.	0.055071	0.64402	D	0.000001	D	0.87034	0.6077	M	0.79926	2.475	0.58432	D	0.999991	D	0.89917	1.0	D	0.79784	0.993	D	0.88438	0.3040	10	0.87932	D	0	-8.795	16.8222	0.85835	1.0:0.0:0.0:0.0	.	32	Q9NP98	MYOZ1_HUMAN	S	32	ENSP00000352272:L32S	ENSP00000352272:L32S	L	-	2	0	MYOZ1	75067665	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.024000	0.76443	2.371000	0.80710	0.533000	0.62120	TTG		0.512	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1			11	134	0	0	0	0.001368	0	11	134				
DLG5	9231	broad.mit.edu	37	10	79553869	79553869	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:79553869C>G	ENST00000372391.2	-	31	5558	c.5553G>C	c.(5551-5553)caG>caC	p.Q1851H	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Missense_Mutation_p.Q1511H|RP13-39P12.3_ENST00000434097.2_RNA|RP13-39P12.3_ENST00000601701.1_RNA	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1851	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGGGGTCTCTCTGCTCCCTGT	0.587																																							uc001jzk.2		NA																	0				ovary(5)|breast(3)	8						c.(5551-5553)CAG>CAC		discs large homolog 5							190.0	157.0	168.0					10																	79553869		2203	4300	6503	SO:0001583	missense	9231				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity	g.chr10:79553869C>G	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.5553G>C	10.37:g.79553869C>G	ENSP00000361467:p.Gln1851His		Somatic				DLG5_uc001jzi.2_Missense_Mutation_p.Q606H|DLG5_uc001jzj.2_Missense_Mutation_p.Q1266H	p.Q1851H	NM_004747	NP_004738	WXS	Illumina HiSeq	Unspecified	Q8TDM6	DLG5_HUMAN	Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)		31	5623	-	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		1851			Guanylate kinase-like.		A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	c.5553G>C	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591730	0.66219	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.17054	2.3;2.3;2.3	5.86	4.95	0.65309	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.36972	N	0.002314	T	0.34948	0.0915	L	0.57536	1.79	0.40735	D	0.98278	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.986	T	0.12502	-1.0545	10	0.66056	D	0.02	.	9.0529	0.36387	0.0:0.7327:0.0:0.2672	.	1851;1511	Q8TDM6;Q8TDM6-2	DLG5_HUMAN;.	H	1851;812;1511	ENSP00000361467:Q1851H;ENSP00000394797:Q812H;ENSP00000361464:Q1511H	ENSP00000361464:Q1511H	Q	-	3	2	DLG5	79223875	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.027000	0.30115	1.473000	0.48159	0.655000	0.94253	CAG		0.587	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			4	77	0	0	0	0.000248	0	4	77				
CNNM1	26507	broad.mit.edu	37	10	101090472	101090472	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:101090472G>T	ENST00000356713.4	+	1	1617	c.1328G>T	c.(1327-1329)cGc>cTc	p.R443L	CNNM1_ENST00000370534.4_Missense_Mutation_p.R78L|CNNM1_ENST00000446890.1_Missense_Mutation_p.R372L|CNNM1_ENST00000370528.3_Missense_Mutation_p.R372L	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	443	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		TTCATGCTGCGCTCAGACGCG	0.612																																							uc001kpp.3		NA																	0					0						c.(1327-1329)CGC>CTC		cyclin M1							80.0	67.0	71.0					10																	101090472		2203	4300	6503	SO:0001583	missense	26507				ion transport	integral to membrane|plasma membrane		g.chr10:101090472G>T	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1328G>T	10.37:g.101090472G>T	ENSP00000349147:p.Arg443Leu		Somatic				CNNM1_uc009xwe.2_Missense_Mutation_p.R443L|CNNM1_uc010qpi.1_Missense_Mutation_p.R443L|CNNM1_uc009xwf.2_Missense_Mutation_p.R443L	p.R443L	NM_020348	NP_065081	WXS	Illumina HiSeq	Unspecified	Q9NRU3	CNNM1_HUMAN		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)	1	1617	+		Colorectal(252;0.234)	443			CBS 1.		Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	c.1328G>T	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639132	0.47153	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	4.83	2.91	0.33838	Cystathionine beta-synthase, core (1);	0.442288	0.24869	N	0.034953	T	0.78597	0.4308	L	0.46157	1.445	0.42457	D	0.992777	P;P;B;P	0.48503	0.911;0.888;0.343;0.656	P;P;B;B	0.55545	0.778;0.653;0.185;0.334	T	0.75235	-0.3389	10	0.40728	T	0.16	-10.2251	9.6257	0.39750	0.0789:0.143:0.7781:0.0	.	78;443;78;443	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	L	443;372;372;78	ENSP00000349147:R443L;ENSP00000406492:R372L;ENSP00000359559:R372L;ENSP00000359565:R78L	ENSP00000349147:R443L	R	+	2	0	CNNM1	101080462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.190000	0.50973	0.604000	0.29930	0.462000	0.41574	CGC		0.612	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348		19	20	1	0	1.10923e-09	0.00278	2.37838e-09	19	20				
PNLIPRP1	5407	broad.mit.edu	37	10	118360673	118360673	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:118360673G>C	ENST00000528052.1	+	10	1094	c.1023G>C	c.(1021-1023)caG>caC	p.Q341H	PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.Q341H|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.Q341H			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	341					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		AAGAGCAGCAGAAATTCTTCT	0.438																																							uc001lco.1		NA																	0				ovary(1)|breast(1)	2						c.(1021-1023)CAG>CAC		pancreatic lipase-related protein 1 precursor							136.0	114.0	122.0					10																	118360673		2203	4300	6503	SO:0001583	missense	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118360673G>C	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.1023G>C	10.37:g.118360673G>C	ENSP00000433933:p.Gln341His		Somatic				PNLIPRP1_uc001lcp.2_Missense_Mutation_p.Q341H	p.Q341H	NM_006229	NP_006220	WXS	Illumina HiSeq	Unspecified	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	10	1041	+			341					Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	c.1023G>C	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	G	9.638	1.138330	0.21123	.	.	ENSG00000187021	ENST00000358834;ENST00000528052;ENST00000534537	D;D;D	0.91068	-2.78;-2.78;-2.78	5.25	4.33	0.51752	Lipase, N-terminal (1);	0.254653	0.33813	N	0.004534	D	0.88551	0.6467	M	0.74389	2.26	0.80722	D	1	B	0.31318	0.319	B	0.31390	0.129	D	0.87798	0.2623	10	0.72032	D	0.01	-8.8094	8.023	0.30421	0.0904:0.1645:0.7451:0.0	.	341	P54315	LIPR1_HUMAN	H	341	ENSP00000351695:Q341H;ENSP00000433933:Q341H;ENSP00000434159:Q341H	ENSP00000351695:Q341H	Q	+	3	2	PNLIPRP1	118350663	0.900000	0.30661	0.998000	0.56505	0.934000	0.57294	1.115000	0.31209	2.601000	0.87937	0.591000	0.81541	CAG		0.438	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		3	46	0	0	0	0.004672	0	3	46				
HTRA1	5654	broad.mit.edu	37	10	124248975	124248975	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:124248975G>T	ENST00000368984.3	+	3	738	c.610G>T	c.(610-612)Ggg>Tgg	p.G204W		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	204	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				GGTGGCTAGTGGGTCTGGGTT	0.493																																							uc001lgj.2		NA																	0					0						c.(610-612)GGG>TGG		HtrA serine peptidase 1 precursor							161.0	156.0	158.0					10																	124248975		2203	4300	6503	SO:0001583	missense	5654				proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr10:124248975G>T	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.610G>T	10.37:g.124248975G>T	ENSP00000357980:p.Gly204Trp		Somatic					p.G204W	NM_002775	NP_002766	WXS	Illumina HiSeq	Unspecified	Q92743	HTRA1_HUMAN			3	738	+		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)	204			Serine protease.		D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	c.610G>T	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.786715	0.70337	.	.	ENSG00000166033	ENST00000368984;ENST00000435263	D	0.93859	-3.3	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99839	1.1060	10	0.87932	D	0	-14.7381	18.6163	0.91304	0.0:0.0:1.0:0.0	.	204	Q92743	HTRA1_HUMAN	W	204;171	ENSP00000357980:G204W	ENSP00000357980:G204W	G	+	1	0	HTRA1	124238965	1.000000	0.71417	0.976000	0.42696	0.341000	0.28922	9.722000	0.98770	2.386000	0.81285	0.650000	0.86243	GGG		0.493	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775		43	65	1	0	1.51926e-22	0.00361	3.80631e-22	43	65				
NKX6-2	84504	broad.mit.edu	37	10	134598651	134598651	+	Silent	SNP	G	G	T	rs548659147		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:134598651G>T	ENST00000368592.5	-	3	706	c.603C>A	c.(601-603)acC>acA	p.T201T	RP11-288G11.3_ENST00000441365.2_lincRNA	NM_177400.2	NP_796374	Q9C056	NKX62_HUMAN	NK6 homeobox 2	201					central nervous system myelination (GO:0022010)|endocrine pancreas development (GO:0031018)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of glial cell differentiation (GO:0045686)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of glial cell differentiation (GO:0045687)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(2)	3		all_cancers(35;2.79e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0584)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;4.06e-05)|Epithelial(32;5.53e-05)|all cancers(32;5.99e-05)		TGCGCCACTTGGTCCGGCGGT	0.741													G|||	1	0.000199681	0.0008	0.0	5008	,	,		9349	0.0		0.0	False		,,,				2504	0.0						uc001llr.2		NA																	0					0						c.(601-603)ACC>ACA		NK6 transcription factor related, locus 2							29.0	26.0	27.0					10																	134598651		2195	4291	6486	SO:0001819	synonymous_variant	84504					nucleus	sequence-specific DNA binding transcription factor activity	g.chr10:134598651G>T	AF184215	CCDS7670.1	10q26.3	2012-03-09	2007-07-09		ENSG00000148826	ENSG00000148826		"""Homeoboxes / ANTP class : NKL subclass"""	19321	protein-coding gene	gene with protein product		605955	"""NK6 transcription factor related, locus 2 (Drosophila)"""			11210186	Standard	NM_177400		Approved	NKX6B, GTX, NKX6.1	uc001llr.2	Q9C056	OTTHUMG00000019294	ENST00000368592.5:c.603C>A	10.37:g.134598651G>T			Somatic					p.T201T	NM_177400	NP_796374	WXS	Illumina HiSeq	Unspecified	Q9C056	NKX62_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;4.06e-05)|Epithelial(32;5.53e-05)|all cancers(32;5.99e-05)	3	688	-		all_cancers(35;2.79e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0584)|Melanoma(40;0.123)|Glioma(114;0.203)	201			Homeobox.		Q5JSF3	Silent	SNP	ENST00000368592.5	37	c.603C>A	CCDS7670.1																																																																																				0.741	NKX6-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051093.2			13	19	1	0	1.05317e-09	0.00245	2.26513e-09	13	19				
KRTAP5-5	439915	broad.mit.edu	37	11	1651399	1651399	+	Missense_Mutation	SNP	G	G	A	rs77602976	byFrequency	TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:1651399G>A	ENST00000399676.2	+	1	367	c.329G>A	c.(328-330)gGc>gAc	p.G110D		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	110	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGGGCCTGTGGCTCCTGTGGG	0.692																																							uc001lty.2		NA																	0				lung(1)	1						c.(328-330)GGC>GAC		keratin associated protein 5-5							32.0	45.0	41.0					11																	1651399		2174	4272	6446	SO:0001583	missense	439915					keratin filament		g.chr11:1651399G>A	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.329G>A	11.37:g.1651399G>A	ENSP00000382584:p.Gly110Asp		Somatic					p.G110D	NM_001001480	NP_001001480	WXS	Illumina HiSeq	Unspecified	Q701N2	KRA55_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	1	367	+		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	110	Missing (in Ref. 1; BAD20201 and 2; CAF31639).		8 X 4 AA repeats of C-C-X-P.		A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	c.329G>A	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	G	0.445	-0.896479	0.02472	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01126	5.3	2.6	1.66	0.24008	.	.	.	.	.	T	0.03651	0.0104	M	0.87381	2.88	0.26741	N	0.970384	D	0.54047	0.964	P	0.47941	0.562	T	0.21518	-1.0243	9	0.72032	D	0.01	.	8.9877	0.36003	0.0:0.0:0.7759:0.2241	.	110	Q701N2	KRA55_HUMAN	D	110;81	ENSP00000382584:G110D	ENSP00000382584:G110D	G	+	2	0	KRTAP5-5	1607975	0.293000	0.24371	0.997000	0.53966	0.034000	0.12701	0.702000	0.25631	0.402000	0.25451	-0.489000	0.04712	GGC		0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1			26	47	0	0	0	0.001271	0	26	47				
OR51V1	283111	broad.mit.edu	37	11	5220994	5220994	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:5220994G>T	ENST00000321255.1	-	1	936	c.937C>A	c.(937-939)Ctt>Att	p.L313I		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	313					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGAGTCTAAGCATTCTGGTA	0.373																																							uc010qyz.1		NA																	0				skin(1)	1						c.(937-939)CTT>ATT		olfactory receptor, family 51, subfamily V,							63.0	63.0	63.0					11																	5220994		2201	4298	6499	SO:0001583	missense	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5220994G>T	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.937C>A	11.37:g.5220994G>T	ENSP00000321729:p.Leu313Ile		Somatic					p.L313I	NM_001004760	NP_001004760	WXS	Illumina HiSeq	Unspecified	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	937	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	313			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000321255.1	37	c.937C>A	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	G	7.807	0.714786	0.15306	.	.	ENSG00000176742	ENST00000321255	T	0.38401	1.14	5.27	-1.91	0.07641	.	1.945930	0.02781	N	0.120874	T	0.23171	0.0560	N	0.26042	0.785	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.10245	-1.0638	10	0.19590	T	0.45	.	5.0066	0.14291	0.2068:0.0:0.3197:0.4734	.	313	Q9H2C8	O51V1_HUMAN	I	313	ENSP00000321729:L313I	ENSP00000321729:L313I	L	-	1	0	OR51V1	5177570	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.050000	0.14120	-0.162000	0.10964	0.655000	0.94253	CTT		0.373	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		9	31	1	0	0.000274275	0.004482	0.000529609	9	31				
OR52H1	390067	broad.mit.edu	37	11	5566148	5566148	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:5566148G>A	ENST00000322653.4	-	1	631	c.606C>T	c.(604-606)atC>atT	p.I202I	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCAGAAGTTGATGGAGATAT	0.498																																							uc010qzh.1		NA																	0				ovary(1)|breast(1)	2						c.(604-606)ATC>ATT		olfactory receptor, family 52, subfamily H,							132.0	102.0	112.0					11																	5566148		2201	4297	6498	SO:0001819	synonymous_variant	390067				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5566148G>A	AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.606C>T	11.37:g.5566148G>A			Somatic				HBG2_uc001mak.1_Intron	p.I202I	NM_001005289	NP_001005289	WXS	Illumina HiSeq	Unspecified	Q8NGJ2	O52H1_HUMAN		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	606	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	202			Extracellular (Potential).		B9EH26|Q6IF79	Silent	SNP	ENST00000322653.4	37	c.606C>T	CCDS31386.1																																																																																				0.498	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289		5	48	0	0	0	0.000602	0	5	48				
SOX6	55553	broad.mit.edu	37	11	16208467	16208467	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:16208467C>A	ENST00000352083.6	-	5	647	c.570G>T	c.(568-570)caG>caT	p.Q190H	SOX6_ENST00000316399.6_Missense_Mutation_p.Q190H|SOX6_ENST00000396356.3_Missense_Mutation_p.Q190H|SOX6_ENST00000527619.1_Missense_Mutation_p.Q193H|SOX6_ENST00000528252.1_Missense_Mutation_p.Q190H|SOX6_ENST00000528429.1_Missense_Mutation_p.Q190H			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	190					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TGGTGGAGAGCTGCCGTTCTT	0.473																																							uc001mme.2		NA																	0				ovary(3)	3						c.(607-609)CAG>CAT		SRY (sex determining region Y)-box 6 isoform 4							129.0	129.0	129.0					11																	16208467		2200	4294	6494	SO:0001583	missense	55553				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity	g.chr11:16208467C>A	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.570G>T	11.37:g.16208467C>A	ENSP00000339876:p.Gln190His		Somatic				SOX6_uc001mmd.2_Missense_Mutation_p.Q193H|SOX6_uc001mmf.2_Missense_Mutation_p.Q190H|SOX6_uc001mmg.2_Missense_Mutation_p.Q190H	p.Q203H	NM_001145819	NP_001139291	WXS	Illumina HiSeq	Unspecified	P35712	SOX6_HUMAN			5	642	-			190			Potential.		Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37	c.609G>T		.	.	.	.	.	.	.	.	.	.	C	12.44	1.938157	0.34189	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98822	-5.16;-5.13;-5.16;-5.05;-5.05;-5.13	5.73	0.665	0.17896	.	0.056766	0.64402	D	0.000001	D	0.98745	0.9578	M	0.81802	2.56	0.54753	D	0.999982	B;B;D	0.65815	0.035;0.232;0.995	B;B;D	0.77004	0.045;0.127;0.989	D	0.98450	1.0591	10	0.87932	D	0	.	9.5598	0.39362	0.0:0.6504:0.0:0.3496	.	190;190;193	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	H	190;190;190;190;193;190	ENSP00000324948:Q190H;ENSP00000339876:Q190H;ENSP00000379644:Q190H;ENSP00000432134:Q190H;ENSP00000434455:Q193H;ENSP00000433233:Q190H	ENSP00000324948:Q190H	Q	-	3	2	SOX6	16165043	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.574000	0.36482	0.074000	0.16767	-0.244000	0.11960	CAG		0.473	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326		52	82	1	0	8.99859e-20	0.00361	2.21479e-19	52	82				
PTPN5	84867	broad.mit.edu	37	11	18763858	18763858	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:18763858C>T	ENST00000358540.2	-	7	1106	c.676G>A	c.(676-678)Gag>Aag	p.E226K	PTPN5_ENST00000477854.1_Missense_Mutation_p.E30K|PTPN5_ENST00000396168.1_Missense_Mutation_p.E202K|PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000396167.2_Missense_Mutation_p.E194K|PTPN5_ENST00000396170.1_Missense_Mutation_p.E194K|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396171.4_Missense_Mutation_p.E226K	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	226					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GGGTCAGCCTCAGGCTTGATG	0.597																																							uc001mpd.2		NA																	0				ovary(2)	2						c.(676-678)GAG>AAG		protein-tyrosine-phosphatase non-receptor 5							78.0	83.0	81.0					11																	18763858		2199	4293	6492	SO:0001583	missense	84867					integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity	g.chr11:18763858C>T	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.676G>A	11.37:g.18763858C>T	ENSP00000351342:p.Glu226Lys		Somatic				PTPN5_uc001mpb.2_Missense_Mutation_p.E194K|PTPN5_uc001mpc.2_Missense_Mutation_p.E226K|PTPN5_uc001mpe.2_Missense_Mutation_p.E194K|PTPN5_uc010rdj.1_Missense_Mutation_p.E170K|PTPN5_uc001mpf.2_Missense_Mutation_p.E202K|PTPN5_uc010rdk.1_Missense_Mutation_p.E171K	p.E226K	NM_006906	NP_008837	WXS	Illumina HiSeq	Unspecified	P54829	PTN5_HUMAN			7	1107	-			226					B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	c.676G>A	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	C	33	5.291065	0.95546	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.04049	3.75;3.72;3.81;3.72;3.81;3.74	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.17577	0.0422	L	0.55481	1.735	0.80722	D	1	P;D	0.69078	0.863;0.997	B;D	0.73380	0.316;0.98	T	0.00189	-1.1938	10	0.59425	D	0.04	-12.7968	16.613	0.84899	0.0:1.0:0.0:0.0	.	226;194	P54829;B3KXG7	PTN5_HUMAN;.	K	30;226;194;226;194;202	ENSP00000435056:E30K;ENSP00000351342:E226K;ENSP00000379473:E194K;ENSP00000379474:E226K;ENSP00000379470:E194K;ENSP00000379471:E202K	ENSP00000351342:E226K	E	-	1	0	PTPN5	18720434	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.162000	0.77515	2.362000	0.80069	0.561000	0.74099	GAG		0.597	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		10	77	0	0	0	0.000673	0	10	77				
MRGPRX1	259249	broad.mit.edu	37	11	18956162	18956162	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:18956162C>T	ENST00000302797.3	-	1	394	c.170G>A	c.(169-171)cGc>cAc	p.R57H	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	57					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GGCGTTCCTGCGCATGCGGCA	0.557																																							uc001mpg.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(169-171)CGC>CAC		MAS-related GPR, member X1							143.0	139.0	140.0					11																	18956162		2194	4286	6480	SO:0001583	missense	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18956162C>T		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.170G>A	11.37:g.18956162C>T	ENSP00000305766:p.Arg57His		Somatic					p.R57H	NM_147199	NP_671732	WXS	Illumina HiSeq	Unspecified	Q96LB2	MRGX1_HUMAN			1	388	-			57			Cytoplasmic (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	c.170G>A	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	0.273	-0.991250	0.02162	.	.	ENSG00000170255	ENST00000302797	T	0.10860	2.83	2.43	-4.86	0.03132	GPCR, rhodopsin-like superfamily (1);	0.831486	0.10560	N	0.660392	T	0.07908	0.0198	L	0.43757	1.38	0.09310	N	1	B	0.12630	0.006	B	0.15484	0.013	T	0.28106	-1.0054	10	0.28530	T	0.3	.	7.2275	0.26024	0.0:0.3247:0.1217:0.5536	.	57	Q96LB2	MRGX1_HUMAN	H	57	ENSP00000305766:R57H	ENSP00000305766:R57H	R	-	2	0	MRGPRX1	18912738	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-2.774000	0.00777	-2.191000	0.00756	-1.579000	0.00862	CGC		0.557	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		41	135	0	0	0	0.001706	0	41	135				
SLC5A12	159963	broad.mit.edu	37	11	26702698	26702698	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:26702698G>T	ENST00000396005.3	-	12	1688	c.1379C>A	c.(1378-1380)cCt>cAt	p.P460H		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	460					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GGCTGGTGCAGGGTAAATGAA	0.473																																							uc001mra.2		NA																	0				ovary(1)|skin(1)	2						c.(1378-1380)CCT>CAT		solute carrier family 5 (sodium/glucose							67.0	66.0	66.0					11																	26702698		1907	4127	6034	SO:0001583	missense	159963				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	g.chr11:26702698G>T	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1379C>A	11.37:g.26702698G>T	ENSP00000379326:p.Pro460His		Somatic				SLC5A12_uc001mrb.2_RNA	p.P460H	NM_178498	NP_848593	WXS	Illumina HiSeq	Unspecified	Q1EHB4	SC5AC_HUMAN			12	1692	-			460			Extracellular (Potential).		Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	c.1379C>A	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424926	0.83667	.	.	ENSG00000148942	ENST00000396005	D	0.87103	-2.21	5.52	5.52	0.82312	.	0.000000	0.64402	U	0.000006	D	0.93455	0.7912	M	0.84219	2.685	0.80722	D	1	D	0.64830	0.994	D	0.63283	0.913	D	0.94044	0.7312	10	0.72032	D	0.01	.	18.1964	0.89823	0.0:0.0:1.0:0.0	.	460	Q1EHB4	SC5AC_HUMAN	H	460	ENSP00000379326:P460H	ENSP00000379326:P460H	P	-	2	0	SLC5A12	26659274	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.366000	0.79548	2.590000	0.87494	0.655000	0.94253	CCT		0.473	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498		12	15	1	0	0.000978159	0.000978	0.00185294	12	15				
CAT	847	broad.mit.edu	37	11	34492577	34492577	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:34492577G>A	ENST00000241052.4	+	12	1596	c.1507G>A	c.(1507-1509)Gag>Aag	p.E503K	CAT_ENST00000534710.1_3'UTR	NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	503					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GTACAATGCTGAGAAGCCTAA	0.512																																							uc001mvm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1507-1509)GAG>AAG		catalase	Fomepizole(DB01213)						120.0	116.0	117.0					11																	34492577		2202	4298	6500	SO:0001583	missense	847				hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity	g.chr11:34492577G>A	AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1507G>A	11.37:g.34492577G>A	ENSP00000241052:p.Glu503Lys		Somatic				CAT_uc001mvn.2_Missense_Mutation_p.E112K	p.E503K	NM_001752	NP_001743	WXS	Illumina HiSeq	Unspecified	P04040	CATA_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000995)	12	1590	+		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)	503					A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Missense_Mutation	SNP	ENST00000241052.4	37	c.1507G>A	CCDS7891.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875613	0.33162	.	.	ENSG00000121691	ENST00000241052	D	0.91351	-2.83	5.7	1.28	0.21552	.	0.204155	0.50627	N	0.000118	T	0.79604	0.4474	N	0.22421	0.69	0.20074	N	0.999936	B	0.02656	0.0	B	0.04013	0.001	T	0.63501	-0.6623	10	0.26408	T	0.33	-15.6566	5.3925	0.16251	0.3427:0.1393:0.518:0.0	.	503	P04040	CATA_HUMAN	K	503	ENSP00000241052:E503K	ENSP00000241052:E503K	E	+	1	0	CAT	34449153	0.970000	0.33590	0.182000	0.23118	0.177000	0.22998	1.653000	0.37323	0.208000	0.20626	0.556000	0.70494	GAG		0.512	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752		38	68	0	0	0	0.005524	0	38	68				
LRP4	4038	broad.mit.edu	37	11	46880824	46880825	+	Missense_Mutation	DNP	CG	CG	AA			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:46880824_46880825CG>AA	ENST00000378623.1	-	38	5669_5670	c.5427_5428CG>TT	c.(5425-5430)atCGta>atTTta	p.V1810L	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1810					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.V1810I(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ATTCCCTCTACGATCTTGATCT	0.55																																							uc001ndn.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(5425-5430)ATCGTA>ATTTTA		low density lipoprotein receptor-related protein																																				SO:0001583	missense	4038				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity	g.chr11:46880824_46880825CG>AA	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.5427_5428delinsAA	11.37:g.46880824_46880825delinsAA	ENSP00000367888:p.Val1810Leu		Somatic				uc001ndl.2_Intron|LRP4_uc001ndm.3_Missense_Mutation_p.V52L	p.V1810L	NM_002334	NP_002325	WXS	Illumina HiSeq	Unspecified	O75096	LRP4_HUMAN		Lung(87;0.159)	38	5573_5574	-			1810			Cytoplasmic (Potential).		B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	DNP	ENST00000378623.1	37	c.5427_5428CG>TT	CCDS31478.1																																																																																				0.550	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334		24	32	0	0	0	0.004672	0	24	32				
OR4C16	219428	broad.mit.edu	37	11	55339784	55339784	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:55339784C>T	ENST00000314634.3	+	1	181	c.181C>T	c.(181-183)Ctt>Ttt	p.L61F		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GTTCTTCTTCCTTTTCTACTT	0.398																																							uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(181-183)CTT>TTT		olfactory receptor, family 4, subfamily C,							283.0	257.0	266.0					11																	55339784		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55339784C>T	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.181C>T	11.37:g.55339784C>T	ENSP00000324913:p.Leu61Phe		Somatic					p.L61F	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	181	+		all_epithelial(135;0.0748)	61			Helical; Name=2; (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.181C>T	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	C	9.908	1.208784	0.22205	.	.	ENSG00000181935	ENST00000314634	T	0.14391	2.51	4.98	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000062	T	0.33933	0.0880	H	0.97390	3.995	0.09310	N	1	B	0.32604	0.377	B	0.36030	0.216	T	0.44375	-0.9332	10	0.87932	D	0	.	11.5228	0.50562	0.0:0.9114:0.0:0.0886	.	61	Q8NGL9	OR4CG_HUMAN	F	61	ENSP00000324913:L61F	ENSP00000324913:L61F	L	+	1	0	OR4C16	55096360	0.827000	0.29292	0.217000	0.23759	0.402000	0.30811	1.573000	0.36472	1.302000	0.44855	0.549000	0.68633	CTT		0.398	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		36	72	0	0	0	0.003271	0	36	72				
OR4S2	219431	broad.mit.edu	37	11	55419048	55419048	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:55419048G>A	ENST00000312422.2	+	1	669	c.669G>A	c.(667-669)ctG>ctA	p.L223L		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TAGTTTCCCTGAGAAAGCAGT	0.483																																							uc001nhs.1		NA																	0				skin(2)|ovary(1)	3						c.(667-669)CTG>CTA		olfactory receptor, family 4, subfamily S,							165.0	133.0	144.0					11																	55419048		2178	4035	6213	SO:0001819	synonymous_variant	219431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55419048G>A	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.669G>A	11.37:g.55419048G>A			Somatic					p.L223L	NM_001004059	NP_001004059	WXS	Illumina HiSeq	Unspecified	Q8NH73	OR4S2_HUMAN			1	669	+		all_epithelial(135;0.0748)	223			Cytoplasmic (Potential).		Q6IF72	Silent	SNP	ENST00000312422.2	37	c.669G>A	CCDS31505.1																																																																																				0.483	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		6	109	0	0	0	0.001168	0	6	109				
OR9Q1	219956	broad.mit.edu	37	11	57947780	57947780	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:57947780C>A	ENST00000335397.3	+	3	1180	c.864C>A	c.(862-864)atC>atA	p.I288I		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				ATCCCCTCATCTACAGCCTGA	0.463																																							uc001nmj.2		NA																	0				ovary(1)	1						c.(862-864)ATC>ATA		olfactory receptor, family 9, subfamily Q,							73.0	70.0	71.0					11																	57947780		2201	4296	6497	SO:0001819	synonymous_variant	219956				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57947780C>A	AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.864C>A	11.37:g.57947780C>A			Somatic					p.I288I	NM_001005212	NP_001005212	WXS	Illumina HiSeq	Unspecified	Q8NGQ5	OR9Q1_HUMAN			3	1180	+		Breast(21;0.222)	288			Helical; Name=7; (Potential).		Q2TAN3|Q96RA7	Silent	SNP	ENST00000335397.3	37	c.864C>A	CCDS31543.1																																																																																				0.463	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212		25	48	1	0	6.38683e-12	0.001512	1.44948e-11	25	48				
AHNAK	79026	broad.mit.edu	37	11	62298096	62298096	+	Missense_Mutation	SNP	G	G	A	rs150191644		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:62298096G>A	ENST00000378024.4	-	5	4067	c.3793C>T	c.(3793-3795)Cct>Tct	p.P1265S	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1265					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTGAAGCCAGGCATGCTAAAC	0.522																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(3793-3795)CCT>TCT		AHNAK nucleoprotein isoform 1							235.0	244.0	241.0					11																	62298096		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62298096G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3793C>T	11.37:g.62298096G>A	ENSP00000367263:p.Pro1265Ser		Somatic				AHNAK_uc001ntk.1_Intron	p.P1265S	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	4093	-		Melanoma(852;0.155)	1265					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.3793C>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	g	15.41	2.825408	0.50739	.	.	ENSG00000124942	ENST00000378024	T	0.02944	4.1	4.66	4.66	0.58398	.	0.000000	0.30193	U	0.010193	T	0.08492	0.0211	L	0.58810	1.83	0.30081	N	0.809181	P	0.43392	0.805	P	0.56042	0.79	T	0.01652	-1.1303	10	0.31617	T	0.26	.	10.4145	0.44314	0.0924:0.0:0.9076:0.0	.	1265	Q09666	AHNK_HUMAN	S	1265	ENSP00000367263:P1265S	ENSP00000367263:P1265S	P	-	1	0	AHNAK	62054672	0.002000	0.14202	0.998000	0.56505	0.951000	0.60555	0.200000	0.17257	2.310000	0.77875	0.650000	0.86243	CCT		0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		137	254	0	0	0	0.00361	0	137	254				
SCYL1	57410	broad.mit.edu	37	11	65293594	65293594	+	Splice_Site	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:65293594G>A	ENST00000270176.5	+	4	452		c.e4-1		SCYL1_ENST00000533862.1_Splice_Site|SCYL1_ENST00000525364.1_Splice_Site|SCYL1_ENST00000279270.6_Splice_Site|SCYL1_ENST00000524944.1_Splice_Site|SCYL1_ENST00000420247.2_Splice_Site|SCYL1_ENST00000527009.1_Splice_Site	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)						peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						TTTGCCCCCAGAAAGCCCTCA	0.627																																							uc001oea.1		NA																	0				skin(1)	1						c.e4-1		SCY1-like 1 isoform A							32.0	39.0	36.0					11																	65293594		2054	4178	6232	SO:0001630	splice_region_variant	57410				regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity	g.chr11:65293594G>A	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.376-1G>A	11.37:g.65293594G>A			Somatic				SCYL1_uc009yqk.2_Splice_Site_p.K126_splice|SCYL1_uc001oeb.1_Splice_Site_p.K126_splice|SCYL1_uc001oec.1_Splice_Site_p.K126_splice|SCYL1_uc001oed.1_Splice_Site	p.K126_splice	NM_020680	NP_065731	WXS	Illumina HiSeq	Unspecified	Q96KG9	NTKL_HUMAN			4	453	+								A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Splice_Site	SNP	ENST00000270176.5	37	c.376_splice	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887644	0.72410	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000417543	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4361	0.75149	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCYL1	65050170	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	6.539000	0.73856	2.220000	0.72140	0.549000	0.68633	.		0.627	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	Intron	19	17	0	0	0	0.001216	0	19	17				
KDM2A	22992	broad.mit.edu	37	11	67021879	67021879	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:67021879C>G	ENST00000529006.2	+	20	3743	c.3297C>G	c.(3295-3297)ctC>ctG	p.L1099L	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_Silent_p.L557L|KDM2A_ENST00000530342.1_Silent_p.L660L|KDM2A_ENST00000398645.2_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1099					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TCACAGAGCTCAATATGGCAG	0.537																																							uc001ojw.2		NA																	0				ovary(4)|lung(3)|breast(1)|skin(1)	9						c.(3295-3297)CTC>CTG		F-box and leucine-rich repeat protein 11							149.0	144.0	146.0					11																	67021879		2097	4211	6308	SO:0001819	synonymous_variant	22992				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chr11:67021879C>G	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3297C>G	11.37:g.67021879C>G			Somatic				KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_Silent_p.L793L|KDM2A_uc001ojz.1_Silent_p.L557L|KDM2A_uc001oka.2_Silent_p.L223L	p.L1099L	NM_012308	NP_036440	WXS	Illumina HiSeq	Unspecified	Q9Y2K7	KDM2A_HUMAN			20	4161	+			1099			LRR 4.		D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	ENST00000529006.2	37	c.3297C>G	CCDS44657.1																																																																																				0.537	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308		35	54	0	0	0	0.001287	0	35	54				
ARRB1	408	broad.mit.edu	37	11	75001077	75001077	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:75001077G>A	ENST00000420843.2	-	2	124	c.27C>T	c.(25-27)ttC>ttT	p.F9F	ARRB1_ENST00000393505.4_Silent_p.F9F|ARRB1_ENST00000360025.3_Silent_p.F9F	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	9	Interaction with SRC. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						TGGCCTTCTTGAACACTCTGT	0.587																																							uc001owe.1		NA																	0				breast(2)	2						c.(25-27)TTC>TTT		arrestin beta 1 isoform A							166.0	136.0	146.0					11																	75001077		2200	4293	6493	SO:0001819	synonymous_variant	408				G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding	g.chr11:75001077G>A	BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.27C>T	11.37:g.75001077G>A			Somatic				ARRB1_uc001owf.1_Silent_p.F9F	p.F9F	NM_004041	NP_004032	WXS	Illumina HiSeq	Unspecified	P49407	ARRB1_HUMAN			2	249	-			9			Interaction with SRC (By similarity).		B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Silent	SNP	ENST00000420843.2	37	c.27C>T	CCDS44684.1																																																																																				0.587	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384092.3	NM_004041		27	39	0	0	0	0.002096	0	27	39				
GAB2	9846	broad.mit.edu	37	11	77991824	77991824	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:77991824C>T	ENST00000361507.4	-	2	284	c.199G>A	c.(199-201)Gag>Aag	p.E67K	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_Missense_Mutation_p.E29K	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	67	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TCTACCTGCTCACAGAAGTTC	0.507																																							uc001ozh.2		NA																	0				ovary(5)|lung(1)	6						c.(199-201)GAG>AAG		GRB2-associated binding protein 2 isoform a							143.0	129.0	134.0					11																	77991824		2200	4292	6492	SO:0001583	missense	9846				osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr11:77991824C>T	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.199G>A	11.37:g.77991824C>T	ENSP00000354952:p.Glu67Lys		Somatic				GAB2_uc001ozg.2_Missense_Mutation_p.E29K	p.E67K	NM_080491	NP_536739	WXS	Illumina HiSeq	Unspecified	Q9UQC2	GAB2_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)		2	199	-	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		67			PH.		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	c.199G>A	CCDS8259.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989679	0.93106	.	.	ENSG00000033327	ENST00000340149;ENST00000361507;ENST00000528886;ENST00000530915	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	U	0.000001	D	0.82536	0.5058	L	0.41124	1.26	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.83736	0.0201	10	0.72032	D	0.01	-16.5983	19.4818	0.95013	0.0:1.0:0.0:0.0	.	67	Q9UQC2	GAB2_HUMAN	K	29;67;29;29	ENSP00000343959:E29K;ENSP00000354952:E67K;ENSP00000433762:E29K;ENSP00000431868:E29K	ENSP00000343959:E29K	E	-	1	0	GAB2	77669472	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.776000	0.85560	2.667000	0.90743	0.563000	0.77884	GAG		0.507	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		41	61	0	0	0	0.001951	0	41	61				
CREBZF	58487	broad.mit.edu	37	11	85375271	85375271	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:85375271C>T	ENST00000527447.1	-	1	875	c.649G>A	c.(649-651)Gct>Act	p.A217T	CREBZF_ENST00000398294.2_Missense_Mutation_p.A135T|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000534224.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	217	bZIP.				negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				AGGCGGgcagcggccgccgcc	0.657											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)	NSCLC(172;674 2044 9050 18334 41735)	uc001pas.2		NA																	0				ovary(1)	1						c.(649-651)GCT>ACT		HCF-binding transcription factor Zhangfei							24.0	29.0	28.0					11																	85375271		1785	3914	5699	SO:0001583	missense	58487				negative regulation of gene expression, epigenetic|negative regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|response to virus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:85375271C>T	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.649G>A	11.37:g.85375271C>T	ENSP00000433459:p.Ala217Thr		Somatic	OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1236	CREBZF_uc010rtc.1_RNA|CREBZF_uc010rtd.1_RNA	p.A217T	NM_001039618	NP_001034707	WXS	Illumina HiSeq	Unspecified	Q9NS37	ZHANG_HUMAN			1	912	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	217			Basic motif.		B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	ENST00000527447.1	37	c.649G>A	CCDS41697.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556721	0.86231	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	T;T	0.71222	-0.55;-0.55	4.89	4.89	0.63831	Basic-leucine zipper (bZIP) transcription factor (1);bZIP transcription factor, bZIP-1 (1);	0.000000	0.51477	D	0.000083	T	0.79052	0.4381	L	0.42245	1.32	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	T	0.77169	-0.2686	9	.	.	.	-18.3339	17.0273	0.86451	0.0:1.0:0.0:0.0	.	217	Q9NS37	ZHANG_HUMAN	T	135;217	ENSP00000381342:A135T;ENSP00000433459:A217T	.	A	-	1	0	CREBZF	85052919	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	5.958000	0.70330	2.542000	0.85734	0.655000	0.94253	GCT		0.657	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	NM_001039618		11	66	0	0	0	0.000673	0	11	66				
ATM	472	broad.mit.edu	37	11	108196896	108196896	+	Missense_Mutation	SNP	C	C	T	rs56009889	byFrequency	TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:108196896C>T	ENST00000452508.2	+	48	7108	c.6919C>T	c.(6919-6921)Ctt>Ttt	p.L2307F	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.L2307F			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2307	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.		L -> F. {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGAGCAGAGTCTTGCCCTGAG	0.403			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(6919-6921)CTT>TTT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1		C	PHE/LEU	1,4401	2.1+/-5.4	0,1,2200	109.0	105.0	106.0		6919	5.6	1.0	11	dbSNP_129	106	23,8573	16.0+/-53.3	0,23,4275	yes	missense	ATM	NM_000051.3	22	0,24,6475	TT,TC,CC		0.2676,0.0227,0.1846	possibly-damaging	2307/3057	108196896	24,12974	2201	4298	6499	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108196896C>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6919C>T	11.37:g.108196896C>T	ENSP00000388058:p.Leu2307Phe	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.L2307F|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.L959F|ATM_uc001pkg.1_Missense_Mutation_p.L664F	p.L2307F	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	47	7304	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	2307		L -> F.	FAT.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.6919C>T	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284611	0.80803	2.27E-4	0.002676	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.69561	-0.41;-0.41	5.58	5.58	0.84498	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-type fold (1);	0.060590	0.64402	D	0.000002	T	0.79879	0.4522	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.79936	-0.1593	10	0.52906	T	0.07	.	14.1569	0.65424	0.0:0.9282:0.0:0.0718	rs56009889	2307	Q13315	ATM_HUMAN	F	2307	ENSP00000278616:L2307F;ENSP00000388058:L2307F	ENSP00000278616:L2307F	L	+	1	0	ATM	107702106	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.720000	0.54933	2.792000	0.96026	0.557000	0.71058	CTT		0.403	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		17	24	0	0	0	0.006122	0	17	24				
KMT2A	4297	broad.mit.edu	37	11	118375477	118375477	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:118375477A>G	ENST00000389506.5	+	27	8861	c.8861A>G	c.(8860-8862)gAc>gGc	p.D2954G	KMT2A_ENST00000534358.1_Missense_Mutation_p.D2957G|KMT2A_ENST00000354520.4_Missense_Mutation_p.D2916G			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2954					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GTTATCTCAGACTCAGGGGAG	0.517																																							uc001pta.2		NA								T|O					MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB		AML|ALL		0				lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25						c.(8860-8862)GAC>GGC		myeloid/lymphoid or mixed-lineage leukemia							65.0	66.0	66.0					11																	118375477		2200	4295	6495	SO:0001583	missense	4297				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding	g.chr11:118375477A>G	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8861A>G	11.37:g.118375477A>G	ENSP00000374157:p.Asp2954Gly		Somatic				MLL_uc001ptb.2_Missense_Mutation_p.D2957G	p.D2954G	NM_005933	NP_005924	WXS	Illumina HiSeq	Unspecified	Q03164	MLL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)	27	8884	+	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)	2954					E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	c.8861A>G	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	9.801	1.180496	0.21787	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.84070	-1.79;-1.8;-1.76	6.17	6.17	0.99709	.	0.259729	0.43919	D	0.000511	T	0.78635	0.4314	L	0.29908	0.895	0.54753	D	0.999988	P;P	0.46395	0.877;0.877	B;B	0.43194	0.411;0.411	T	0.81420	-0.0941	10	0.66056	D	0.02	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	2957;2954	E9PQG7;Q03164	.;MLL1_HUMAN	G	2957;2954;2916;1864	ENSP00000436786:D2957G;ENSP00000374157:D2954G;ENSP00000346516:D2916G	ENSP00000346516:D2916G	D	+	2	0	MLL	117880687	1.000000	0.71417	0.999000	0.59377	0.666000	0.39218	6.900000	0.75687	2.371000	0.80710	0.533000	0.62120	GAC		0.517	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		21	39	0	0	0	0.001882	0	21	39				
TRAPPC4	51399	broad.mit.edu	37	11	118892538	118892538	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:118892538G>A	ENST00000533632.1	+	4	887	c.523G>A	c.(523-525)Gag>Aag	p.E175K	TRAPPC4_ENST00000533058.1_Missense_Mutation_p.E175K|MIR3656_ENST00000577421.1_RNA|TRAPPC4_ENST00000528230.1_Missense_Mutation_p.E132K|TRAPPC4_ENST00000434101.2_Missense_Mutation_p.E121K|SLC37A4_ENST00000525102.1_5'Flank|TRAPPC4_ENST00000526141.1_3'UTR|TRAPPC4_ENST00000525303.1_Missense_Mutation_p.E82K|TRAPPC4_ENST00000359005.4_Intron	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	175					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		AAAGATTTATGAGATTTACTC	0.438																																							uc010ryo.1		NA																	0					0						c.(523-525)GAG>AAG		trafficking protein particle complex 4							117.0	117.0	117.0					11																	118892538		2200	4295	6495	SO:0001583	missense	51399				dendrite development|ER to Golgi vesicle-mediated transport	cis-Golgi network|dendrite|endoplasmic reticulum|Golgi stack|synaptic vesicle	protein binding	g.chr11:118892538G>A	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.523G>A	11.37:g.118892538G>A	ENSP00000436005:p.Glu175Lys		Somatic				TRAPPC4_uc010ryp.1_Missense_Mutation_p.E121K|TRAPPC4_uc001pup.2_RNA|TRAPPC4_uc010ryq.1_Intron	p.E175K	NM_016146	NP_057230	WXS	Illumina HiSeq	Unspecified	Q9Y296	TPPC4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)	4	788	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)	175					A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	37	c.523G>A	CCDS8407.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960408	0.92791	.	.	ENSG00000196655	ENST00000533632;ENST00000528230;ENST00000525303;ENST00000434101;ENST00000533058	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.92	5.92	0.95590	Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	M	0.82823	2.61	0.80722	D	1	D;B	0.67145	0.996;0.099	D;B	0.66351	0.943;0.146	T	0.72802	-0.4183	10	0.52906	T	0.07	-23.9084	20.3248	0.98698	0.0:0.0:1.0:0.0	.	121;175	B4DME1;Q9Y296	.;TPPC4_HUMAN	K	175;132;82;121;175	ENSP00000436005:E175K;ENSP00000436827:E132K;ENSP00000435339:E82K;ENSP00000405033:E121K;ENSP00000432920:E175K	ENSP00000405033:E121K	E	+	1	0	TRAPPC4	118397748	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.837000	0.99465	2.818000	0.97014	0.655000	0.94253	GAG		0.438	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389332.1	NM_016146		8	77	0	0	0	0.00308	0	8	77				
OR6M1	390261	broad.mit.edu	37	11	123676362	123676362	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:123676362C>T	ENST00000309154.2	-	1	733	c.696G>A	c.(694-696)caG>caA	p.Q232Q		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		AAAAAGCTTTCTGACGGCCCT	0.512																																							uc010rzz.1		NA																	0				skin(2)	2						c.(694-696)CAG>CAA		olfactory receptor, family 6, subfamily M,							87.0	74.0	78.0					11																	123676362		2202	4299	6501	SO:0001819	synonymous_variant	390261				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123676362C>T	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.696G>A	11.37:g.123676362C>T			Somatic					p.Q232Q	NM_001005325	NP_001005325	WXS	Illumina HiSeq	Unspecified	Q8NGM8	OR6M1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)	1	696	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	232			Cytoplasmic (Potential).		B2RNK0|Q6IEW9|Q96R37	Silent	SNP	ENST00000309154.2	37	c.696G>A	CCDS31696.1																																																																																				0.512	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325		4	31	0	0	0	0.000248	0	4	31				
OR10G7	390265	broad.mit.edu	37	11	123908901	123908901	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:123908901C>A	ENST00000330487.5	-	1	816	c.808G>T	c.(808-810)Gtt>Ttt	p.V270F		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ACGGCCACAACCCCATGCAAG	0.507																																							uc001pzq.1		NA																	0				ovary(2)	2						c.(808-810)GTT>TTT		olfactory receptor, family 10, subfamily G,							101.0	91.0	95.0					11																	123908901		2200	4299	6499	SO:0001583	missense	390265				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123908901C>A	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.808G>T	11.37:g.123908901C>A	ENSP00000329689:p.Val270Phe		Somatic					p.V270F	NM_001004463	NP_001004463	WXS	Illumina HiSeq	Unspecified	Q8NGN6	O10G7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	808	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	270			Helical; Name=7; (Potential).		Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	c.808G>T	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291016	0.23564	.	.	ENSG00000182634	ENST00000330487	T	0.00274	8.35	3.38	-0.803	0.10886	GPCR, rhodopsin-like superfamily (1);	0.435365	0.16932	N	0.193619	T	0.00328	0.0010	L	0.42245	1.32	0.09310	N	1	P	0.44877	0.845	P	0.59171	0.853	T	0.48980	-0.8986	10	0.62326	D	0.03	.	8.2659	0.31813	0.0:0.5006:0.0:0.4994	.	270	Q8NGN6	O10G7_HUMAN	F	270	ENSP00000329689:V270F	ENSP00000329689:V270F	V	-	1	0	OR10G7	123414111	0.000000	0.05858	0.044000	0.18714	0.173000	0.22820	-5.026000	0.00158	-0.038000	0.13624	0.557000	0.71058	GTT		0.507	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		23	35	1	0	1.10513e-12	0.002299	2.52447e-12	23	35				
PRB4	5545	broad.mit.edu	37	12	11463272	11463272	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:11463272C>A	ENST00000535904.1	-	1	94	c.61G>T	c.(61-63)Gaa>Taa	p.E21*	PRB4_ENST00000445719.2_Nonsense_Mutation_p.E21*|PRB4_ENST00000279575.1_Nonsense_Mutation_p.E21*			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	0						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GTTTTACCTTCACTTGAACTC	0.532										HNSCC(22;0.051)																													uc001qzf.1		NA																	0				ovary(1)	1						c.(61-63)GAA>TAA		proline-rich protein BstNI subfamily 4							206.0	180.0	189.0					12																	11463272		2203	4300	6503	SO:0001587	stop_gained	5545					extracellular region		g.chr12:11463272C>A		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.61G>T	12.37:g.11463272C>A	ENSP00000442834:p.Glu21*	HNSCC(22;0.051)	Somatic				PRB4_uc001qzt.2_Nonsense_Mutation_p.E21*	p.E21*	NM_002723	NP_002714	WXS	Illumina HiSeq	Unspecified	P10163	PRB4_HUMAN			1	95	-			21					A1L439|O00600|P02813|P10161|P10162|P81489	Nonsense_Mutation	SNP	ENST00000535904.1	37	c.61G>T	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	12.72	2.023701	0.35701	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	.	.	.	1.07	-2.13	0.07144	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999992	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	1.5845	0.02641	0.3063:0.332:0.0:0.3618	.	.	.	.	X	21	.	ENSP00000279575:E21X	E	-	1	0	PRB4	11354539	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-3.006000	0.00650	-0.917000	0.03813	0.400000	0.26472	GAA		0.532	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		54	100	1	0	1.7104e-27	0.00361	4.36339e-27	54	100				
GRIN2B	2904	broad.mit.edu	37	12	13761752	13761752	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:13761752A>T	ENST00000609686.1	-	9	2004	c.1795T>A	c.(1795-1797)Tct>Act	p.S599T		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	599					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATGGTGAAAGAGGGTCCACCA	0.502																																							uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1795-1797)TCT>ACT		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						68.0	65.0	66.0					12																	13761752		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13761752A>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1795T>A	12.37:g.13761752A>T	ENSP00000477455:p.Ser599Thr		Somatic					p.S599T	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			9	1974	-			599			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.1795T>A	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	A	19.51	3.841849	0.71488	.	.	ENSG00000150086	ENST00000279593	T	0.53423	0.62	5.57	5.57	0.84162	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.57844	0.2081	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.54754	-0.8246	10	0.31617	T	0.26	.	15.7338	0.77827	1.0:0.0:0.0:0.0	.	599	Q13224	NMDE2_HUMAN	T	599	ENSP00000279593:S599T	ENSP00000279593:S599T	S	-	1	0	GRIN2B	13653019	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.301000	0.78850	2.107000	0.64212	0.533000	0.62120	TCT		0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			19	32	0	0	0	0.001523	0	19	32				
SOX5	6660	broad.mit.edu	37	12	24048791	24048791	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:24048791G>T	ENST00000451604.2	-	2	307	c.206C>A	c.(205-207)cCa>cAa	p.P69Q	SOX5_ENST00000546136.1_Missense_Mutation_p.P56Q|SOX5_ENST00000541847.1_Missense_Mutation_p.P59Q|SOX5_ENST00000441133.2_Intron|SOX5_ENST00000541536.1_Missense_Mutation_p.P56Q|SOX5_ENST00000537393.1_Intron|SOX5_ENST00000545921.1_Missense_Mutation_p.P59Q|SOX5_ENST00000309359.1_Missense_Mutation_p.P56Q|SOX5_ENST00000381381.2_Missense_Mutation_p.P56Q			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	69					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CAGAGAAACTGGCTGAAATTC	0.488																																							uc001rfw.2		NA																	0				ovary(5)|lung(1)	6						c.(205-207)CCA>CAA		SRY (sex determining region Y)-box 5 isoform a							232.0	225.0	228.0					12																	24048791		2203	4300	6503	SO:0001583	missense	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:24048791G>T	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.206C>A	12.37:g.24048791G>T	ENSP00000398273:p.Pro69Gln		Somatic				SOX5_uc001rfx.2_Missense_Mutation_p.P56Q|SOX5_uc001rfy.2_Missense_Mutation_p.P56Q|SOX5_uc010siv.1_Missense_Mutation_p.P56Q|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	p.P69Q	NM_006940	NP_008871	WXS	Illumina HiSeq	Unspecified	P35711	SOX5_HUMAN			2	308	-			69					B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	c.206C>A	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621936	0.46840	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000538083	D;D;D;D;D;D	0.96992	-4.19;-4.19;-4.2;-4.19;-4.2;-4.19	5.79	5.79	0.91817	.	0.121832	0.53938	D	0.000047	D	0.94925	0.8359	L	0.61387	1.9	0.49798	D	0.999824	P;B	0.34977	0.478;0.006	B;B	0.29663	0.105;0.011	D	0.93702	0.7016	10	0.41790	T	0.15	.	20.0349	0.97554	0.0:0.0:1.0:0.0	.	56;69	P35711-4;P35711	.;SOX5_HUMAN	Q	56;56;56;69;56;59;59;56	ENSP00000437487:P56Q;ENSP00000308927:P56Q;ENSP00000370788:P56Q;ENSP00000398273:P69Q;ENSP00000441973:P56Q;ENSP00000443520:P59Q	ENSP00000308927:P56Q	P	-	2	0	SOX5	23940058	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.141000	0.77330	2.744000	0.94065	0.650000	0.86243	CCA		0.488	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		77	123	1	0	1.19893e-55	0.00361	3.13876e-55	77	123				
ITPR2	3709	broad.mit.edu	37	12	26835601	26835601	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:26835601G>C	ENST00000381340.3	-	12	1570	c.1154C>G	c.(1153-1155)tCa>tGa	p.S385*		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	385	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CCGAACATATGAGTTCCTAAA	0.299																																							uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(1153-1155)TCA>TGA		inositol 1,4,5-triphosphate receptor, type 2							114.0	100.0	104.0					12																	26835601		1829	4075	5904	SO:0001587	stop_gained	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26835601G>C	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1154C>G	12.37:g.26835601G>C	ENSP00000370744:p.Ser385*		Somatic					p.S385*	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			12	1571	-	Colorectal(261;0.0847)		385			Cytoplasmic (Potential).|MIR 5.		O94773	Nonsense_Mutation	SNP	ENST00000381340.3	37	c.1154C>G	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	42	9.512276	0.99192	.	.	ENSG00000123104	ENST00000381340	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9991	0.89193	0.0:0.0:1.0:0.0	.	.	.	.	X	385	.	ENSP00000370744:S385X	S	-	2	0	ITPR2	26726868	1.000000	0.71417	0.948000	0.38648	0.842000	0.47809	9.502000	0.97981	2.462000	0.83206	0.650000	0.86243	TCA		0.299	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		3	48	0	0	0	0.004672	0	3	48				
ALG10B	144245	broad.mit.edu	37	12	38714293	38714293	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:38714293C>G	ENST00000308742.4	+	3	1016	c.700C>G	c.(700-702)Ctt>Gtt	p.L234V	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	234					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.L234I(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CAGAAAAATTCTTCAGTTTCT	0.373																																							uc001rln.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|skin(1)	3						c.(700-702)CTT>GTT		asparagine-linked glycosylation 10 homolog B							92.0	102.0	99.0					12																	38714293		2199	4294	6493	SO:0001583	missense	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38714293C>G	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.700C>G	12.37:g.38714293C>G	ENSP00000310120:p.Leu234Val		Somatic				ALG10B_uc001rlo.3_Missense_Mutation_p.L204V|ALG10B_uc010skk.1_Missense_Mutation_p.L174V	p.L234V	NM_001013620	NP_001013642	WXS	Illumina HiSeq	Unspecified	Q5I7T1	AG10B_HUMAN			3	839	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	234			Cytoplasmic (Potential).		B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	c.700C>G	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	N	1.765	-0.485809	0.04352	.	.	ENSG00000175548	ENST00000308742	T	0.56941	0.43	3.23	1.37	0.22104	.	0.315231	0.32343	N	0.006239	T	0.27731	0.0682	N	0.20845	0.615	0.09310	N	1	B	0.31026	0.304	B	0.29353	0.101	T	0.08513	-1.0718	10	0.18276	T	0.48	.	3.5876	0.07977	0.0:0.5504:0.2123:0.2373	.	234	Q5I7T1	AG10B_HUMAN	V	234	ENSP00000310120:L234V	ENSP00000310120:L234V	L	+	1	0	ALG10B	37000560	0.000000	0.05858	0.005000	0.12908	0.318000	0.28184	-0.636000	0.05465	0.380000	0.24823	-0.148000	0.13756	CTT		0.373	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		7	95	0	0	0	0.00308	0	7	95				
EIF4B	1975	broad.mit.edu	37	12	53421875	53421875	+	Silent	SNP	C	C	T	rs540767038		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:53421875C>T	ENST00000262056.9	+	8	1208	c.882C>T	c.(880-882)ggC>ggT	p.G294G	EIF4B_ENST00000416762.3_Silent_p.G255G|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Silent_p.G294G	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	294	Arg-rich.|Asp-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						ACAGAGGAGGCGGGGACCGCT	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18788	0.0		0.0	False		,,,				2504	0.0						uc001sbh.3		NA																	0				breast(1)|kidney(1)	2						c.(880-882)GGC>GGT		eukaryotic translation initiation factor 4B							77.0	81.0	80.0					12																	53421875		1916	4135	6051	SO:0001819	synonymous_variant	1975				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity	g.chr12:53421875C>T	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.882C>T	12.37:g.53421875C>T			Somatic				EIF4B_uc010snu.1_Silent_p.G294G|EIF4B_uc010snv.1_Silent_p.G255G|EIF4B_uc001sbi.2_Silent_p.G46G	p.G294G	NM_001417	NP_001408	WXS	Illumina HiSeq	Unspecified	P23588	IF4B_HUMAN			8	1088	+			294			Arg-rich.|Asp-rich.		Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Silent	SNP	ENST00000262056.9	37	c.882C>T	CCDS41788.1																																																																																				0.488	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417		10	74	0	0	0	0.000673	0	10	74				
MAP3K12	7786	broad.mit.edu	37	12	53879207	53879207	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:53879207T>A	ENST00000267079.2	-	6	1000	c.775A>T	c.(775-777)Aag>Tag	p.K259*	MAP3K12_ENST00000547488.1_Nonsense_Mutation_p.K292*|MAP3K12_ENST00000547035.1_Nonsense_Mutation_p.K292*|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	259	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CTCAGCTCCTTGGAAGTGCCA	0.532																																							uc001sdm.1		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(775-777)AAG>TAG		mitogen-activated protein kinase kinase kinase							235.0	225.0	229.0					12																	53879207		2203	4300	6503	SO:0001587	stop_gained	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53879207T>A	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.775A>T	12.37:g.53879207T>A	ENSP00000267079:p.Lys259*		Somatic				MAP3K12_uc001sdn.1_Nonsense_Mutation_p.K292*	p.K259*	NM_006301	NP_006292	WXS	Illumina HiSeq	Unspecified	Q12852	M3K12_HUMAN			6	873	-			259			Protein kinase.		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Nonsense_Mutation	SNP	ENST00000267079.2	37	c.775A>T	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	T	38	7.029160	0.98013	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	.	.	.	4.84	4.84	0.62591	.	0.000000	0.46442	D	0.000284	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	13.8275	0.63359	0.0:0.0:0.0:1.0	.	.	.	.	X	259;292;292	.	ENSP00000267079:K259X	K	-	1	0	MAP3K12	52165474	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.171000	0.68590	0.459000	0.35465	AAG		0.532	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		84	143	0	0	0	0.00361	0	84	143				
OR9K2	441639	broad.mit.edu	37	12	55524082	55524082	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:55524082G>T	ENST00000305377.5	+	1	618	c.530G>T	c.(529-531)gGc>gTc	p.G177V		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						TATTTTTGTGGCTGCATTAGC	0.453																																							uc010spe.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(529-531)GGC>GTC		olfactory receptor, family 9, subfamily K,							135.0	130.0	132.0					12																	55524082		2203	4300	6503	SO:0001583	missense	441639				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55524082G>T	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.530G>T	12.37:g.55524082G>T	ENSP00000307598:p.Gly177Val		Somatic					p.G177V	NM_001005243	NP_001005243	WXS	Illumina HiSeq	Unspecified	Q8NGE7	OR9K2_HUMAN			1	530	+			177			Helical; Name=4; (Potential).		B9EH19|Q6IFD6	Missense_Mutation	SNP	ENST00000305377.5	37	c.530G>T	CCDS31814.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431868	0.43122	.	.	ENSG00000170605	ENST00000305377	T	0.39056	1.1	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000056	T	0.74306	0.3699	M	0.93462	3.42	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.81586	-0.0865	10	0.87932	D	0	-15.1169	18.4253	0.90607	0.0:0.0:1.0:0.0	.	177	Q8NGE7	OR9K2_HUMAN	V	177	ENSP00000307598:G177V	ENSP00000307598:G177V	G	+	2	0	OR9K2	53810349	1.000000	0.71417	1.000000	0.80357	0.286000	0.27126	2.519000	0.45546	2.753000	0.94483	0.650000	0.86243	GGC		0.453	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1			37	62	1	0	2.75727e-19	0.004878	6.76257e-19	37	62				
DPY19L2	283417	broad.mit.edu	37	12	64062106	64062106	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:64062106C>A	ENST00000324472.4	-	1	251	c.68G>T	c.(67-69)cGc>cTc	p.R23L	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	23					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GGAGGCCCCGCGCCGCCCCTT	0.622																																							uc001srp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(67-69)CGC>CTC		dpy-19-like 2							15.0	20.0	19.0					12																	64062106		2178	4285	6463	SO:0001583	missense	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:64062106C>A		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.68G>T	12.37:g.64062106C>A	ENSP00000315988:p.Arg23Leu		Somatic				DPY19L2_uc009zqk.1_RNA	p.R23L	NM_173812	NP_776173	WXS	Illumina HiSeq	Unspecified	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	1	249	-			23					A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	c.68G>T	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	C	8.540	0.873146	0.17322	.	.	ENSG00000177990	ENST00000324472;ENST00000542209	T;T	0.41758	0.99;1.68	1.61	1.61	0.23674	.	12.498800	0.02127	U	0.056115	T	0.42108	0.1188	N	0.24115	0.695	0.80722	D	1	D	0.53745	0.962	P	0.53450	0.726	T	0.51834	-0.8655	9	.	.	.	.	6.6426	0.22917	0.0:1.0:0.0:0.0	.	23	Q6NUT2	D19L2_HUMAN	L	23	ENSP00000315988:R23L;ENSP00000444932:R23L	.	R	-	2	0	DPY19L2	62348373	0.978000	0.34361	0.799000	0.32177	0.069000	0.16628	1.094000	0.30951	1.191000	0.43056	0.195000	0.17529	CGC		0.622	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		14	21	1	0	2.62699e-14	0.003163	6.12088e-14	14	21				
PWP1	11137	broad.mit.edu	37	12	108086843	108086843	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:108086843G>A	ENST00000412830.3	+	5	640	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	PWP1_ENST00000541166.1_Missense_Mutation_p.E96K	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	158					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						TGGCCGAGCTGAACAGGACCA	0.338																																							uc001tmo.1		NA																	0					0						c.(472-474)GAA>AAA		periodic tryptophan protein 1							107.0	106.0	106.0					12																	108086843		2203	4300	6503	SO:0001583	missense	11137				transcription, DNA-dependent	nucleus		g.chr12:108086843G>A	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.472G>A	12.37:g.108086843G>A	ENSP00000387365:p.Glu158Lys		Somatic				PWP1_uc001tmn.1_RNA|PWP1_uc009zuu.1_Missense_Mutation_p.E158K	p.E158K	NM_007062	NP_008993	WXS	Illumina HiSeq	Unspecified	Q13610	PWP1_HUMAN			5	559	+			158					A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	c.472G>A	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	G	35	5.567953	0.96540	.	.	ENSG00000136045	ENST00000412830;ENST00000547995;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.74842	-0.88;-0.84	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.093105	0.64402	D	0.000001	D	0.84356	0.5454	M	0.77103	2.36	0.80722	D	1	P	0.52692	0.955	P	0.55161	0.77	D	0.85794	0.1369	10	0.72032	D	0.01	.	19.3784	0.94521	0.0:0.0:1.0:0.0	.	158	Q13610	PWP1_HUMAN	K	158;96;158;158;158;96	ENSP00000387365:E158K;ENSP00000445249:E96K	ENSP00000258531:E158K	E	+	1	0	PWP1	106610973	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.733000	0.91539	2.690000	0.91761	0.579000	0.79373	GAA		0.338	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062		4	36	0	0	0	0.000248	0	4	36				
WSCD2	9671	broad.mit.edu	37	12	108604015	108604015	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:108604015C>A	ENST00000332082.4	+	5	1433	c.615C>A	c.(613-615)agC>agA	p.S205R	WSCD2_ENST00000261400.3_Missense_Mutation_p.S205R|WSCD2_ENST00000547525.1_Missense_Mutation_p.S205R|WSCD2_ENST00000549903.1_Missense_Mutation_p.S205R			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	205	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						AGCGAGGCAGCGTGTGCGGCG	0.682																																							uc001tms.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(613-615)AGC>AGA		WSC domain containing 2							17.0	24.0	21.0					12																	108604015		2200	4289	6489	SO:0001583	missense	9671					integral to membrane		g.chr12:108604015C>A		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.615C>A	12.37:g.108604015C>A	ENSP00000331933:p.Ser205Arg		Somatic				WSCD2_uc001tmt.2_Missense_Mutation_p.S205R	p.S205R	NM_014653	NP_055468	WXS	Illumina HiSeq	Unspecified	Q2TBF2	WSCD2_HUMAN			4	1359	+			205			WSC 1.		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	c.615C>A	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165412	0.78339	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.12	2.3	0.28687	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.366358	0.34652	N	0.003798	T	0.46946	0.1419	L	0.47716	1.5	0.36185	D	0.849657	B	0.28419	0.211	B	0.35655	0.207	T	0.51545	-0.8692	10	0.59425	D	0.04	-18.6051	9.1269	0.36821	0.0:0.7622:0.0:0.2378	.	205	Q2TBF2	WSCD2_HUMAN	R	205;205;52;205;205	ENSP00000448047:S205R;ENSP00000261400:S205R;ENSP00000446744:S52R;ENSP00000331933:S205R;ENSP00000447272:S205R	ENSP00000261400:S205R	S	+	3	2	WSCD2	107128145	0.918000	0.31147	0.997000	0.53966	0.987000	0.75469	1.029000	0.30140	0.190000	0.20209	0.555000	0.69702	AGC		0.682	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		11	5	1	0	4.68919e-08	0.000673	9.66886e-08	11	5				
SSH1	54434	broad.mit.edu	37	12	109182309	109182309	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:109182309C>A	ENST00000326495.5	-	15	2698	c.2605G>T	c.(2605-2607)Ggc>Tgc	p.G869C	SSH1_ENST00000360239.3_Missense_Mutation_p.G557C	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	869					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACCAGGGGGCCCAGCTCGTGG	0.672																																							uc001tnm.2		NA																	0				ovary(4)	4						c.(2605-2607)GGC>TGC		slingshot 1 isoform 1							21.0	26.0	24.0					12																	109182309		2201	4297	6498	SO:0001583	missense	54434				actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr12:109182309C>A	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2605G>T	12.37:g.109182309C>A	ENSP00000315713:p.Gly869Cys		Somatic				SSH1_uc001tnl.2_Missense_Mutation_p.G557C	p.G869C	NM_018984	NP_061857	WXS	Illumina HiSeq	Unspecified	Q8WYL5	SSH1_HUMAN			15	2692	-			869					Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	37	c.2605G>T	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	C	7.049	0.563990	0.13498	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.12147	2.89;2.71	4.69	0.592	0.17471	.	4.361770	0.00357	N	0.000030	T	0.07908	0.0198	N	0.08118	0	0.09310	N	1	B;B	0.17667	0.002;0.023	B;B	0.17098	0.001;0.017	T	0.29458	-1.0011	10	0.49607	T	0.09	-1.3798	3.1204	0.06388	0.1431:0.5654:0.1383:0.1532	.	869;557	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	C	557;869	ENSP00000353374:G557C;ENSP00000315713:G869C	ENSP00000315713:G869C	G	-	1	0	SSH1	107706438	0.013000	0.17824	0.000000	0.03702	0.001000	0.01503	1.924000	0.40065	0.014000	0.14944	-0.749000	0.03505	GGC		0.672	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984		24	28	1	0	5.35356e-11	0.00278	1.18798e-10	24	28				
MYO1H	283446	broad.mit.edu	37	12	109862602	109862602	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:109862602C>A	ENST00000431443.2	+	16	1676	c.1676C>A	c.(1675-1677)gCc>gAc	p.A559D	MYO1H_ENST00000310903.5_Missense_Mutation_p.A549D	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	559	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						TTCCTGCTGGCCGAGTTAGAA	0.493																																							uc010sxn.1		NA																	0					0						c.(1645-1647)GCC>GAC		myosin 1H							60.0	61.0	61.0					12																	109862602		1876	4102	5978	SO:0001583	missense	283446					myosin complex	motor activity	g.chr12:109862602C>A		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1676C>A	12.37:g.109862602C>A	ENSP00000444076:p.Ala559Asp		Somatic					p.A549D	NM_001101421	NP_001094891	WXS	Illumina HiSeq	Unspecified	Q8N1T3	MYO1H_HUMAN			16	1646	+			Error:Variant_position_missing_in_B4DNW6_after_alignment					F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37	c.1646C>A		.	.	.	.	.	.	.	.	.	.	C	9.376	1.071689	0.20147	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87650	-2.28;-2.28	5.74	4.77	0.60923	.	.	.	.	.	T	0.73877	0.3643	N	0.04063	-0.285	0.09310	N	1	P	0.35745	0.518	B	0.30572	0.117	T	0.66854	-0.5818	9	0.40728	T	0.16	.	16.2683	0.82601	0.1415:0.8585:0.0:0.0	.	549	F5H3C6	.	D	549;559	ENSP00000439182:A549D;ENSP00000444076:A559D	ENSP00000439182:A549D	A	+	2	0	MYO1H	108346985	0.000000	0.05858	0.847000	0.33407	0.260000	0.26232	1.116000	0.31221	2.698000	0.92095	0.591000	0.81541	GCC		0.493	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597		12	13	1	0	0.00136819	0.001368	0.00257781	12	13				
KDM2B	84678	broad.mit.edu	37	12	121881557	121881557	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:121881557G>A	ENST00000377071.4	-	17	2563	c.2491C>T	c.(2491-2493)Ctc>Ttc	p.L831F	KDM2B_ENST00000377069.4_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.L199F|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	831					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CTCGGCGAGAGGTGAGAGGAG	0.627											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001uat.2		NA																	0				ovary(1)|skin(1)	2						c.(2491-2493)CTC>TTC		F-box and leucine-rich repeat protein 10 isoform							41.0	49.0	46.0					12																	121881557		1995	4162	6157	SO:0001583	missense	84678				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding	g.chr12:121881557G>A	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2491C>T	12.37:g.121881557G>A	ENSP00000366271:p.Leu831Phe		Somatic	OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1514	KDM2B_uc001uaq.2_Missense_Mutation_p.L271F|KDM2B_uc010szy.1_Missense_Mutation_p.L271F|KDM2B_uc001uar.2_Missense_Mutation_p.L422F|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Missense_Mutation_p.L79F|KDM2B_uc010szx.1_Missense_Mutation_p.L79F|KDM2B_uc001uap.2_RNA	p.L831F	NM_032590	NP_115979	WXS	Illumina HiSeq	Unspecified	Q8NHM5	KDM2B_HUMAN			17	2595	-			831					A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	c.2491C>T	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	9.154	1.016937	0.19355	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377071;ENST00000540043;ENST00000261824	T;T	0.24538	2.2;1.85	6.04	2.95	0.34219	.	0.000000	0.39909	N	0.001224	T	0.17195	0.0413	L	0.38175	1.15	0.80722	D	1	B;B;B	0.14805	0.003;0.011;0.003	B;B;B	0.11329	0.003;0.006;0.003	T	0.10177	-1.0641	10	0.62326	D	0.03	-15.4071	4.4405	0.11572	0.0835:0.1543:0.6026:0.1596	.	271;831;274	B7ZB05;Q8NHM5;B4DSN4	.;KDM2B_HUMAN;.	F	831;199;831;274;834	ENSP00000437821:L199F;ENSP00000366271:L831F	ENSP00000261824:L834F	L	-	1	0	KDM2B	120365940	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.589000	0.53972	1.506000	0.48736	0.561000	0.74099	CTC		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590		12	44	0	0	0	0.001855	0	12	44				
TMEM120B	144404	broad.mit.edu	37	12	122150869	122150869	+	Splice_Site	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr12:122150869A>T	ENST00000449592.2	+	1	169	c.68A>T	c.(67-69)cAg>cTg	p.Q23L		NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	23						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CAAGAACTGCAGGTAGGGCCA	0.701																																							uc001ubc.3		NA																	0					0						c.(67-69)CAG>CTG		transmembrane protein 120B							30.0	37.0	35.0					12																	122150869		2023	4167	6190	SO:0001630	splice_region_variant	144404					integral to membrane		g.chr12:122150869A>T	BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.69+1A>T	12.37:g.122150869A>T			Somatic				TMEM120B_uc009zxh.2_Missense_Mutation_p.Q23L	p.Q23L	NM_001080825	NP_001074294	WXS	Illumina HiSeq	Unspecified	A0PK00	T120B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)	1	212	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		23			Potential.		A0PK01|B3KX33	Missense_Mutation	SNP	ENST00000449592.2	37	c.68A>T	CCDS41852.1	.	.	.	.	.	.	.	.	.	.	a	11.90	1.775409	0.31411	.	.	ENSG00000188735	ENST00000449592	T	0.33216	1.42	4.03	4.03	0.46877	.	0.061993	0.64402	D	0.000003	T	0.34542	0.0901	M	0.76002	2.32	0.80722	D	1	B	0.24675	0.109	B	0.30251	0.113	T	0.25779	-1.0122	10	0.49607	T	0.09	-22.3515	9.286	0.37758	1.0:0.0:0.0:0.0	.	23	A0PK00	T120B_HUMAN	L	23	ENSP00000404991:Q23L	ENSP00000345152:Q23L	Q	+	2	0	TMEM120B	120635252	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	4.143000	0.58051	1.687000	0.51057	0.377000	0.23210	CAG		0.701	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402158.1	NM_001080825	Missense_Mutation	7	12	0	0	0	0.001984	0	7	12				
SACS	26278	broad.mit.edu	37	13	23913577	23913577	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:23913577C>A	ENST00000382292.3	-	9	4711	c.4438G>T	c.(4438-4440)Gaa>Taa	p.E1480*	SACS_ENST00000402364.1_Nonsense_Mutation_p.E730*|SACS_ENST00000382298.3_Nonsense_Mutation_p.E1480*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1480					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E1333*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGAAGTAGTTCTTTAAAAATA	0.363																																							uc001uon.2		NA																	1	Substitution - Nonsense(1)		large_intestine(1)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4438-4440)GAA>TAA		sacsin							72.0	72.0	72.0					13																	23913577		2203	4299	6502	SO:0001587	stop_gained	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23913577C>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4438G>T	13.37:g.23913577C>A	ENSP00000371729:p.Glu1480*		Somatic				SACS_uc001uoo.2_Nonsense_Mutation_p.E1333*|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.E1480*	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	5027	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	1480					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	37	c.4438G>T	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	55	23.451959	0.99955	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0413	0.97592	0.0:1.0:0.0:0.0	.	.	.	.	X	1480;730;1480	.	ENSP00000371729:E1480X	E	-	1	0	SACS	22811577	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.487000	0.81328	2.751000	0.94390	0.650000	0.86243	GAA		0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		17	39	1	0	1.67942e-08	0.006122	3.48342e-08	17	39				
CENPJ	55835	broad.mit.edu	37	13	25479865	25479865	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:25479865C>T	ENST00000381884.4	-	7	2496	c.2311G>A	c.(2311-2313)Gaa>Aaa	p.E771K	CENPJ_ENST00000545981.1_Missense_Mutation_p.E771K	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	771					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTTATGCTTTCCATGATAGAC	0.408																																							uc001upt.3		NA																	0				ovary(2)	2						c.(2311-2313)GAA>AAA		centromere protein J							174.0	168.0	170.0					13																	25479865		2203	4300	6503	SO:0001583	missense	55835				cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding	g.chr13:25479865C>T	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2311G>A	13.37:g.25479865C>T	ENSP00000371308:p.Glu771Lys		Somatic				CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_5'Flank	p.E771K	NM_018451	NP_060921	WXS	Illumina HiSeq	Unspecified	Q9HC77	CENPJ_HUMAN		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)	7	2564	-		Lung SC(185;0.0225)|Breast(139;0.0602)	771					Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	c.2311G>A	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335115	0.24253	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.37584	1.19;1.76	5.8	5.8	0.92144	.	0.092619	0.47455	D	0.000232	T	0.48095	0.1481	M	0.75447	2.3	0.41073	D	0.985468	P	0.52316	0.952	P	0.47075	0.536	T	0.42120	-0.9470	10	0.27082	T	0.32	.	18.8181	0.92085	0.0:1.0:0.0:0.0	.	771	Q9HC77	CENPJ_HUMAN	K	771	ENSP00000371308:E771K;ENSP00000441090:E771K	ENSP00000371308:E771K	E	-	1	0	CENPJ	24377865	0.436000	0.25586	0.341000	0.25589	0.020000	0.10135	1.544000	0.36158	2.729000	0.93468	0.563000	0.77884	GAA		0.408	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		11	114	0	0	0	0.00245	0	11	114				
MTUS2	23281	broad.mit.edu	37	13	29600969	29600969	+	Nonsense_Mutation	SNP	G	G	T	rs552392007		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:29600969G>T	ENST00000431530.3	+	1	2222	c.2164G>T	c.(2164-2166)Gga>Tga	p.G722*		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	712	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTTCAGTTCCGGATTGATGGT	0.483																																							uc001usl.3		NA																	0					0						c.(2164-2166)GGA>TGA		hypothetical protein LOC23281 isoform a							66.0	67.0	67.0					13																	29600969		1884	4101	5985	SO:0001587	stop_gained	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29600969G>T	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2164G>T	13.37:g.29600969G>T	ENSP00000392057:p.Gly722*		Somatic					p.G722*	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	2222	+			712			Mediates interaction with MAPRE1.		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Nonsense_Mutation	SNP	ENST00000431530.3	37	c.2164G>T	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	g	42	9.812165	0.99270	.	.	ENSG00000132938	ENST00000431530	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	.	.	.	X	722	.	.	G	+	1	0	MTUS2	28498969	1.000000	0.71417	0.290000	0.24890	0.992000	0.81027	7.040000	0.76551	2.941000	0.99782	0.655000	0.94253	GGA		0.483	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		17	33	1	0	1.5739e-10	0.004007	3.4815e-10	17	33				
MEDAG	84935	broad.mit.edu	37	13	31495969	31495969	+	Missense_Mutation	SNP	G	G	T	rs181484496	byFrequency	TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:31495969G>T	ENST00000380482.4	+	4	1098	c.773G>T	c.(772-774)aGt>aTt	p.S258I	TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000451495.2_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000588425.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000588726.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	258					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGAAAGTTCAGTGTAACTTCC	0.358																																							uc001uth.3		NA																	0					0						c.(772-774)AGT>ATT		hypothetical protein LOC84935							44.0	45.0	45.0					13																	31495969		2203	4300	6503	SO:0001583	missense	84935							g.chr13:31495969G>T	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.773G>T	13.37:g.31495969G>T	ENSP00000369849:p.Ser258Ile		Somatic				uc001utg.1_Intron	p.S258I	NM_032849	NP_116238	WXS	Illumina HiSeq	Unspecified	Q5VYS4	CM033_HUMAN		all cancers(112;0.00914)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.0559)|GBM - Glioblastoma multiforme(144;0.244)	4	1114	+		Lung SC(185;0.0281)	258					Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	c.773G>T	CCDS9338.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722421	0.68959	.	.	ENSG00000102802	ENST00000380482	T	0.58060	0.36	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.62684	0.2448	L	0.29908	0.895	0.39289	D	0.964706	D	0.69078	0.997	D	0.80764	0.994	T	0.67409	-0.5678	10	0.87932	D	0	-18.5322	16.471	0.84112	0.0:0.0:1.0:0.0	.	258	Q5VYS4	CM033_HUMAN	I	258	ENSP00000369849:S258I	ENSP00000369849:S258I	S	+	2	0	C13orf33	30393969	1.000000	0.71417	0.965000	0.40720	0.810000	0.45777	5.711000	0.68400	2.626000	0.88956	0.462000	0.41574	AGT		0.358	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849		12	30	1	0	4.36969e-10	0.001855	9.54504e-10	12	30				
COG3	83548	broad.mit.edu	37	13	46050481	46050481	+	Splice_Site	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:46050481A>G	ENST00000349995.5	+	2	432	c.320A>G	c.(319-321)cAg>cGg	p.Q107R		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	107				QQ -> HE (in Ref. 1; AAK66974). {ECO:0000305}.	ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		ACCGCACAGCAGGTGAATTGC	0.373																																					Ovarian(150;1048 1859 18083 21577 42700)	Ovarian(150;1048 1859 18083 21577 42700)	uc001vak.2		NA																	0				breast(1)|skin(1)	2						c.(319-321)CAG>CGG		component of golgi transport complex 3							83.0	81.0	82.0					13																	46050481		2203	4300	6503	SO:0001630	splice_region_variant	83548				ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity	g.chr13:46050481A>G	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.321+1A>G	13.37:g.46050481A>G			Somatic				COG3_uc010tfu.1_RNA|COG3_uc001vai.2_Missense_Mutation_p.Q107R|COG3_uc001vaj.1_Missense_Mutation_p.Q107R|COG3_uc010tfv.1_5'UTR|COG3_uc010aci.2_5'UTR	p.Q107R	NM_031431	NP_113619	WXS	Illumina HiSeq	Unspecified	Q96JB2	COG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)	2	421	+		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	107	QQ -> HE (in Ref. 1; AAK66974).				B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	37	c.320A>G	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119784	0.77323	.	.	ENSG00000136152	ENST00000349995	T	0.48201	0.82	5.44	5.44	0.79542	.	0.057908	0.64402	D	0.000001	T	0.65428	0.2690	M	0.61703	1.905	0.80722	D	1	P;D;P	0.69078	0.92;0.997;0.841	B;D;P	0.77557	0.386;0.99;0.57	T	0.65821	-0.6075	10	0.46703	T	0.11	-11.8956	14.9604	0.71153	1.0:0.0:0.0:0.0	.	107;107;107	Q96JB2;B4DH72;Q96JB2-2	COG3_HUMAN;.;.	R	107	ENSP00000258654:Q107R	ENSP00000258654:Q107R	Q	+	2	0	COG3	44948482	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	8.678000	0.91211	2.182000	0.69389	0.533000	0.62120	CAG		0.373	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		Missense_Mutation	8	28	0	0	0	0.00308	0	8	28				
COG3	83548	broad.mit.edu	37	13	46050484	46050484	+	Splice_Site	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:46050484T>A	ENST00000349995.5	+	2	433		c.e2+2			NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3						ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GCACAGCAGGTGAATTGCAGT	0.373																																					Ovarian(150;1048 1859 18083 21577 42700)	Ovarian(150;1048 1859 18083 21577 42700)	uc001vak.2		NA																	0				breast(1)|skin(1)	2						c.e2+2		component of golgi transport complex 3							81.0	79.0	79.0					13																	46050484		2203	4300	6503	SO:0001630	splice_region_variant	83548				ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity	g.chr13:46050484T>A	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.321+2T>A	13.37:g.46050484T>A			Somatic				COG3_uc010tfu.1_Splice_Site|COG3_uc001vai.2_Splice_Site_p.Q107_splice|COG3_uc001vaj.1_Splice_Site_p.Q107_splice|COG3_uc010tfv.1_Splice_Site|COG3_uc010aci.2_Splice_Site	p.Q107_splice	NM_031431	NP_113619	WXS	Illumina HiSeq	Unspecified	Q96JB2	COG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)	2	422	+		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)						B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Splice_Site	SNP	ENST00000349995.5	37	c.321_splice	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.068405	0.76301	.	.	ENSG00000136152	ENST00000349995	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9604	0.71153	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COG3	44948485	1.000000	0.71417	0.993000	0.49108	0.842000	0.47809	7.114000	0.77103	2.182000	0.69389	0.533000	0.62120	.		0.373	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		Intron	9	27	0	0	0	0.004482	0	9	27				
PCDH17	27253	broad.mit.edu	37	13	58208112	58208112	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr13:58208112G>T	ENST00000377918.3	+	1	1458	c.1432G>T	c.(1432-1434)Gtg>Ttg	p.V478L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGGGCTCTACGTGCTTCAGGT	0.602																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(1432-1434)GTG>TTG		protocadherin 17 precursor							49.0	45.0	46.0					13																	58208112		2203	4300	6503	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58208112G>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1432G>T	13.37:g.58208112G>T	ENSP00000367151:p.Val478Leu		Somatic				PCDH17_uc010aec.1_Missense_Mutation_p.V478L	p.V478L	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	2324	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	478			Extracellular (Potential).|Cadherin 5.		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.1432G>T	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386337	0.25031	.	.	ENSG00000118946	ENST00000377918	T	0.52526	0.66	5.58	4.7	0.59300	Cadherin (4);Cadherin-like (1);	0.107799	0.64402	D	0.000005	T	0.28928	0.0718	N	0.05330	-0.07	0.41335	D	0.987262	B;B	0.13594	0.008;0.003	B;B	0.20955	0.032;0.01	T	0.09400	-1.0676	9	.	.	.	.	16.5422	0.84395	0.0:0.1301:0.8699:0.0	.	478;478	O14917-2;O14917	.;PCD17_HUMAN	L	478	ENSP00000367151:V478L	.	V	+	1	0	PCDH17	57106113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.287000	0.51732	2.640000	0.89533	0.561000	0.74099	GTG		0.602	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		13	18	1	0	0.000151284	0.001855	0.000296212	13	18				
OR4K2	390431	broad.mit.edu	37	14	20344916	20344916	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:20344916C>A	ENST00000298642.2	+	1	526	c.490C>A	c.(490-492)Ctc>Atc	p.L164I		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATATTTGCCCTCACGTTACC	0.483																																							uc001vwh.1		NA																	0				ovary(2)|skin(2)	4						c.(490-492)CTC>ATC		olfactory receptor, family 4, subfamily K,							404.0	394.0	398.0					14																	20344916		2203	4300	6503	SO:0001583	missense	390431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20344916C>A		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.490C>A	14.37:g.20344916C>A	ENSP00000298642:p.Leu164Ile		Somatic					p.L164I	NM_001005501	NP_001005501	WXS	Illumina HiSeq	Unspecified	Q8NGD2	OR4K2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	490	+	all_cancers(95;0.00108)		164			Extracellular (Potential).		B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	37	c.490C>A	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	8.092	0.774771	0.16051	.	.	ENSG00000165762	ENST00000298642	T	0.00211	8.54	5.12	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.163255	0.28754	N	0.014252	T	0.00178	0.0005	L	0.47716	1.5	0.09310	N	1	B	0.17465	0.022	B	0.24006	0.05	T	0.39643	-0.9604	10	0.35671	T	0.21	.	8.7215	0.34443	0.1678:0.6697:0.1624:0.0	.	164	Q8NGD2	OR4K2_HUMAN	I	164	ENSP00000298642:L164I	ENSP00000298642:L164I	L	+	1	0	OR4K2	19414756	0.000000	0.05858	0.998000	0.56505	0.676000	0.39594	-0.657000	0.05335	2.660000	0.90430	0.563000	0.77884	CTC		0.483	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1			27	522	1	0	4.59853e-10	0.005443	1.00136e-09	27	522				
OR11H6	122748	broad.mit.edu	37	14	20692590	20692590	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:20692590G>T	ENST00000315519.2	+	1	800	c.722G>T	c.(721-723)aGa>aTa	p.R241I		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		CTGGTCATCAGAGCTGTGCTT	0.473																																							uc010tlc.1		NA																	0				ovary(2)|skin(1)	3						c.(721-723)AGA>ATA		olfactory receptor, family 11, subfamily H,							114.0	100.0	105.0					14																	20692590		2203	4300	6503	SO:0001583	missense	122748				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20692590G>T		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.722G>T	14.37:g.20692590G>T	ENSP00000319071:p.Arg241Ile		Somatic					p.R241I	NM_001004480	NP_001004480	WXS	Illumina HiSeq	Unspecified	Q8NGC7	O11H6_HUMAN	Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)	1	722	+	all_cancers(95;0.00108)		241			Cytoplasmic (Potential).		Q6IF08	Missense_Mutation	SNP	ENST00000315519.2	37	c.722G>T	CCDS32033.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559883	0.27827	.	.	ENSG00000176219	ENST00000315519	T	0.38560	1.13	4.78	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000089	T	0.31796	0.0808	L	0.38733	1.17	0.40985	D	0.984806	B	0.19935	0.04	B	0.24006	0.05	T	0.09997	-1.0649	10	0.23302	T	0.38	.	10.7593	0.46256	0.0939:0.0:0.9061:0.0	.	241	Q8NGC7	O11H6_HUMAN	I	241	ENSP00000319071:R241I	ENSP00000319071:R241I	R	+	2	0	OR11H6	19762430	0.000000	0.05858	1.000000	0.80357	0.884000	0.51177	-0.493000	0.06459	1.223000	0.43536	0.471000	0.43371	AGA		0.473	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1			22	18	1	0	5.35356e-11	0.00278	1.18798e-10	22	18				
ADCY4	196883	broad.mit.edu	37	14	24787633	24787633	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:24787633T>G	ENST00000310677.4	-	26	3336	c.3223A>C	c.(3223-3225)Acc>Ccc	p.T1075P	ADCY4_ENST00000554068.2_Missense_Mutation_p.T1075P|ADCY4_ENST00000418030.2_Missense_Mutation_p.T1075P	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	1075					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CAGCCTAGGGTAGCTGAAGGA	0.527																																							uc001wov.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(3223-3225)ACC>CCC		adenylate cyclase 4							144.0	131.0	135.0					14																	24787633		2203	4300	6503	SO:0001583	missense	196883				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding	g.chr14:24787633T>G	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.3223A>C	14.37:g.24787633T>G	ENSP00000312126:p.Thr1075Pro		Somatic				ADCY4_uc001wow.2_Missense_Mutation_p.T1075P|ADCY4_uc010toh.1_Missense_Mutation_p.T761P|ADCY4_uc001wox.2_Missense_Mutation_p.T1075P|ADCY4_uc001woy.2_Missense_Mutation_p.T1075P	p.T1075P	NM_139247	NP_640340	WXS	Illumina HiSeq	Unspecified	Q8NFM4	ADCY4_HUMAN		GBM - Glioblastoma multiforme(265;0.0192)	25	3229	-			1075			Cytoplasmic (Potential).		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	c.3223A>C	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	T	9.835	1.189566	0.21954	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.76578	-1.03;-1.03;-1.03	5.52	3.18	0.36537	.	0.442674	0.19121	N	0.122198	T	0.64416	0.2596	L	0.34521	1.04	0.21220	N	0.99976	B	0.06786	0.001	B	0.06405	0.002	T	0.53070	-0.8490	10	0.41790	T	0.15	.	6.9676	0.24631	0.0:0.2583:0.0:0.7417	.	1075	Q8NFM4	ADCY4_HUMAN	P	1075	ENSP00000312126:T1075P;ENSP00000452250:T1075P;ENSP00000393177:T1075P	ENSP00000312126:T1075P	T	-	1	0	ADCY4	23857473	0.001000	0.12720	0.978000	0.43139	0.355000	0.29361	0.159000	0.16442	0.391000	0.25143	0.533000	0.62120	ACC		0.527	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			12	20	0	0	0	0.001368	0	12	20				
ARHGAP5	394	broad.mit.edu	37	14	32624010	32624010	+	Silent	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:32624010A>G	ENST00000345122.3	+	7	4680	c.4365A>G	c.(4363-4365)gtA>gtG	p.V1455V	ARHGAP5_ENST00000556611.1_Silent_p.V1454V|ARHGAP5_ENST00000396582.2_Silent_p.V190V|ARHGAP5_ENST00000433497.1_Silent_p.V194V|ARHGAP5_ENST00000539826.2_Silent_p.V1455V|ARHGAP5_ENST00000432921.1_Silent_p.V1454V	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1455					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GAGAAATTGTAGAAACGACAA	0.428																																					NSCLC(9;77 350 3443 29227 41353)	NSCLC(9;77 350 3443 29227 41353)	uc001wrl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(4363-4365)GTA>GTG		Rho GTPase activating protein 5 isoform b							60.0	56.0	58.0					14																	32624010		2203	4300	6503	SO:0001819	synonymous_variant	394				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding	g.chr14:32624010A>G	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4365A>G	14.37:g.32624010A>G			Somatic				ARHGAP5_uc001wrm.2_Silent_p.V1454V|ARHGAP5_uc001wrn.2_Silent_p.V1455V|ARHGAP5_uc001wro.2_Silent_p.V194V|ARHGAP5_uc001wrp.2_Silent_p.V190V	p.V1455V	NM_001173	NP_001025226	WXS	Illumina HiSeq	Unspecified	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)	7	4604	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		1455					A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Silent	SNP	ENST00000345122.3	37	c.4365A>G	CCDS32062.1																																																																																				0.428	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		17	33	0	0	0	0.004007	0	17	33				
MDGA2	161357	broad.mit.edu	37	14	47342758	47342758	+	Nonsense_Mutation	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:47342758A>T	ENST00000399232.2	-	14	2787	c.2423T>A	c.(2422-2424)tTg>tAg	p.L808*	MDGA2_ENST00000439988.3_Nonsense_Mutation_p.L877*|MDGA2_ENST00000426342.1_Nonsense_Mutation_p.L579*|MDGA2_ENST00000399222.3_Nonsense_Mutation_p.L10*|MDGA2_ENST00000357362.3_Nonsense_Mutation_p.L579*	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	808	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTCGCCTTCCAATCTGGGTCG	0.363																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(2422-2424)TTG>TAG		MAM domain containing 1 isoform 1							134.0	129.0	131.0					14																	47342758		1849	4097	5946	SO:0001587	stop_gained	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47342758A>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2423T>A	14.37:g.47342758A>T	ENSP00000382178:p.Leu808*		Somatic				MDGA2_uc001wwh.3_Nonsense_Mutation_p.L10*|MDGA2_uc001wwi.3_Nonsense_Mutation_p.L579*|MDGA2_uc010ani.2_Nonsense_Mutation_p.L368*	p.L808*	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			14	2619	-			808			MAM.		F6W3S7|J3KPX6	Nonsense_Mutation	SNP	ENST00000399232.2	37	c.2423T>A		.	.	.	.	.	.	.	.	.	.	A	38	6.884276	0.97908	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000399222;ENST00000357362	.	.	.	5.19	5.19	0.71726	.	0.155857	0.28067	U	0.016727	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	14.1626	0.65457	1.0:0.0:0.0:0.0	.	.	.	.	X	808;579;877;10;579	.	ENSP00000349925:L579X	L	-	2	0	MDGA2	46412508	0.996000	0.38824	0.924000	0.36721	0.995000	0.86356	3.230000	0.51286	2.078000	0.62432	0.383000	0.25322	TTG		0.363	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		44	63	0	0	0	0.002852	0	44	63				
ZFYVE26	23503	broad.mit.edu	37	14	68222664	68222664	+	Splice_Site	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:68222664C>A	ENST00000347230.4	-	36	6925		c.e36+1		ZFYVE26_ENST00000557306.1_Splice_Site	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCTGCCATTACCTTCATAAAC	0.517																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.e36+1		zinc finger, FYVE domain containing 26							207.0	200.0	202.0					14																	68222664		2203	4300	6503	SO:0001630	splice_region_variant	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68222664C>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6786+1G>T	14.37:g.68222664C>A			Somatic				ZFYVE26_uc010tsz.1_Splice_Site|ZFYVE26_uc001xkb.2_Splice_Site_p.K108_splice	p.K2262_splice	NM_015346	NP_056161	WXS	Illumina HiSeq	Unspecified	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	36	6925	-								B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Splice_Site	SNP	ENST00000347230.4	37	c.6786_splice	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501429	0.64298	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000557306	.	.	.	5.25	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7763	0.63055	0.0:0.9258:0.0:0.0742	.	.	.	.	.	-1	.	.	.	-	.	.	ZFYVE26	67292417	1.000000	0.71417	0.987000	0.45799	0.828000	0.46876	7.818000	0.86416	1.231000	0.43661	0.462000	0.41574	.		0.517	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	Intron	90	129	1	0	6.44939e-38	0.00361	1.66968e-37	90	129				
ENTPD5	957	broad.mit.edu	37	14	74443113	74443113	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:74443113G>C	ENST00000334696.6	-	9	875	c.556C>G	c.(556-558)Cag>Gag	p.Q186E	ENTPD5_ENST00000557325.1_Missense_Mutation_p.Q186E	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	186					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CCATGCAGCTGACCTGTCAAA	0.512																																							uc010tuo.1		NA																	0				ovary(1)	1						c.(556-558)CAG>GAG		ectonucleoside triphosphate diphosphohydrolase 5							82.0	71.0	75.0					14																	74443113		2203	4300	6503	SO:0001583	missense	957				'de novo' posttranslational protein folding|ATP metabolic process|cell growth|cell proliferation|glycolysis|protein N-linked glycosylation|regulation of phosphatidylinositol 3-kinase cascade	endoplasmic reticulum lumen	guanosine-diphosphatase activity|uridine-diphosphatase activity	g.chr14:74443113G>C	AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.556C>G	14.37:g.74443113G>C	ENSP00000335246:p.Gln186Glu		Somatic				ENTPD5_uc001xpi.2_Missense_Mutation_p.Q186E	p.Q186E	NM_001249	NP_001240	WXS	Illumina HiSeq	Unspecified	O75356	ENTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00394)	9	867	-			186					A1L4C5|Q96RX0	Missense_Mutation	SNP	ENST00000334696.6	37	c.556C>G	CCDS9825.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909138	0.52439	.	.	ENSG00000187097	ENST00000557325;ENST00000334696;ENST00000553284	T;T;T	0.10960	2.82;2.82;2.82	5.53	5.53	0.82687	.	0.054460	0.85682	D	0.000000	T	0.21921	0.0528	L	0.42245	1.32	0.80722	D	1	P;P	0.49307	0.922;0.905	P;P	0.54924	0.764;0.652	T	0.00073	-1.2125	10	0.33940	T	0.23	-9.1098	19.6556	0.95837	0.0:0.0:1.0:0.0	.	186;186	O75356;G3V4I0	ENTP5_HUMAN;.	E	186	ENSP00000451810:Q186E;ENSP00000335246:Q186E;ENSP00000451591:Q186E	ENSP00000335246:Q186E	Q	-	1	0	ENTPD5	73512866	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.437000	0.90302	2.882000	0.98803	0.655000	0.94253	CAG		0.512	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249		8	52	0	0	0	0.004482	0	8	52				
CIPC	85457	broad.mit.edu	37	14	77580090	77580090	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:77580090C>G	ENST00000361786.2	+	4	946	c.629C>G	c.(628-630)tCc>tGc	p.S210C	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		210					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		GCTGTCCCATCCAGTCCCTCG	0.562																																							uc001xtd.2		NA																	0					0						c.(628-630)TCC>TGC		KIAA1737 protein							47.0	47.0	47.0					14																	77580090		2203	4300	6503	SO:0001583	missense	85457							g.chr14:77580090C>G																												ENST00000361786.2:c.629C>G	14.37:g.77580090C>G	ENSP00000355319:p.Ser210Cys		Somatic				KIAA1737_uc001xtc.1_Missense_Mutation_p.S112C	p.S210C	NM_033426	NP_219494	WXS	Illumina HiSeq	Unspecified	Q9C0C6	K1737_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)	4	808	+			210					B2RCI1|Q8N389|Q8NDZ1	Missense_Mutation	SNP	ENST00000361786.2	37	c.629C>G	CCDS9855.1	.	.	.	.	.	.	.	.	.	.	C	9.373	1.071044	0.20147	.	.	ENSG00000198894	ENST00000361786	T	0.35048	1.33	5.75	4.86	0.63082	.	0.801233	0.11375	N	0.570419	T	0.42653	0.1212	L	0.56769	1.78	0.51767	D	0.999933	B;B	0.31581	0.329;0.329	B;B	0.39562	0.303;0.303	T	0.14811	-1.0459	10	0.38643	T	0.18	-17.7546	12.0462	0.53480	0.0:0.9206:0.0:0.0794	.	210;112	Q9C0C6;B3KU75	K1737_HUMAN;.	C	210	ENSP00000355319:S210C	ENSP00000355319:S210C	S	+	2	0	KIAA1737	76649843	0.103000	0.21917	0.003000	0.11579	0.021000	0.10359	4.148000	0.58085	1.430000	0.47334	0.455000	0.32223	TCC		0.562	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414278.1			4	45	0	0	0	0.000248	0	4	45				
TC2N	123036	broad.mit.edu	37	14	92258854	92258854	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:92258854G>C	ENST00000435962.2	-	9	1227	c.904C>G	c.(904-906)Cta>Gta	p.L302V	TC2N_ENST00000556018.1_Intron|TC2N_ENST00000360594.5_Missense_Mutation_p.L302V|TC2N_ENST00000340892.5_Missense_Mutation_p.L302V	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	302					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		ACAGTTTGTAGATTTTGAAGT	0.313																																							uc001xzu.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(904-906)CTA>GTA		tandem C2 domains, nuclear							101.0	100.0	101.0					14																	92258854		2203	4300	6503	SO:0001583	missense	123036					nucleus		g.chr14:92258854G>C	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.904C>G	14.37:g.92258854G>C	ENSP00000387882:p.Leu302Val		Somatic				TC2N_uc001xzt.3_Missense_Mutation_p.L302V|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Missense_Mutation_p.L302V	p.L302V	NM_001128595	NP_001122067	WXS	Illumina HiSeq	Unspecified	Q8N9U0	TAC2N_HUMAN		COAD - Colon adenocarcinoma(157;0.218)	9	1095	-			302						Missense_Mutation	SNP	ENST00000435962.2	37	c.904C>G	CCDS9897.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546566	0.27652	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556590	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.65	3.83	0.44106	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.150437	0.45606	D	0.000353	T	0.61961	0.2389	N	0.17082	0.46	0.80722	D	1	B	0.32283	0.362	B	0.33568	0.166	T	0.58115	-0.7693	10	0.42905	T	0.14	-11.5524	9.0737	0.36508	0.1355:0.1217:0.7428:0.0	.	302	Q8N9U0	TAC2N_HUMAN	V	302;302;302;54	ENSP00000387882:L302V;ENSP00000343199:L302V;ENSP00000353802:L302V;ENSP00000450922:L54V	ENSP00000343199:L302V	L	-	1	2	TC2N	91328607	1.000000	0.71417	0.999000	0.59377	0.736000	0.42039	4.713000	0.61895	0.738000	0.32606	0.557000	0.71058	CTA		0.313	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411778.1	NM_152332		3	50	0	0	0	0.004672	0	3	50				
SERPINA4	5267	broad.mit.edu	37	14	95030088	95030088	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:95030088C>T	ENST00000557004.1	+	2	690	c.269C>T	c.(268-270)tCc>tTc	p.S90F	SERPINA4_ENST00000298841.5_Missense_Mutation_p.S90F|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000555095.1_Missense_Mutation_p.S90F			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	90					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCCATGCTTTCCCTGGGGGCC	0.607																																							uc001ydk.2		NA																	0				ovary(3)|skin(1)	4						c.(268-270)TCC>TTC		serine (or cysteine) proteinase inhibitor, clade							38.0	40.0	39.0					14																	95030088		2203	4300	6503	SO:0001583	missense	5267				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chr14:95030088C>T	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.269C>T	14.37:g.95030088C>T	ENSP00000450838:p.Ser90Phe		Somatic				SERPINA4_uc010avd.2_Missense_Mutation_p.S127F|SERPINA4_uc001ydl.2_Missense_Mutation_p.S90F	p.S90F	NM_006215	NP_006206	WXS	Illumina HiSeq	Unspecified	P29622	KAIN_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	335	+			90					Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	c.269C>T	CCDS9927.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008635	0.75046	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.83250	-1.7;-1.7;-1.7	4.38	4.38	0.52667	Serpin domain (3);	0.372509	0.21881	N	0.067733	D	0.88897	0.6562	L	0.53671	1.685	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.967	D	0.89474	0.3745	10	0.54805	T	0.06	.	16.312	0.82874	0.0:1.0:0.0:0.0	.	90;90	B2R815;P29622	.;KAIN_HUMAN	F	90	ENSP00000450838:S90F;ENSP00000451172:S90F;ENSP00000298841:S90F	ENSP00000298841:S90F	S	+	2	0	SERPINA4	94099841	0.618000	0.27051	0.875000	0.34327	0.595000	0.36748	5.421000	0.66447	2.153000	0.67306	0.563000	0.77884	TCC		0.607	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		27	26	0	0	0	0.004656	0	27	26				
OR4N4	283694	broad.mit.edu	37	15	22382892	22382892	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:22382892C>T	ENST00000328795.4	+	1	511	c.420C>T	c.(418-420)gcC>gcT	p.A140A	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ACCCTAGAGCCTGCTATGCAA	0.542																																							uc001yuc.1		NA																	0				ovary(4)|skin(1)	5						c.(418-420)GCC>GCT		olfactory receptor, family 4, subfamily N,							180.0	156.0	164.0					15																	22382892		2191	4261	6452	SO:0001819	synonymous_variant	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382892C>T	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.420C>T	15.37:g.22382892C>T			Somatic				LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Silent_p.A140A	p.A140A	NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1401	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	140			Helical; Name=4; (Potential).		Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	c.420C>T	CCDS32173.1																																																																																				0.542	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			52	160	0	0	0	0.00361	0	52	160				
GOLGA8F	100132565	broad.mit.edu	37	15	28632820	28632820	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:28632820T>C	ENST00000450328.2	+	14	1632	c.734T>C	c.(733-735)cTg>cCg	p.L245P	GOLGA8F_ENST00000532622.2_Missense_Mutation_p.L463P|GOLGA8F_ENST00000337838.7_Intron|GOLGA8F_ENST00000526619.2_Missense_Mutation_p.L249P|AC091304.1_ENST00000408123.1_RNA|RN7SL238P_ENST00000465782.2_RNA			Q08AF8	GOG8F_HUMAN	golgin A8 family, member F	245						Golgi apparatus (GO:0005794)				lung(4)	4						CCACAGGACCTGGAGAGCAGG	0.617																																							uc010uag.1		NA																	0					0						c.(1351-1353)CTG>CCG		golgi autoantigen, golgin subfamily a, 8F							58.0	120.0	103.0					15																	28632820		632	1588	2220	SO:0001583	missense	100132565							g.chr15:28632820T>C			15q13.1	2013-01-17	2010-02-12		ENSG00000153684	ENSG00000153684			32378	other	unknown			"""golgi autoantigen, golgin subfamily a, 8F"""			12477932	Standard	NR_033351		Approved	DKFZp434P162	uc010uag.1	Q08AF8	OTTHUMG00000167129	ENST00000450328.2:c.734T>C	15.37:g.28632820T>C	ENSP00000455253:p.Leu245Pro		Somatic				GOLGA8G_uc001zbp.3_Missense_Mutation_p.L245P|GOLGA8G_uc001zbo.2_Intron|GOLGA8G_uc001zbn.2_Missense_Mutation_p.L249P	p.L451P	NM_001164328	NP_001157800	WXS	Illumina HiSeq	Unspecified					15	1476	+								A4FTY1|Q1A5X9|Q8NDK0	Missense_Mutation	SNP	ENST00000450328.2	37	c.1352T>C																																																																																					0.617	GOLGA8F-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NR_033351.1		4	56	0	0	0	0.001984	0	4	56				
OTUD7A	161725	broad.mit.edu	37	15	31819488	31819488	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:31819488C>T	ENST00000307050.4	-	5	768	c.676G>A	c.(676-678)Gac>Aac	p.D226N	OTUD7A_ENST00000382902.1_Missense_Mutation_p.D226N	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	226	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		AACACCAGGTCCCGGTCGTGA	0.557																																							uc001zfq.2		NA																	0				pancreas(1)|skin(1)	2						c.(676-678)GAC>AAC		OTU domain containing 7A							127.0	119.0	122.0					15																	31819488		2202	4300	6502	SO:0001583	missense	161725					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding	g.chr15:31819488C>T	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.676G>A	15.37:g.31819488C>T	ENSP00000305926:p.Asp226Asn		Somatic				OTUD7A_uc001zfr.2_Missense_Mutation_p.D226N	p.D226N	NM_130901	NP_570971	WXS	Illumina HiSeq	Unspecified	Q8TE49	OTU7A_HUMAN		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)	5	769	-		all_lung(180;1.6e-09)	226			OTU.|Catalytic (By similarity).|TRAF-binding (By similarity).		Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	c.676G>A	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450359	0.96205	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.36157	1.27;1.31	5.6	5.6	0.85130	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	M	0.63169	1.94	0.53688	D	0.999972	D;D	0.76494	0.998;0.999	D;D	0.85130	0.995;0.997	T	0.52480	-0.8570	10	0.33141	T	0.24	-42.512	19.6033	0.95572	0.0:1.0:0.0:0.0	.	226;226	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	N	226	ENSP00000305926:D226N;ENSP00000372358:D226N	ENSP00000305926:D226N	D	-	1	0	OTUD7A	29606780	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.933000	0.75874	2.624000	0.88883	0.563000	0.77884	GAC		0.557	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901		16	82	0	0	0	0.004007	0	16	82				
NUTM1	256646	broad.mit.edu	37	15	34649603	34649603	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:34649603C>A	ENST00000333756.4	+	7	3465	c.3310C>A	c.(3310-3312)Ctg>Atg	p.L1104M	NUTM1_ENST00000537011.1_Missense_Mutation_p.L1132M|NUTM1_ENST00000438749.3_Missense_Mutation_p.L1122M	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	1104						cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACCCCTAGCTCTGGGAGTAGT	0.582																																							uc001zif.2		NA								T					BRD3|BRD4		lethal midline carcinoma	BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	0				midline_organs(25)|ovary(2)|lung(2)|skin(1)	30						c.(3310-3312)CTG>ATG		nuclear protein in testis							53.0	56.0	55.0					15																	34649603		2201	4298	6499	SO:0001583	missense	256646					cytoplasm|nucleus		g.chr15:34649603C>A	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.3310C>A	15.37:g.34649603C>A	ENSP00000329448:p.Leu1104Met		Somatic				C15orf55_uc010ucc.1_Missense_Mutation_p.L1132M|C15orf55_uc010ucd.1_Missense_Mutation_p.L1122M	p.L1104M	NM_175741	NP_786883	WXS	Illumina HiSeq	Unspecified	Q86Y26	NUT_HUMAN		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)	7	3465	+		all_lung(180;2.78e-08)	1104					B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	37	c.3310C>A	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170631	0.57584	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.13420	2.61;2.59;2.6	5.77	3.55	0.40652	.	1.124360	0.06827	N	0.793239	T	0.35828	0.0945	M	0.74881	2.28	0.09310	N	1	D;D;D	0.64830	0.99;0.994;0.971	P;D;P	0.65443	0.862;0.935;0.707	T	0.07028	-1.0794	10	0.51188	T	0.08	.	8.8698	0.35309	0.0:0.8031:0.0:0.1969	.	1122;1132;1104	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	M	1132;1122;1104	ENSP00000444896:L1132M;ENSP00000407031:L1122M;ENSP00000329448:L1104M	ENSP00000329448:L1104M	L	+	1	2	C15orf55	32436895	0.000000	0.05858	0.013000	0.15412	0.292000	0.27327	0.766000	0.26560	1.436000	0.47453	0.655000	0.94253	CTG		0.582	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741		19	35	1	0	1.67942e-08	0.006122	3.48342e-08	19	35				
BUB1B	701	broad.mit.edu	37	15	40504704	40504704	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:40504704C>G	ENST00000287598.6	+	19	2585	c.2390C>G	c.(2389-2391)tCt>tGt	p.S797C	BUB1B_ENST00000412359.3_Missense_Mutation_p.S811C	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	797	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TTACAGGTATCTTCTCAACCT	0.348			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														uc001zkx.3		NA	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	Mis|N|F|S	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)			M		rhabdomyosarcoma			0				stomach(2)|ovary(1)|kidney(1)	4						c.(2389-2391)TCT>TGT		budding uninhibited by benzimidazoles 1 beta							87.0	84.0	85.0					15																	40504704		2203	4299	6502	SO:0001583	missense	701	Mosaic_Variegated_Aneuploidy_Syndrome	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40504704C>G	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2390C>G	15.37:g.40504704C>G	ENSP00000287598:p.Ser797Cys		Somatic					p.S797C	NM_001211	NP_001202	WXS	Illumina HiSeq	Unspecified	O60566	BUB1B_HUMAN		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)	19	2602	+		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	797			Protein kinase.		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	37	c.2390C>G	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286799	0.59867	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.20069	2.1;2.1	5.42	2.26	0.28386	Protein kinase-like domain (1);	0.315266	0.27544	N	0.018886	T	0.18045	0.0433	N	0.22421	0.69	0.25845	N	0.984013	D	0.65815	0.995	P	0.52514	0.701	T	0.05022	-1.0911	10	0.72032	D	0.01	-5.6144	4.6513	0.12596	0.3842:0.4219:0.0:0.1938	.	797	O60566	BUB1B_HUMAN	C	797;811;680	ENSP00000287598:S797C;ENSP00000398470:S811C	ENSP00000287598:S797C	S	+	2	0	BUB1B	38291996	0.914000	0.31030	0.600000	0.28864	0.985000	0.73830	2.375000	0.44283	0.665000	0.31066	0.655000	0.94253	TCT		0.348	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4			6	32	0	0	0	0.001984	0	6	32				
RPUSD2	27079	broad.mit.edu	37	15	40861844	40861844	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:40861844G>A	ENST00000315616.7	+	1	346	c.308G>A	c.(307-309)cGg>cAg	p.R103Q	RPUSD2_ENST00000559271.1_Missense_Mutation_p.R103Q	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	103					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		AAGAAGCGGCGGGGCGCAACC	0.687																																							uc001zmd.1		NA																	0				skin(1)	1						c.(307-309)CGG>CAG		RNA pseudouridylate synthase domain containing							9.0	9.0	9.0					15																	40861844		2162	4243	6405	SO:0001583	missense	27079				pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding	g.chr15:40861844G>A	AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.308G>A	15.37:g.40861844G>A	ENSP00000323288:p.Arg103Gln		Somatic					p.R103Q	NM_152260	NP_689473	WXS	Illumina HiSeq	Unspecified	Q8IZ73	RUSD2_HUMAN		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)	1	308	+		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)	103					B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	ENST00000315616.7	37	c.308G>A	CCDS10061.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580225	0.86645	.	.	ENSG00000166133	ENST00000315616	T	0.35789	1.29	5.39	4.48	0.54585	.	0.187267	0.45361	D	0.000373	T	0.38134	0.1029	L	0.59436	1.845	0.37117	D	0.900641	D	0.56746	0.977	P	0.47102	0.537	T	0.45205	-0.9277	10	0.41790	T	0.15	-19.8227	9.2302	0.37432	0.0719:0.0:0.7817:0.1464	.	103	Q8IZ73	RUSD2_HUMAN	Q	103	ENSP00000323288:R103Q	ENSP00000323288:R103Q	R	+	2	0	RPUSD2	38649136	1.000000	0.71417	0.985000	0.45067	0.426000	0.31534	4.108000	0.57817	1.510000	0.48803	0.650000	0.86243	CGG		0.687	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252308.2	NM_152260		4	7	0	0	0	0.000248	0	4	7				
MGA	23269	broad.mit.edu	37	15	41988856	41988856	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:41988856C>T	ENST00000570161.1	+	2	1648	c.1648C>T	c.(1648-1650)Cag>Tag	p.Q550*	MGA_ENST00000389936.4_Nonsense_Mutation_p.Q550*|MGA_ENST00000566586.1_Nonsense_Mutation_p.Q550*|MGA_ENST00000219905.7_Nonsense_Mutation_p.Q550*|MGA_ENST00000545763.1_Nonsense_Mutation_p.Q550*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAAAGAGCCTCAGTGGAAATA	0.403																																							uc001zog.1		NA																	0				ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(1648-1650)CAG>TAG		MAX-interacting protein isoform 2							73.0	65.0	67.0					15																	41988856		1847	4094	5941	SO:0001587	stop_gained	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:41988856C>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1648C>T	15.37:g.41988856C>T	ENSP00000457035:p.Gln550*		Somatic				MGA_uc010ucy.1_Nonsense_Mutation_p.Q550*|MGA_uc010ucz.1_Nonsense_Mutation_p.Q550*	p.Q550*	NM_001080541	NP_001074010	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	3	1739	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	550					Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	c.1648C>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259295	0.39995	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.54	2.27	0.28462	.	3.390110	0.00763	N	0.001153	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	11.3245	0.49440	0.32:0.5624:0.1176:0.0	.	.	.	.	X	550	.	ENSP00000219905:Q550X	Q	+	1	0	MGA	39776148	0.082000	0.21442	0.088000	0.20740	0.065000	0.16274	1.029000	0.30140	0.650000	0.30769	0.462000	0.41574	CAG		0.403	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		11	12	0	0	0	0.000978	0	11	12				
MGA	23269	broad.mit.edu	37	15	42041410	42041410	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:42041410C>G	ENST00000570161.1	+	16	5605	c.5605C>G	c.(5605-5607)Caa>Gaa	p.Q1869E	MGA_ENST00000389936.4_Missense_Mutation_p.Q1830E|MGA_ENST00000566586.1_Missense_Mutation_p.Q1660E|MGA_ENST00000219905.7_Missense_Mutation_p.Q1869E|MGA_ENST00000545763.1_Missense_Mutation_p.Q1660E			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCCTGTAATTCAAGCTGTTGG	0.488																																							uc010ucy.1		NA																	0				ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(5605-5607)CAA>GAA		MAX-interacting protein isoform 1							122.0	114.0	117.0					15																	42041410		1970	4159	6129	SO:0001583	missense	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42041410C>G	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5605C>G	15.37:g.42041410C>G	ENSP00000457035:p.Gln1869Glu		Somatic				MGA_uc010ucz.1_Missense_Mutation_p.Q1660E|MGA_uc010uda.1_Missense_Mutation_p.Q485E|MGA_uc001zoi.2_Missense_Mutation_p.Q83E	p.Q1869E	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	17	5786	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	1830					Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	c.5605C>G	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.186053	0.57909	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.27720	1.65;1.65;1.65	5.72	5.72	0.89469	.	0.812426	0.10539	N	0.662929	T	0.45054	0.1323	N	0.19112	0.55	0.25705	N	0.985542	P;P;D;D	0.54964	0.893;0.935;0.969;0.969	B;P;D;D	0.64877	0.251;0.648;0.93;0.93	T	0.52837	-0.8522	10	0.59425	D	0.04	.	19.8788	0.96888	0.0:1.0:0.0:0.0	.	485;1660;1869;1830	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	E	1869;1830;1660	ENSP00000219905:Q1869E;ENSP00000374586:Q1830E;ENSP00000442467:Q1660E	ENSP00000219905:Q1869E	Q	+	1	0	MGA	39828702	0.999000	0.42202	1.000000	0.80357	0.845000	0.48019	2.892000	0.48625	2.704000	0.92352	0.563000	0.77884	CAA		0.488	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		9	67	0	0	0	0.004482	0	9	67				
UNC13C	440279	broad.mit.edu	37	15	54307337	54307337	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:54307337C>A	ENST00000260323.11	+	1	2237	c.2237C>A	c.(2236-2238)tCt>tAt	p.S746Y	UNC13C_ENST00000537900.1_Missense_Mutation_p.S746Y|UNC13C_ENST00000545554.1_Missense_Mutation_p.S746Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	746					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGAGCTAATTCTAATGAGCTA	0.423																																							uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(2236-2238)TCT>TAT		unc-13 homolog C							41.0	38.0	39.0					15																	54307337		1890	4117	6007	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54307337C>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2237C>A	15.37:g.54307337C>A	ENSP00000260323:p.Ser746Tyr		Somatic					p.S746Y	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	2237	+			746					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.2237C>A	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.492960	0.44352	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.80393	-1.37;-1.37;-1.37	5.69	5.69	0.88448	.	.	.	.	.	T	0.69584	0.3127	N	0.24115	0.695	0.33798	D	0.62628	P	0.40476	0.718	B	0.31191	0.125	T	0.80158	-0.1499	9	0.87932	D	0	.	18.7937	0.91985	0.0:1.0:0.0:0.0	.	746	Q8NB66	UN13C_HUMAN	Y	746	ENSP00000260323:S746Y;ENSP00000438156:S746Y;ENSP00000442569:S746Y	ENSP00000260323:S746Y	S	+	2	0	UNC13C	52094629	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.206000	0.58473	2.681000	0.91329	0.650000	0.86243	TCT		0.423	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		10	9	1	0	7.48243e-07	0.000443	1.50727e-06	10	9				
RFX7	64864	broad.mit.edu	37	15	56387666	56387666	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:56387666G>A	ENST00000559447.2	-	9	2240	c.1969C>T	c.(1969-1971)Cca>Tca	p.P657S	RFX7_ENST00000317318.6_Missense_Mutation_p.P754S|RFX7_ENST00000422057.1_Missense_Mutation_p.P657S|RFX7_ENST00000423270.1_Missense_Mutation_p.P754S			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	657					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTTATATCTGGAGATGATGAT	0.393																																							uc010bfn.2		NA																	0					0						c.(2260-2262)CCA>TCA		regulatory factor X domain containing 2							92.0	83.0	86.0					15																	56387666		1880	4099	5979	SO:0001583	missense	64864				regulation of transcription, DNA-dependent	nucleus	DNA binding	g.chr15:56387666G>A			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1969C>T	15.37:g.56387666G>A	ENSP00000453281:p.Pro657Ser		Somatic				RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.P568S	p.P754S	NM_022841	NP_073752	WXS	Illumina HiSeq	Unspecified	Q2KHR2	RFX7_HUMAN			9	2260	-			657					Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37	c.2260C>T		.	.	.	.	.	.	.	.	.	.	G	12.61	1.989021	0.35131	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.51574	0.7;0.7;0.7	5.47	5.47	0.80525	.	0.088601	0.48767	D	0.000168	T	0.34019	0.0883	N	0.19112	0.55	0.43287	D	0.99526	B;B	0.34200	0.134;0.441	B;B	0.24541	0.022;0.054	T	0.25984	-1.0116	10	0.59425	D	0.04	-11.495	18.326	0.90254	0.0:0.0:1.0:0.0	.	657;657	Q2KHR2;C9JU50	RFX7_HUMAN;.	S	657;754;754	ENSP00000387504:P657S;ENSP00000313299:P754S;ENSP00000397644:P754S	ENSP00000313299:P754S	P	-	1	0	RFX7	54174958	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.737000	0.47393	2.552000	0.86080	0.591000	0.81541	CCA		0.393	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841		28	30	0	0	0	0.001061	0	28	30				
VWA9	81556	broad.mit.edu	37	15	65871944	65871944	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:65871944C>T	ENST00000395644.4	-	12	1694	c.1359G>A	c.(1357-1359)ctG>ctA	p.L453L	VWA9_ENST00000431261.2_Silent_p.L374L|VWA9_ENST00000567744.1_Silent_p.L489L|VWA9_ENST00000313182.2_Silent_p.L453L|VWA9_ENST00000420799.2_Silent_p.L396L|VWA9_ENST00000569491.1_Silent_p.L403L|VWA9_ENST00000442903.3_Silent_p.L417L			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	453																	CCACCCCTTTCAGCAGGTCCA	0.537																																							uc002apd.2		NA																	0				ovary(1)	1						c.(1357-1359)CTG>CTA		hypothetical protein LOC81556 isoform 2							62.0	54.0	57.0					15																	65871944		2201	4299	6500	SO:0001819	synonymous_variant	81556							g.chr15:65871944C>T	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.1359G>A	15.37:g.65871944C>T			Somatic				C15orf44_uc010uix.1_Silent_p.L489L|C15orf44_uc010uiz.1_Silent_p.L417L|C15orf44_uc010uja.1_Silent_p.L403L|C15orf44_uc010ujb.1_Silent_p.L374L|C15orf44_uc002ape.3_Silent_p.L453L|C15orf44_uc010uiy.1_Silent_p.L374L	p.L453L	NM_030800	NP_110427	WXS	Illumina HiSeq	Unspecified	Q96SY0	CO044_HUMAN			12	1695	-			453					B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Silent	SNP	ENST00000395644.4	37	c.1359G>A																																																																																					0.537	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800		4	31	0	0	0	0.000248	0	4	31				
THSD4	79875	broad.mit.edu	37	15	72030138	72030138	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:72030138G>C	ENST00000355327.3	+	11	1832	c.1698G>C	c.(1696-1698)agG>agC	p.R566S	THSD4_ENST00000357769.4_Missense_Mutation_p.R206S|THSD4_ENST00000261862.6_Missense_Mutation_p.R566S|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	566					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AGAAAGGGAGGAACGAGGAGA	0.567																																							uc002atb.1		NA																	0				ovary(2)	2						c.(1696-1698)AGG>AGC		thrombospondin, type I, domain containing 4							151.0	202.0	185.0					15																	72030138		2050	4187	6237	SO:0001583	missense	79875					proteinaceous extracellular matrix	metalloendopeptidase activity	g.chr15:72030138G>C	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1698G>C	15.37:g.72030138G>C	ENSP00000347484:p.Arg566Ser		Somatic				THSD4_uc010ukg.1_Missense_Mutation_p.R206S|THSD4_uc002ate.2_Missense_Mutation_p.R206S	p.R566S	NM_024817	NP_079093	WXS	Illumina HiSeq	Unspecified	Q6ZMP0	THSD4_HUMAN			10	1777	+			566					B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	c.1698G>C	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	3.340	-0.134724	0.06711	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.60797	0.16;0.16;0.44	4.57	2.55	0.30701	.	0.818161	0.10206	N	0.702738	T	0.29716	0.0742	N	0.08118	0	0.09310	N	1	B;B;B	0.22276	0.067;0.0;0.008	B;B;B	0.14578	0.011;0.001;0.011	T	0.23440	-1.0188	10	0.07990	T	0.79	.	5.8016	0.18417	0.105:0.1969:0.6981:0.0	.	206;206;566	B4E1J6;B4DR13;Q6ZMP0	.;.;THSD4_HUMAN	S	566;566;206	ENSP00000347484:R566S;ENSP00000261862:R566S;ENSP00000350413:R206S	ENSP00000261862:R566S	R	+	3	2	THSD4	69817192	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.403000	0.20982	1.289000	0.44618	0.650000	0.86243	AGG		0.567	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817		17	22	0	0	0	0.004007	0	17	22				
ZNF592	9640	broad.mit.edu	37	15	85326329	85326329	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:85326329C>A	ENST00000560079.2	+	4	711	c.423C>A	c.(421-423)ttC>ttA	p.F141L	ZNF592_ENST00000299927.3_Missense_Mutation_p.F141L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	141					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F141L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCAACCAGTTCAGTCCAATCT	0.483																																							uc002bld.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(4)|skin(2)	6						c.(421-423)TTC>TTA		zinc finger protein 592							110.0	117.0	115.0					15																	85326329		2203	4299	6502	SO:0001583	missense	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85326329C>A	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.423C>A	15.37:g.85326329C>A	ENSP00000452877:p.Phe141Leu		Somatic				ZNF592_uc010upb.1_RNA	p.F141L	NM_014630	NP_055445	WXS	Illumina HiSeq	Unspecified	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		4	759	+			141					Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.423C>A	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181095	0.57800	.	.	ENSG00000166716	ENST00000299927	T	0.00882	5.58	6.06	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.03348	0.0097	L	0.52573	1.65	0.46798	D	0.999207	D	0.89917	1.0	D	0.85130	0.997	T	0.50642	-0.8804	10	0.87932	D	0	-23.9264	9.8941	0.41306	0.0:0.8271:0.0:0.1729	.	141	Q92610	ZN592_HUMAN	L	141	ENSP00000299927:F141L	ENSP00000299927:F141L	F	+	3	2	ZNF592	83127333	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.706000	0.25690	0.837000	0.34925	-0.140000	0.14226	TTC		0.483	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		16	150	1	0	4.7546e-09	0.004007	1.00104e-08	16	150				
ZNF592	9640	broad.mit.edu	37	15	85327622	85327622	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:85327622C>T	ENST00000560079.2	+	4	2004	c.1716C>T	c.(1714-1716)ctC>ctT	p.L572L	ZNF592_ENST00000299927.3_Silent_p.L572L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	572					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGCCAAATCTCAGCCCGCCTG	0.597																																							uc002bld.2		NA																	0				ovary(4)|skin(2)	6						c.(1714-1716)CTC>CTT		zinc finger protein 592							92.0	97.0	95.0					15																	85327622		2203	4299	6502	SO:0001819	synonymous_variant	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85327622C>T	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1716C>T	15.37:g.85327622C>T			Somatic				ZNF592_uc010upb.1_RNA	p.L572L	NM_014630	NP_055445	WXS	Illumina HiSeq	Unspecified	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		4	2052	+			572					Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	37	c.1716C>T	CCDS32317.1																																																																																				0.597	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		13	118	0	0	0	0.00245	0	13	118				
NARFL	64428	broad.mit.edu	37	16	783371	783371	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:783371C>G	ENST00000251588.2	-	7	766	c.750G>C	c.(748-750)aaG>aaC	p.K250N	NARFL_ENST00000562862.1_5'UTR|NARFL_ENST00000301694.5_3'UTR|NARFL_ENST00000540986.1_Missense_Mutation_p.K148N|HAGHL_ENST00000569604.1_Intron|NARFL_ENST00000568545.1_Missense_Mutation_p.K148N	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	250					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				AGGCTTCCAGCTTTTTGTCAT	0.547																																							uc002cjr.2		NA																	0					0						c.(748-750)AAG>AAC		nuclear prelamin A recognition factor-like							131.0	114.0	120.0					16																	783371		2200	4299	6499	SO:0001583	missense	64428				iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding	g.chr16:783371C>G	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.750G>C	16.37:g.783371C>G	ENSP00000251588:p.Lys250Asn		Somatic				NARFL_uc002cjp.2_Missense_Mutation_p.K148N|NARFL_uc002cjq.2_Missense_Mutation_p.K148N|NARFL_uc002cjs.2_Missense_Mutation_p.K32N|NARFL_uc010uuq.1_5'Flank	p.K250N	NM_022493	NP_071938	WXS	Illumina HiSeq	Unspecified	Q9H6Q4	NARFL_HUMAN			7	762	-		Hepatocellular(780;0.0218)	250					A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	ENST00000251588.2	37	c.750G>C	CCDS10425.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954265	0.53293	.	.	ENSG00000103245	ENST00000251588;ENST00000540986	T;T	0.64085	-0.08;-0.08	4.84	1.67	0.24075	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.134169	0.64402	D	0.000003	D	0.83184	0.5199	H	0.97415	4	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.83812	0.0242	10	0.87932	D	0	-31.0134	8.3153	0.32097	0.0:0.676:0.0:0.324	.	250	Q9H6Q4	NARFL_HUMAN	N	250;148	ENSP00000251588:K250N;ENSP00000444008:K148N	ENSP00000251588:K250N	K	-	3	2	NARFL	723372	0.987000	0.35691	1.000000	0.80357	0.889000	0.51656	0.230000	0.17852	0.633000	0.30452	0.555000	0.69702	AAG		0.547	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242855.1	NM_022493		17	65	0	0	0	0.006122	0	17	65				
PTX4	390667	broad.mit.edu	37	16	1537824	1537824	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:1537824C>A	ENST00000447419.2	-	2	314	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	PTX4_ENST00000293922.1_Missense_Mutation_p.V92L|PTX4_ENST00000440447.2_Missense_Mutation_p.V97L			Q96A99	PTX4_HUMAN	pentraxin 4, long	97						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						TCCCCCTGCACCGAGGCCTGT	0.662																																							uc010uvf.1		NA																	0					0						c.(274-276)GTG>TTG		neuronal pentraxin II-like							65.0	68.0	67.0					16																	1537824		2199	4297	6496	SO:0001583	missense	390667					extracellular region	metal ion binding	g.chr16:1537824C>A		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.289G>T	16.37:g.1537824C>A	ENSP00000445277:p.Val97Leu		Somatic					p.V92L	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			2	274	-			97						Missense_Mutation	SNP	ENST00000447419.2	37	c.274G>T		.	.	.	.	.	.	.	.	.	.	C	5.766	0.325725	0.10900	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.05025	3.67;3.51	5.78	-2.95	0.05564	.	1.612450	0.03470	N	0.213607	T	0.05640	0.0148	L	0.36672	1.1	0.09310	N	1	B	0.18461	0.028	B	0.14578	0.011	T	0.41052	-0.9530	10	0.27082	T	0.32	.	5.6595	0.17660	0.0:0.3244:0.2871:0.3885	.	92	Q96A99-2	.	L	97;92	ENSP00000445277:V97L;ENSP00000293922:V92L	ENSP00000293922:V92L	V	-	1	0	PTX4	1477825	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.490000	0.02304	-0.461000	0.06993	-0.251000	0.11542	GTG		0.662	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		39	102	1	0	8.69298e-16	0.001485	2.05284e-15	39	102				
ZNF263	10127	broad.mit.edu	37	16	3339518	3339518	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:3339518C>G	ENST00000219069.5	+	6	1888	c.1012C>G	c.(1012-1014)Cat>Gat	p.H338D	ZNF263_ENST00000574253.1_Silent_p.L171L|ZNF263_ENST00000538765.1_5'UTR	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	338					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GGGAAGACCTCATGACCGGTC	0.632																																							uc002cuq.2		NA																	0				skin(3)|ovary(1)	4						c.(1012-1014)CAT>GAT		zinc finger protein 263							48.0	52.0	51.0					16																	3339518		2197	4300	6497	SO:0001583	missense	10127				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3339518C>G	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1012C>G	16.37:g.3339518C>G	ENSP00000219069:p.His338Asp		Somatic				ZNF263_uc010uww.1_5'UTR|ZNF263_uc002cur.2_5'UTR	p.H338D	NM_005741	NP_005732	WXS	Illumina HiSeq	Unspecified	O14978	ZN263_HUMAN			6	1344	+			338					B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	c.1012C>G	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.516617	0.00975	.	.	ENSG00000006194	ENST00000219069	T	0.04758	3.56	4.63	0.235	0.15431	.	1.888230	0.02428	N	0.083315	T	0.02888	0.0086	N	0.03608	-0.345	0.21553	N	0.999641	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.28530	T	0.3	.	8.0684	0.30674	0.0:0.5788:0.3114:0.1099	.	338	O14978	ZN263_HUMAN	D	338	ENSP00000219069:H338D	ENSP00000219069:H338D	H	+	1	0	ZNF263	3279519	0.000000	0.05858	0.071000	0.20095	0.312000	0.27988	-0.038000	0.12144	0.085000	0.17107	0.655000	0.94253	CAT		0.632	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2			3	86	0	0	0	0.004672	0	3	86				
GRIN2A	2903	broad.mit.edu	37	16	10274192	10274192	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:10274192G>A	ENST00000396573.2	-	3	386	c.77C>T	c.(76-78)gCg>gTg	p.A26V	GRIN2A_ENST00000562109.1_Missense_Mutation_p.A26V|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A26V|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A26V|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A26V	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	26					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTTCTCCGCCGCCGCGCTCGG	0.672																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(76-78)GCG>GTG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						18.0	22.0	20.0					16																	10274192		2187	4288	6475	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10274192G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.77C>T	16.37:g.10274192G>A	ENSP00000379818:p.Ala26Val		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.A26V|GRIN2A_uc002czr.3_Missense_Mutation_p.A26V|GRIN2A_uc010buk.2_Missense_Mutation_p.A26V	p.A26V	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			2	625	-			26			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.77C>T	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914293	0.52546	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	3.81	2.85	0.33270	.	0.254375	0.30593	N	0.009294	T	0.06188	0.0160	N	0.22421	0.69	0.80722	D	1	P;B;P	0.40638	0.725;0.013;0.672	B;B;B	0.30646	0.118;0.002;0.019	T	0.33675	-0.9859	9	.	.	.	.	6.3188	0.21206	0.1327:0.0:0.8673:0.0	.	26;26;26	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	V	26	ENSP00000379818:A26V;ENSP00000385872:A26V;ENSP00000332549:A26V;ENSP00000379820:A26V	.	A	-	2	0	GRIN2A	10181693	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.450000	0.60041	2.088000	0.63022	0.561000	0.74099	GCG		0.672	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			29	27	0	0	0	0.005443	0	29	27				
EMP2	2013	broad.mit.edu	37	16	10626919	10626919	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:10626919T>A	ENST00000359543.3	-	5	556	c.347A>T	c.(346-348)tAt>tTt	p.Y116F	EMP2_ENST00000566033.1_5'Flank|RP11-27M24.1_ENST00000535363.1_RNA|EMP2_ENST00000536829.1_Missense_Mutation_p.Y116F	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2	116					cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						CCTGTCTGTATAAATGGAGGC	0.512																																					GBM(158;2021 2691 14714 39478)	GBM(158;2021 2691 14714 39478)	uc002czx.2		NA																	0					0						c.(346-348)TAT>TTT		epithelial membrane protein 2							127.0	106.0	113.0					16																	10626919		2197	4300	6497	SO:0001583	missense	2013				cell proliferation	integral to membrane		g.chr16:10626919T>A	U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.347A>T	16.37:g.10626919T>A	ENSP00000352540:p.Tyr116Phe		Somatic					p.Y116F	NM_001424	NP_001415	WXS	Illumina HiSeq	Unspecified	P54851	EMP2_HUMAN			5	541	-			116					B2R7V6|D3DUF8	Missense_Mutation	SNP	ENST00000359543.3	37	c.347A>T	CCDS10541.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.460031	0.84317	.	.	ENSG00000213853	ENST00000359543;ENST00000536829	D;D	0.95137	-3.62;-3.62	5.43	5.43	0.79202	.	0.000000	0.85682	U	0.000000	D	0.96658	0.8909	M	0.71296	2.17	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.96330	0.9243	10	0.42905	T	0.14	-15.1432	14.954	0.71098	0.0:0.0:0.0:1.0	.	116	P54851	EMP2_HUMAN	F	116	ENSP00000352540:Y116F;ENSP00000445712:Y116F	ENSP00000352540:Y116F	Y	-	2	0	EMP2	10534420	1.000000	0.71417	0.690000	0.30148	0.591000	0.36615	7.544000	0.82117	2.190000	0.69967	0.533000	0.62120	TAT		0.512	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251965.1	NM_001424		25	59	0	0	0	0.001061	0	25	59				
ZNF646	9726	broad.mit.edu	37	16	31087858	31087858	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:31087858G>C	ENST00000394979.2	+	1	636	c.213G>C	c.(211-213)gaG>gaC	p.E71D	ZNF668_ENST00000300849.4_5'Flank|ZNF668_ENST00000564456.1_5'Flank|ZNF646_ENST00000300850.5_Missense_Mutation_p.E71D			O15015	ZN646_HUMAN	zinc finger protein 646	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GGACCCACGAGACTGGCCTTT	0.627																																							uc002eap.2		NA																	0				breast(2)	2						c.(211-213)GAG>GAC		zinc finger protein 646							104.0	63.0	77.0					16																	31087858		2197	4300	6497	SO:0001583	missense	9726				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:31087858G>C	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.213G>C	16.37:g.31087858G>C	ENSP00000378429:p.Glu71Asp		Somatic				ZNF668_uc002eao.2_5'Flank	p.E71D	NM_014699	NP_055514	WXS	Illumina HiSeq	Unspecified	O15015	ZN646_HUMAN			2	502	+			71					Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37	c.213G>C		.	.	.	.	.	.	.	.	.	.	G	16.78	3.216684	0.58452	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	T;T;T	0.27890	1.64;2.97;3.0	5.9	2.86	0.33363	.	.	.	.	.	T	0.16041	0.0386	N	0.12831	0.26	0.29206	N	0.874876	B	0.24186	0.099	B	0.19148	0.024	T	0.20306	-1.0279	9	0.27785	T	0.31	-15.6719	8.3692	0.32404	0.1422:0.1289:0.7289:0.0	.	71	O15015-2	.	D	71	ENSP00000391271:E71D;ENSP00000300850:E71D;ENSP00000378429:E71D	ENSP00000300850:E71D	E	+	3	2	ZNF646	30995359	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.629000	0.46485	0.387000	0.25024	0.563000	0.77884	GAG		0.627	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		3	65	0	0	0	0.004672	0	3	65				
DNAJA2	10294	broad.mit.edu	37	16	47005275	47005275	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:47005275C>G	ENST00000317089.5	-	3	563	c.348G>C	c.(346-348)atG>atC	p.M116I	RP11-169E6.1_ENST00000562536.1_RNA	NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2	116					positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				GTGGATGCATCATGTCCTCTC	0.378																																							uc002eeo.2		NA																	0				lung(1)	1						c.(346-348)ATG>ATC		DnaJ subfamily A member 2							115.0	107.0	110.0					16																	47005275		2203	4300	6503	SO:0001583	missense	10294				positive regulation of cell proliferation|protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding	g.chr16:47005275C>G	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.348G>C	16.37:g.47005275C>G	ENSP00000314030:p.Met116Ile		Somatic				DNAJA2_uc002eep.2_Missense_Mutation_p.M33I	p.M116I	NM_005880	NP_005871	WXS	Illumina HiSeq	Unspecified	O60884	DNJA2_HUMAN			3	490	-		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)	116					B2R7L7|O14711	Missense_Mutation	SNP	ENST00000317089.5	37	c.348G>C	CCDS10726.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722936	0.68959	.	.	ENSG00000069345	ENST00000317089	T	0.37752	1.18	5.47	5.47	0.80525	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	N	0.11154	0.105	0.80722	D	1	B	0.32507	0.373	B	0.24269	0.052	T	0.07177	-1.0786	10	0.17832	T	0.49	-24.5513	19.3119	0.94192	0.0:1.0:0.0:0.0	.	116	O60884	DNJA2_HUMAN	I	116	ENSP00000314030:M116I	ENSP00000314030:M116I	M	-	3	0	DNAJA2	45562776	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.559000	0.86315	0.561000	0.74099	ATG		0.378	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2			7	64	0	0	0	0.001984	0	7	64				
NOD2	64127	broad.mit.edu	37	16	50745221	50745221	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:50745221G>A	ENST00000300589.2	+	4	1504	c.1399G>A	c.(1399-1401)Gac>Aac	p.D467N	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	467	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CGGGGTGGCGGACCGCCTCAT	0.592																																							uc002egm.1		NA																	0				ovary(3)|skin(1)	4						c.(1399-1401)GAC>AAC		nucleotide-binding oligomerization domain							69.0	72.0	71.0					16																	50745221		2198	4300	6498	SO:0001583	missense	64127				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding	g.chr16:50745221G>A	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.1399G>A	16.37:g.50745221G>A	ENSP00000300589:p.Asp467Asn		Somatic				NOD2_uc010cbk.1_Missense_Mutation_p.D440N|NOD2_uc002egl.1_Missense_Mutation_p.D245N|NOD2_uc010cbl.1_Missense_Mutation_p.D245N|NOD2_uc010cbm.1_Missense_Mutation_p.D245N|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	p.D467N	NM_022162	NP_071445	WXS	Illumina HiSeq	Unspecified	Q9HC29	NOD2_HUMAN			4	1504	+		all_cancers(37;0.0156)	467			NACHT.		E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	c.1399G>A	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468784	0.43839	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.65916	-0.18	5.12	5.12	0.69794	.	0.092574	0.47093	D	0.000242	T	0.69015	0.3064	L	0.46885	1.475	0.32929	D	0.516898	D;D;D	0.89917	1.0;0.991;1.0	D;P;D	0.85130	0.997;0.74;0.997	T	0.71122	-0.4684	10	0.22706	T	0.39	.	9.6424	0.39846	0.0954:0.0:0.9046:0.0	.	251;440;467	D6CHF9;Q9HC29-2;Q9HC29	.;.;NOD2_HUMAN	N	440;467	ENSP00000300589:D467N	ENSP00000300589:D467N	D	+	1	0	NOD2	49302722	0.861000	0.29849	0.998000	0.56505	0.213000	0.24496	2.018000	0.40991	2.385000	0.81259	0.561000	0.74099	GAC		0.592	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162		5	86	0	0	0	0.000602	0	5	86				
CDH8	1006	broad.mit.edu	37	16	61823353	61823353	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:61823353C>T	ENST00000577390.1	-	8	2265	c.1311G>A	c.(1309-1311)agG>agA	p.R437R	CDH8_ENST00000584337.1_Silent_p.R437R|CDH8_ENST00000577730.1_Silent_p.R437R|CDH8_ENST00000299345.6_Silent_p.R437R	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	437	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGTTGAACTGCCTCTCCAGGT	0.418																																							uc002eog.1		NA																	0				ovary(6)|skin(2)|breast(1)	9						c.(1309-1311)AGG>AGA		cadherin 8, type 2 preproprotein							216.0	179.0	192.0					16																	61823353		2203	4300	6503	SO:0001819	synonymous_variant	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61823353C>T	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1311G>A	16.37:g.61823353C>T			Somatic				CDH8_uc002eoh.2_Silent_p.R206R	p.R437R	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	8	1563	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	437			Extracellular (Potential).|Cadherin 4.		B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	c.1311G>A	CCDS10802.1																																																																																				0.418	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		23	24	0	0	0	0.001882	0	23	24				
ACD	65057	broad.mit.edu	37	16	67691688	67691688	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr16:67691688G>A	ENST00000393919.4	-	11	1797	c.1533C>T	c.(1531-1533)ctC>ctT	p.L511L	ACD_ENST00000219251.8_Silent_p.L508L			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	511					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CCCGAGCACAGAGGGACGTGC	0.572																																							uc002etq.3		NA																	0				pancreas(1)	1						c.(1531-1533)CTC>CTT		adrenocortical dysplasia homolog isoform 1							89.0	84.0	86.0					16																	67691688		2198	4300	6498	SO:0001819	synonymous_variant	65057				intracellular protein transport|negative regulation of telomere maintenance via telomerase|positive regulation of single-stranded telomeric DNA binding|positive regulation of telomerase activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|telomere assembly	nuclear telomere cap complex|nucleoplasm	DNA binding|DNA polymerase binding	g.chr16:67691688G>A	AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.1533C>T	16.37:g.67691688G>A			Somatic				ACD_uc002etp.3_Silent_p.L508L|ACD_uc002etr.3_Silent_p.L495L	p.L511L	NM_001082486	NP_001075955	WXS	Illumina HiSeq	Unspecified	Q96AP0	ACD_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)	11	1870	-		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	511					Q562H5|Q9H8F9	Silent	SNP	ENST00000393919.4	37	c.1533C>T	CCDS42181.1																																																																																				0.572	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268880.1	NM_022914		5	50	0	0	0	0.001984	0	5	50				
TRPV3	162514	broad.mit.edu	37	17	3446879	3446879	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:3446879G>T	ENST00000576742.1	-	5	676	c.355C>A	c.(355-357)Ctg>Atg	p.L119M	TRPV3_ENST00000572519.1_Missense_Mutation_p.L119M|TRPV3_ENST00000301365.4_Missense_Mutation_p.L119M	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	119					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CGCTTCTTCAGCCGCCTCTTT	0.547																																							uc002fvt.1		NA																	0				ovary(4)	4						c.(355-357)CTG>ATG		transient receptor potential cation channel,	Menthol(DB00825)						114.0	109.0	111.0					17																	3446879		2203	4300	6503	SO:0001583	missense	162514					integral to membrane	calcium channel activity	g.chr17:3446879G>T	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.355C>A	17.37:g.3446879G>T	ENSP00000461518:p.Leu119Met		Somatic				TRPV3_uc010vrh.1_Missense_Mutation_p.L103M|TRPV3_uc010vri.1_Missense_Mutation_p.L74M|TRPV3_uc010vrj.1_Missense_Mutation_p.L103M|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.L103M|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.L119M|TRPV3_uc002fvu.2_Missense_Mutation_p.L119M	p.L119M	NM_145068	NP_659505	WXS	Illumina HiSeq	Unspecified	Q8NET8	TRPV3_HUMAN			5	677	-			119			Cytoplasmic (Potential).		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	c.355C>A	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	G	6.852	0.526485	0.13066	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D;D	0.91295	-2.82;-2.25	5.12	3.92	0.45320	.	0.234644	0.29853	N	0.011021	D	0.92004	0.7467	M	0.74467	2.265	0.26712	N	0.970951	P;B;B;B;D;B;B	0.54964	0.946;0.003;0.031;0.003;0.969;0.122;0.1	P;B;B;B;P;B;B	0.54759	0.628;0.006;0.085;0.006;0.76;0.132;0.081	D	0.85321	0.1084	10	0.40728	T	0.16	-0.847	9.4793	0.38891	0.1371:0.0:0.8629:0.0	.	103;103;119;103;119;119;119	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	M	119;119;103	ENSP00000371338:L119M;ENSP00000301365:L119M	ENSP00000301365:L119M	L	-	1	2	TRPV3	3393629	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	2.169000	0.42434	2.548000	0.85928	0.561000	0.74099	CTG		0.547	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		44	67	1	0	3.05275e-18	0.003214	7.46108e-18	44	67				
GSG2	83903	broad.mit.edu	37	17	3629172	3629172	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:3629172G>A	ENST00000325418.4	+	1	1962	c.1943G>A	c.(1942-1944)cGa>cAa	p.R648Q	ITGAE_ENST00000571185.1_Intron|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	648	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										TTTGAGCACCGAGACTTACAC	0.527																																							uc002fwp.2		NA																	0					0						c.(1942-1944)CGA>CAA		haspin							94.0	82.0	86.0					17																	3629172		2203	4300	6503	SO:0001583	missense	83903				cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr17:3629172G>A	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1943G>A	17.37:g.3629172G>A	ENSP00000325290:p.Arg648Gln		Somatic				ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	p.R648Q	NM_031965	NP_114171	WXS	Illumina HiSeq	Unspecified	Q8TF76	HASP_HUMAN			1	1976	+			648			Protein kinase.		Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	c.1943G>A	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466847	0.84425	.	.	ENSG00000177602	ENST00000325418	T	0.74632	-0.86	4.7	4.7	0.59300	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	D	0.90913	0.7144	H	0.97611	4.04	0.51012	D	0.9999	D	0.89917	1.0	D	0.91635	0.999	D	0.93843	0.7138	10	0.87932	D	0	-22.5015	15.6646	0.77217	0.0:0.0:1.0:0.0	.	648	Q8TF76	HASP_HUMAN	Q	648	ENSP00000325290:R648Q	ENSP00000325290:R648Q	R	+	2	0	GSG2	3575921	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.208000	0.77907	2.565000	0.86533	0.655000	0.94253	CGA		0.527	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965		4	50	0	0	0	0.000248	0	4	50				
USP6	9098	broad.mit.edu	37	17	5072223	5072223	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:5072223C>G	ENST00000574788.1	+	35	5620	c.3390C>G	c.(3388-3390)ctC>ctG	p.L1130L	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Silent_p.L813L|USP6_ENST00000250066.6_Silent_p.L1130L			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1130	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GGGATGAGCTCTCCAAGCCCA	0.527			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		uc002gau.1		NA		Dom	yes		17	17p13	9098	T	ubiquitin specific peptidase 6 (Tre-2 oncogene)			M	COL1A1|CDH11|ZNF9|OMD		aneurysmal bone cysts		0				skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						c.(3388-3390)CTC>CTG		ubiquitin specific protease 6							88.0	95.0	93.0					17																	5072223		2203	4298	6501	SO:0001819	synonymous_variant	9098				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr17:5072223C>G	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3390C>G	17.37:g.5072223C>G			Somatic				USP6_uc002gav.1_Silent_p.L1130L|USP6_uc010ckz.1_Silent_p.L813L	p.L1130L	NM_004505	NP_004496	WXS	Illumina HiSeq	Unspecified	P35125	UBP6_HUMAN			35	5620	+			1130					Q15634|Q86WP6|Q8IWT4	Silent	SNP	ENST00000574788.1	37	c.3390C>G	CCDS11069.2																																																																																				0.527	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505		3	122	0	0	0	0.004672	0	3	122				
TMEM107	84314	broad.mit.edu	37	17	8079142	8079142	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:8079142G>A	ENST00000437139.2	-	3	276	c.189C>T	c.(187-189)ctC>ctT	p.L63L	TMEM107_ENST00000532998.1_Silent_p.L63L|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000316425.5_Silent_p.L69L|TMEM107_ENST00000431792.2_Intron|RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000449985.2_Intron|TMEM107_ENST00000533070.1_Silent_p.L69L	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	63					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						CCACTGCAAAGAGGCCCAGGG	0.597																																							uc002gkg.3		NA																	0					0						c.(187-189)CTC>CTT		transmembrane protein 107 isoform 2							83.0	88.0	87.0					17																	8079142		2203	4300	6503	SO:0001819	synonymous_variant	84314					integral to membrane		g.chr17:8079142G>A	AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.189C>T	17.37:g.8079142G>A			Somatic				TMEM107_uc002gkh.3_Silent_p.L69L|TMEM107_uc002gki.3_Silent_p.L69L|TMEM107_uc002gkj.3_Intron|TMEM107_uc002gkk.2_Silent_p.L63L	p.L63L	NM_183065	NP_898888	WXS	Illumina HiSeq	Unspecified	Q6UX40	TM107_HUMAN			3	299	-			63			Helical; (Potential).		A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Silent	SNP	ENST00000437139.2	37	c.189C>T	CCDS45607.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439068	0.25900	.	.	ENSG00000179029	ENST00000415860	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	T	0.73583	0.3605	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76027	-0.3109	5	0.87932	D	0	-17.2755	13.0723	0.59068	0.0:0.1612:0.8387:0.0	.	.	.	.	F	94	.	ENSP00000392476:S94F	S	-	2	0	TMEM107	8019867	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.785000	0.55424	2.715000	0.92844	0.551000	0.68910	TCT		0.597	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388844.1	NM_032354		5	69	0	0	0	0.001168	0	5	69				
MYH13	8735	broad.mit.edu	37	17	10250001	10250001	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:10250001T>A	ENST00000418404.3	-	12	1422	c.1259A>T	c.(1258-1260)cAg>cTg	p.Q420L	MYH13_ENST00000252172.4_Missense_Mutation_p.Q420L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	420	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CATTACCTGCTGGACATTTTG	0.438																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(1258-1260)CAG>CTG		myosin, heavy polypeptide 13, skeletal muscle							110.0	104.0	106.0					17																	10250001		1975	4167	6142	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10250001T>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1259A>T	17.37:g.10250001T>A	ENSP00000404570:p.Gln420Leu		Somatic				MYH13_uc010vvf.1_Missense_Mutation_p.Q95L	p.Q420L	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			13	1349	-			420			Myosin head-like.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.1259A>T	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447086	0.43429	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.87491	-2.26	4.65	4.65	0.58169	Myosin head, motor domain (2);	.	.	.	.	D	0.85396	0.5687	M	0.65677	2.01	0.36956	D	0.893108	B	0.02656	0.0	B	0.12837	0.008	D	0.85567	0.1231	9	0.66056	D	0.02	.	11.6398	0.51227	0.0:0.0:0.1481:0.8519	.	420	Q9UKX3	MYH13_HUMAN	L	420;95	ENSP00000252172:Q420L	ENSP00000252172:Q420L	Q	-	2	0	MYH13	10190726	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.311000	0.51919	1.861000	0.53984	0.459000	0.35465	CAG		0.438	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		16	17	0	0	0	0.00499	0	16	17				
DNAH9	1770	broad.mit.edu	37	17	11795148	11795148	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:11795148C>A	ENST00000262442.4	+	58	11235	c.11167C>A	c.(11167-11169)Ctc>Atc	p.L3723I	DNAH9_ENST00000454412.2_Missense_Mutation_p.L3723I|DNAH9_ENST00000608377.1_Missense_Mutation_p.L35I|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3723					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGACGAAAGCCTCAGGGAGCG	0.542																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(11167-11169)CTC>ATC		dynein, axonemal, heavy chain 9 isoform 2							138.0	135.0	136.0					17																	11795148		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11795148C>A	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11167C>A	17.37:g.11795148C>A	ENSP00000262442:p.Leu3723Ile		Somatic				DNAH9_uc010coo.2_Missense_Mutation_p.L3017I|DNAH9_uc002gnf.2_Missense_Mutation_p.L35I|DNAH9_uc010vvh.1_Missense_Mutation_p.L76I	p.L3723I	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	58	11235	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3723					A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.11167C>A	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	7.093	0.572589	0.13623	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.51817	0.69;0.69;0.69	5.34	2.14	0.27477	.	0.264676	0.38663	N	0.001613	T	0.38081	0.1027	L	0.45228	1.405	0.38107	D	0.937451	B;B	0.15473	0.005;0.013	B;B	0.16289	0.015;0.009	T	0.26121	-1.0112	10	0.39692	T	0.17	.	11.4474	0.50131	0.13:0.472:0.3981:0.0	.	76;3723	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	I	3723;3723;2305;35;76	ENSP00000262442:L3723I;ENSP00000414874:L3723I;ENSP00000379323:L35I	ENSP00000262442:L3723I	L	+	1	0	DNAH9	11735873	0.741000	0.28217	0.003000	0.11579	0.001000	0.01503	1.425000	0.34859	0.338000	0.23692	-0.182000	0.12963	CTC		0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		64	83	1	0	8.4772e-36	0.00361	2.18655e-35	64	83				
SLC5A10	125206	broad.mit.edu	37	17	18862054	18862054	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:18862054G>A	ENST00000395645.3	+	2	189	c.171G>A	c.(169-171)atG>atA	p.M57I	SLC5A10_ENST00000395643.2_Missense_Mutation_p.M57I|SLC5A10_ENST00000395647.2_Missense_Mutation_p.M57I|SLC5A10_ENST00000395642.1_Start_Codon_SNP_p.M1I|SLC5A10_ENST00000417251.2_Missense_Mutation_p.M57I|SLC5A10_ENST00000317977.6_Start_Codon_SNP_p.M1I	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	57					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						GCCGGGACATGACGTGGTGGC	0.577																																							uc002guu.1		NA																	0				ovary(1)	1						c.(169-171)ATG>ATA		solute carrier family 5 (sodium/glucose							107.0	91.0	97.0					17																	18862054		2203	4300	6503	SO:0001583	missense	125206				sodium ion transport|transmembrane transport	integral to membrane	transporter activity	g.chr17:18862054G>A		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.171G>A	17.37:g.18862054G>A	ENSP00000379007:p.Met57Ile		Somatic				SLC5A10_uc002gur.1_Missense_Mutation_p.M1I|SLC5A10_uc002gut.1_Missense_Mutation_p.M57I|SLC5A10_uc002guv.1_Missense_Mutation_p.M57I|SLC5A10_uc010vyl.1_Missense_Mutation_p.M57I	p.M57I	NM_001042450	NP_001035915	WXS	Illumina HiSeq	Unspecified	A0PJK1	SC5AA_HUMAN			2	212	+			57			Cytoplasmic (Potential).		A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	37	c.171G>A	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198257	0.79015	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.92495	-3.05;-2.42;-3.05;-2.42;-2.42;-2.39	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.91908	0.7438	M	0.69185	2.1	0.80722	D	1	P;P;P;P;P	0.45768	0.571;0.721;0.571;0.753;0.866	B;B;B;B;P	0.44811	0.378;0.26;0.378;0.26;0.461	D	0.92770	0.6231	10	0.87932	D	0	.	14.4539	0.67404	0.0:0.1483:0.8517:0.0	.	57;57;57;57;1	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	I	1;57;1;57;57;57	ENSP00000324346:M1I;ENSP00000379008:M57I;ENSP00000379004:M1I;ENSP00000401875:M57I;ENSP00000379007:M57I;ENSP00000379005:M57I	ENSP00000324346:M1I	M	+	3	0	SLC5A10	18802779	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	6.649000	0.74364	2.665000	0.90641	0.655000	0.94253	ATG		0.577	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	NM_152351		23	43	0	0	0	0.001271	0	23	43				
UNC45B	146862	broad.mit.edu	37	17	33475347	33475347	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:33475347A>G	ENST00000268876.5	+	2	162	c.65A>G	c.(64-66)tAc>tGc	p.Y22C	UNC45B_ENST00000378449.1_Missense_Mutation_p.Y22C|UNC45B_ENST00000433649.1_Missense_Mutation_p.Y22C|UNC45B_ENST00000394570.2_Missense_Mutation_p.Y22C|UNC45B_ENST00000591048.1_Missense_Mutation_p.Y22C	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	22					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CTCCAGGACTACAAGGCCGCC	0.597																																							uc002hja.2		NA																	0				ovary(3)|central_nervous_system(2)|breast(1)	6						c.(64-66)TAC>TGC		cardiomyopathy associated 4 isoform 1							73.0	68.0	70.0					17																	33475347		2203	4300	6503	SO:0001583	missense	146862				cell differentiation|muscle organ development	cytosol	binding	g.chr17:33475347A>G	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.65A>G	17.37:g.33475347A>G	ENSP00000268876:p.Tyr22Cys		Somatic				UNC45B_uc002hjb.2_Missense_Mutation_p.Y22C|UNC45B_uc002hjc.2_Missense_Mutation_p.Y22C|UNC45B_uc010cto.2_Missense_Mutation_p.Y22C	p.Y22C	NM_173167	NP_775259	WXS	Illumina HiSeq	Unspecified	Q8IWX7	UN45B_HUMAN			2	162	+		Ovarian(249;0.17)	22			TPR 1.		Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	c.65A>G	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.466280	0.63625	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	4.79	4.79	0.61399	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	0.449050	0.25723	N	0.028725	D	0.84835	0.5560	M	0.92268	3.29	0.47905	D	0.999546	D;D;D	0.76494	0.999;0.985;0.995	D;P;D	0.72338	0.977;0.907;0.963	D	0.88560	0.3122	10	0.87932	D	0	-18.374	13.6691	0.62414	1.0:0.0:0.0:0.0	.	22;22;22	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	C	22	ENSP00000378071:Y22C;ENSP00000268876:Y22C;ENSP00000412840:Y22C;ENSP00000367710:Y22C	ENSP00000268876:Y22C	Y	+	2	0	UNC45B	30499460	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.711000	0.54868	2.019000	0.59389	0.450000	0.29827	TAC		0.597	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167		19	78	0	0	0	0.000958	0	19	78				
GSDMB	55876	broad.mit.edu	37	17	38068750	38068750	+	Splice_Site	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:38068750C>T	ENST00000394179.1	-	3	366	c.236G>A	c.(235-237)gGt>gAt	p.G79D	GSDMB_ENST00000394175.2_Splice_Site_p.G79D|GSDMB_ENST00000360317.3_Splice_Site_p.G79D|GSDMB_ENST00000520542.1_Splice_Site_p.G79D|GSDMB_ENST00000418519.1_Splice_Site_p.G79D|GSDMB_ENST00000309481.7_Splice_Site_p.G79D			Q8TAX9	GSDMB_HUMAN	gasdermin B	79						cytoplasm (GO:0005737)				breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						AGCCTTTTGACCTGGAAAGAG	0.483																																							uc010cwj.2		NA																	0				breast(1)|pancreas(1)	2						c.(235-237)GGT>GAT		gasdermin B isoform 1							102.0	99.0	100.0					17																	38068750		2203	4300	6503	SO:0001630	splice_region_variant	55876					cytoplasm		g.chr17:38068750C>T	AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.236-1G>A	17.37:g.38068750C>T			Somatic				GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Missense_Mutation_p.G79D|GSDMB_uc002hth.2_Missense_Mutation_p.G79D|GSDMB_uc010wem.1_Missense_Mutation_p.G79D	p.G79D	NM_001042471	NP_001035936	WXS	Illumina HiSeq	Unspecified	Q8TAX9	GSDMB_HUMAN			2	241	-			79					B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Missense_Mutation	SNP	ENST00000394179.1	37	c.236G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.18|11.18	1.564085|1.564085	0.27915|0.27915	.|.	.|.	ENSG00000073605|ENSG00000073605	ENST00000360317;ENST00000394175;ENST00000309481;ENST00000520542;ENST00000418519;ENST00000394179|ENST00000420491	T;T;T;T;T;T|.	0.21031|.	2.03;2.03;2.03;2.03;2.03;2.03|.	3.18|3.18	1.12|1.12	0.20585|0.20585	.|.	1.413240|.	0.05003|.	U|.	0.469392|.	T|T	0.35422|0.35422	0.0931|0.0931	L|L	0.47716|0.47716	1.5|1.5	0.21445|0.21445	N|N	0.999689|0.999689	B;B;B;B|.	0.27013|.	0.057;0.166;0.166;0.046|.	B;B;B;B|.	0.24974|.	0.047;0.057;0.057;0.019|.	T|T	0.27331|0.27331	-1.0077|-1.0077	10|5	0.28530|.	T|.	0.3|.	.|.	3.9601|3.9601	0.09407|0.09407	0.2327:0.6391:0.0:0.1281|0.2327:0.6391:0.0:0.1281	.|.	79;79;79;79|.	B4DKK7;Q8TAX9-4;Q8TAX9-3;Q8TAX9-2|.	.;.;.;.|.	D|I	79|11	ENSP00000353465:G79D;ENSP00000377729:G79D;ENSP00000312584:G79D;ENSP00000430157:G79D;ENSP00000415049:G79D;ENSP00000377733:G79D|.	ENSP00000312584:G79D|.	G|V	-|-	2|1	0|0	GSDMB|GSDMB	35322276|35322276	0.041000|0.041000	0.20044|0.20044	0.387000|0.387000	0.26183|0.26183	0.481000|0.481000	0.33189|0.33189	0.044000|0.044000	0.13992|0.13992	0.350000|0.350000	0.24002|0.24002	0.514000|0.514000	0.50259|0.50259	GGT|GTC		0.483	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530	Missense_Mutation	24	22	0	0	0	0.004656	0	24	22				
KRT23	25984	broad.mit.edu	37	17	39092802	39092802	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:39092802G>A	ENST00000209718.3	-	2	478	c.54C>T	c.(52-54)gcC>gcT	p.A18A	KRT23_ENST00000582283.1_5'Flank|KRT23_ENST00000436344.3_Intron|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	18	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AGCCACCTCCGGCGCCATGGA	0.692																																							uc002hvm.1		NA																	0				ovary(1)	1						c.(52-54)GCC>GCT		keratin 23							23.0	29.0	27.0					17																	39092802		2188	4264	6452	SO:0001819	synonymous_variant	25984					intermediate filament	structural molecule activity	g.chr17:39092802G>A	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.54C>T	17.37:g.39092802G>A			Somatic				KRT23_uc010wfl.1_Intron|KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.2_Silent_p.A18A|KRT23_uc002hvn.1_Silent_p.A18A	p.A18A	NM_015515	NP_056330	WXS	Illumina HiSeq	Unspecified	Q9C075	K1C23_HUMAN			2	643	-		Breast(137;0.000301)|Ovarian(249;0.15)	18			Head.		A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Silent	SNP	ENST00000209718.3	37	c.54C>T	CCDS11380.1																																																																																				0.692	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1			15	47	0	0	0	0.00245	0	15	47				
KRT13	3860	broad.mit.edu	37	17	39661387	39661387	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:39661387C>T	ENST00000246635.3	-	1	462	c.416G>A	c.(415-417)tGg>tAg	p.W139*	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000336861.3_Nonsense_Mutation_p.W139*|KRT13_ENST00000587544.1_Nonsense_Mutation_p.W139*|KRT13_ENST00000587118.1_5'Flank	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	139	Coil 1A.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				CTTCAGGTGCCAGTCACGGAT	0.607																																							uc002hwu.1		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(415-417)TGG>TAG		keratin 13 isoform a							122.0	113.0	116.0					17																	39661387		2203	4300	6503	SO:0001587	stop_gained	3860				epidermis development	intermediate filament	structural molecule activity	g.chr17:39661387C>T		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.416G>A	17.37:g.39661387C>T	ENSP00000246635:p.Trp139*		Somatic				KRT13_uc002hwv.1_Nonsense_Mutation_p.W139*|KRT13_uc002hww.2_Nonsense_Mutation_p.W32*|KRT13_uc010wfr.1_Nonsense_Mutation_p.W32*|KRT13_uc010cxo.2_Nonsense_Mutation_p.W139*|KRT13_uc002hwx.1_Nonsense_Mutation_p.W127*	p.W139*	NM_153490	NP_705694	WXS	Illumina HiSeq	Unspecified	P13646	K1C13_HUMAN			1	479	-		Breast(137;0.000286)	139			Coil 1A.|Rod.		Q53G54|Q6AZK5|Q8N240	Nonsense_Mutation	SNP	ENST00000246635.3	37	c.416G>A	CCDS11396.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262501	0.59431	.	.	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	.	.	.	4.9	4.9	0.64082	.	0.000000	0.43110	D	0.000615	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.2732	0.90074	0.0:1.0:0.0:0.0	.	.	.	.	X	139;139;127	.	ENSP00000157775:W127X	W	-	2	0	KRT13	36914913	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	1.989000	0.40707	2.564000	0.86499	0.655000	0.94253	TGG		0.607	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490		41	14	0	0	0	0.001706	0	41	14				
KRT14	3861	broad.mit.edu	37	17	39742866	39742866	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:39742866C>A	ENST00000167586.6	-	1	307	c.221G>T	c.(220-222)aGc>aTc	p.S74I		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	74	Head.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				GCTGCTGCTGCTGAAGCCACC	0.667																																							uc002hxf.1		NA																	0				ovary(1)	1						c.(220-222)AGC>ATC		keratin 14							48.0	53.0	51.0					17																	39742866		2200	4297	6497	SO:0001583	missense	3861				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	g.chr17:39742866C>A	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.221G>T	17.37:g.39742866C>A	ENSP00000167586:p.Ser74Ile		Somatic				JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Missense_Mutation_p.S74I	p.S74I	NM_000526	NP_000517	WXS	Illumina HiSeq	Unspecified	P02533	K1C14_HUMAN			1	282	-		Breast(137;0.000307)	74			Head.		Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	ENST00000167586.6	37	c.221G>T	CCDS11400.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.447570	0.26074	.	.	ENSG00000186847	ENST00000167586	D	0.81996	-1.56	5.02	4.05	0.47172	.	0.110526	0.41097	D	0.000956	T	0.76608	0.4011	L	0.50333	1.59	0.30784	N	0.741669	B	0.32693	0.38	B	0.34991	0.193	T	0.71735	-0.4503	10	0.22109	T	0.4	.	9.6147	0.39685	0.0:0.9025:0.0:0.0975	.	74	P02533	K1C14_HUMAN	I	74	ENSP00000167586:S74I	ENSP00000167586:S74I	S	-	2	0	KRT14	36996392	0.033000	0.19621	1.000000	0.80357	0.707000	0.40811	2.260000	0.43267	1.254000	0.44035	-0.362000	0.07510	AGC		0.667	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257289.1	NM_000526		10	4	1	0	0.000442599	0.000443	0.000852278	10	4				
GFAP	2670	broad.mit.edu	37	17	42992602	42992602	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:42992602C>G	ENST00000253408.5	-	1	318	c.253G>C	c.(253-255)Gag>Cag	p.E85Q	GFAP_ENST00000591327.1_5'UTR|GFAP_ENST00000588735.1_Intron|GFAP_ENST00000435360.2_Missense_Mutation_p.E85Q|GFAP_ENST00000586793.1_Missense_Mutation_p.E85Q	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	85	Coil 1A.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				CGAACCTTCTCGATGTAGCTG	0.602																																							uc002ihq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(253-255)GAG>CAG		glial fibrillary acidic protein isoform 1							80.0	66.0	71.0					17																	42992602		2203	4300	6503	SO:0001583	missense	2670					cytoplasm|intermediate filament	structural constituent of cytoskeleton	g.chr17:42992602C>G	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.253G>C	17.37:g.42992602C>G	ENSP00000253408:p.Glu85Gln		Somatic				GFAP_uc002ihr.2_Missense_Mutation_p.E85Q|GFAP_uc010wjg.1_RNA	p.E85Q	NM_002055	NP_002046	WXS	Illumina HiSeq	Unspecified	P14136	GFAP_HUMAN			1	313	-		Prostate(33;0.0959)	85			Rod.|Coil 1A.		B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	37	c.253G>C	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838343	0.91117	.	.	ENSG00000131095	ENST00000253408;ENST00000421021;ENST00000435360;ENST00000376990	D;D;D	0.91521	-2.86;-2.86;-2.86	4.82	4.82	0.62117	Filament (1);	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;0.989	D;D	0.76575	0.988;0.966	D	0.96595	0.9440	10	0.87932	D	0	.	18.0582	0.89369	0.0:1.0:0.0:0.0	.	85;85	E9PAX3;P14136	.;GFAP_HUMAN	Q	85;60;85;85	ENSP00000253408:E85Q;ENSP00000403962:E85Q;ENSP00000366189:E85Q	ENSP00000253408:E85Q	E	-	1	0	GFAP	40348128	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	7.609000	0.82925	2.677000	0.91161	0.561000	0.74099	GAG		0.602	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055		24	16	0	0	0	0.00333	0	24	16				
SLC16A6	9120	broad.mit.edu	37	17	66270079	66270079	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:66270079C>A	ENST00000327268.4	-	4	529	c.365G>T	c.(364-366)gGc>gTc	p.G122V	ARSG_ENST00000448504.2_Intron|SLC16A6_ENST00000580666.1_Missense_Mutation_p.G122V	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	122					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	AGAGATGATGCCGATGGCGAC	0.493																																							uc002jgz.1		NA																	0					0						c.(364-366)GGC>GTC		solute carrier family 16, member 6	Pyruvic acid(DB00119)						87.0	78.0	81.0					17																	66270079		2203	4300	6503	SO:0001583	missense	9120					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity	g.chr17:66270079C>A	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.365G>T	17.37:g.66270079C>A	ENSP00000319991:p.Gly122Val		Somatic				ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Missense_Mutation_p.G122V	p.G122V	NM_004694	NP_004685	WXS	Illumina HiSeq	Unspecified	O15403	MOT7_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		3	553	-	all_cancers(12;1.24e-09)		122			Helical; (Potential).		Q6P1X3	Missense_Mutation	SNP	ENST00000327268.4	37	c.365G>T	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233204	0.58777	.	.	ENSG00000108932	ENST00000327268	T	0.77489	-1.1	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91590	0.7343	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93113	0.6518	10	0.87932	D	0	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	122	O15403	MOT7_HUMAN	V	122	ENSP00000319991:G122V	ENSP00000319991:G122V	G	-	2	0	SLC16A6	63781674	1.000000	0.71417	0.153000	0.22517	0.008000	0.06430	7.354000	0.79424	2.735000	0.93741	0.655000	0.94253	GGC		0.493	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694		18	28	1	0	3.99206e-14	0.000958	9.27059e-14	18	28				
CCDC57	284001	broad.mit.edu	37	17	80159691	80159691	+	Missense_Mutation	SNP	C	C	T	rs373916021		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:80159691C>T	ENST00000389641.4	-	2	166	c.130G>A	c.(130-132)Gag>Aag	p.E44K	CCDC57_ENST00000392347.1_Missense_Mutation_p.E44K|CCDC57_ENST00000392343.3_Missense_Mutation_p.E44K			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	44										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TGCGCCTCCTCCAGCTGGCTC	0.657																																							uc002kdz.1		NA																	0				ovary(2)	2						c.(130-132)GAG>AAG		coiled-coil domain containing 57		C	LYS/GLU	0,4280		0,0,2140	38.0	45.0	43.0		130	-9.9	0.4	17		43	1,8487		0,1,4243	no	missense	CCDC57	NM_198082.2	56	0,1,6383	TT,TC,CC		0.0118,0.0,0.0078	benign	44/916	80159691	1,12767	2140	4244	6384	SO:0001583	missense	284001							g.chr17:80159691C>T	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.130G>A	17.37:g.80159691C>T	ENSP00000374292:p.Glu44Lys		Somatic				CCDC57_uc002kdx.1_Missense_Mutation_p.E44K	p.E44K	NM_198082	NP_932348	WXS	Illumina HiSeq	Unspecified	Q2TAC2	CCD57_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)		3	485	-	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		44			Potential.		A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37	c.130G>A		.	.	.	.	.	.	.	.	.	.	C	9.810	1.182987	0.21870	0.0	1.18E-4	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.23950	3.05;3.05;1.88	5.06	-9.93	0.00452	.	1.009930	0.07943	N	0.979650	T	0.16514	0.0397	L	0.44542	1.39	0.09310	N	0.999997	B;B	0.14805	0.011;0.002	B;B	0.14023	0.01;0.005	T	0.50816	-0.8783	10	0.06365	T	0.9	-5.4599	16.2589	0.82530	0.0:0.1703:0.6954:0.1343	.	44;44	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	K	44	ENSP00000374292:E44K;ENSP00000376158:E44K;ENSP00000376154:E44K	ENSP00000374292:E44K	E	-	1	0	CCDC57	77752980	0.000000	0.05858	0.444000	0.26895	0.164000	0.22412	-0.632000	0.05489	-1.225000	0.02578	-0.932000	0.02703	GAG		0.657	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082		21	40	0	0	0	0.001882	0	21	40				
ROCK1	6093	broad.mit.edu	37	18	18600168	18600168	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:18600168C>A	ENST00000399799.2	-	12	2245	c.1305G>T	c.(1303-1305)ctG>ctT	p.L435L		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	435	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GCTGTTCTTCCAGCTTATAGA	0.269																																							uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(1303-1305)CTG>CTT		Rho-associated, coiled-coil containing protein							76.0	71.0	72.0					18																	18600168		2202	4291	6493	SO:0001819	synonymous_variant	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18600168C>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1305G>T	18.37:g.18600168C>A			Somatic					p.L435L	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			12	2246	-	Melanoma(1;0.165)		435			Interaction with FHOD1.|Potential.		B0YJ91|Q2KHM4|Q59GZ4	Silent	SNP	ENST00000399799.2	37	c.1305G>T	CCDS11870.2																																																																																				0.269	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		8	13	1	0	0.000157383	0.00308	0.000307293	8	13				
SNRPD1	6632	broad.mit.edu	37	18	19209061	19209061	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:19209061C>T	ENST00000300413.5	+	4	485	c.322C>T	c.(322-324)Cgt>Tgt	p.R108C	RP11-13N13.2_ENST00000577906.1_lincRNA|SNRPD1_ENST00000579618.1_3'UTR|SNRPD1_ENST00000582475.1_Missense_Mutation_p.R64C	NM_006938.2	NP_008869.1	P62314	SMD1_HUMAN	small nuclear ribonucleoprotein D1 polypeptide 16kDa	108	Arg/Lys-rich (basic).				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			lung(2)|prostate(1)	3						aggaagaggacgtggccgtgg	0.448																																							uc002ktj.1		NA																	0					0						c.(322-324)CGT>TGT		small nuclear ribonucleoprotein D1 polypeptide							124.0	121.0	122.0					18																	19209061		2203	4300	6503	SO:0001583	missense	6632				ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding	g.chr18:19209061C>T	L36188	CCDS32801.1	18q11.2	2011-10-11	2002-08-29		ENSG00000167088	ENSG00000167088			11158	protein-coding gene	gene with protein product		601063	"""small nuclear ribonucleoprotein D1 polypeptide (16kD)"""	SNRPD		7527560, 1701240	Standard	NM_006938		Approved	HsT2456, Sm-D1	uc002ktj.1	P62314		ENST00000300413.5:c.322C>T	18.37:g.19209061C>T	ENSP00000300413:p.Arg108Cys		Somatic					p.R108C	NM_006938	NP_008869	WXS	Illumina HiSeq	Unspecified	P62314	SMD1_HUMAN			4	453	+			108			Arg/Lys-rich (basic).		B5BTZ1|P13641	Missense_Mutation	SNP	ENST00000300413.5	37	c.322C>T	CCDS32801.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541084	0.65085	.	.	ENSG00000167088	ENST00000300413	T	0.48201	0.82	5.33	5.33	0.75918	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.053027	0.85682	D	0.000000	T	0.71384	0.3333	M	0.86864	2.845	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.74791	-0.3545	10	0.51188	T	0.08	-6.5402	14.9033	0.70696	0.0:1.0:0.0:0.0	.	108	P62314	SMD1_HUMAN	C	108	ENSP00000300413:R108C	ENSP00000300413:R108C	R	+	1	0	SNRPD1	17463059	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.372000	0.34261	2.652000	0.90054	0.655000	0.94253	CGT		0.448	SNRPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444020.2	NM_006938		11	57	0	0	0	0.000673	0	11	57				
WDR7	23335	broad.mit.edu	37	18	54629724	54629724	+	Silent	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:54629724A>T	ENST00000254442.3	+	26	4339	c.4128A>T	c.(4126-4128)tcA>tcT	p.S1376S	WDR7_ENST00000357574.3_Silent_p.S1343S|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1376					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GCCATGGTTCAGTGGCCCTGT	0.418																																							uc002lgk.1		NA																	0				ovary(2)|skin(1)	3						c.(4126-4128)TCA>TCT		rabconnectin-3 beta isoform 1							98.0	89.0	92.0					18																	54629724		2203	4300	6503	SO:0001819	synonymous_variant	23335							g.chr18:54629724A>T	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.4128A>T	18.37:g.54629724A>T			Somatic				WDR7_uc002lgl.1_Silent_p.S1343S	p.S1376S	NM_015285	NP_056100	WXS	Illumina HiSeq	Unspecified	Q9Y4E6	WDR7_HUMAN		Lung(128;0.0238)|Colorectal(16;0.0296)	26	4339	+			1376			WD 8.		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Silent	SNP	ENST00000254442.3	37	c.4128A>T	CCDS11962.1																																																																																				0.418	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			15	30	0	0	0	0.006122	0	15	30				
CDH20	28316	broad.mit.edu	37	18	59195350	59195350	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:59195350G>C	ENST00000262717.4	+	7	1566	c.1168G>C	c.(1168-1170)Gaa>Caa	p.E390Q	CDH20_ENST00000536675.2_Missense_Mutation_p.E390Q|CDH20_ENST00000538374.1_Missense_Mutation_p.E390Q			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	390	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				CCCTGTGTTTGAACCTGGCTT	0.493																																							uc010dps.1		NA																	0				breast(3)|ovary(1)|pancreas(1)	5						c.(1168-1170)GAA>CAA		cadherin 20, type 2 preproprotein							163.0	158.0	160.0					18																	59195350		2203	4300	6503	SO:0001583	missense	28316				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:59195350G>C	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1168G>C	18.37:g.59195350G>C	ENSP00000262717:p.Glu390Gln		Somatic				CDH20_uc002lif.2_Missense_Mutation_p.E384Q	p.E390Q	NM_031891	NP_114097	WXS	Illumina HiSeq	Unspecified	Q9HBT6	CAD20_HUMAN			6	1180	+		Colorectal(73;0.186)	390			Cadherin 4.|Extracellular (Potential).		Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	c.1168G>C	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968092	0.34754	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.60920	0.15;0.15;0.15	5.73	4.85	0.62838	Cadherin (2);Cadherin-like (1);	0.253874	0.44902	D	0.000409	T	0.51601	0.1684	L	0.42632	1.34	0.40911	D	0.98423	B	0.20164	0.042	B	0.22601	0.04	T	0.46624	-0.9178	10	0.26408	T	0.33	.	16.7791	0.85558	0.0:0.129:0.871:0.0	.	390	Q9HBT6	CAD20_HUMAN	Q	390	ENSP00000444767:E390Q;ENSP00000442226:E390Q;ENSP00000262717:E390Q	ENSP00000262717:E390Q	E	+	1	0	CDH20	57346330	1.000000	0.71417	0.999000	0.59377	0.754000	0.42855	4.334000	0.59291	1.416000	0.47057	0.650000	0.86243	GAA		0.493	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891		7	136	0	0	0	0.001984	0	7	136				
SERPINB3	6317	broad.mit.edu	37	18	61322930	61322930	+	Silent	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:61322930G>T	ENST00000283752.5	-	8	1277	c.1134C>A	c.(1132-1134)acC>acA	p.T378T	SERPINB3_ENST00000332821.8_Silent_p.T326T|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	378					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GGATGCTGTTGGTCTTATTTT	0.423																																							uc002lji.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1132-1134)ACC>ACA		serine (or cysteine) proteinase inhibitor, clade							196.0	194.0	194.0					18																	61322930		2203	4300	6503	SO:0001819	synonymous_variant	6317				regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61322930G>T	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.1134C>A	18.37:g.61322930G>T			Somatic				SERPINB4_uc002ljg.2_Intron|SERPINB3_uc010dqa.2_Silent_p.T326T	p.T378T	NM_006919	NP_008850	WXS	Illumina HiSeq	Unspecified	P29508	SPB3_HUMAN			8	1278	-			378					A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Silent	SNP	ENST00000283752.5	37	c.1134C>A	CCDS11987.1																																																																																				0.423	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		35	66	1	0	2.47316e-13	0.003271	5.7054e-13	35	66				
SERPINB2	5055	broad.mit.edu	37	18	61569653	61569653	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:61569653G>T	ENST00000299502.4	+	7	774	c.694G>T	c.(694-696)Gta>Tta	p.V232L	SERPINB2_ENST00000482254.1_3'UTR|SERPINB2_ENST00000457692.1_Missense_Mutation_p.V232L	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	232					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	GCGCACACCTGTACAGATGAT	0.358																																							uc010xeu.1		NA																	0				lung(1)|skin(1)	2						c.(694-696)GTA>TTA		serine (or cysteine) proteinase inhibitor, clade	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)						91.0	85.0	87.0					18																	61569653		2203	4300	6503	SO:0001583	missense	5055				anti-apoptosis|blood coagulation|fibrinolysis|regulation of proteolysis	extracellular space|Golgi apparatus|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr18:61569653G>T	Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.694G>T	18.37:g.61569653G>T	ENSP00000299502:p.Val232Leu		Somatic				SERPINB2_uc002ljo.2_Missense_Mutation_p.V232L|SERPINB2_uc010dqh.2_Missense_Mutation_p.V162L|SERPINB2_uc002ljp.1_Missense_Mutation_p.V37L|SERPINB2_uc002ljq.1_Missense_Mutation_p.V37L	p.V232L	NM_001143818	NP_001137290	WXS	Illumina HiSeq	Unspecified	P05120	PAI2_HUMAN			8	1027	+		Esophageal squamous(42;0.131)	232					Q96E96	Missense_Mutation	SNP	ENST00000299502.4	37	c.694G>T	CCDS11989.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.49|18.49	3.634816|3.634816	0.67130|0.67130	.|.	.|.	ENSG00000242550|ENSG00000197632	ENST00000397996;ENST00000418725|ENST00000299502;ENST00000457692	.|T;T	.|0.20881	.|2.04;2.04	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Serpin domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60444|0.60444	0.2269|0.2269	H|H	0.94582|0.94582	3.555|3.555	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.998	T|T	0.72184|0.72184	-0.4367|-0.4367	5|10	.|0.87932	.|D	.|0	.|.	18.522|18.522	0.90956|0.90956	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|232;232	.|B2R7Y0;P05120	.|.;PAI2_HUMAN	F|L	108|232	.|ENSP00000299502:V232L;ENSP00000401645:V232L	.|ENSP00000299502:V232L	C|V	+|+	2|1	0|0	SERPINB10|SERPINB2	59720633|59720633	1.000000|1.000000	0.71417|0.71417	0.783000|0.783000	0.31826|0.31826	0.021000|0.021000	0.10359|0.10359	9.301000|9.301000	0.96167|0.96167	2.684000|2.684000	0.91462|0.91462	0.650000|0.650000	0.86243|0.86243	TGT|GTA		0.358	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134009.1	NM_002575		15	34	1	0	3.35478e-16	0.003163	8.03078e-16	15	34				
CDH7	1005	broad.mit.edu	37	18	63547748	63547748	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:63547748G>T	ENST00000397968.2	+	12	2402	c.1976G>T	c.(1975-1977)gGa>gTa	p.G659V	CDH7_ENST00000323011.3_Missense_Mutation_p.G659V	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	659					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GAGGGCGGGGGAGAGGAGGAC	0.478																																							uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1975-1977)GGA>GTA		cadherin 7, type 2 preproprotein							72.0	73.0	73.0					18																	63547748		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63547748G>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1976G>T	18.37:g.63547748G>T	ENSP00000381058:p.Gly659Val		Somatic				CDH7_uc002lkb.2_Missense_Mutation_p.G659V	p.G659V	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			12	2301	+		Esophageal squamous(42;0.129)	659			Cytoplasmic (Potential).		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.1976G>T	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797407	0.50208	.	.	ENSG00000081138	ENST00000323011;ENST00000397966;ENST00000397968	D;D	0.98717	-5.09;-5.09	5.61	5.61	0.85477	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98448	1.0590	10	0.87932	D	0	.	19.6378	0.95744	0.0:0.0:1.0:0.0	.	659	Q9ULB5	CADH7_HUMAN	V	659	ENSP00000319166:G659V;ENSP00000381058:G659V	ENSP00000319166:G659V	G	+	2	0	CDH7	61698728	1.000000	0.71417	0.660000	0.29694	0.078000	0.17371	9.869000	0.99810	2.631000	0.89168	0.655000	0.94253	GGA		0.478	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		12	41	1	0	4.36969e-10	0.001855	9.54504e-10	12	41				
SOCS6	9306	broad.mit.edu	37	18	67992759	67992759	+	Silent	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr18:67992759G>C	ENST00000397942.3	+	2	1171	c.855G>C	c.(853-855)gtG>gtC	p.V285V	SOCS6_ENST00000582322.1_Silent_p.V285V	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	285					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ATCAGTCCGTGAATGGCTTGT	0.577																																					Melanoma(84;1024 1361 24382 36583 42651)	Melanoma(84;1024 1361 24382 36583 42651)	uc002lkr.1		NA																	0				large_intestine(1)|lung(1)	2						c.(853-855)GTG>GTC		suppressor of cytokine signaling 6							164.0	148.0	153.0					18																	67992759		2203	4300	6503	SO:0001819	synonymous_variant	9306				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm		g.chr18:67992759G>C	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.855G>C	18.37:g.67992759G>C			Somatic				SOCS6_uc010dqq.2_Silent_p.V285V	p.V285V	NM_004232	NP_004223	WXS	Illumina HiSeq	Unspecified	O14544	SOCS6_HUMAN			2	1171	+		Esophageal squamous(42;0.129)|Colorectal(73;0.152)	285					Q8WUM3	Silent	SNP	ENST00000397942.3	37	c.855G>C	CCDS11998.1																																																																																				0.577	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2			3	138	0	0	0	0.004672	0	3	138				
DOT1L	84444	broad.mit.edu	37	19	2216400	2216400	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:2216400G>T	ENST00000398665.3	+	20	2080	c.2044G>T	c.(2044-2046)Gag>Tag	p.E682*	DOT1L_ENST00000608122.1_3'UTR|AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	682					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGGCCGCGAGCTGGAGCC	0.677																																							uc002lvb.3		NA																	0				pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4						c.(2044-2046)GAG>TAG		DOT1-like, histone H3 methyltransferase							27.0	31.0	29.0					19																	2216400		2069	4189	6258	SO:0001587	stop_gained	84444					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr19:2216400G>T	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2044G>T	19.37:g.2216400G>T	ENSP00000381657:p.Glu682*		Somatic				DOT1L_uc002lvc.1_5'UTR|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_5'UTR	p.E682*	NM_032482	NP_115871	WXS	Illumina HiSeq	Unspecified	Q8TEK3	DOT1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2080	+		Hepatocellular(1079;0.137)	682					O60379|Q96JL1	Nonsense_Mutation	SNP	ENST00000398665.3	37	c.2044G>T	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	32	5.127869	0.94473	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	.	.	.	5.01	2.84	0.33178	.	0.483668	0.23300	N	0.049683	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.8279	6.6638	0.23029	0.161:0.1442:0.6949:0.0	.	.	.	.	X	682	.	ENSP00000221482:E682X	E	+	1	0	DOT1L	2167400	1.000000	0.71417	0.525000	0.27900	0.105000	0.19272	5.645000	0.67909	1.105000	0.41606	0.655000	0.94253	GAG		0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482		19	11	1	0	4.30721e-22	0.001523	1.07526e-21	19	11				
GNA15	2769	broad.mit.edu	37	19	3163000	3163000	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:3163000G>A	ENST00000262958.3	+	7	1366	c.1108G>A	c.(1108-1110)Gag>Aag	p.E370K		NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	370					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		CTACCTGGACGAGATCAACCT	0.662											OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002lxf.2		NA																	0				skin(2)	2						c.(1108-1110)GAG>AAG		guanine nucleotide binding protein (G protein),							69.0	60.0	63.0					19																	3163000		2203	4300	6503	SO:0001583	missense	2769				activation of phospholipase C activity by dopamine receptor signaling pathway|activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	g.chr19:3163000G>A		CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.1108G>A	19.37:g.3163000G>A	ENSP00000262958:p.Glu370Lys		Somatic	OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	609		p.E370K	NM_002068	NP_002059	WXS	Illumina HiSeq	Unspecified	P30679	GNA15_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)	7	1366	+		Hepatocellular(1079;0.137)	370					E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	37	c.1108G>A	CCDS12104.1	.	.	.	.	.	.	.	.	.	.	g	27.2	4.808677	0.90707	.	.	ENSG00000060558	ENST00000262958	D	0.82344	-1.6	3.9	3.9	0.45041	.	0.076235	0.50627	D	0.000103	T	0.80763	0.4685	N	0.17764	0.52	0.36253	D	0.854048	D	0.58620	0.983	P	0.56042	0.79	D	0.86040	0.1519	10	0.62326	D	0.03	.	13.4115	0.60946	0.0:0.0:1.0:0.0	.	370	P30679	GNA15_HUMAN	K	370	ENSP00000262958:E370K	ENSP00000262958:E370K	E	+	1	0	GNA15	3114000	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.408000	0.52651	2.001000	0.58596	0.491000	0.48974	GAG		0.662	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068		3	12	0	0	0	0.004672	0	3	12				
SAFB2	9667	broad.mit.edu	37	19	5604655	5604655	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:5604655C>G	ENST00000252542.4	-	11	1762	c.1498G>C	c.(1498-1500)Gtg>Ctg	p.V500L	SAFB2_ENST00000591310.1_5'UTR	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	500	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TCCTTCTTCACTTCGCACTCT	0.408																																					Ovarian(127;888 1728 23957 44128 52668)	Ovarian(127;888 1728 23957 44128 52668)	uc002mcd.2		NA																	0					0						c.(1498-1500)GTG>CTG		scaffold attachment factor B2							100.0	92.0	95.0					19																	5604655		2203	4300	6503	SO:0001583	missense	9667				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding	g.chr19:5604655C>G	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.1498G>C	19.37:g.5604655C>G	ENSP00000252542:p.Val500Leu		Somatic					p.V500L	NM_014649	NP_055464	WXS	Illumina HiSeq	Unspecified	Q14151	SAFB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)	11	1710	-			500			Lys-rich.		B4DKG3|Q8TB13	Missense_Mutation	SNP	ENST00000252542.4	37	c.1498G>C	CCDS32879.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540687	0.27563	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542	T	0.21031	2.03	4.44	3.35	0.38373	.	0.431068	0.19452	N	0.113905	T	0.09069	0.0224	N	0.08118	0	0.22500	N	0.999047	B	0.20988	0.05	B	0.23716	0.048	T	0.29212	-1.0019	10	0.18276	T	0.48	-26.4231	6.2475	0.20827	0.0:0.6657:0.1784:0.1559	.	500	Q14151	SAFB2_HUMAN	L	396;251;500;500	ENSP00000252542:V500L	ENSP00000252542:V500L	V	-	1	0	SAFB2	5555655	0.051000	0.20477	0.974000	0.42286	0.861000	0.49209	-0.082000	0.11304	2.306000	0.77630	0.555000	0.69702	GTG		0.408	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451016.1	NM_014649		4	28	0	0	0	0.000248	0	4	28				
LONP1	9361	broad.mit.edu	37	19	5700844	5700844	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:5700844C>G	ENST00000360614.3	-	9	1619	c.1462G>C	c.(1462-1464)Gag>Cag	p.E488Q	LONP1_ENST00000590729.1_Missense_Mutation_p.E358Q|LONP1_ENST00000593119.1_Missense_Mutation_p.E424Q|LONP1_ENST00000585374.1_Missense_Mutation_p.E374Q|LONP1_ENST00000540670.2_Missense_Mutation_p.E292Q	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGTCTTCCTCCAGCACTGCC	0.612																																							uc002mcx.2		NA																	0					0						c.(1462-1464)GAG>CAG		mitochondrial lon peptidase 1 precursor							217.0	137.0	164.0					19																	5700844		2203	4300	6503	SO:0001583	missense	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5700844C>G	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1462G>C	19.37:g.5700844C>G	ENSP00000353826:p.Glu488Gln		Somatic				LONP1_uc002mcy.2_Missense_Mutation_p.E424Q|LONP1_uc010duh.2_Missense_Mutation_p.E229Q|LONP1_uc010dui.2_Missense_Mutation_p.E472Q|LONP1_uc002mcz.2_Missense_Mutation_p.E292Q	p.E488Q	NM_004793	NP_004784	WXS	Illumina HiSeq	Unspecified	P36776	LONM_HUMAN			9	1495	-			488						Missense_Mutation	SNP	ENST00000360614.3	37	c.1462G>C	CCDS12148.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932709	0.92458	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.23552	2.21;1.9	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	M	0.76838	2.35	0.58432	D	0.999998	D;P;D	0.58970	0.984;0.955;0.984	P;P;P	0.57009	0.811;0.709;0.811	T	0.53885	-0.8375	10	0.72032	D	0.01	-39.7162	14.8717	0.70462	0.0:1.0:0.0:0.0	.	488;424;488	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	Q	488;452;292	ENSP00000353826:E488Q;ENSP00000441523:E292Q	ENSP00000351177:E452Q	E	-	1	0	LONP1	5651844	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.492000	0.81482	2.090000	0.63153	0.561000	0.74099	GAG		0.612	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		4	31	0	0	0	0.000602	0	4	31				
MUC16	94025	broad.mit.edu	37	19	9057032	9057032	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:9057032G>A	ENST00000397910.4	-	3	30617	c.30414C>T	c.(30412-30414)tcC>tcT	p.S10138S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10140	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTCAGCCATGGAAGAGGGAG	0.458																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(30412-30414)TCC>TCT		mucin 16							66.0	64.0	65.0					19																	9057032		1938	4129	6067	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9057032G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30414C>T	19.37:g.9057032G>A			Somatic					p.S10138S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	30618	-			10140			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.30414C>T	CCDS54212.1																																																																																				0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		15	10	0	0	0	0.003163	0	15	10				
QTRT1	81890	broad.mit.edu	37	19	10822872	10822872	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:10822872G>T	ENST00000250237.5	+	6	692	c.682G>T	c.(682-684)Ggg>Tgg	p.G228W		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	228					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)	p.G228R(2)		large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTTCGCCATCGGGGGCCTGAG	0.617																																							uc002mpr.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(682-684)GGG>TGG		queuine tRNA-ribosyltransferase 1																																				SO:0001583	missense	81890				queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr19:10822872G>T	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.682G>T	19.37:g.10822872G>T	ENSP00000250237:p.Gly228Trp		Somatic				DNM2_uc010dxk.2_5'Flank	p.G228W	NM_031209	NP_112486	WXS	Illumina HiSeq	Unspecified	Q9BXR0	TGT_HUMAN	Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)		6	707	+			228					B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	c.682G>T	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110925	0.77210	.	.	ENSG00000213339	ENST00000250237	.	.	.	4.01	4.01	0.46588	.	0.000000	0.85682	U	0.000000	D	0.90253	0.6952	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94169	0.7421	9	0.87932	D	0	-0.38	15.0488	0.71850	0.0:0.0:1.0:0.0	.	228	Q9BXR0	TGT_HUMAN	W	228	.	ENSP00000250237:G228W	G	+	1	0	QTRT1	10683872	1.000000	0.71417	0.989000	0.46669	0.749000	0.42624	8.755000	0.91646	2.079000	0.62486	0.462000	0.41574	GGG		0.617	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		35	14	1	0	9.80977e-26	0.004289	2.46656e-25	35	14				
URI1	8725	broad.mit.edu	37	19	30505953	30505953	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:30505953G>T	ENST00000542441.2	+	11	1882	c.1585G>T	c.(1585-1587)Gcc>Tcc	p.A529S	URI1_ENST00000360605.4_Intron|URI1_ENST00000312051.6_Missense_Mutation_p.A489S|URI1_ENST00000392271.1_Missense_Mutation_p.A453S			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	529					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GTTTAAAGCTGCCAGATTGCA	0.408																																						Melanoma(75;661 1306 1472 28422 37948)	uc002nsr.2		NA																	0				ovary(1)|kidney(1)	2						c.(1585-1587)GCC>TCC		RPB5-mediating protein isoform a							84.0	83.0	84.0					19																	30505953		2203	4300	6503	SO:0001583	missense	8725				protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding	g.chr19:30505953G>T	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1585G>T	19.37:g.30505953G>T	ENSP00000442436:p.Ala529Ser		Somatic				C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_Missense_Mutation_p.A489S|C19orf2_uc002nst.2_Missense_Mutation_p.A453S	p.A529S	NM_003796	NP_003787	WXS	Illumina HiSeq	Unspecified	O94763	RMP_HUMAN	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)	11	1615	+	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	529					A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	37	c.1585G>T	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449247	0.63178	.	.	ENSG00000105176	ENST00000392271;ENST00000542441;ENST00000312051	T	0.59906	0.23	6.07	2.81	0.32909	.	0.193668	0.56097	D	0.000036	T	0.59729	0.2215	L	0.58101	1.795	0.47778	D	0.999513	P;B	0.52842	0.956;0.19	P;B	0.53102	0.718;0.066	T	0.56183	-0.8021	10	0.33141	T	0.24	-6.7431	8.5693	0.33558	0.1304:0.0:0.7428:0.1268	.	489;529	F8W9T0;O94763	.;RMP_HUMAN	S	453;529;489	ENSP00000442436:A529S	ENSP00000312530:A489S	A	+	1	0	C19orf2	35197793	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.455000	0.52993	0.894000	0.36317	-0.158000	0.13435	GCC		0.408	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447		14	36	1	0	4.3838e-07	0.001855	8.93375e-07	14	36				
C19orf40	91442	broad.mit.edu	37	19	33465037	33465037	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:33465037G>C	ENST00000588258.1	+	4	425	c.315G>C	c.(313-315)caG>caC	p.Q105H	CEP89_ENST00000591863.1_5'Flank|CEP89_ENST00000305768.5_5'Flank|C19orf40_ENST00000590179.1_Missense_Mutation_p.Q10H|C19orf40_ENST00000589646.1_Missense_Mutation_p.Q10H|C19orf40_ENST00000590281.1_Missense_Mutation_p.Q105H|CEP89_ENST00000590597.2_5'Flank	NM_152266.3	NP_689479.1	Q9BTP7	FAP24_HUMAN	chromosome 19 open reading frame 40	105					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7	Esophageal squamous(110;0.137)					CAGCCCTACAGAAGTTTACTG	0.453								Direct reversal of damage																															uc002nud.3		NA																	0					0						c.(313-315)CAG>CAC	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia-associated protein, 24 kDa							99.0	87.0	91.0					19																	33465037		2203	4300	6503	SO:0001583	missense	91442				DNA repair	Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding	g.chr19:33465037G>C	AK128668	CCDS12426.1, CCDS74327.1	19q13.11	2011-11-24			ENSG00000131944	ENSG00000131944			28467	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 24kDa"""	610884				17289582	Standard	XM_005259393		Approved	FLJ46828, MGC32020, FAAP24	uc002nud.4	Q9BTP7		ENST00000588258.1:c.315G>C	19.37:g.33465037G>C	ENSP00000466121:p.Gln105His		Somatic				CCDC123_uc002nty.2_5'Flank|CCDC123_uc010edg.2_5'Flank|CCDC123_uc002ntz.1_5'Flank|CCDC123_uc002nua.2_5'Flank|CCDC123_uc002nuc.1_5'Flank	p.Q105H	NM_152266	NP_689479	WXS	Illumina HiSeq	Unspecified	Q9BTP7	FAP24_HUMAN			4	433	+	Esophageal squamous(110;0.137)		105					B3KY46|Q8WUJ7|Q96FX6	Missense_Mutation	SNP	ENST00000588258.1	37	c.315G>C	CCDS12426.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496608	0.64186	.	.	ENSG00000131944	ENST00000254262	.	.	.	4.71	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.71056	0.3295	M	0.74258	2.255	0.42205	D	0.991783	D	0.89917	1.0	D	0.83275	0.996	T	0.70392	-0.4884	9	0.42905	T	0.14	-12.1842	8.1597	0.31192	0.2531:0.0:0.7469:0.0	.	105	Q9BTP7	FAP24_HUMAN	H	105	.	ENSP00000254262:Q105H	Q	+	3	2	C19orf40	38156877	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	4.220000	0.58567	1.117000	0.41842	0.467000	0.42956	CAG		0.453	C19orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450823.2	NM_152266		3	39	0	0	0	0.004672	0	3	39				
EIF3K	27335	broad.mit.edu	37	19	39116723	39116723	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:39116723G>T	ENST00000538434.1	+	3	309	c.74G>T	c.(73-75)tGc>tTc	p.C25F	EIF3K_ENST00000248342.4_Missense_Mutation_p.C112F|EIF3K_ENST00000593062.1_3'UTR|EIF3K_ENST00000588934.1_Missense_Mutation_p.C112F|EIF3K_ENST00000593149.1_Missense_Mutation_p.C25F|EIF3K_ENST00000545173.2_Missense_Mutation_p.C112F|EIF3K_ENST00000592558.1_Missense_Mutation_p.C112F					eukaryotic translation initiation factor 3, subunit K										EIF3K/CYP39A1(2)	central_nervous_system(1)|endometrium(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTGGAGACCTGCCATTTCCAG	0.567																																							uc002oiz.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(334-336)TGC>TTC		eukaryotic translation initiation factor 3,							110.0	99.0	103.0					19																	39116723		2203	4300	6503	SO:0001583	missense	27335				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex|nucleus	protein binding|ribosome binding|translation initiation factor activity	g.chr19:39116723G>T	AB019392	CCDS12517.1, CCDS74360.1	19q13.2	2012-05-28	2007-07-27	2007-07-27	ENSG00000178982	ENSG00000178982			24656	protein-coding gene	gene with protein product		609596	"""eukaryotic translation initiation factor 3, subunit 12"""	EIF3S12		11042152, 14519125	Standard	XM_006723147		Approved	eIF3k, PRO1474, HSPC029, PTD001, PLAC-24, M9, ARG134	uc002oiz.1	Q9UBQ5		ENST00000538434.1:c.74G>T	19.37:g.39116723G>T	ENSP00000440999:p.Cys25Phe		Somatic				EIF3K_uc010xuh.1_Missense_Mutation_p.C112F|EIF3K_uc010xui.1_Missense_Mutation_p.C25F	p.C112F	NM_013234	NP_037366	WXS	Illumina HiSeq	Unspecified	Q9UBQ5	EIF3K_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		4	522	+	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		112						Missense_Mutation	SNP	ENST00000538434.1	37	c.335G>T		.	.	.	.	.	.	.	.	.	.	G	21.4	4.150915	0.78001	.	.	ENSG00000178982	ENST00000248342;ENST00000538434;ENST00000545173	.	.	.	4.29	4.29	0.51040	Translation initiation factor 3, subunit 12, N-terminal, eukaryotic (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83741	0.5320	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.87361	0.2344	9	0.87932	D	0	-19.6679	16.3713	0.83361	0.0:0.0:1.0:0.0	.	25;112;112	B4DQ48;B7ZAM9;Q9UBQ5	.;.;EIF3K_HUMAN	F	112;25;112	.	ENSP00000248342:C112F	C	+	2	0	EIF3K	43808563	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.135000	0.94478	2.321000	0.78463	0.563000	0.77884	TGC		0.567	EIF3K-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453409.1	NM_013234		45	52	1	0	1.00776e-21	0.00361	2.50684e-21	45	52				
AKT2	208	broad.mit.edu	37	19	40761077	40761077	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:40761077G>A	ENST00000392038.2	-	4	573	c.275C>T	c.(274-276)tCt>tTt	p.S92F	AKT2_ENST00000424901.1_Missense_Mutation_p.S92F|AKT2_ENST00000311278.6_Missense_Mutation_p.S92F|AKT2_ENST00000579047.1_Missense_Mutation_p.S30F	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	92	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CTCGTCTGGAGAATCCACGTG	0.577			A		"""ovarian, pancreatic """																																		uc002onf.2		NA		Dom	yes		19	19q13.1-q13.2	208	A	v-akt murine thymoma viral oncogene homolog 2			E			ovarian|pancreatic 		0				lung(2)	2						c.(274-276)TCT>TTT		AKT2 kinase							102.0	100.0	101.0					19																	40761077		2203	4300	6503	SO:0001583	missense	208				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr19:40761077G>A	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.275C>T	19.37:g.40761077G>A	ENSP00000375892:p.Ser92Phe		Somatic				AKT2_uc010egs.2_Missense_Mutation_p.S92F|AKT2_uc010egt.2_Missense_Mutation_p.S30F|AKT2_uc010xvj.1_Missense_Mutation_p.S30F|AKT2_uc010egu.1_Missense_Mutation_p.S30F|AKT2_uc010xvk.1_Missense_Mutation_p.S92F	p.S92F	NM_001626	NP_001617	WXS	Illumina HiSeq	Unspecified	P31751	AKT2_HUMAN	Lung(22;0.000499)		4	537	-			92			PH.		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	c.275C>T	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.371552	0.24771	.	.	ENSG00000105221	ENST00000392038;ENST00000358335;ENST00000424901;ENST00000311278;ENST00000537834;ENST00000452077;ENST00000392037;ENST00000416362;ENST00000423127;ENST00000456441;ENST00000416994	T;T;T;T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;0.88	4.71	4.71	0.59529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.159187	0.53938	D	0.000051	D	0.91781	0.7400	M	0.93016	3.37	0.58432	D	0.999999	D;P;P;P	0.65815	0.995;0.554;0.936;0.732	D;B;P;P	0.75020	0.985;0.418;0.89;0.89	D	0.93940	0.7222	10	0.87932	D	0	.	16.4117	0.83717	0.0:0.0:1.0:0.0	.	92;30;92;92	B7Z8Z9;B4DG79;Q0VAN0;P31751	.;.;.;AKT2_HUMAN	F	92;91;92;92;92;92;92;92;92;92;92	ENSP00000375892:S92F;ENSP00000399532:S92F;ENSP00000309428:S92F;ENSP00000404083:S92F;ENSP00000375891:S92F;ENSP00000407999:S92F;ENSP00000403842:S92F;ENSP00000396532:S92F;ENSP00000392458:S92F	ENSP00000309428:S92F	S	-	2	0	AKT2	45452917	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	3.656000	0.54467	2.181000	0.69327	0.591000	0.81541	TCT		0.577	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626		11	81	0	0	0	0.000673	0	11	81				
CEACAM7	1087	broad.mit.edu	37	19	42190823	42190823	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:42190823T>G	ENST00000006724.3	-	2	595	c.394A>C	c.(394-396)Aat>Cat	p.N132H	CEACAM7_ENST00000602225.1_Missense_Mutation_p.N132H|CEACAM7_ENST00000599715.1_5'UTR|CEACAM7_ENST00000401731.1_Missense_Mutation_p.N132H|CEACAM7_ENST00000338196.4_Missense_Mutation_p.N132H	NM_006890.3	NP_008821.1	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 7	132	Ig-like V-type.					anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		ACTTCTTCATTCACAAGATTT	0.453																																							uc002ori.1		NA																	0				ovary(2)	2						c.(394-396)AAT>CAT		carcinoembryonic antigen-related cell adhesion							165.0	154.0	158.0					19																	42190823		2203	4300	6503	SO:0001583	missense	1087					anchored to membrane|integral to membrane|plasma membrane		g.chr19:42190823T>G	X98311	CCDS12583.1	19q13.2	2013-01-29			ENSG00000007306	ENSG00000007306		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1819	protein-coding gene	gene with protein product	"""carcinoembryonic antigen gene family member 2"""			CGM2		7806520, 9135022	Standard	XM_005278379		Approved	CEA	uc002ori.1	Q14002	OTTHUMG00000151063	ENST00000006724.3:c.394A>C	19.37:g.42190823T>G	ENSP00000006724:p.Asn132His		Somatic				CEACAM7_uc010ehx.2_Missense_Mutation_p.N132H|CEACAM7_uc010ehy.1_Missense_Mutation_p.N132H	p.N132H	NM_006890	NP_008821	WXS	Illumina HiSeq	Unspecified	Q14002	CEAM7_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)	2	396	-			132			Ig-like V-type.		A8K848|O15148|O15149|Q0VAC1|Q13983|Q9UPJ2	Missense_Mutation	SNP	ENST00000006724.3	37	c.394A>C	CCDS12583.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.306806	0.23821	.	.	ENSG00000007306	ENST00000006724;ENST00000412062;ENST00000401731;ENST00000338196	T;T;T	0.66638	-0.22;-0.22;-0.22	1.68	-2.16	0.07080	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61048	0.2316	M	0.72576	2.205	0.09310	N	1	P;B	0.42584	0.784;0.031	B;B	0.40602	0.334;0.196	T	0.55592	-0.8117	9	0.66056	D	0.02	.	6.6634	0.23027	0.0:0.0:0.6446:0.3554	.	132;132	Q14002-2;Q14002	.;CEAM7_HUMAN	H	132;111;132;132	ENSP00000006724:N132H;ENSP00000385932:N132H;ENSP00000343286:N132H	ENSP00000006724:N132H	N	-	1	0	CEACAM7	46882663	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.284000	0.02793	-0.462000	0.06984	0.260000	0.18958	AAT		0.453	CEACAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321145.1	NM_006890		49	59	0	0	0	0.00361	0	49	59				
NKG7	4818	broad.mit.edu	37	19	51875207	51875207	+	Silent	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:51875207G>T	ENST00000221978.5	-	3	605	c.426C>A	c.(424-426)ctC>ctA	p.L142L	NKG7_ENST00000595217.1_Missense_Mutation_p.S136Y|NKG7_ENST00000600427.1_Intron|CLDND2_ENST00000291715.1_5'Flank|CLDND2_ENST00000601435.1_5'Flank	NM_005601.3	NP_005592.1	Q16617	NKG7_HUMAN	natural killer cell granule protein 7	142						integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TACAGAGCAAGAGGATAGCTG	0.612																																							uc002pwj.2		NA																	0				central_nervous_system(1)	1						c.(424-426)CTC>CTA		natural killer cell group 7 sequence							89.0	96.0	94.0					19																	51875207		2203	4300	6503	SO:0001819	synonymous_variant	4818					integral to plasma membrane		g.chr19:51875207G>T		CCDS12830.1	19q13.41	2014-03-07	2014-03-07		ENSG00000105374	ENSG00000105374			7830	protein-coding gene	gene with protein product	"""granule membrane protein 17"""	606008	"""natural killer cell group 7 sequence"""			8458737	Standard	NM_005601		Approved	GIG1, GMP-17	uc002pwj.3	Q16617	OTTHUMG00000182898	ENST00000221978.5:c.426C>A	19.37:g.51875207G>T			Somatic				CLDND2_uc002pwi.1_5'Flank|NKG7_uc002pwk.2_Silent_p.L107L	p.L142L	NM_005601	NP_005592	WXS	Illumina HiSeq	Unspecified	Q16617	NKG7_HUMAN		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	3	597	-		all_neural(266;0.0199)	142			Helical; (Potential).			Silent	SNP	ENST00000221978.5	37	c.426C>A	CCDS12830.1																																																																																				0.612	NKG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464260.2	NM_005601		5	64	1	0	4.096e-09	0.001168	8.64986e-09	5	64				
ZNF578	147660	broad.mit.edu	37	19	53013909	53013909	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:53013909G>C	ENST00000421239.2	+	6	519	c.275G>C	c.(274-276)aGa>aCa	p.R92T	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	92	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATGTTGCAAAGACATGAAAGT	0.373																																							uc002pzp.3		NA																	0					0						c.(274-276)AGA>ACA		zinc finger protein 578							124.0	128.0	127.0					19																	53013909		2203	4300	6503	SO:0001583	missense	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53013909G>C	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.275G>C	19.37:g.53013909G>C	ENSP00000459216:p.Arg92Thr		Somatic					p.R92T	NM_001099694	NP_001093164	WXS	Illumina HiSeq	Unspecified	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	519	+			191			C2H2-type 7.		B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	c.275G>C	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	10.81	1.455888	0.26161	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	1.48	0.22813	.	.	.	.	.	T	0.54208	0.1844	L	0.58810	1.83	0.09310	N	0.999999	D	0.57899	0.981	D	0.66351	0.943	T	0.35822	-0.9773	7	.	.	.	.	8.6374	0.33957	0.0:0.0:1.0:0.0	.	92	G3V4F6	.	T	92	.	.	R	+	2	0	ZNF578	57705721	0.004000	0.15560	0.005000	0.12908	0.226000	0.24999	0.903000	0.28475	0.835000	0.34877	0.297000	0.19635	AGA		0.373	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		6	83	0	0	0	0.001168	0	6	83				
LENG9	94059	broad.mit.edu	37	19	54973285	54973285	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:54973285C>G	ENST00000333834.4	-	1	1609	c.1491G>C	c.(1489-1491)gaG>gaC	p.E497D		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	497							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		CCAGGCGGATCTCAGCCAGGG	0.607																																							uc010yez.1		NA																	0					0						c.(1489-1491)GAG>GAC		leukocyte receptor cluster (LRC) member 9							57.0	67.0	64.0					19																	54973285		2203	4298	6501	SO:0001583	missense	94059				RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding	g.chr19:54973285C>G	AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.1491G>C	19.37:g.54973285C>G	ENSP00000331647:p.Glu497Asp		Somatic					p.E497D	NM_198988	NP_945339	WXS	Illumina HiSeq	Unspecified	Q96B70	LENG9_HUMAN		GBM - Glioblastoma multiforme(193;0.134)	1	1610	-	Ovarian(34;0.19)		497					B2VAM3	Missense_Mutation	SNP	ENST00000333834.4	37	c.1491G>C	CCDS12895.2	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410336	0.62399	.	.	ENSG00000182909	ENST00000333834	T	0.46063	0.88	4.98	1.68	0.24146	RNA ligase/cyclic nucleotide phosphodiesterase (1);	0.316555	0.28694	U	0.014444	T	0.51244	0.1663	L	0.59436	1.845	0.09310	N	1	D	0.57257	0.979	D	0.63033	0.91	T	0.37033	-0.9723	10	0.59425	D	0.04	-28.7521	6.7323	0.23390	0.0:0.7018:0.0:0.2982	.	497	Q96B70	LENG9_HUMAN	D	497	ENSP00000331647:E497D	ENSP00000331647:E497D	E	-	3	2	LENG9	59665097	0.000000	0.05858	0.024000	0.17045	0.085000	0.17905	-0.029000	0.12329	0.220000	0.20860	0.655000	0.94253	GAG		0.607	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140806.3	NM_198988		8	51	0	0	0	0.004482	0	8	51				
LILRA2	11027	broad.mit.edu	37	19	55086414	55086414	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:55086414G>C	ENST00000251377.3	+	5	702	c.569G>C	c.(568-570)aGg>aCg	p.R190T	LILRA2_ENST00000391738.3_Missense_Mutation_p.R190T|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Missense_Mutation_p.R178T|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.R190T			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	190	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCGAGTCGCAGGTGGTCGTAC	0.577																																							uc002qgg.3		NA																	0				ovary(1)	1						c.(568-570)AGG>ACG		leukocyte immunoglobulin-like receptor,							162.0	157.0	158.0					19																	55086414		2203	4300	6503	SO:0001583	missense	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086414G>C	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.569G>C	19.37:g.55086414G>C	ENSP00000251377:p.Arg190Thr		Somatic				LILRA2_uc010ern.2_Missense_Mutation_p.R190T|LILRA2_uc002qgf.2_Missense_Mutation_p.R190T|LILRA2_uc010yfe.1_Missense_Mutation_p.R190T|LILRA2_uc010yff.1_Missense_Mutation_p.R178T|LILRA2_uc010ero.2_Missense_Mutation_p.R178T|LILRA2_uc010yfg.1_Missense_Mutation_p.R190T	p.R190T	NM_001130917	NP_001124389	WXS	Illumina HiSeq	Unspecified	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	4	658	+			190			Extracellular (Potential).|Ig-like C2-type 2.		O75020	Missense_Mutation	SNP	ENST00000251377.3	37	c.569G>C	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789496	0.31685	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.02890	4.12;4.12;4.12;4.12;4.12	2.93	-2.3	0.06785	Immunoglobulin-like fold (1);	0.778430	0.11595	N	0.548297	T	0.07863	0.0197	M	0.69463	2.115	0.09310	N	1	P;D;D;D	0.89917	0.826;0.997;1.0;1.0	B;D;D;D	0.81914	0.275;0.96;0.973;0.995	T	0.28522	-1.0041	9	.	.	.	.	0.2314	0.00180	0.2921:0.2085:0.2882:0.2112	.	190;178;190;190	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	T	190;190;190;190;178	ENSP00000388131:R190T;ENSP00000251377:R190T;ENSP00000375618:R190T;ENSP00000251376:R190T;ENSP00000375617:R178T	.	R	+	2	0	LILRA2	59778226	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.124000	0.15728	-0.243000	0.09653	0.508000	0.49915	AGG		0.577	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			54	39	0	0	0	0.00361	0	54	39				
ZNF512	84450	broad.mit.edu	37	2	27822465	27822465	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:27822465C>T	ENST00000355467.4	+	4	376	c.293C>T	c.(292-294)tCa>tTa	p.S98L	RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000379717.1_Missense_Mutation_p.S97L|ZNF512_ENST00000413371.2_Missense_Mutation_p.S21L|ZNF512_ENST00000416005.2_Missense_Mutation_p.S97L|ZNF512_ENST00000494548.1_3'UTR|ZNF512_ENST00000556601.1_Nonsense_Mutation_p.Q9*	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					GGTGGAGTATCAGCCAAGGGG	0.403																																							uc002rla.2		NA																	0				ovary(1)	1						c.(292-294)TCA>TTA		zinc finger protein 512							108.0	110.0	109.0					2																	27822465		2203	4300	6503	SO:0001583	missense	84450				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:27822465C>T	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.293C>T	2.37:g.27822465C>T	ENSP00000347648:p.Ser98Leu		Somatic				ZNF512_uc010ylv.1_Missense_Mutation_p.S19L|ZNF512_uc010ylw.1_Missense_Mutation_p.S97L|ZNF512_uc002rlb.2_Missense_Mutation_p.S19L|ZNF512_uc010ylx.1_Missense_Mutation_p.S19L|ZNF512_uc002rlc.2_Missense_Mutation_p.S19L|ZNF512_uc010yly.1_RNA|ZNF512_uc010ylz.1_Missense_Mutation_p.S19L	p.S98L	NM_032434	NP_115810	WXS	Illumina HiSeq	Unspecified	Q96ME7	ZN512_HUMAN			4	380	+	Acute lymphoblastic leukemia(172;0.155)		98					B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	ENST00000355467.4	37	c.293C>T	CCDS1758.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.901538|5.901538	0.97087|0.97087	.|.	.|.	ENSG00000243943|ENSG00000243943	ENST00000556601|ENST00000379717;ENST00000355467;ENST00000416005;ENST00000413371	.|.	.|.	.|.	5.65|5.65	2.84|2.84	0.33178|0.33178	.|.	.|1.355590	.|0.04764	.|N	.|0.426724	.|T	.|0.20981	.|0.0505	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	A|A	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	.|T	.|0.22068	.|-1.0227	.|8	.|0.25106	.|T	.|0.35	3.2368|3.2368	2.498|2.498	0.04626|0.04626	0.1552:0.5318:0.1499:0.1631|0.1552:0.5318:0.1499:0.1631	.|.	.|21;97;98	.|B4DES6;B4DSM5;Q96ME7	.|.;.;ZN512_HUMAN	X|L	9|97;98;97;21	.|.	.|ENSP00000347648:S98L	Q|S	+|+	1|2	0|0	ZNF512|ZNF512	27675969|27675969	0.001000|0.001000	0.12720|0.12720	0.003000|0.003000	0.11579|0.11579	0.931000|0.931000	0.56810|0.56810	1.174000|1.174000	0.31932|0.31932	0.317000|0.317000	0.23160|0.23160	0.655000|0.655000	0.94253|0.94253	CAG|TCA		0.403	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215029.2	NM_032434		18	37	0	0	0	0.002299	0	18	37				
PLB1	151056	broad.mit.edu	37	2	28761185	28761185	+	Splice_Site	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:28761185G>C	ENST00000327757.5	+	10	599		c.e10-1		PLB1_ENST00000422425.2_Missense_Mutation_p.Q196H	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1						glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TCCTCTCACAGAATGGGCTTG	0.652																																							uc002rmb.1		NA																	0				ovary(4)|large_intestine(2)|skin(2)|breast(1)	9						c.e10-1		phospholipase B1 precursor							49.0	46.0	47.0					2																	28761185		2203	4300	6503	SO:0001630	splice_region_variant	151056				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	g.chr2:28761185G>C		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.556-1G>C	2.37:g.28761185G>C			Somatic				PLB1_uc010ezj.1_Missense_Mutation_p.Q196H	p.N186_splice	NM_153021	NP_694566	WXS	Illumina HiSeq	Unspecified	Q6P1J6	PLB1_HUMAN			10	556	+	Acute lymphoblastic leukemia(172;0.155)							A8KAX2|Q53S03|Q8IUP7|Q96DP9	Splice_Site	SNP	ENST00000327757.5	37	c.556_splice	CCDS33168.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.69|11.69|11.69	1.714940|1.714940|1.714940	0.30413|0.30413|0.30413	.|.|.	.|.|.	ENSG00000163803|ENSG00000163803|ENSG00000163803	ENST00000327757|ENST00000416713;ENST00000422425|ENST00000404858	.|T;T|.	.|0.24908|.	.|1.83;2.72|.	5.0|5.0|5.0	4.12|4.12|4.12	0.48240|0.48240|0.48240	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.33469|0.33469	.|0.0864|0.0864	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.39786|0.39786|0.39786	D|D|D	0.972378|0.972378|0.972378	.|D|.	.|0.89917|.	.|1.0|.	.|D|.	.|0.83275|.	.|0.996|.	.|T|T	.|0.16100|0.16100	.|-1.0414|-1.0414	.|9|5	.|0.42905|.	.|T|.	.|0.14|.	.|.|.	9.9796|9.9796|9.9796	0.41806|0.41806|0.41806	0.0964:0.0:0.9036:0.0|0.0964:0.0:0.9036:0.0|0.0964:0.0:0.9036:0.0	.|.|.	.|196|.	.|Q6P1J6-3|.	.|.|.	.|H|T	-1|140;196|195	.|ENSP00000407076:Q140H;ENSP00000416440:Q196H|.	.|ENSP00000407076:Q140H|.	.|Q|R	+|+|+	.|3|2	.|2|0	PLB1|PLB1|PLB1	28614689|28614689|28614689	0.927000|0.927000|0.927000	0.31430|0.31430|0.31430	0.021000|0.021000|0.021000	0.16686|0.16686|0.16686	0.124000|0.124000|0.124000	0.20399|0.20399|0.20399	2.216000|2.216000|2.216000	0.42871|0.42871|0.42871	1.232000|1.232000|1.232000	0.43678|0.43678|0.43678	0.491000|0.491000|0.491000	0.48974|0.48974|0.48974	.|CAG|AGA		0.652	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Intron	8	20	0	0	0	0.001855	0	8	20				
ALK	238	broad.mit.edu	37	2	29606635	29606635	+	Silent	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:29606635A>T	ENST00000389048.3	-	5	2151	c.1245T>A	c.(1243-1245)tcT>tcA	p.S415S	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	415	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AGTCCACTGCAGACAAGCTGC	0.507			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	0				haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(1243-1245)TCT>TCA		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)						114.0	101.0	105.0					2																	29606635		2203	4300	6503	SO:0001819	synonymous_variant	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29606635A>T	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1245T>A	2.37:g.29606635A>T			Somatic					p.S415S	NM_004304	NP_004295	WXS	Illumina HiSeq	Unspecified	Q9UM73	ALK_HUMAN			5	2152	-	Acute lymphoblastic leukemia(172;0.155)		415			MAM 1.|Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	c.1245T>A	CCDS33172.1																																																																																				0.507	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		28	23	0	0	0	0.001512	0	28	23				
SULT6B1	391365	broad.mit.edu	37	2	37395098	37395098	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:37395098C>T	ENST00000535679.1	-	7	891	c.892G>A	c.(892-894)Gaa>Aaa	p.E298K	SULT6B1_ENST00000260637.3_Missense_Mutation_p.E260K|SULT6B1_ENST00000407963.1_Missense_Mutation_p.E260K|SULT6B1_ENST00000379149.2_Missense_Mutation_p.E194K			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	298						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				CAATATGATTCATACTTCAAC	0.333																																							uc002rpu.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(778-780)GAA>AAA		sulfotransferase family, cytosolic, 6B, member							112.0	113.0	112.0					2																	37395098		2203	4300	6503	SO:0001583	missense	391365					cytoplasm	sulfotransferase activity	g.chr2:37395098C>T	AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.892G>A	2.37:g.37395098C>T	ENSP00000444081:p.Glu298Lys		Somatic				SULT6B1_uc010yni.1_RNA	p.E260K	NM_001032377	NP_001027549	WXS	Illumina HiSeq	Unspecified	Q6IMI4	ST6B1_HUMAN			7	799	-		all_hematologic(82;0.248)	298					B2RTS7	Missense_Mutation	SNP	ENST00000535679.1	37	c.778G>A		.	.	.	.	.	.	.	.	.	.	C	13.18	2.158798	0.38119	.	.	ENSG00000138068	ENST00000535679;ENST00000379149;ENST00000260637;ENST00000407963	T;T;T;T	0.02579	4.93;4.24;4.84;4.84	4.57	2.64	0.31445	.	0.775340	0.11274	N	0.581089	T	0.03827	0.0108	L	0.49640	1.575	0.33284	D	0.5626	B	0.22746	0.074	B	0.17722	0.019	T	0.10245	-1.0638	10	0.36615	T	0.2	.	8.9883	0.36008	0.0:0.8044:0.0:0.1956	.	298	Q6IMI4	ST6B1_HUMAN	K	298;194;260;260	ENSP00000444081:E298K;ENSP00000368444:E194K;ENSP00000260637:E260K;ENSP00000384950:E260K	ENSP00000260637:E260K	E	-	1	0	SULT6B1	37248602	0.998000	0.40836	0.790000	0.31976	0.871000	0.50021	0.739000	0.26173	0.565000	0.29255	0.655000	0.94253	GAA		0.333	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377		5	45	0	0	0	0.001168	0	5	45				
OXER1	165140	broad.mit.edu	37	2	42990430	42990430	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:42990430A>G	ENST00000378661.2	-	1	971	c.890T>C	c.(889-891)cTg>cCg	p.L297P		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	297					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						CACCATGGCCAGCACACGCAT	0.622																																							uc002rss.2		NA																	0				breast(1)	1						c.(889-891)CTG>CCG		G-protein coupled receptor TG1019							39.0	35.0	36.0					2																	42990430		2203	4300	6503	SO:0001583	missense	165140				regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding|G-protein coupled receptor activity	g.chr2:42990430A>G	AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.890T>C	2.37:g.42990430A>G	ENSP00000367930:p.Leu297Pro		Somatic					p.L297P	NM_148962	NP_683765	WXS	Illumina HiSeq	Unspecified	Q8TDS5	OXER1_HUMAN			1	972	-			297			Helical; Name=6; (Potential).		Q86WP7|Q8NGW4	Missense_Mutation	SNP	ENST00000378661.2	37	c.890T>C	CCDS1810.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.490719	0.64074	.	.	ENSG00000162881	ENST00000378661	T	0.51574	0.7	4.36	4.36	0.52297	GPCR, rhodopsin-like superfamily (1);	0.569064	0.13464	U	0.385896	T	0.61527	0.2354	L	0.49126	1.545	0.48571	D	0.999674	D	0.71674	0.998	D	0.71414	0.973	T	0.61227	-0.7105	10	0.87932	D	0	.	11.5205	0.50549	1.0:0.0:0.0:0.0	.	297	Q8TDS5	OXER1_HUMAN	P	297	ENSP00000367930:L297P	ENSP00000367930:L297P	L	-	2	0	OXER1	42843934	0.296000	0.24398	0.974000	0.42286	0.104000	0.19210	4.420000	0.59841	1.603000	0.50134	0.477000	0.44152	CTG		0.622	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250514.1	NM_148962		8	12	0	0	0	0.00308	0	8	12				
ABCG8	64241	broad.mit.edu	37	2	44102490	44102490	+	Missense_Mutation	SNP	C	C	A	rs200919814		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:44102490C>A	ENST00000272286.2	+	11	1784	c.1694C>A	c.(1693-1695)gCc>gAc	p.A565D		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	565	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TTCAGCAATGCCCTCTACAAC	0.612																																							uc002rtq.2		NA																	0				skin(3)|ovary(1)	4						c.(1693-1695)GCC>GAC		ATP-binding cassette sub-family G member 8							58.0	60.0	59.0					2																	44102490		2203	4300	6503	SO:0001583	missense	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44102490C>A	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1694C>A	2.37:g.44102490C>A	ENSP00000272286:p.Ala565Asp		Somatic				ABCG8_uc010yoa.1_Missense_Mutation_p.A564D	p.A565D	NM_022437	NP_071882	WXS	Illumina HiSeq	Unspecified	Q9H221	ABCG8_HUMAN			11	1784	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	565			Cytoplasmic (Potential).|ABC transmembrane type-2.		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	c.1694C>A	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360950	0.41801	.	.	ENSG00000143921	ENST00000272286	T	0.73152	-0.72	4.59	4.59	0.56863	ABC-2 type transporter (1);	0.170130	0.50627	D	0.000108	T	0.80116	0.4564	M	0.63428	1.95	0.54753	D	0.999988	D;D	0.76494	0.999;0.999	D;D	0.74348	0.971;0.983	T	0.81106	-0.1083	10	0.56958	D	0.05	.	11.453	0.50164	0.0:0.904:0.0:0.096	.	564;565	Q9H221-2;Q9H221	.;ABCG8_HUMAN	D	565	ENSP00000272286:A565D	ENSP00000272286:A565D	A	+	2	0	ABCG8	43955994	0.996000	0.38824	0.097000	0.21041	0.007000	0.05969	3.756000	0.55205	2.101000	0.63845	0.462000	0.41574	GCC		0.612	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		22	36	1	0	4.4004e-07	0.00333	8.94151e-07	22	36				
NRXN1	9378	broad.mit.edu	37	2	51255218	51255218	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:51255218C>T	ENST00000406316.2	-	2	1670	c.194G>A	c.(193-195)gGc>gAc	p.G65D	NRXN1_ENST00000404971.1_Missense_Mutation_p.G65D|NRXN1_ENST00000405581.1_Missense_Mutation_p.G65D|NRXN1_ENST00000402717.3_Missense_Mutation_p.G65D|NRXN1_ENST00000406859.3_Missense_Mutation_p.G65D|NRXN1_ENST00000401669.2_Missense_Mutation_p.G65D|NRXN1_ENST00000405472.3_Missense_Mutation_p.G65D	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	65	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GAGCACGAGGCCGCGGGCGCT	0.652																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(193-195)GGC>GAC		neurexin 1 isoform alpha2 precursor							11.0	15.0	14.0					2																	51255218		1992	4166	6158	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:51255218C>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.194G>A	2.37:g.51255218C>T	ENSP00000384311:p.Gly65Asp		Somatic				NRXN1_uc002rxe.3_Missense_Mutation_p.G65D|NRXN1_uc002rxd.1_Missense_Mutation_p.G65D	p.G65D	NM_001135659	NP_001129131	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		2	1671	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:Variant_position_missing_in_P58400_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.194G>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813266	0.90707	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	D;D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.26911	U	0.021876	D	0.96340	0.8806	M	0.91196	3.185	0.58432	D	0.999992	D;D;B	0.71674	0.998;0.997;0.012	D;D;B	0.74674	0.984;0.972;0.006	D	0.97335	0.9953	10	0.87932	D	0	.	18.2347	0.89946	0.0:1.0:0.0:0.0	.	65;65;65	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	D	65	ENSP00000385142:G65D;ENSP00000384311:G65D;ENSP00000434015:G65D;ENSP00000385017:G65D;ENSP00000385434:G65D;ENSP00000385681:G65D;ENSP00000385310:G65D	ENSP00000385017:G65D	G	-	2	0	NRXN1	51108722	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.914000	0.69964	2.293000	0.77203	0.563000	0.77884	GGC		0.652	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			5	9	0	0	0	0.000602	0	5	9				
UGP2	7360	broad.mit.edu	37	2	64112839	64112839	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:64112839A>G	ENST00000337130.5	+	6	1168	c.692A>G	c.(691-693)tAc>tGc	p.Y231C	ACA59_ENST00000515966.1_RNA|UGP2_ENST00000394417.2_Missense_Mutation_p.Y220C|UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000445915.2_Missense_Mutation_p.Y240C|UGP2_ENST00000467648.2_Missense_Mutation_p.Y220C	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	231					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						GCCAGTTTCTACAACTCTGGA	0.398																																							uc002scm.2		NA																	0					0						c.(691-693)TAC>TGC		UDP-glucose pyrophosphorylase 2 isoform a							163.0	172.0	169.0					2																	64112839		2203	4300	6503	SO:0001583	missense	7360				glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity	g.chr2:64112839A>G		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.692A>G	2.37:g.64112839A>G	ENSP00000338703:p.Tyr231Cys		Somatic				UGP2_uc002scl.2_Missense_Mutation_p.Y220C|UGP2_uc010ypx.1_Missense_Mutation_p.Y240C	p.Y231C	NM_006759	NP_006750	WXS	Illumina HiSeq	Unspecified	Q16851	UGPA_HUMAN			6	998	+			231					Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	37	c.692A>G	CCDS1875.1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277199	0.40294	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	L	0.53671	1.685	0.58432	D	0.999999	B;B	0.20459	0.045;0.025	B;B	0.23852	0.049;0.033	T	0.01894	-1.1252	10	0.42905	T	0.14	-53.1615	16.1461	0.81569	1.0:0.0:0.0:0.0	.	240;231	E7EUC7;Q16851	.;UGPA_HUMAN	C	220;220;231;240	ENSP00000377939:Y220C;ENSP00000420793:Y220C;ENSP00000338703:Y231C;ENSP00000411803:Y240C	ENSP00000338703:Y231C	Y	+	2	0	UGP2	63966343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.256000	0.58810	2.219000	0.72066	0.533000	0.62120	TAC		0.398	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	NM_006759		47	55	0	0	0	0.00361	0	47	55				
FIGLA	344018	broad.mit.edu	37	2	71012708	71012708	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:71012708T>A	ENST00000332372.6	-	3	452	c.448A>T	c.(448-450)Aga>Tga	p.R150*		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	150					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						GACAGCTGTCTTGCCGAGGAT	0.453																																							uc002she.1		NA																	0					0						c.(448-450)AGA>TGA		factor in the germline alpha							428.0	421.0	423.0					2																	71012708		2052	4203	6255	SO:0001587	stop_gained	344018				multicellular organismal development|oocyte development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor complex	DNA binding|transcription factor binding	g.chr2:71012708T>A	BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.448A>T	2.37:g.71012708T>A	ENSP00000333097:p.Arg150*		Somatic					p.R150*	NM_001004311	NP_001004311	WXS	Illumina HiSeq	Unspecified	Q6QHK4	FIGLA_HUMAN			3	453	-			150						Nonsense_Mutation	SNP	ENST00000332372.6	37	c.448A>T	CCDS46320.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.474583	0.43942	.	.	ENSG00000183733	ENST00000332372	.	.	.	4.12	-0.931	0.10438	.	0.317953	0.24748	N	0.035932	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	3.8892	0.09111	0.0:0.3092:0.1901:0.5006	.	.	.	.	X	150	.	ENSP00000333097:R150X	R	-	1	2	FIGLA	70866216	0.821000	0.29204	0.001000	0.08648	0.000000	0.00434	0.065000	0.14466	-0.153000	0.11137	-0.256000	0.11100	AGA		0.453	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331214.1	NM_001004311		130	234	0	0	0	0.00361	0	130	234				
CYP26B1	56603	broad.mit.edu	37	2	72360362	72360363	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:72360362_72360363CA>AG	ENST00000001146.2	-	5	1138_1139	c.935_936TG>CT	c.(934-936)cTG>cCT	p.L312P	CYP26B1_ENST00000412253.1_Missense_Mutation_p.L121P|CYP26B1_ENST00000546307.1_Missense_Mutation_p.L237P	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	312					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GGTGCTTCAGCAGCTGCATGAT	0.653																																							uc002sih.1		NA																	0				skin(2)	2						c.(934-936)CTG>CCT		cytochrome P450, family 26, subfamily b,																																				SO:0001583	missense	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72360362_72360363CA>AG		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.935_936delinsAG	2.37:g.72360362_72360363delinsAG	ENSP00000001146:p.Leu312Pro		Somatic				CYP26B1_uc010yra.1_Missense_Mutation_p.L295P|CYP26B1_uc010yrb.1_Missense_Mutation_p.L237P	p.L312P	NM_019885	NP_063938	WXS	Illumina HiSeq	Unspecified	Q9NR63	CP26B_HUMAN			5	935_936	-			312					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	DNP	ENST00000001146.2	37	c.935_936TG>CT	CCDS1919.1																																																																																				0.653	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		9	16	0	0	0	0.004672	0	9	16				
SMYD5	10322	broad.mit.edu	37	2	73451084	73451084	+	Missense_Mutation	SNP	A	A	G	rs200366462		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:73451084A>G	ENST00000389501.4	+	10	938	c.893A>G	c.(892-894)gAg>gGg	p.E298G		NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	298	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						GCAACTGGAGAGTTTCTTAAC	0.493													A|||	0	0.0	0.0	0.0	5008	,	,		20445	0.0		0.0	False		,,,				2504	0.0						uc002siw.2		NA																	0					0						c.(892-894)GAG>GGG		SMYD family member 5							244.0	223.0	230.0					2																	73451084		2203	4300	6503	SO:0001583	missense	10322						metal ion binding	g.chr2:73451084A>G	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.893A>G	2.37:g.73451084A>G	ENSP00000374152:p.Glu298Gly		Somatic				SMYD5_uc010yre.1_Missense_Mutation_p.E182G|SMYD5_uc002six.1_RNA	p.E298G	NM_006062	NP_006053	WXS	Illumina HiSeq	Unspecified	Q6GMV2	SMYD5_HUMAN			10	922	+			298			SET.		D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	37	c.893A>G	CCDS33221.2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	18.49	3.636196	0.67130	.	.	ENSG00000135632	ENST00000389501	T	0.42900	0.96	4.77	4.77	0.60923	SET domain (2);	0.048750	0.85682	D	0.000000	T	0.32793	0.0841	L	0.39245	1.2	0.80722	D	1	P	0.37914	0.611	B	0.34536	0.185	T	0.10753	-1.0616	10	0.30078	T	0.28	-21.6957	13.5605	0.61786	1.0:0.0:0.0:0.0	.	298	Q6GMV2	SMYD5_HUMAN	G	298	ENSP00000374152:E298G	ENSP00000374152:E298G	E	+	2	0	SMYD5	73304592	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.236000	0.78154	2.144000	0.66660	0.533000	0.62120	GAG		0.493	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062		65	88	0	0	0	0.00361	0	65	88				
REG1A	5967	broad.mit.edu	37	2	79349128	79349128	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:79349128C>A	ENST00000233735.1	+	4	301	c.198C>A	c.(196-198)aaC>aaA	p.N66K		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	66	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						ATTGCCAGAACATGAATTCGG	0.512																																							uc002snz.2		NA																	0					0						c.(196-198)AAC>AAA		regenerating islet-derived 1 alpha precursor							131.0	124.0	127.0					2																	79349128		2203	4300	6503	SO:0001583	missense	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79349128C>A		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.198C>A	2.37:g.79349128C>A	ENSP00000233735:p.Asn66Lys		Somatic				REG1A_uc010ffx.1_3'UTR|REG1A_uc010ysd.1_Missense_Mutation_p.N66K	p.N66K	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			4	301	+			66			C-type lectin.		P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	37	c.198C>A	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	c	0.021	-1.421585	0.01126	.	.	ENSG00000115386	ENST00000233735	T	0.62639	0.01	3.51	0.391	0.16282	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.179549	0.26723	N	0.022826	T	0.32164	0.0820	N	0.12182	0.205	0.09310	N	0.999999	P	0.39831	0.69	B	0.42188	0.379	T	0.41413	-0.9510	10	0.02654	T	1	.	1.0949	0.01671	0.1828:0.3668:0.2813:0.1691	.	66	P05451	REG1A_HUMAN	K	66	ENSP00000233735:N66K	ENSP00000233735:N66K	N	+	3	2	REG1A	79202636	0.000000	0.05858	0.189000	0.23252	0.952000	0.60782	-1.196000	0.03041	-0.057000	0.13199	0.563000	0.77884	AAC		0.512	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909		38	60	1	0	3.76604e-16	0.002522	8.9845e-16	38	60				
ABCB11	8647	broad.mit.edu	37	2	169783672	169783672	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:169783672G>A	ENST00000263817.6	-	26	3736	c.3612C>T	c.(3610-3612)ctC>ctT	p.L1204L		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	1204	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TCACCTCTGGGAGTGACATGA	0.453																																							uc002ueo.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(3610-3612)CTC>CTT		ATP-binding cassette, sub-family B (MDR/TAP),	Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)						170.0	162.0	165.0					2																	169783672		1933	4153	6086	SO:0001819	synonymous_variant	8647				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism	g.chr2:169783672G>A	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.3612C>T	2.37:g.169783672G>A			Somatic				ABCB11_uc010zda.1_Silent_p.L622L|ABCB11_uc010zdb.1_Silent_p.L680L	p.L1204L	NM_003742	NP_003733	WXS	Illumina HiSeq	Unspecified	O95342	ABCBB_HUMAN			26	3738	-			1204			Cytoplasmic (Potential).|ABC transporter 2.		Q53TL2|Q9UNB2	Silent	SNP	ENST00000263817.6	37	c.3612C>T	CCDS46444.1																																																																																				0.453	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742		56	86	0	0	0	0.00361	0	56	86				
NRP2	8828	broad.mit.edu	37	2	206608091	206608091	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:206608091G>C	ENST00000357785.5	+	9	1487	c.1456G>C	c.(1456-1458)Gag>Cag	p.E486Q	NRP2_ENST00000272849.3_Missense_Mutation_p.E486Q|NRP2_ENST00000540841.1_Missense_Mutation_p.E486Q|NRP2_ENST00000412873.2_Missense_Mutation_p.E486Q|NRP2_ENST00000357118.4_Missense_Mutation_p.E486Q|NRP2_ENST00000540178.1_Missense_Mutation_p.E486Q|NRP2_ENST00000355117.4_Missense_Mutation_p.E486Q|NRP2_ENST00000417189.1_Missense_Mutation_p.E486Q|NRP2_ENST00000360409.3_Missense_Mutation_p.E486Q			Q99435	NELL2_HUMAN	neuropilin 2	0	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						GCCCGGTGAGGAGTGGCTTCA	0.617																																							uc002vaw.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1456-1458)GAG>CAG		neuropilin 2 isoform 1 precursor							56.0	60.0	59.0					2																	206608091		2203	4300	6503	SO:0001583	missense	8828				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity	g.chr2:206608091G>C	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1456G>C	2.37:g.206608091G>C	ENSP00000350432:p.Glu486Gln		Somatic				NRP2_uc002vat.2_Missense_Mutation_p.E486Q|NRP2_uc002vau.2_Missense_Mutation_p.E486Q|NRP2_uc002vav.2_Missense_Mutation_p.E486Q|NRP2_uc002vax.2_Missense_Mutation_p.E486Q|NRP2_uc002vay.2_Missense_Mutation_p.E486Q|NRP2_uc010fud.2_Missense_Mutation_p.E486Q	p.E486Q	NM_201266	NP_957718	WXS	Illumina HiSeq	Unspecified	O60462	NRP2_HUMAN			9	2247	+			486			Extracellular (Potential).|F5/8 type C 2.		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	37	c.1456G>C	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685833	0.68157	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D;D;D	0.98822	-5.16;-5.16;-5.16;-1.53;-1.53;-5.16;-5.16;-5.16;-5.16	5.96	5.96	0.96718	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98353	0.9453	L	0.31294	0.92	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.988;0.991;0.996;0.983;0.983;0.986	D	0.97713	1.0192	10	0.22109	T	0.4	-34.0058	20.3928	0.98949	0.0:0.0:1.0:0.0	.	486;486;486;486;486;486	O60462-2;O60462-3;O60462;O60462-4;O60462-5;E9PF66	.;.;NRP2_HUMAN;.;.;.	Q	486	ENSP00000353582:E486Q;ENSP00000439658:E486Q;ENSP00000439261:E486Q;ENSP00000347238:E486Q;ENSP00000387519:E486Q;ENSP00000349632:E486Q;ENSP00000350432:E486Q;ENSP00000407626:E486Q;ENSP00000272849:E486Q	ENSP00000272849:E486Q	E	+	1	0	NRP2	206316336	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	9.789000	0.99068	2.813000	0.96785	0.655000	0.94253	GAG		0.617	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1			4	63	0	0	0	0.001168	0	4	63				
SLC4A3	6508	broad.mit.edu	37	2	220500158	220500158	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:220500158G>T	ENST00000358055.3	+	13	2424	c.1912G>T	c.(1912-1914)Gag>Tag	p.E638*	SLC4A3_ENST00000273063.6_Nonsense_Mutation_p.E665*|SLC4A3_ENST00000373760.2_Nonsense_Mutation_p.E638*|SLC4A3_ENST00000373762.3_Nonsense_Mutation_p.E665*|SLC4A3_ENST00000317151.3_Nonsense_Mutation_p.E638*			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	638					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGCGGCGAGAGCGTGAACA	0.632																																							uc002vmp.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5						c.(1912-1914)GAG>TAG		solute carrier family 4, anion exchanger, member							62.0	57.0	59.0					2																	220500158		2203	4300	6503	SO:0001587	stop_gained	6508				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity	g.chr2:220500158G>T		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1912G>T	2.37:g.220500158G>T	ENSP00000350756:p.Glu638*		Somatic				SLC4A3_uc002vmo.3_Nonsense_Mutation_p.E665*|SLC4A3_uc010fwm.2_Nonsense_Mutation_p.E188*|SLC4A3_uc010fwn.1_Nonsense_Mutation_p.E147*	p.E638*	NM_005070	NP_005061	WXS	Illumina HiSeq	Unspecified	P48751	B3A3_HUMAN		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	13	2181	+		Renal(207;0.0183)	638			Cytoplasmic.		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Nonsense_Mutation	SNP	ENST00000358055.3	37	c.1912G>T	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	41	8.556665	0.98861	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	.	.	.	4.92	4.92	0.64577	.	0.075184	0.51477	D	0.000094	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	18.1358	0.89618	0.0:0.0:1.0:0.0	.	.	.	.	X	638;638;665;665;638	.	ENSP00000273063:E665X	E	+	1	0	SLC4A3	220208402	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.742000	0.85008	2.264000	0.75181	0.643000	0.83706	GAG		0.632	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070		7	13	1	0	8.12818e-05	0.001984	0.000159596	7	13				
SLC4A3	6508	broad.mit.edu	37	2	220504391	220504391	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:220504391G>T	ENST00000358055.3	+	20	3723	c.3211G>T	c.(3211-3213)Gac>Tac	p.D1071Y	SLC4A3_ENST00000273063.6_Missense_Mutation_p.D1098Y|SLC4A3_ENST00000373760.2_Missense_Mutation_p.D1071Y|SLC4A3_ENST00000373762.3_Missense_Mutation_p.D1098Y|SLC4A3_ENST00000317151.3_Missense_Mutation_p.D1071Y			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	1071	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGCGCCTGGTGACAAGCCCCA	0.657																																							uc002vmp.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5						c.(3211-3213)GAC>TAC		solute carrier family 4, anion exchanger, member							59.0	48.0	52.0					2																	220504391		2203	4300	6503	SO:0001583	missense	6508				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity	g.chr2:220504391G>T		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.3211G>T	2.37:g.220504391G>T	ENSP00000350756:p.Asp1071Tyr		Somatic				SLC4A3_uc002vmo.3_Missense_Mutation_p.D1098Y|SLC4A3_uc010fwm.2_Missense_Mutation_p.D621Y	p.D1071Y	NM_005070	NP_005061	WXS	Illumina HiSeq	Unspecified	P48751	B3A3_HUMAN		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	20	3480	+		Renal(207;0.0183)	1071			Membrane (anion exchange).		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	c.3211G>T	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259310	0.80246	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35	4.38	4.38	0.52667	Bicarbonate transporter, C-terminal (1);	0.168748	0.50627	D	0.000104	D	0.87261	0.6133	M	0.73962	2.25	0.58432	D	0.999997	P;B;P	0.39520	0.537;0.242;0.676	P;P;P	0.52267	0.622;0.629;0.694	D	0.89149	0.3522	10	0.87932	D	0	.	17.5373	0.87835	0.0:0.0:1.0:0.0	.	775;1071;1098	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	Y	1071;1071;1098;1098;331;1071	ENSP00000350756:D1071Y;ENSP00000362865:D1071Y;ENSP00000273063:D1098Y;ENSP00000362867:D1098Y;ENSP00000314006:D1071Y	ENSP00000273063:D1098Y	D	+	1	0	SLC4A3	220212635	1.000000	0.71417	0.953000	0.39169	0.712000	0.41017	9.443000	0.97568	2.431000	0.82371	0.539000	0.68188	GAC		0.657	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070		17	22	1	0	1.33834e-09	0.000958	2.85213e-09	17	22				
MFF	56947	broad.mit.edu	37	2	228220473	228220473	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:228220473G>A	ENST00000353339.3	+	10	1334	c.893G>A	c.(892-894)cGa>cAa	p.R298Q	MFF_ENST00000304593.9_Missense_Mutation_p.R247Q|MFF_ENST00000409565.1_Missense_Mutation_p.R174Q|MFF_ENST00000524634.1_Missense_Mutation_p.R45Q|MFF_ENST00000409616.1_Missense_Mutation_p.R194Q|MFF_ENST00000354503.6_Missense_Mutation_p.R174Q|MFF_ENST00000349901.7_Missense_Mutation_p.R194Q|MFF_ENST00000392059.1_Missense_Mutation_p.R298Q|MFF_ENST00000476924.1_3'UTR|MFF_ENST00000337110.7_Missense_Mutation_p.R199Q	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	298					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						TCACTAAGACGACAGGTATTT	0.328																																							uc002vos.2		NA																	0				large_intestine(1)	1						c.(892-894)CGA>CAA		mitochondrial fission factor							136.0	140.0	138.0					2																	228220473		2203	4300	6503	SO:0001583	missense	56947					integral to membrane|mitochondrial outer membrane		g.chr2:228220473G>A	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.893G>A	2.37:g.228220473G>A	ENSP00000302037:p.Arg298Gln		Somatic				MFF_uc002vot.2_Missense_Mutation_p.R247Q|MFF_uc002vou.2_Missense_Mutation_p.R220Q|MFF_uc002vov.2_Missense_Mutation_p.R194Q|MFF_uc002vow.2_Missense_Mutation_p.R199Q|MFF_uc002vox.2_Missense_Mutation_p.R174Q|MFF_uc002voy.2_Missense_Mutation_p.R298Q|MFF_uc002voz.2_Missense_Mutation_p.R174Q|MFF_uc002vpa.2_Missense_Mutation_p.R86Q	p.R298Q	NM_020194	NP_064579	WXS	Illumina HiSeq	Unspecified	Q9GZY8	MFF_HUMAN			10	1311	+			298			Potential.|Cytoplasmic (Potential).		Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	ENST00000353339.3	37	c.893G>A	CCDS2465.1	.	.	.	.	.	.	.	.	.	.	G	37	6.022797	0.97211	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000354503;ENST00000409565;ENST00000409616;ENST00000337110;ENST00000534203;ENST00000524634;ENST00000349901;ENST00000392059;ENST00000456345	T;T	0.46451	0.87;0.87	6.08	6.08	0.98989	.	0.053155	0.64402	D	0.000002	T	0.64416	0.2596	M	0.67397	2.05	0.58432	D	0.999999	P;D;D;D;D	0.76494	0.519;0.984;0.964;0.99;0.999	B;P;B;P;D	0.64237	0.163;0.676;0.404;0.728;0.923	T	0.63980	-0.6514	10	0.87932	D	0	-28.3752	20.6721	0.99693	0.0:0.0:1.0:0.0	.	174;199;194;247;298	Q9GZY8-4;Q9GZY8-3;Q9GZY8-5;Q9GZY8-2;Q9GZY8	.;.;.;.;MFF_HUMAN	Q	247;298;174;174;194;199;70;45;194;298;110	ENSP00000302037:R298Q;ENSP00000375912:R298Q	ENSP00000304898:R247Q	R	+	2	0	MFF	227928717	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.739000	0.91574	2.894000	0.99253	0.591000	0.81541	CGA		0.328	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194		6	126	0	0	0	0.00308	0	6	126				
SPHKAP	80309	broad.mit.edu	37	2	228856021	228856021	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:228856021C>A	ENST00000392056.3	-	10	4789	c.4743G>T	c.(4741-4743)aaG>aaT	p.K1581N	SPHKAP_ENST00000344657.5_Missense_Mutation_p.K1552N	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1581						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTTAAGAATCTTCTTTTCTT	0.403																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(4741-4743)AAG>AAT		sphingosine kinase type 1-interacting protein							168.0	164.0	165.0					2																	228856021		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228856021C>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4743G>T	2.37:g.228856021C>A	ENSP00000375909:p.Lys1581Asn		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.K1552N|SPHKAP_uc010zlx.1_Intron	p.K1581N	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	10	4790	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	1581					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.4743G>T	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385611	0.25031	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12039	2.72;2.78	6.04	3.95	0.45737	.	0.415525	0.26474	N	0.024163	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.06405	0.001;0.002	T	0.37934	-0.9684	10	0.16896	T	0.51	.	6.2804	0.21003	0.1621:0.6663:0.0:0.1716	.	1581;1552	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	N	1581;1552	ENSP00000375909:K1581N;ENSP00000339886:K1552N	ENSP00000339886:K1552N	K	-	3	2	SPHKAP	228564265	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.838000	0.27572	1.566000	0.49654	0.563000	0.77884	AAG		0.403	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		24	46	1	0	1.77063e-15	0.005443	4.15326e-15	24	46				
DIS3L2	129563	broad.mit.edu	37	2	232952246	232952246	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr2:232952246C>T	ENST00000409307.1	+	5	416	c.416C>T	c.(415-417)tCa>tTa	p.S139L	DIS3L2_ENST00000325385.7_Missense_Mutation_p.S139L|DIS3L2_ENST00000360410.4_Missense_Mutation_p.S139L|DIS3L2_ENST00000273009.6_Missense_Mutation_p.S139L|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000409401.3_Missense_Mutation_p.S139L					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GCGTATGAATCAGATATCCCC	0.418																																							uc010fxz.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(415-417)TCA>TTA		DIS3 mitotic control homolog (S.							66.0	68.0	67.0					2																	232952246		1910	4140	6050	SO:0001583	missense	129563						exonuclease activity|ribonuclease activity|RNA binding	g.chr2:232952246C>T	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.416C>T	2.37:g.232952246C>T	ENSP00000386799:p.Ser139Leu		Somatic				DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vsn.1_Missense_Mutation_p.S139L|DIS3L2_uc002vso.2_RNA	p.S139L	NM_152383	NP_689596	WXS	Illumina HiSeq	Unspecified	Q8IYB7	DI3L2_HUMAN		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)	6	692	+		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)	139						Missense_Mutation	SNP	ENST00000409307.1	37	c.416C>T	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679972	0.47886	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000360410;ENST00000409401;ENST00000441279;ENST00000431466;ENST00000409307	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.65	4.75	0.60458	.	0.372405	0.25511	N	0.030166	T	0.26629	0.0651	L	0.48642	1.525	0.09310	N	0.999996	B;B	0.16166	0.001;0.016	B;B	0.16289	0.002;0.015	T	0.14699	-1.0463	10	0.22109	T	0.4	-0.3611	12.0815	0.53673	0.0:0.9176:0.0:0.0824	.	139;139	Q8IYB7;Q8IYB7-4	DI3L2_HUMAN;.	L	139	ENSP00000273009:S139L;ENSP00000315569:S139L;ENSP00000353584:S139L;ENSP00000386594:S139L;ENSP00000390467:S139L;ENSP00000386799:S139L	ENSP00000273009:S139L	S	+	2	0	DIS3L2	232660490	0.522000	0.26266	0.134000	0.22075	0.844000	0.47949	1.806000	0.38892	1.333000	0.45449	0.655000	0.94253	TCA		0.418	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383		4	48	0	0	0	0.000248	0	4	48				
PLCB1	23236	broad.mit.edu	37	20	8705382	8705382	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:8705382C>T	ENST00000338037.6	+	16	1688	c.1661C>T	c.(1660-1662)tCa>tTa	p.S554L	PLCB1_ENST00000378637.2_Missense_Mutation_p.S554L|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.S554L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	554	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAGTTTGAGTCATTTGAAATT	0.373																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(1660-1662)TCA>TTA		phosphoinositide-specific phospholipase C beta 1							63.0	67.0	66.0					20																	8705382		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8705382C>T	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1661C>T	20.37:g.8705382C>T	ENSP00000338185:p.Ser554Leu		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.S453L|PLCB1_uc002wna.2_Missense_Mutation_p.S554L|PLCB1_uc002wnc.1_Missense_Mutation_p.S453L|PLCB1_uc002wnd.1_Missense_Mutation_p.S131L	p.S554L	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			16	1664	+			554			PI-PLC Y-box.		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.1661C>T	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.355845	0.82243	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.56103	0.48;0.48;0.48	5.22	5.22	0.72569	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.136231	0.52532	D	0.000067	D	0.82604	0.5073	H	0.96604	3.85	0.58432	D	0.999995	P;D	0.76494	0.939;0.999	P;D	0.78314	0.766;0.991	D	0.88612	0.3157	10	0.87932	D	0	.	19.1525	0.93495	0.0:1.0:0.0:0.0	.	554;554	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	L	554;554;554;474;474	ENSP00000367908:S554L;ENSP00000338185:S554L;ENSP00000367904:S554L	ENSP00000338185:S554L	S	+	2	0	PLCB1	8653382	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.999000	0.63934	2.592000	0.87571	0.563000	0.77884	TCA		0.373	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			12	35	0	0	0	0.000978	0	12	35				
PIGT	51604	broad.mit.edu	37	20	44048215	44048215	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:44048215C>T	ENST00000279036.6	+	5	746	c.666C>T	c.(664-666)atC>atT	p.I222I	PIGT_ENST00000372689.5_Silent_p.I222I|PIGT_ENST00000279035.9_Silent_p.I120I|PIGT_ENST00000535404.1_Silent_p.I67I|PIGT_ENST00000341555.5_Intron|PIGT_ENST00000545755.1_5'UTR|PIGT_ENST00000543458.2_Silent_p.I166I	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	222					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				CAGTGCATATCCGCCCTGTTT	0.547																																							uc002xoh.1		NA																	0				pancreas(1)	1						c.(664-666)ATC>ATT		phosphatidylinositol glycan anchor biosynthesis,							124.0	112.0	116.0					20																	44048215		2203	4300	6503	SO:0001819	synonymous_variant	51604				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr20:44048215C>T		CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.666C>T	20.37:g.44048215C>T			Somatic				PIGT_uc010ghb.1_Silent_p.I212I|PIGT_uc010zwt.1_RNA|PIGT_uc010ghd.1_Silent_p.I129I|PIGT_uc010ghc.1_RNA|PIGT_uc010ghe.1_Silent_p.I185I|PIGT_uc010ghf.1_Silent_p.I175I|PIGT_uc002xoj.1_Silent_p.I222I|PIGT_uc002xok.1_Silent_p.I187I|PIGT_uc010zwu.1_5'UTR|PIGT_uc002xoi.1_RNA|PIGT_uc010zwv.1_5'UTR|PIGT_uc010zww.1_Silent_p.I166I|PIGT_uc010zwx.1_Silent_p.I57I|PIGT_uc010zwy.1_Silent_p.I120I|PIGT_uc010zwz.1_5'UTR|PIGT_uc010zxa.1_Silent_p.I60I|PIGT_uc002xol.1_Silent_p.I78I|PIGT_uc010zxb.1_5'Flank	p.I222I	NM_015937	NP_057021	WXS	Illumina HiSeq	Unspecified	Q969N2	PIGT_HUMAN			5	739	+		Myeloproliferative disorder(115;0.0122)	222			Lumenal (Potential).		B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	c.666C>T	CCDS13353.1																																																																																				0.547	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937		6	124	0	0	0	0.001168	0	6	124				
TNNC2	7125	broad.mit.edu	37	20	44452748	44452748	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:44452748G>C	ENST00000372555.3	-	5	425	c.333C>G	c.(331-333)atC>atG	p.I111M	TNNC2_ENST00000372557.1_Missense_Mutation_p.I96M	NM_003279.2	NP_003270.1	P02585	TNNC2_HUMAN	troponin C type 2 (fast)	111	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				muscle filament sliding (GO:0030049)|regulation of muscle contraction (GO:0006937)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.0122)			Felodipine(DB01023)	CCTCCGGGTCGATGTAGCCGT	0.642																																							uc002xpr.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(331-333)ATC>ATG		fast skeletal muscle troponin C							123.0	116.0	119.0					20																	44452748		2203	4300	6503	SO:0001583	missense	7125				muscle filament sliding|regulation of muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium ion binding	g.chr20:44452748G>C		CCDS13375.1	20q12-q13.11	2013-01-10	2005-09-12		ENSG00000101470	ENSG00000101470		"""EF-hand domain containing"""	11944	protein-coding gene	gene with protein product		191039	"""troponin C2, fast"""			2373703	Standard	NM_003279		Approved		uc002xpr.3	P02585	OTTHUMG00000032623	ENST00000372555.3:c.333C>G	20.37:g.44452748G>C	ENSP00000361636:p.Ile111Met		Somatic					p.I111M	NM_003279	NP_003270	WXS	Illumina HiSeq	Unspecified	P02585	TNNC2_HUMAN			5	399	-		Myeloproliferative disorder(115;0.0122)	111			EF-hand 3.|3.		Q6FH92	Missense_Mutation	SNP	ENST00000372555.3	37	c.333C>G	CCDS13375.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562464	0.45694	.	.	ENSG00000101470	ENST00000372557;ENST00000372555	T;T	0.77750	-1.12;-1.12	4.12	0.782	0.18567	EF-hand-like domain (1);	0.060051	0.64402	D	0.000003	D	0.87884	0.6290	M	0.89601	3.045	0.80722	D	1	P	0.38863	0.65	D	0.68192	0.956	D	0.85210	0.1020	10	0.87932	D	0	-23.1386	5.5088	0.16868	0.6093:0.0:0.3907:0.0	.	111	P02585	TNNC2_HUMAN	M	96;111	ENSP00000361638:I96M;ENSP00000361636:I111M	ENSP00000361636:I111M	I	-	3	3	TNNC2	43886155	1.000000	0.71417	0.995000	0.50966	0.514000	0.34195	0.710000	0.25748	0.377000	0.24735	0.305000	0.20034	ATC		0.642	TNNC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079524.3	NM_003279		5	97	0	0	0	0.000602	0	5	97				
ZMYND8	23613	broad.mit.edu	37	20	45867661	45867661	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:45867661G>A	ENST00000311275.7	-	15	2699	c.2446C>T	c.(2446-2448)Cgg>Tgg	p.R816W	ZMYND8_ENST00000396281.4_Missense_Mutation_p.R816W|ZMYND8_ENST00000540497.1_Missense_Mutation_p.R764W|ZMYND8_ENST00000360911.3_Missense_Mutation_p.R811W|ZMYND8_ENST00000372023.3_Missense_Mutation_p.R811W|ZMYND8_ENST00000461685.1_Missense_Mutation_p.R836W|ZMYND8_ENST00000458360.2_Intron|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000352431.2_Missense_Mutation_p.R836W|ZMYND8_ENST00000262975.4_Missense_Mutation_p.R816W|ZMYND8_ENST00000446994.2_Missense_Mutation_p.R753W|ZMYND8_ENST00000355972.4_Missense_Mutation_p.R816W|ZMYND8_ENST00000536340.1_Missense_Mutation_p.R843W|ZMYND8_ENST00000471951.2_Missense_Mutation_p.R836W	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	816					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			CACACGACCCGCTGCACGGCC	0.607																																							uc002xta.1		NA																	0				central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5						c.(2446-2448)CGG>TGG		zinc finger, MYND-type containing 8 isoform b							62.0	74.0	70.0					20																	45867661		2196	4291	6487	SO:0001583	missense	23613						protein binding|zinc ion binding	g.chr20:45867661G>A	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2446C>T	20.37:g.45867661G>A	ENSP00000312237:p.Arg816Trp		Somatic				ZMYND8_uc010ghq.1_Missense_Mutation_p.R493W|ZMYND8_uc010ghr.1_Missense_Mutation_p.R791W|ZMYND8_uc002xst.1_Missense_Mutation_p.R744W|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Missense_Mutation_p.R744W|ZMYND8_uc002xsw.1_Missense_Mutation_p.R568W|ZMYND8_uc002xsx.1_Missense_Mutation_p.R568W|ZMYND8_uc002xsy.1_Missense_Mutation_p.R791W|ZMYND8_uc002xsz.1_Missense_Mutation_p.R753W|ZMYND8_uc010zxy.1_Missense_Mutation_p.R843W|ZMYND8_uc002xtb.1_Missense_Mutation_p.R836W|ZMYND8_uc002xss.2_Missense_Mutation_p.R816W|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Missense_Mutation_p.R836W|ZMYND8_uc002xtd.1_Missense_Mutation_p.R811W|ZMYND8_uc002xte.1_Missense_Mutation_p.R816W|ZMYND8_uc010zya.1_Missense_Mutation_p.R816W|ZMYND8_uc002xtf.1_Missense_Mutation_p.R836W|ZMYND8_uc002xtg.2_Missense_Mutation_p.R810W|ZMYND8_uc010ghs.1_Missense_Mutation_p.R810W|ZMYND8_uc002xsr.1_5'UTR	p.R816W	NM_012408	NP_036540	WXS	Illumina HiSeq	Unspecified	Q9ULU4	PKCB1_HUMAN	Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)		15	2700	-			816					B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37	c.2446C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.966703|3.966703	0.74131|0.74131	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000467200|ENST00000360911;ENST00000311275;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	.|D;D;D;D;D;D;D;D;D;D	.|0.91686	.|-2.02;-1.89;-1.92;-2.01;-1.91;-1.9;-2.89;-1.93;-1.81;-2.04	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.120419	.|0.64402	.|D	.|0.000017	D|D	0.95300|0.95300	0.8475|0.8475	M|M	0.71581|0.71581	2.175|2.175	0.39751|0.39751	D|D	0.971887|0.971887	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;0.999;1.0	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.77557	.|0.99;0.952;0.976;0.937;0.976;0.99;0.986;0.971;0.971;0.986;0.952;0.968;0.968;0.952;0.937;0.952	D|D	0.95642|0.95642	0.8699|0.8699	5|10	.|0.66056	.|D	.|0.02	-2.7509|-2.7509	13.8988|13.8988	0.63790|0.63790	0.0:0.0:0.7319:0.2681|0.0:0.0:0.7319:0.2681	.|.	.|843;811;811;791;810;836;816;811;836;836;816;753;811;764;764;816	.|F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q2HXV4;B7Z2A8	.|.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.	V|W	743|811;816;817;837;836;816;843;816;753;836;811;764	.|ENSP00000354166:R811W;ENSP00000312237:R816W;ENSP00000335537:R836W;ENSP00000379577:R816W;ENSP00000439800:R843W;ENSP00000348246:R816W;ENSP00000396725:R753W;ENSP00000418210:R836W;ENSP00000361093:R811W;ENSP00000443086:R764W	.|ENSP00000262975:R817W	A|R	-|-	2|1	0|2	ZMYND8|ZMYND8	45301068|45301068	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.697000|0.697000	0.40408|0.40408	3.662000|3.662000	0.54510|0.54510	2.688000|2.688000	0.91661|0.91661	0.591000|0.591000	0.81541|0.81541	GCG|CGG		0.607	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047		51	76	0	0	0	0.00361	0	51	76				
SULF2	55959	broad.mit.edu	37	20	46386098	46386098	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:46386098G>A	ENST00000359930.4	-	2	861	c.10C>T	c.(10-12)Ccg>Tcg	p.P4S	SULF2_ENST00000361612.4_Missense_Mutation_p.P4S|SULF2_ENST00000484875.1_Missense_Mutation_p.P4S|SULF2_ENST00000467815.1_Missense_Mutation_p.P4S	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	4					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						ACGAGGCTCGGGGGGCCCATC	0.562																																							uc002xto.2		NA																	0				ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(10-12)CCG>TCG		sulfatase 2 isoform a precursor							40.0	28.0	32.0					20																	46386098		2201	4300	6501	SO:0001583	missense	55959				bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr20:46386098G>A	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.10C>T	20.37:g.46386098G>A	ENSP00000353007:p.Pro4Ser		Somatic				SULF2_uc002xtr.2_Missense_Mutation_p.P4S|SULF2_uc002xtq.2_Missense_Mutation_p.P4S|SULF2_uc010ghv.1_Missense_Mutation_p.P4S	p.P4S	NM_018837	NP_061325	WXS	Illumina HiSeq	Unspecified	Q8IWU5	SULF2_HUMAN			2	340	-			4					E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	c.10C>T	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	G	0.281	-0.986105	0.02180	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815;ENST00000437955	D;D;D;D;D	0.98889	-5.21;-5.21;-5.21;-5.21;-4.35	4.49	-0.689	0.11313	.	1.331770	0.04488	N	0.379074	D	0.95781	0.8627	L	0.36672	1.1	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.10450	0.005;0.0;0.0	D	0.90241	0.4286	10	0.18276	T	0.48	-5.3615	5.7315	0.18042	0.2252:0.2942:0.4806:0.0	.	4;4;4	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	S	4	ENSP00000353007:P4S;ENSP00000418290:P4S;ENSP00000354662:P4S;ENSP00000418442:P4S;ENSP00000410026:P4S	ENSP00000353007:P4S	P	-	1	0	SULF2	45819505	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.459000	0.21908	0.012000	0.14892	-0.502000	0.04539	CCG		0.562	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837		4	3	0	0	0	0.000602	0	4	3				
GMEB2	26205	broad.mit.edu	37	20	62223949	62223949	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr20:62223949C>T	ENST00000266068.1	-	7	1244	c.766G>A	c.(766-768)Gag>Aag	p.E256K	GMEB2_ENST00000370069.1_Missense_Mutation_p.E205K|GMEB2_ENST00000370077.1_Missense_Mutation_p.E256K			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	256					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			TCCACCAGCTCCTGGTGGAAC	0.612																																							uc002yfp.1		NA																	0					0						c.(766-768)GAG>AAG		glucocorticoid modulatory element binding							46.0	47.0	47.0					20																	62223949		2203	4300	6503	SO:0001583	missense	26205				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding	g.chr20:62223949C>T	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.766G>A	20.37:g.62223949C>T	ENSP00000266068:p.Glu256Lys		Somatic				GMEB2_uc002yfo.1_Missense_Mutation_p.E178K|GMEB2_uc002yfq.1_Missense_Mutation_p.E256K	p.E256K	NM_012384	NP_036516	WXS	Illumina HiSeq	Unspecified	Q9UKD1	GMEB2_HUMAN	Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)		7	1245	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		256					E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	ENST00000266068.1	37	c.766G>A	CCDS13528.1	.	.	.	.	.	.	.	.	.	.	C	34	5.365117	0.95877	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.70631	-0.5;0.07;0.07	5.19	5.19	0.71726	.	0.053645	0.64402	D	0.000001	T	0.80732	0.4679	L	0.61218	1.895	0.49389	D	0.999785	D	0.58620	0.983	P	0.58454	0.839	T	0.82818	-0.0269	10	0.72032	D	0.01	-3.6483	18.7161	0.91677	0.0:1.0:0.0:0.0	.	256	Q9UKD1	GMEB2_HUMAN	K	205;256;256	ENSP00000359086:E205K;ENSP00000359094:E256K;ENSP00000266068:E256K	ENSP00000266068:E256K	E	-	1	0	GMEB2	61694393	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.449000	0.60034	2.410000	0.81850	0.561000	0.74099	GAG		0.612	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384		4	46	0	0	0	0.000248	0	4	46				
HLCS	3141	broad.mit.edu	37	21	38126640	38126640	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr21:38126640C>A	ENST00000399120.1	-	12	3318	c.2088G>T	c.(2086-2088)caG>caT	p.Q696H	HLCS_ENST00000336648.4_Missense_Mutation_p.Q696H	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	696					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CCTGGTGAACCTGGAGGAAGC	0.597																																							uc010gnb.2		NA																	0				ovary(2)|breast(1)|kidney(1)|liver(1)	5						c.(2086-2088)CAG>CAT		holocarboxylase synthetase	Biotin(DB00121)						71.0	54.0	60.0					21																	38126640		2203	4300	6503	SO:0001583	missense	3141				cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding	g.chr21:38126640C>A		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.2088G>T	21.37:g.38126640C>A	ENSP00000382071:p.Gln696His		Somatic				HLCS_uc002yvs.2_Missense_Mutation_p.Q696H	p.Q696H	NM_000411	NP_000402	WXS	Illumina HiSeq	Unspecified	P50747	BPL1_HUMAN			11	3289	-		Myeloproliferative disorder(46;0.0422)	696					B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	37	c.2088G>T	CCDS13647.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916277	0.52546	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	T;T	0.76578	-1.03;-1.03	6.17	3.0	0.34707	Biotin protein ligase, C-terminal (1);	0.059015	0.64402	D	0.000002	D	0.84406	0.5465	M	0.80616	2.505	0.53005	D	0.999961	D	0.67145	0.996	P	0.62649	0.905	T	0.82232	-0.0559	10	0.15499	T	0.54	.	12.2466	0.54574	0.0:0.7116:0.0:0.2884	.	696	P50747	BPL1_HUMAN	H	696	ENSP00000382071:Q696H;ENSP00000338387:Q696H	ENSP00000338387:Q696H	Q	-	3	2	HLCS	37048510	0.998000	0.40836	0.976000	0.42696	0.351000	0.29236	0.542000	0.23222	0.943000	0.37553	0.655000	0.94253	CAG		0.597	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2			5	18	1	0	5.9392e-07	0.001168	1.19986e-06	5	18				
ERG	2078	broad.mit.edu	37	21	39763602	39763602	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr21:39763602C>T	ENST00000417133.2	-	10	1056	c.871G>A	c.(871-873)Gaa>Aaa	p.E291K	ERG_ENST00000288319.7_Missense_Mutation_p.E284K|ERG_ENST00000398911.1_Missense_Mutation_p.E267K|ERG_ENST00000398919.2_Missense_Mutation_p.E291K|ERG_ENST00000398905.1_Missense_Mutation_p.E260K|ERG_ENST00000453032.2_Missense_Mutation_p.E192K|ERG_ENST00000398907.1_Missense_Mutation_p.E261K|ERG_ENST00000398897.1_Missense_Mutation_p.E168K|ERG_ENST00000398910.1_Missense_Mutation_p.E268K|ERG_ENST00000442448.1_Missense_Mutation_p.E267K	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	330					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CGCTGGTCTTCAGTTTTGGGC	0.423			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	Esophageal Squamous(130;336 1700 3010 3083 40589)	uc010gnw.2		NA		Dom	yes		21	21q22.3	2078		v-ets erythroblastosis virus E26 oncogene like (avian)			"""M, E, L"""				TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	0				prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828						c.(871-873)GAA>AAA		ets-related isoform 4							114.0	107.0	109.0					21																	39763602		2203	4300	6503	SO:0001583	missense	2078				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr21:39763602C>T		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.871G>A	21.37:g.39763602C>T	ENSP00000414150:p.Glu291Lys		Somatic				ERG_uc002yxa.2_Missense_Mutation_p.E284K|ERG_uc011aek.1_Missense_Mutation_p.E192K|ERG_uc010gnv.2_Missense_Mutation_p.E168K|ERG_uc010gnx.2_Missense_Mutation_p.E267K|ERG_uc011ael.1_Missense_Mutation_p.E291K|ERG_uc002yxb.2_Missense_Mutation_p.E267K	p.E291K	NM_001136155	NP_001129627	WXS	Illumina HiSeq	Unspecified	P11308	ERG_HUMAN			10	1166	-		Prostate(19;3.6e-06)	291					A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	c.871G>A	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145120	0.57044	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.14640	2.54;2.5;2.52;2.53;2.54;2.52;2.49;2.54;2.53;2.52	5.29	5.29	0.74685	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.662300	0.15109	N	0.280082	T	0.13628	0.0330	L	0.39898	1.24	0.80722	D	1	B;B;B;P	0.35774	0.048;0.138;0.049;0.519	B;B;B;B	0.35073	0.015;0.065;0.021;0.195	T	0.10291	-1.0636	10	0.08381	T	0.77	.	18.889	0.92391	0.0:1.0:0.0:0.0	.	291;260;267;284	P11308;B5MDW0;P11308-1;P11308-4	ERG_HUMAN;.;.;.	K	260;261;284;168;267;291;268;267;192;291	ENSP00000381877:E260K;ENSP00000381879:E261K;ENSP00000288319:E284K;ENSP00000381871:E168K;ENSP00000381882:E267K;ENSP00000414150:E291K;ENSP00000381881:E268K;ENSP00000394694:E267K;ENSP00000396268:E192K;ENSP00000381891:E291K	ENSP00000288319:E284K	E	-	1	0	ERG	38685472	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	5.618000	0.67722	2.640000	0.89533	0.655000	0.94253	GAA		0.423	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918		23	57	0	0	0	0.004656	0	23	57				
SH3BGR	6450	broad.mit.edu	37	21	40824019	40824019	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr21:40824019C>G	ENST00000333634.4	+	1	264	c.186C>G	c.(184-186)gtC>gtG	p.V62V	SH3BGR_ENST00000380631.1_Intron|SH3BGR_ENST00000380637.3_Intron|SH3BGR_ENST00000458295.1_Intron|SH3BGR_ENST00000380634.1_Intron	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	62					positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		TTCCAACTGTCGAAATGGTTA	0.502																																							uc002yya.2		NA																	0					0						c.(184-186)GTC>GTG		SH3-binding domain and glutamic acid-rich							226.0	213.0	217.0					21																	40824019		2203	4300	6503	SO:0001819	synonymous_variant	6450				protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity	g.chr21:40824019C>G		CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.186C>G	21.37:g.40824019C>G			Somatic				SH3BGR_uc002yxz.2_Intron	p.V62V	NM_007341	NP_031367	WXS	Illumina HiSeq	Unspecified	P55822	SH3BG_HUMAN		STAD - Stomach adenocarcinoma(101;0.00151)	1	240	+		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)	62					A6ND59|D3DSI2|Q9BRB8	Silent	SNP	ENST00000333634.4	37	c.186C>G	CCDS13666.1																																																																																				0.502	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157377.6	NM_007341		8	159	0	0	0	0.00308	0	8	159				
FAM3B	54097	broad.mit.edu	37	21	42719025	42719025	+	Silent	SNP	A	A	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr21:42719025A>C	ENST00000357985.2	+	6	629	c.483A>C	c.(481-483)acA>acC	p.T161T	FAM3B_ENST00000398646.3_Silent_p.T184T|FAM3B_ENST00000398647.3_Silent_p.T113T|FAM3B_ENST00000479810.2_3'UTR|FAM3B_ENST00000398652.3_Silent_p.T200T	NM_058186.3	NP_478066.3	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	161					apoptotic process (GO:0006915)|insulin secretion (GO:0030073)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			central_nervous_system(2)|endometrium(1)|lung(2)	5		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				ACGGAAGCACAAGGTGAGTGG	0.542																																							uc002yzb.1		NA																	0					0						c.(481-483)ACA>ACC		family with sequence similarity 3, member B							151.0	129.0	136.0					21																	42719025		2203	4300	6503	SO:0001819	synonymous_variant	54097				apoptosis|insulin secretion	extracellular space	cytokine activity	g.chr21:42719025A>C	AF494379	CCDS13671.1, CCDS42930.1	21q22.3	2014-08-14	2002-05-23	2002-06-20	ENSG00000183844	ENSG00000183844			1253	protein-coding gene	gene with protein product	"""pancreatic-derived factor"""	608617	"""chromosome 21 open reading frame 11"""	C21orf11			Standard	NM_058186		Approved	D21M16SJHU19e, PRED44, 2-21, ORF9, C21orf76, PANDER	uc002yzb.1	P58499	OTTHUMG00000086752	ENST00000357985.2:c.483A>C	21.37:g.42719025A>C			Somatic				FAM3B_uc002yza.2_RNA|FAM3B_uc002yzc.1_Silent_p.T113T|FAM3B_uc002yzd.1_Silent_p.T184T	p.T161T	NM_058186	NP_478066	WXS	Illumina HiSeq	Unspecified	P58499	FAM3B_HUMAN			6	629	+		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)	161						Silent	SNP	ENST00000357985.2	37	c.483A>C	CCDS13671.1																																																																																				0.542	FAM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195142.1	NM_058186		23	53	0	0	0	0.002299	0	23	53				
TRPM2	7226	broad.mit.edu	37	21	45798968	45798968	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr21:45798968A>T	ENST00000397928.1	+	8	1548	c.1103A>T	c.(1102-1104)aAc>aTc	p.N368I	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.N368I|TRPM2_ENST00000300482.5_Missense_Mutation_p.N368I|TRPM2_ENST00000300481.9_Missense_Mutation_p.N368I	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	368					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CAGGTGGCCAACCTGCCTGTC	0.597																																							uc002zet.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1102-1104)AAC>ATC		transient receptor potential cation channel,							109.0	83.0	92.0					21																	45798968		2203	4300	6503	SO:0001583	missense	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45798968A>T	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1103A>T	21.37:g.45798968A>T	ENSP00000381023:p.Asn368Ile		Somatic				TRPM2_uc002zeu.1_Missense_Mutation_p.N368I|TRPM2_uc002zew.1_Missense_Mutation_p.N368I|TRPM2_uc010gpt.1_Missense_Mutation_p.N368I|TRPM2_uc002zex.1_Missense_Mutation_p.N154I	p.N368I	NM_003307	NP_003298	WXS	Illumina HiSeq	Unspecified	O94759	TRPM2_HUMAN			9	1316	+			368			Cytoplasmic (Potential).		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	c.1103A>T	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	A	4.256	0.046477	0.08243	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.04156	3.69;3.69;3.69;3.69	3.84	-1.37	0.09056	.	1.245860	0.05432	N	0.546088	T	0.06371	0.0164	M	0.72118	2.19	0.09310	N	1	P;B	0.40266	0.71;0.259	B;B	0.33750	0.169;0.044	T	0.39941	-0.9589	10	0.45353	T	0.12	-6.9736	5.5497	0.17083	0.5561:0.1509:0.2929:0.0	.	368;368	E9PGK7;O94759	.;TRPM2_HUMAN	I	368	ENSP00000300482:N368I;ENSP00000381023:N368I;ENSP00000300481:N368I;ENSP00000381026:N368I	ENSP00000300481:N368I	N	+	2	0	TRPM2	44623396	0.000000	0.05858	0.217000	0.23759	0.065000	0.16274	0.064000	0.14437	-0.085000	0.12573	-0.313000	0.08912	AAC		0.597	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		26	41	0	0	0	0.005443	0	26	41				
KLHL22	84861	broad.mit.edu	37	22	20819347	20819347	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr22:20819347C>A	ENST00000328879.4	-	4	1066	c.910G>T	c.(910-912)Ggg>Tgg	p.G304W	KLHL22_ENST00000440659.2_Missense_Mutation_p.G161W	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	304					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGAATGCCCCCGAAGCCCACA	0.637																																							uc002zsl.1		NA																	0				lung(1)	1						c.(910-912)GGG>TGG		kelch-like							75.0	71.0	72.0					22																	20819347		2203	4300	6503	SO:0001583	missense	84861				cell division	Cul3-RING ubiquitin ligase complex		g.chr22:20819347C>A		CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.910G>T	22.37:g.20819347C>A	ENSP00000331682:p.Gly304Trp		Somatic				KLHL22_uc011ahr.1_Missense_Mutation_p.G161W|KLHL22_uc002zsm.1_Missense_Mutation_p.G304W	p.G304W	NM_032775	NP_116164	WXS	Illumina HiSeq	Unspecified	Q53GT1	KLH22_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)		4	1019	-	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	304			Kelch 1.		A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	ENST00000328879.4	37	c.910G>T	CCDS13780.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791299	0.90367	.	.	ENSG00000099910	ENST00000328879;ENST00000440659	T;T	0.74632	-0.86;-0.86	5.42	5.42	0.78866	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87459	0.2406	10	0.87932	D	0	.	16.693	0.85327	0.0:1.0:0.0:0.0	.	161;304	B7Z2G1;Q53GT1	.;KLH22_HUMAN	W	304;161	ENSP00000331682:G304W;ENSP00000405521:G161W	ENSP00000331682:G304W	G	-	1	0	KLHL22	19149347	1.000000	0.71417	0.963000	0.40424	0.973000	0.67179	7.326000	0.79133	2.531000	0.85337	0.655000	0.94253	GGG		0.637	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320045.2	NM_032775		19	41	1	0	8.00594e-06	0.000958	1.59435e-05	19	41				
RANGAP1	5905	broad.mit.edu	37	22	41657569	41657569	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr22:41657569G>A	ENST00000455915.2	-	5	1965	c.496C>T	c.(496-498)Ctg>Ttg	p.L166L	RANGAP1_ENST00000405486.1_Silent_p.L166L|RANGAP1_ENST00000407260.4_Intron|RANGAP1_ENST00000356244.3_Silent_p.L166L			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	166					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CATTCGGTCAGAGCTGCAGCC	0.612																																							uc003azs.2		NA																	0					0						c.(496-498)CTG>TTG		Ran GTPase activating protein 1							65.0	60.0	61.0					22																	41657569		2203	4300	6503	SO:0001819	synonymous_variant	5905				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity	g.chr22:41657569G>A	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.496C>T	22.37:g.41657569G>A			Somatic				RANGAP1_uc003azt.2_Silent_p.L166L|RANGAP1_uc003azu.2_Silent_p.L166L|RANGAP1_uc011aoz.1_Intron	p.L166L	NM_002883	NP_002874	WXS	Illumina HiSeq	Unspecified	P46060	RAGP1_HUMAN			5	1966	-			166					Q96JJ2	Silent	SNP	ENST00000455915.2	37	c.496C>T	CCDS14012.1																																																																																				0.612	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883		14	18	0	0	0	0.001855	0	14	18				
XRCC6	2547	broad.mit.edu	37	22	42057418	42057418	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr22:42057418C>T	ENST00000359308.4	+	11	2261	c.1606C>T	c.(1606-1608)Cct>Tct	p.P536S	XRCC6_ENST00000428575.2_Missense_Mutation_p.P403S|XRCC6_ENST00000405506.1_Missense_Mutation_p.P486S|XRCC6_ENST00000360079.3_Missense_Mutation_p.P536S|XRCC6_ENST00000405878.1_Missense_Mutation_p.P536S|XRCC6_ENST00000402580.3_Missense_Mutation_p.P495S			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	536					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						AGATTACAATCCTGAAGGGAA	0.403								Non-homologous end-joining																															uc003bao.1		NA																	0				skin(2)|ovary(1)|lung(1)|kidney(1)	5						c.(1606-1608)CCT>TCT	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II, 70 kDa subunit							110.0	115.0	113.0					22																	42057418		2203	4300	6503	SO:0001583	missense	2547				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding	g.chr22:42057418C>T	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1606C>T	22.37:g.42057418C>T	ENSP00000352257:p.Pro536Ser		Somatic				XRCC6_uc003bap.1_Missense_Mutation_p.P495S|XRCC6_uc011apc.1_Missense_Mutation_p.P486S|XRCC6_uc003baq.1_Missense_Mutation_p.P536S|XRCC6_uc003bar.1_Missense_Mutation_p.P536S|XRCC6_uc003bas.1_Missense_Mutation_p.P486S	p.P536S	NM_001469	NP_001460	WXS	Illumina HiSeq	Unspecified	P12956	XRCC6_HUMAN			12	1676	+			536					B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	c.1606C>T	CCDS14021.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828629	0.90955	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.42	5.42	0.78866	Ku70/Ku80 C-terminal arm (1);	0.000000	0.85682	D	0.000000	T	0.55162	0.1903	L	0.52905	1.665	0.80722	D	1	B;B;D;B	0.54207	0.45;0.232;0.965;0.45	P;B;P;P	0.59171	0.644;0.164;0.853;0.524	T	0.43130	-0.9410	10	0.13470	T	0.59	-3.2359	19.2162	0.93780	0.0:1.0:0.0:0.0	.	486;536;495;536	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	S	536;495;403;536;536;536;486	ENSP00000353192:P536S;ENSP00000384941:P495S;ENSP00000403679:P403S;ENSP00000352257:P536S;ENSP00000384257:P536S;ENSP00000384082:P486S	ENSP00000352257:P536S	P	+	1	0	XRCC6	40387364	1.000000	0.71417	0.855000	0.33649	0.912000	0.54170	5.602000	0.67612	2.535000	0.85469	0.555000	0.69702	CCT		0.403	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469		13	95	0	0	0	0.00245	0	13	95				
KLHDC7B	113730	broad.mit.edu	37	22	50987960	50987960	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr22:50987960C>A	ENST00000395676.2	+	1	1499	c.1365C>A	c.(1363-1365)acC>acA	p.T455T	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	455										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCTACGTCACCGGGGGTCACC	0.677																																							uc003bmi.2		NA																	0				central_nervous_system(1)	1						c.(1363-1365)ACC>ACA		kelch domain containing 7B							69.0	73.0	72.0					22																	50987960		2203	4300	6503	SO:0001819	synonymous_variant	113730							g.chr22:50987960C>A	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1365C>A	22.37:g.50987960C>A			Somatic					p.T455T	NM_138433	NP_612442	WXS	Illumina HiSeq	Unspecified	Q96G42	KLD7B_HUMAN		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	1	1499	+		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)	455			Kelch 4.			Silent	SNP	ENST00000395676.2	37	c.1365C>A	CCDS14097.2																																																																																				0.677	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433		32	48	1	0	7.11191e-15	0.002836	1.66262e-14	32	48				
TATDN2	9797	broad.mit.edu	37	3	10291093	10291093	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:10291093C>T	ENST00000287652.4	+	2	1260	c.209C>T	c.(208-210)tCc>tTc	p.S70F	TATDN2_ENST00000448281.2_Missense_Mutation_p.S70F|RP11-438J1.1_ENST00000450534.1_Missense_Mutation_p.S13F	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	70					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CGGAGGTTATCCTGGGGCTCA	0.642																																							uc003bvg.2		NA																	0				pancreas(2)	2						c.(208-210)TCC>TTC		TatD DNase domain containing 2							54.0	68.0	63.0					3																	10291093		2201	4295	6496	SO:0001583	missense	9797					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr3:10291093C>T	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.209C>T	3.37:g.10291093C>T	ENSP00000287652:p.Ser70Phe		Somatic				TATDN2_uc003bvf.2_Missense_Mutation_p.S70F|TATDN2_uc011atr.1_Missense_Mutation_p.S70F|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA	p.S70F	NM_014760	NP_055575	WXS	Illumina HiSeq	Unspecified	Q93075	TATD2_HUMAN			2	790	+			70					Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	37	c.209C>T	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	c	15.13	2.740992	0.49151	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.26223	1.75;1.75	4.16	2.37	0.29283	.	.	.	.	.	T	0.22166	0.0534	L	0.54323	1.7	0.09310	N	1	B	0.34015	0.435	B	0.31290	0.127	T	0.20706	-1.0267	9	0.87932	D	0	-0.115	5.7639	0.18215	0.0:0.6941:0.1987:0.1072	.	70	Q93075	TATD2_HUMAN	F	70	ENSP00000287652:S70F;ENSP00000408736:S70F	ENSP00000287652:S70F	S	+	2	0	TATDN2	10266093	0.000000	0.05858	0.001000	0.08648	0.736000	0.42039	0.467000	0.22035	0.524000	0.28502	-0.215000	0.12644	TCC		0.642	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203		9	117	0	0	0	0.004482	0	9	117				
TATDN2	9797	broad.mit.edu	37	3	10312076	10312076	+	Missense_Mutation	SNP	G	G	A	rs142076830		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:10312076G>A	ENST00000287652.4	+	4	2261	c.1210G>A	c.(1210-1212)Gat>Aat	p.D404N	TATDN2_ENST00000448281.2_Missense_Mutation_p.D404N|RP11-438J1.1_ENST00000450534.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	404					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CAGCAGCAACGATGCAGCCCA	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17699	0.0		0.0	False		,,,				2504	0.0						uc003bvg.2		NA																	0				pancreas(2)	2						c.(1210-1212)GAT>AAT		TatD DNase domain containing 2		G	ASN/ASP	6,4400	11.4+/-27.6	0,6,2197	86.0	87.0	86.0		1210	3.4	0.0	3	dbSNP_134	86	0,8600		0,0,4300	yes	missense	TATDN2	NM_014760.3	23	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	benign	404/762	10312076	6,13000	2203	4300	6503	SO:0001583	missense	9797					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr3:10312076G>A	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1210G>A	3.37:g.10312076G>A	ENSP00000287652:p.Asp404Asn		Somatic				TATDN2_uc003bvf.2_Missense_Mutation_p.D404N|TATDN2_uc011atr.1_Missense_Mutation_p.D404N|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA	p.D404N	NM_014760	NP_055575	WXS	Illumina HiSeq	Unspecified	Q93075	TATD2_HUMAN			4	1791	+			404					Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	37	c.1210G>A	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461265	0.26248	0.001362	0.0	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.73897	-0.79;-0.79	4.28	3.41	0.39046	.	2.223100	0.02624	N	0.103574	T	0.70020	0.3176	L	0.46157	1.445	0.09310	N	1	B	0.26547	0.152	B	0.13407	0.009	T	0.53669	-0.8406	10	0.35671	T	0.21	-15.4962	10.5154	0.44887	0.096:0.0:0.904:0.0	.	404	Q93075	TATD2_HUMAN	N	404	ENSP00000287652:D404N;ENSP00000408736:D404N	ENSP00000287652:D404N	D	+	1	0	TATDN2	10287076	0.954000	0.32549	0.009000	0.14445	0.002000	0.02628	1.668000	0.37481	1.171000	0.42768	-0.211000	0.12701	GAT		0.572	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203		7	119	0	0	0	0.001984	0	7	119				
RFTN1	23180	broad.mit.edu	37	3	16399494	16399494	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:16399494C>T	ENST00000334133.4	-	7	1363	c.1091G>A	c.(1090-1092)aGc>aAc	p.S364N	RFTN1_ENST00000483671.1_5'UTR|RFTN1_ENST00000432519.1_Missense_Mutation_p.S328N	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	364					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						TATGGTTTTGCTATCTTCTGT	0.473																																							uc003cay.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1090-1092)AGC>AAC		raft-linking protein							164.0	150.0	155.0					3																	16399494		2203	4300	6503	SO:0001583	missense	23180					plasma membrane		g.chr3:16399494C>T	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1091G>A	3.37:g.16399494C>T	ENSP00000334153:p.Ser364Asn		Somatic				RFTN1_uc010hes.2_Missense_Mutation_p.S328N	p.S364N	NM_015150	NP_055965	WXS	Illumina HiSeq	Unspecified	Q14699	RFTN1_HUMAN			7	1373	-			364					Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	c.1091G>A	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	C	6.453	0.451760	0.12283	.	.	ENSG00000131378	ENST00000432519;ENST00000334133	T;T	0.30981	1.51;1.51	5.46	3.3	0.37823	.	0.420024	0.24162	N	0.040968	T	0.13927	0.0337	N	0.11927	0.2	0.24229	N	0.995401	B;B	0.18013	0.025;0.009	B;B	0.16722	0.013;0.016	T	0.27434	-1.0074	10	0.08179	T	0.78	-23.2942	8.614	0.33820	0.0:0.6736:0.1217:0.2047	.	328;364	G3XAJ6;Q14699	.;RFTN1_HUMAN	N	328;364	ENSP00000403926:S328N;ENSP00000334153:S364N	ENSP00000334153:S364N	S	-	2	0	RFTN1	16374498	0.754000	0.28360	1.000000	0.80357	0.998000	0.95712	-0.060000	0.11712	1.287000	0.44583	0.561000	0.74099	AGC		0.473	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150		8	109	0	0	0	0.000673	0	8	109				
CCR4	1233	broad.mit.edu	37	3	32995849	32995849	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:32995849G>A	ENST00000330953.5	+	2	1103	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	312					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						GAGAAATTTCGCAAGTACATC	0.478																																							uc003cfg.1		NA																	0				lung(1)	1						c.(934-936)CGC>CAC		chemokine (C-C motif) receptor 4							64.0	68.0	67.0					3																	32995849		2203	4300	6503	SO:0001583	missense	1233				chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response	integral to plasma membrane		g.chr3:32995849G>A	X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.935G>A	3.37:g.32995849G>A	ENSP00000332659:p.Arg312His		Somatic					p.R312H	NM_005508	NP_005499	WXS	Illumina HiSeq	Unspecified	P51679	CCR4_HUMAN			2	1103	+			312			Cytoplasmic (Potential).		Q9ULY6|Q9ULY7	Missense_Mutation	SNP	ENST00000330953.5	37	c.935G>A	CCDS2656.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068896	0.76301	.	.	ENSG00000183813	ENST00000330953	T	0.58358	0.34	5.73	5.73	0.89815	.	0.107611	0.39210	N	0.001435	T	0.71986	0.3405	M	0.84948	2.725	0.48288	D	0.999625	D	0.89917	1.0	D	0.64506	0.926	T	0.76187	-0.3051	10	0.87932	D	0	.	11.2774	0.49174	0.1148:0.0:0.8852:0.0	.	312	P51679	CCR4_HUMAN	H	312	ENSP00000332659:R312H	ENSP00000332659:R312H	R	+	2	0	CCR4	32970853	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.362000	0.59467	2.706000	0.92434	0.563000	0.77884	CGC		0.478	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253252.2			24	49	0	0	0	0.00333	0	24	49				
AMT	275	broad.mit.edu	37	3	49458927	49458927	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:49458927G>A	ENST00000273588.3	-	3	639	c.337C>T	c.(337-339)Cag>Tag	p.Q113*	AMT_ENST00000538581.1_Nonsense_Mutation_p.Q57*|AMT_ENST00000458307.2_Nonsense_Mutation_p.Q113*|AMT_ENST00000476226.1_5'UTR|NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000395338.2_Nonsense_Mutation_p.Q113*|AMT_ENST00000546031.1_Nonsense_Mutation_p.Q16*	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	113					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	GGGCCCACCTGGTTTGGTCTT	0.493																																							uc003cww.2		NA																	0				ovary(1)	1						c.(337-339)CAG>TAG		aminomethyltransferase isoform 1 precursor	NADH(DB00157)|Tetrahydrofolic acid(DB00116)						137.0	133.0	134.0					3																	49458927		2203	4300	6503	SO:0001587	stop_gained	275				glycine catabolic process	mitochondrion	aminomethyltransferase activity|transaminase activity	g.chr3:49458927G>A	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.337C>T	3.37:g.49458927G>A	ENSP00000273588:p.Gln113*		Somatic				AMT_uc011bcn.1_Nonsense_Mutation_p.Q65*|AMT_uc003cwx.2_Nonsense_Mutation_p.Q113*|AMT_uc011bco.1_Nonsense_Mutation_p.Q113*|AMT_uc003cwy.2_Nonsense_Mutation_p.Q65*|AMT_uc011bcp.1_Nonsense_Mutation_p.Q16*|AMT_uc011bcq.1_Nonsense_Mutation_p.Q57*	p.Q113*	NM_000481	NP_000472	WXS	Illumina HiSeq	Unspecified	P48728	GCST_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	3	466	-			113					A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Nonsense_Mutation	SNP	ENST00000273588.3	37	c.337C>T	CCDS2797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.345696|4.345696	0.82022|0.82022	.|.	.|.	ENSG00000145020|ENSG00000145020	ENST00000427987|ENST00000395338;ENST00000458307;ENST00000273588;ENST00000538581;ENST00000546031;ENST00000430521	.|.	.|.	.|.	5.51|5.51	4.63|4.63	0.57726|0.57726	.|.	.|0.053337	.|0.85682	.|D	.|0.000000	T|.	0.34193|.	0.0889|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35176|.	-0.9799|.	3|.	.|0.02654	.|T	.|1	-16.1318|-16.1318	13.7315|13.7315	0.62789|0.62789	0.0:0.0:0.8446:0.1554|0.0:0.0:0.8446:0.1554	.|.	.|.	.|.	.|.	L|X	110|113;113;113;57;16;57	.|.	.|ENSP00000273588:Q113X	P|Q	-|-	2|1	0|0	AMT|AMT	49433931|49433931	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	7.166000|7.166000	0.77553|0.77553	1.430000|1.430000	0.47334|0.47334	0.655000|0.655000	0.94253|0.94253	CCA|CAG		0.493	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481		32	52	0	0	0	0.003271	0	32	52				
GMPPB	29925	broad.mit.edu	37	3	49756557	49756557	+	3'UTR	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:49756557G>A	ENST00000480687.1	-	0	3827				AMIGO3_ENST00000535833.1_Silent_p.L114L|AMIGO3_ENST00000320431.7_Silent_p.L114L|RNF123_ENST00000433785.1_Intron|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000497099.1_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ATGATAGATCGAGCAGCCTCA	0.637											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003cxj.2		NA																	0				pancreas(1)	1						c.(340-342)CTC>CTT		adhesion molecule with Ig-like domain 3							57.0	66.0	63.0					3																	49756557		2203	4300	6503	SO:0001624	3_prime_UTR_variant	386724				heterophilic cell-cell adhesion	integral to membrane		g.chr3:49756557G>A	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2628C>T	3.37:g.49756557G>A			Somatic	OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	964	RNF123_uc003cxh.2_Intron|RNF123_uc003cxi.2_Intron	p.L114L	NM_198722	NP_942015	WXS	Illumina HiSeq	Unspecified	Q86WK7	AMGO3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	1	682	-			114			Extracellular (Potential).|LRR 3.		A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	37	c.342C>T	CCDS2803.1																																																																																				0.637	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334		12	131	0	0	0	0.001368	0	12	131				
DOCK3	1795	broad.mit.edu	37	3	51265438	51265438	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:51265438C>G	ENST00000266037.9	+	17	1589	c.1566C>G	c.(1564-1566)ctC>ctG	p.L522L		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	522	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AAAAGAAACTCTTTGGCTTTG	0.438																																							uc011bds.1		NA																	0					0						c.(1564-1566)CTC>CTG		dedicator of cytokinesis 3							149.0	140.0	143.0					3																	51265438		1986	4169	6155	SO:0001819	synonymous_variant	1795					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr3:51265438C>G	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1566C>G	3.37:g.51265438C>G			Somatic					p.L522L	NM_004947	NP_004938	WXS	Illumina HiSeq	Unspecified	Q8IZD9	DOCK3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	17	1589	+			522			DHR-1.		O15017	Silent	SNP	ENST00000266037.9	37	c.1566C>G	CCDS46835.1																																																																																				0.438	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		17	29	0	0	0	0.006122	0	17	29				
DNAH1	25981	broad.mit.edu	37	3	52427015	52427015	+	Missense_Mutation	SNP	C	C	T	rs200066420		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:52427015C>T	ENST00000420323.2	+	65	10709	c.10448C>T	c.(10447-10449)tCg>tTg	p.S3483L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3548	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCTTCCTCTCGGGCATCGCC	0.572																																							uc011bef.1		NA																	0				large_intestine(3)	3						c.(10447-10449)TCG>TTG		dynein, axonemal, heavy chain 1		C	LEU/SER	0,4134		0,0,2067	148.0	157.0	154.0		10448	4.7	1.0	3		154	2,8406		0,2,4202	yes	missense	DNAH1	NM_015512.4	145	0,2,6269	TT,TC,CC		0.0238,0.0,0.0159	benign	3483/4266	52427015	2,12540	2067	4204	6271	SO:0001583	missense	25981				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr3:52427015C>T	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10448C>T	3.37:g.52427015C>T	ENSP00000401514:p.Ser3483Leu		Somatic				DNAH1_uc003ddv.2_Missense_Mutation_p.S341L	p.S3483L	NM_015512	NP_056327	WXS	Illumina HiSeq	Unspecified	Q9P2D7	DYH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	65	10709	+			3548					B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	c.10448C>T	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.425537	0.25639	0.0	2.38E-4	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.60548	0.18	4.68	4.68	0.58851	.	0.572144	0.15572	N	0.255420	T	0.36771	0.0979	N	0.13371	0.34	0.26196	N	0.97952	B;B	0.14805	0.001;0.011	B;B	0.06405	0.001;0.002	T	0.09997	-1.0649	10	0.10377	T	0.69	.	11.7204	0.51678	0.0:0.9067:0.0:0.0933	.	3483;3548	C9JXH6;Q9P2D7-2	.;.	L	3483;236	ENSP00000401514:S3483L	ENSP00000273600:S236L	S	+	2	0	DNAH1	52402055	0.040000	0.19996	0.972000	0.41901	0.663000	0.39108	1.232000	0.32636	2.437000	0.82529	0.491000	0.48974	TCG		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		14	105	0	0	0	0.00245	0	14	105				
C3orf17	25871	broad.mit.edu	37	3	112724627	112724627	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:112724627C>A	ENST00000314400.5	-	9	1651	c.1460G>T	c.(1459-1461)tGg>tTg	p.W487L	C3orf17_ENST00000472762.1_5'Flank|C3orf17_ENST00000393857.2_Missense_Mutation_p.W351L|C3orf17_ENST00000383675.2_Missense_Mutation_p.W417L	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	487					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						TGAGAGTCTCCACTTAGCACT	0.443																																							uc003dzr.2		NA																	0					0						c.(1459-1461)TGG>TTG		hypothetical protein LOC25871							115.0	105.0	108.0					3																	112724627		2203	4300	6503	SO:0001583	missense	25871					integral to membrane		g.chr3:112724627C>A	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.1460G>T	3.37:g.112724627C>A	ENSP00000320251:p.Trp487Leu		Somatic				GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_Missense_Mutation_p.W112L|C3orf17_uc011bhz.1_Missense_Mutation_p.W112L|C3orf17_uc010hqh.2_Missense_Mutation_p.W112L|C3orf17_uc003dzt.2_Missense_Mutation_p.W390L|C3orf17_uc003dzs.2_Missense_Mutation_p.W351L|C3orf17_uc010hqg.2_Missense_Mutation_p.W312L|C3orf17_uc011bia.1_Missense_Mutation_p.W284L|C3orf17_uc003dzu.2_Missense_Mutation_p.W416L|C3orf17_uc011bib.1_Missense_Mutation_p.W376L|C3orf17_uc011bic.1_Missense_Mutation_p.W320L|C3orf17_uc011bid.1_RNA	p.W487L	NM_015412	NP_056227	WXS	Illumina HiSeq	Unspecified	Q6NW34	CC017_HUMAN			9	1521	-			487					D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Missense_Mutation	SNP	ENST00000314400.5	37	c.1460G>T	CCDS33824.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.158158	0.38119	.	.	ENSG00000163608	ENST00000314400;ENST00000383675;ENST00000412848;ENST00000393857	T;T;T	0.31247	1.5;1.5;1.5	5.9	2.13	0.27403	.	1.314310	0.05055	N	0.478832	T	0.23330	0.0564	L	0.44542	1.39	0.09310	N	1	B;B;P;B	0.37276	0.068;0.119;0.589;0.435	B;B;B;B	0.27500	0.025;0.051;0.08;0.058	T	0.21109	-1.0255	10	0.23891	T	0.37	3.6977	8.0578	0.30614	0.0:0.675:0.0:0.325	.	376;284;417;487	E7EN80;E7EQH6;Q6NW34-2;Q6NW34	.;.;.;CC017_HUMAN	L	487;417;134;351	ENSP00000320251:W487L;ENSP00000373173:W417L;ENSP00000377438:W351L	ENSP00000320251:W487L	W	-	2	0	C3orf17	114207317	0.000000	0.05858	0.001000	0.08648	0.378000	0.30076	0.221000	0.17680	0.108000	0.17862	0.655000	0.94253	TGG		0.443	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412		22	41	1	0	2.89027e-11	0.002299	6.47531e-11	22	41				
ARGFX	503582	broad.mit.edu	37	3	121305102	121305102	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:121305102T>A	ENST00000334384.3	+	4	613	c.603T>A	c.(601-603)agT>agA	p.S201R		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		GTTCTACCAGTGACTTCCAAA	0.463																																							uc003eef.2		NA																	0				skin(2)|ovary(1)	3						c.(601-603)AGT>AGA		arginine-fifty homeobox							143.0	142.0	143.0					3																	121305102		2203	4300	6503	SO:0001583	missense	503582					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121305102T>A		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.603T>A	3.37:g.121305102T>A	ENSP00000335578:p.Ser201Arg		Somatic					p.S201R	NM_001012659	NP_001012677	WXS	Illumina HiSeq	Unspecified	A6NJG6	ARGFX_HUMAN		GBM - Glioblastoma multiforme(114;0.152)	5	698	+			201						Missense_Mutation	SNP	ENST00000334384.3	37	c.603T>A	CCDS33834.1	.	.	.	.	.	.	.	.	.	.	T	10.19	1.281816	0.23392	.	.	ENSG00000186103	ENST00000334384	D	0.90004	-2.6	3.56	0.587	0.17439	.	1.276350	0.05344	N	0.530648	T	0.79233	0.4411	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.64554	-0.6380	10	0.41790	T	0.15	0.0334	6.5622	0.22493	0.5104:0.0:0.0:0.4896	.	201	A6NJG6	ARGFX_HUMAN	R	201	ENSP00000335578:S201R	ENSP00000335578:S201R	S	+	3	2	ARGFX	122787792	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	-0.342000	0.07801	0.080000	0.16959	0.459000	0.35465	AGT		0.463	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659		47	86	0	0	0	0.00361	0	47	86				
ATP2C1	27032	broad.mit.edu	37	3	130683838	130683838	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:130683838G>C	ENST00000510168.1	+	14	1621	c.1071G>C	c.(1069-1071)aaG>aaC	p.K357N	ATP2C1_ENST00000328560.8_Missense_Mutation_p.K357N|ATP2C1_ENST00000507488.2_Missense_Mutation_p.K341N|ATP2C1_ENST00000422190.2_Missense_Mutation_p.K357N|ATP2C1_ENST00000508532.1_Missense_Mutation_p.K357N|ATP2C1_ENST00000513801.1_Missense_Mutation_p.K341N|ATP2C1_ENST00000393221.4_Missense_Mutation_p.K391N|ATP2C1_ENST00000533801.2_Missense_Mutation_p.K352N|ATP2C1_ENST00000504381.1_Missense_Mutation_p.K302N|ATP2C1_ENST00000428331.2_Missense_Mutation_p.K357N|ATP2C1_ENST00000359644.3_Missense_Mutation_p.K357N|ATP2C1_ENST00000504948.1_Missense_Mutation_p.K341N|ATP2C1_ENST00000505330.1_Missense_Mutation_p.K341N			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	357					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CACTGACGAAGAATGAAATGA	0.328									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)	Esophageal Squamous(99;456 1443 27647 34099 42636)	uc003enl.2		NA																	0				skin(1)	1						c.(1069-1071)AAG>AAC		calcium-transporting ATPase 2C1 isoform 1a	Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)						156.0	142.0	147.0					3																	130683838		2203	4299	6502	SO:0001583	missense	27032	Hailey-Hailey_disease	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity	g.chr3:130683838G>C	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.1071G>C	3.37:g.130683838G>C	ENSP00000427461:p.Lys357Asn		Somatic				ATP2C1_uc011blg.1_Missense_Mutation_p.K391N|ATP2C1_uc011blh.1_Missense_Mutation_p.K352N|ATP2C1_uc011bli.1_Missense_Mutation_p.K391N|ATP2C1_uc003enk.2_Missense_Mutation_p.K341N|ATP2C1_uc003enm.2_Missense_Mutation_p.K357N|ATP2C1_uc003enn.2_Missense_Mutation_p.K341N|ATP2C1_uc003eno.2_Missense_Mutation_p.K357N|ATP2C1_uc003enp.2_Missense_Mutation_p.K357N|ATP2C1_uc003enq.2_Missense_Mutation_p.K357N|ATP2C1_uc003enr.2_Missense_Mutation_p.K357N|ATP2C1_uc003ens.2_Missense_Mutation_p.K357N|ATP2C1_uc003ent.2_Missense_Mutation_p.K357N|ATP2C1_uc003enu.2_Missense_Mutation_p.K35N	p.K357N	NM_014382	NP_055197	WXS	Illumina HiSeq	Unspecified	P98194	AT2C1_HUMAN			14	1293	+			357			Cytoplasmic (By similarity).		B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	ENST00000510168.1	37	c.1071G>C	CCDS46914.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.508802|2.508802	0.44660|0.44660	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421;ENST00000515854|ENST00000504612	D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.95885|.	-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-1.69|.	5.53|5.53	3.71|3.71	0.42584|0.42584	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79393|0.79393	0.4438|0.4438	M|M	0.92649|0.92649	3.33|3.33	0.80722|0.80722	D|D	1|1	P;P;B;P;B;B;B|.	0.36733|.	0.511;0.567;0.218;0.511;0.218;0.079;0.097|.	B;B;B;B;B;B;B|.	0.41764|.	0.251;0.366;0.201;0.251;0.201;0.16;0.248|.	T|T	0.82238|0.82238	-0.0556|-0.0556	10|5	0.66056|.	D|.	0.02|.	.|.	9.0144|9.0144	0.36161|0.36161	0.2225:0.0:0.7775:0.0|0.2225:0.0:0.7775:0.0	.|.	391;352;391;357;391;357;357|.	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194|.	.;.;.;.;.;.;AT2C1_HUMAN|.	N|T	341;302;341;391;352;357;357;341;341;357;357;357;357;356;96|311	ENSP00000423774:K341N;ENSP00000425320:K302N;ENSP00000421326:K341N;ENSP00000376914:K391N;ENSP00000432956:K352N;ENSP00000427461:K357N;ENSP00000424783:K357N;ENSP00000423330:K341N;ENSP00000422872:K341N;ENSP00000329664:K357N;ENSP00000395809:K357N;ENSP00000352665:K357N;ENSP00000402677:K357N;ENSP00000422890:K96N|.	ENSP00000329664:K357N|.	K|R	+|+	3|2	2|0	ATP2C1|ATP2C1	132166528|132166528	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.848000|3.848000	0.55903|0.55903	1.452000|1.452000	0.47756|0.47756	0.561000|0.561000	0.74099|0.74099	AAG|AGA		0.328	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	NM_001001486		15	26	0	0	0	0.001216	0	15	26				
SLCO2A1	6578	broad.mit.edu	37	3	133666133	133666133	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:133666133G>C	ENST00000310926.4	-	9	1535	c.1262C>G	c.(1261-1263)tCc>tGc	p.S421C	SLCO2A1_ENST00000493729.1_Missense_Mutation_p.S345C	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	421					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	AGTTGGGGTGGAGCATCCCAT	0.488																																							uc003eqa.3		NA																	0				central_nervous_system(1)	1						c.(1261-1263)TCC>TGC		solute carrier organic anion transporter family,							109.0	101.0	103.0					3																	133666133		2203	4300	6503	SO:0001583	missense	6578				sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding	g.chr3:133666133G>C		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1262C>G	3.37:g.133666133G>C	ENSP00000311291:p.Ser421Cys		Somatic				SLCO2A1_uc003eqb.3_Missense_Mutation_p.S345C|SLCO2A1_uc011blv.1_Missense_Mutation_p.S240C	p.S421C	NM_005630	NP_005621	WXS	Illumina HiSeq	Unspecified	Q92959	SO2A1_HUMAN			9	1536	-			421			Extracellular (Potential).		Q86V98|Q8IUN2	Missense_Mutation	SNP	ENST00000310926.4	37	c.1262C>G	CCDS3084.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696088	0.30052	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.44881	0.91;0.91	5.59	5.59	0.84812	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.385970	0.29218	N	0.012791	T	0.68016	0.2955	M	0.77313	2.365	0.54753	D	0.999984	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.80764	0.994;0.911;0.968	T	0.71038	-0.4708	10	0.87932	D	0	.	19.601	0.95561	0.0:0.0:1.0:0.0	.	240;345;421	B7Z8J8;E7EU40;Q92959	.;.;SO2A1_HUMAN	C	421;345	ENSP00000311291:S421C;ENSP00000418893:S345C	ENSP00000311291:S421C	S	-	2	0	SLCO2A1	135148823	1.000000	0.71417	0.969000	0.41365	0.033000	0.12548	5.934000	0.70138	2.626000	0.88956	0.655000	0.94253	TCC		0.488	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630		18	28	0	0	0	0.00499	0	18	28				
ZIC4	84107	broad.mit.edu	37	3	147113967	147113967	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:147113967C>A	ENST00000383075.3	-	3	872	c.360G>T	c.(358-360)atG>atT	p.M120I	ZIC4_ENST00000525172.2_Missense_Mutation_p.M170I|ZIC4_ENST00000484399.1_Missense_Mutation_p.M120I|ZIC4_ENST00000425731.3_Missense_Mutation_p.M158I|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000473123.1_Missense_Mutation_p.M120I	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	120						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TGGGCTGGCGCATGTAGCGGA	0.657																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(358-360)ATG>ATT		zinc finger protein of the cerebellum 4							34.0	39.0	37.0					3																	147113967		2200	4299	6499	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147113967C>A	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.360G>T	3.37:g.147113967C>A	ENSP00000372553:p.Met120Ile		Somatic				ZIC4_uc003ewc.1_Missense_Mutation_p.M50I|ZIC4_uc011bno.1_Missense_Mutation_p.M170I	p.M120I	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	633	-			120					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.360G>T	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249061	0.80024	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	4.98	4.98	0.66077	.	0.117022	0.38272	N	0.001758	T	0.50667	0.1629	M	0.80616	2.505	0.80722	D	1	P;P	0.47841	0.609;0.901	B;B	0.41466	0.358;0.354	T	0.63853	-0.6543	10	0.87932	D	0	.	18.2471	0.89989	0.0:1.0:0.0:0.0	.	170;120	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	I	120;158;170;120;120;120	ENSP00000372553:M120I;ENSP00000397695:M158I;ENSP00000435509:M170I;ENSP00000417855:M120I;ENSP00000420775:M120I;ENSP00000420627:M120I	ENSP00000372553:M120I	M	-	3	0	ZIC4	148596657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.299000	0.77371	0.561000	0.74099	ATG		0.657	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			15	26	1	0	1.49906e-05	0.00245	2.96839e-05	15	26				
MLF1	4291	broad.mit.edu	37	3	158310301	158310301	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:158310301C>T	ENST00000355893.5	+	2	264	c.126C>T	c.(124-126)ctC>ctT	p.L42L	MLF1_ENST00000471745.1_Silent_p.L17L|MLF1_ENST00000484955.1_Silent_p.L17L|MLF1_ENST00000482628.1_Silent_p.L17L|MLF1_ENST00000469452.1_Silent_p.L17L|MLF1_ENST00000478894.2_Silent_p.L17L|MLF1_ENST00000359117.5_Silent_p.L17L|MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000392822.3_Silent_p.L58L	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	42					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)			large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			GAGACTTGCTCAGTATCTCTG	0.373			T	NPM1	AML																																		uc003fcb.2		NA		Dom	yes		3	3q25.1	4291	T	myeloid leukemia factor 1			L	NPM1		AML		0					0						c.(124-126)CTC>CTT		myeloid leukemia factor 1 isoform 1							145.0	138.0	140.0					3																	158310301		2203	4300	6503	SO:0001819	synonymous_variant	4291				cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding	g.chr3:158310301C>T	L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.126C>T	3.37:g.158310301C>T			Somatic				MLF1_uc003fbz.2_Silent_p.L17L|MLF1_uc003fca.2_Silent_p.L17L|MLF1_uc003fbx.2_Silent_p.L17L|MLF1_uc003fcc.2_Silent_p.L58L|MLF1_uc003fby.2_5'UTR|MLF1_uc010hvx.2_Silent_p.L17L	p.L42L	NM_022443	NP_071888	WXS	Illumina HiSeq	Unspecified	P58340	MLF1_HUMAN	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)		2	263	+		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	42					E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Silent	SNP	ENST00000355893.5	37	c.126C>T	CCDS3182.1																																																																																				0.373	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443		5	56	0	0	0	0.000602	0	5	56				
DGKG	1608	broad.mit.edu	37	3	185906046	185906046	+	Silent	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr3:185906046G>T	ENST00000265022.3	-	22	2579	c.2040C>A	c.(2038-2040)atC>atA	p.I680I	DGKG_ENST00000344484.4_Silent_p.I655I|DGKG_ENST00000382164.4_Silent_p.I641I|DGKG_ENST00000544847.1_Silent_p.I621I	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	680					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGCTTTCCCGGATCACAGCCC	0.488																																							uc003fqa.2		NA																	0				breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(2038-2040)ATC>ATA		diacylglycerol kinase gamma isoform 1	Phosphatidylserine(DB00144)						154.0	140.0	144.0					3																	185906046		2203	4300	6503	SO:0001819	synonymous_variant	1608				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity	g.chr3:185906046G>T	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.2040C>A	3.37:g.185906046G>T			Somatic				DGKG_uc003fqb.2_Silent_p.I641I|DGKG_uc003fqc.2_Silent_p.I655I|DGKG_uc011brx.1_Silent_p.I621I	p.I680I	NM_001346	NP_001337	WXS	Illumina HiSeq	Unspecified	P49619	DGKG_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	22	2577	-	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		680					B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	ENST00000265022.3	37	c.2040C>A	CCDS3274.1																																																																																				0.488	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3			44	75	1	0	4.10826e-27	0.00361	1.04046e-26	44	75				
ZNF732	654254	broad.mit.edu	37	4	265812	265812	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:265812G>T	ENST00000419098.1	-	4	844	c.834C>A	c.(832-834)ttC>ttA	p.F278L		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CTTCACATGTGAAGGGTTTCT	0.378																																							uc011buu.1		NA																	0					0						c.(829-831)TTC>TTA		zinc finger protein 732							53.0	47.0	49.0					4																	265812		692	1591	2283	SO:0001583	missense	654254				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:265812G>T	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.834C>A	4.37:g.265812G>T	ENSP00000415774:p.Phe278Leu		Somatic				ZNF732_uc010ibb.1_Intron	p.F277L	NM_001137608	NP_001131080	WXS	Illumina HiSeq	Unspecified	B4DXR9	ZN732_HUMAN			3	845	-			278			C2H2-type 6.			Missense_Mutation	SNP	ENST00000419098.1	37	c.831C>A	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	G	9.207	1.030038	0.19512	.	.	ENSG00000186777	ENST00000419098	T	0.21932	1.98	0.937	-0.135	0.13477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17109	0.0411	L	0.47190	1.495	0.19775	N	0.999953	B	0.18741	0.03	B	0.22152	0.038	T	0.32903	-0.9889	9	0.87932	D	0	.	4.7453	0.13035	0.2864:0.0:0.7135:0.0	.	278	B4DXR9	ZN732_HUMAN	L	278	ENSP00000415774:F278L	ENSP00000415774:F278L	F	-	3	2	ZNF732	255812	0.000000	0.05858	0.029000	0.17559	0.026000	0.11368	0.729000	0.26028	0.392000	0.25172	0.393000	0.25936	TTC		0.378	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608		4	12	1	0	2.56e-06	0.000248	5.12734e-06	4	12				
PSAPL1	768239	broad.mit.edu	37	4	7436310	7436310	+	Silent	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:7436310G>T	ENST00000319098.4	-	1	390	c.297C>A	c.(295-297)ccC>ccA	p.P99P	SORCS2_ENST00000511199.1_Intron|SORCS2_ENST00000507866.2_Intron|SORCS2_ENST00000329016.9_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	99	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				lung(4)	4						ACTCCTGGCTGGGGAGCCACT	0.632																																							uc011bwj.1		NA																	0					0						c.(295-297)CCC>CCA		prosaposin-like protein 1							30.0	32.0	31.0					4																	7436310		2074	4215	6289	SO:0001819	synonymous_variant	768239				sphingolipid metabolic process	extracellular region|lysosome		g.chr4:7436310G>T	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.297C>A	4.37:g.7436310G>T			Somatic				SORCS2_uc003gkb.3_Intron|SORCS2_uc011bwi.1_Intron	p.P99P	NM_001085382	NP_001078851	WXS	Illumina HiSeq	Unspecified	Q6NUJ1	SAPL1_HUMAN			1	391	-			99			Saposin B-type 1.		A0A184|Q8N7T4	Silent	SNP	ENST00000319098.4	37	c.297C>A	CCDS47009.1																																																																																				0.632	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1			5	19	1	0	0.000602214	0.000602	0.00115328	5	19				
ZNF518B	85460	broad.mit.edu	37	4	10445616	10445616	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:10445616C>A	ENST00000326756.3	-	3	2775	c.2337G>T	c.(2335-2337)agG>agT	p.R779S		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	779					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						AATTAAGAACCCTCAACACAG	0.468																																							uc003gmn.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(2335-2337)AGG>AGT		zinc finger protein 518B							70.0	70.0	70.0					4																	10445616		2203	4300	6503	SO:0001583	missense	85460				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:10445616C>A	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2337G>T	4.37:g.10445616C>A	ENSP00000317614:p.Arg779Ser		Somatic					p.R779S	NM_053042	NP_444270	WXS	Illumina HiSeq	Unspecified	Q9C0D4	Z518B_HUMAN			3	2824	-			779					Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	c.2337G>T	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158057	0.78114	.	.	ENSG00000178163	ENST00000326756	T	0.02216	4.39	6.02	1.45	0.22620	.	0.095949	0.44902	D	0.000413	T	0.05135	0.0137	L	0.38838	1.175	0.28935	N	0.891305	D	0.76494	0.999	D	0.64042	0.921	T	0.10941	-1.0608	10	0.87932	D	0	-15.4899	8.0264	0.30440	0.0:0.5015:0.0:0.4985	.	779	Q9C0D4	Z518B_HUMAN	S	779	ENSP00000317614:R779S	ENSP00000317614:R779S	R	-	3	2	ZNF518B	10054714	0.959000	0.32827	0.985000	0.45067	0.985000	0.73830	-0.095000	0.11077	0.310000	0.22990	0.655000	0.94253	AGG		0.468	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		28	29	1	0	1.12875e-08	0.001061	2.36936e-08	28	29				
GABRA2	2555	broad.mit.edu	37	4	46388188	46388188	+	Silent	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:46388188G>T	ENST00000510861.1	-	3	263	c.90C>A	c.(88-90)atC>atA	p.I30I	GABRA2_ENST00000515082.1_Silent_p.I30I|GABRA2_ENST00000514090.1_Silent_p.I30I|GABRA2_ENST00000507460.1_Silent_p.I30I|GABRA2_ENST00000540012.1_5'UTR|GABRA2_ENST00000381620.4_Silent_p.I30I|GABRA2_ENST00000507069.1_Silent_p.I30I|GABRA2_ENST00000356504.1_Silent_p.I30I|GABRA2_ENST00000509716.1_5'UTR			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	30					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CATCTTCTTGGATGTTAGCCA	0.358																																							uc003gxc.3		NA																	0				ovary(2)|skin(2)	4						c.(88-90)ATC>ATA		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						81.0	73.0	76.0					4																	46388188		2202	4300	6502	SO:0001819	synonymous_variant	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46388188G>T		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.90C>A	4.37:g.46388188G>T			Somatic				GABRA2_uc010igc.2_Silent_p.I30I|GABRA2_uc011bzc.1_5'UTR|GABRA2_uc003gxe.2_Silent_p.I30I|GABRA2_uc010igd.1_Silent_p.I30I	p.I30I	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			2	763	-			30			Extracellular (Probable).		A8K0U7|B7Z1H8|Q59G14	Silent	SNP	ENST00000510861.1	37	c.90C>A	CCDS3471.1																																																																																				0.358	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			10	10	1	0	0.000978159	0.000978	0.00185294	10	10				
LRRC66	339977	broad.mit.edu	37	4	52860682	52860682	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:52860682C>T	ENST00000343457.3	-	4	2512	c.2506G>A	c.(2506-2508)Gaa>Aaa	p.E836K		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	836						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CAATGCCATTCTGCTGCCTTG	0.473																																							uc003gzi.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2506-2508)GAA>AAA		leucine rich repeat containing 66							81.0	81.0	81.0					4																	52860682		1911	4120	6031	SO:0001583	missense	339977					integral to membrane		g.chr4:52860682C>T	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2506G>A	4.37:g.52860682C>T	ENSP00000341944:p.Glu836Lys		Somatic					p.E836K	NM_001024611	NP_001019782	WXS	Illumina HiSeq	Unspecified	Q68CR7	LRC66_HUMAN			4	2519	-			836						Missense_Mutation	SNP	ENST00000343457.3	37	c.2506G>A	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.224985	0.39300	.	.	ENSG00000188993	ENST00000343457	T	0.34667	1.35	4.67	0.663	0.17885	.	1.062150	0.07341	N	0.880828	T	0.24736	0.0600	L	0.32530	0.975	0.09310	N	1	P	0.34977	0.478	B	0.25884	0.064	T	0.18808	-1.0325	10	0.72032	D	0.01	-3.0269	7.877	0.29599	0.0:0.4246:0.4827:0.0927	.	836	Q68CR7	LRC66_HUMAN	K	836	ENSP00000341944:E836K	ENSP00000341944:E836K	E	-	1	0	LRRC66	52555439	0.000000	0.05858	0.005000	0.12908	0.068000	0.16541	-0.124000	0.10595	-0.020000	0.14032	-0.150000	0.13652	GAA		0.473	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		23	37	0	0	0	0.00278	0	23	37				
ADAMTS3	9508	broad.mit.edu	37	4	73169681	73169681	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:73169681C>G	ENST00000286657.4	-	17	2413	c.2377G>C	c.(2377-2379)Gaa>Caa	p.E793Q		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	793	Spacer.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGAAGACTTTCAATGTCATCT	0.398																																					NSCLC(168;1941 2048 2918 13048 43078)	NSCLC(168;1941 2048 2918 13048 43078)	uc003hgk.1		NA																	0				ovary(1)|lung(1)	2						c.(2377-2379)GAA>CAA		ADAM metallopeptidase with thrombospondin type 1							200.0	189.0	193.0					4																	73169681		2203	4300	6503	SO:0001583	missense	9508				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding	g.chr4:73169681C>G	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2377G>C	4.37:g.73169681C>G	ENSP00000286657:p.Glu793Gln		Somatic				ADAMTS3_uc003hgl.2_Missense_Mutation_p.E134Q	p.E793Q	NM_014243	NP_055058	WXS	Illumina HiSeq	Unspecified	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		17	2414	-			793			Spacer.		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	c.2377G>C	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510623	0.64522	.	.	ENSG00000156140	ENST00000286657	T	0.63913	-0.07	5.56	5.56	0.83823	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	D	0.82724	0.5099	M	0.86573	2.825	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.84859	0.0818	10	0.62326	D	0.03	.	19.5394	0.95268	0.0:1.0:0.0:0.0	.	793	O15072	ATS3_HUMAN	Q	793	ENSP00000286657:E793Q	ENSP00000286657:E793Q	E	-	1	0	ADAMTS3	73388545	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	7.730000	0.84881	2.619000	0.88677	0.650000	0.86243	GAA		0.398	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2			58	86	0	0	0	0.00361	0	58	86				
MEPE	56955	broad.mit.edu	37	4	88766663	88766663	+	Missense_Mutation	SNP	C	C	A	rs189348533		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:88766663C>A	ENST00000424957.3	+	4	716	c.643C>A	c.(643-645)Cgt>Agt	p.R215S	MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000560249.1_Missense_Mutation_p.R102S|MEPE_ENST00000540395.1_Missense_Mutation_p.R102S|MEPE_ENST00000395102.4_Missense_Mutation_p.R246S|MEPE_ENST00000361056.3_Missense_Mutation_p.R215S|MEPE_ENST00000497649.2_Missense_Mutation_p.R191S	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	215					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AAGCACCCATCGTATTCAACA	0.393																																							uc003hqy.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(643-645)CGT>AGT		matrix, extracellular phosphoglycoprotein with							79.0	83.0	81.0					4																	88766663		2203	4300	6503	SO:0001583	missense	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88766663C>A	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.643C>A	4.37:g.88766663C>A	ENSP00000416984:p.Arg215Ser		Somatic				MEPE_uc010ikn.2_Missense_Mutation_p.R102S	p.R215S	NM_020203	NP_064588	WXS	Illumina HiSeq	Unspecified	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	682	+		Hepatocellular(203;0.114)	215					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	c.643C>A	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.586443	0.28268	.	.	ENSG00000152595	ENST00000535138;ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.47177	0.86;0.85;0.85;0.88;0.86	4.7	3.86	0.44501	.	1.198750	0.05986	N	0.645235	T	0.42743	0.1216	L	0.43923	1.385	0.09310	N	1	P	0.37158	0.585	B	0.35727	0.209	T	0.35101	-0.9802	10	0.49607	T	0.09	-0.2091	8.8333	0.35098	0.0:0.8984:0.0:0.1016	.	215	Q9NQ76	MEPE_HUMAN	S	215;215;246;191;102;215	ENSP00000416984:R215S;ENSP00000378534:R246S;ENSP00000422747:R191S;ENSP00000443491:R102S;ENSP00000354341:R215S	ENSP00000354341:R215S	R	+	1	0	MEPE	88985687	0.002000	0.14202	0.001000	0.08648	0.003000	0.03518	1.499000	0.35671	1.215000	0.43411	-0.291000	0.09656	CGT		0.393	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			18	43	1	0	5.3912e-06	0.006122	1.0767e-05	18	43				
DNAJB14	79982	broad.mit.edu	37	4	100822301	100822301	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:100822301T>A	ENST00000442697.2	-	8	1178	c.1024A>T	c.(1024-1026)Atg>Ttg	p.M342L		NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	Q8TBM8	DJB14_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 14	342						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)		GCATACTGCATATCTGTTTCT	0.383																																							uc003hvl.2		NA																	0					0						c.(1024-1026)ATG>TTG		DnaJ (Hsp40) homolog, subfamily B, member 14							73.0	70.0	71.0					4																	100822301		2203	4299	6502	SO:0001583	missense	79982				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr4:100822301T>A	BC022248	CCDS34035.1, CCDS75171.1	4q23	2011-09-02			ENSG00000164031	ENSG00000164031		"""Heat shock proteins / DNAJ (HSP40)"""	25881	protein-coding gene	gene with protein product							Standard	NM_001031723		Approved	FLJ14281	uc003hvl.4	Q8TBM8	OTTHUMG00000131049	ENST00000442697.2:c.1024A>T	4.37:g.100822301T>A	ENSP00000404381:p.Met342Leu		Somatic				DNAJB14_uc003hvk.2_Missense_Mutation_p.M257L|DNAJB14_uc010ili.2_Missense_Mutation_p.M275L	p.M342L	NM_001031723	NP_001026893	WXS	Illumina HiSeq	Unspecified	Q8TBM8	DJB14_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)	8	1175	-			342					Q6UXN1|Q7Z3P0|Q86TA7|Q86TM0|Q9GZU9	Missense_Mutation	SNP	ENST00000442697.2	37	c.1024A>T	CCDS34035.1	.	.	.	.	.	.	.	.	.	.	T	2.378	-0.342700	0.05243	.	.	ENSG00000164031	ENST00000442697	T	0.35789	1.29	5.71	5.71	0.89125	Domain of unknown function DUF1977, DnaJ-like (1);	0.114225	0.64402	D	0.000011	T	0.11750	0.0286	N	0.01631	-0.79	0.39619	D	0.969998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.21449	-1.0245	10	0.02654	T	1	.	9.5622	0.39376	0.2634:0.0:0.0:0.7366	.	342;257	Q8TBM8;Q8TBM8-2	DJB14_HUMAN;.	L	342	ENSP00000404381:M342L	ENSP00000404381:M342L	M	-	1	0	DNAJB14	101041324	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.966000	0.56795	2.171000	0.68590	0.533000	0.62120	ATG		0.383	DNAJB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253696.2	NM_001031723.2		17	31	0	0	0	0.00499	0	17	31				
DKK2	27123	broad.mit.edu	37	4	107956578	107956578	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:107956578C>A	ENST00000285311.3	-	1	876	c.171G>T	c.(169-171)atG>atT	p.M57I	DKK2_ENST00000513208.1_Intron|DKK2_ENST00000510463.1_Intron	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	57					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		GTCCTTGGTACATGCCCGCAG	0.587																																							uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(169-171)ATG>ATT		dickkopf homolog 2 precursor							67.0	71.0	69.0					4																	107956578		2203	4300	6503	SO:0001583	missense	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107956578C>A	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.171G>T	4.37:g.107956578C>A	ENSP00000285311:p.Met57Ile		Somatic				DKK2_uc010ilw.1_Intron|DKK2_uc003hyj.1_Missense_Mutation_p.M57I	p.M57I	NM_014421	NP_055236	WXS	Illumina HiSeq	Unspecified	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	1	876	-		Hepatocellular(203;0.217)	57					A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	c.171G>T	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	c	0.017	-1.500859	0.01001	.	.	ENSG00000155011	ENST00000285311	T	0.39997	1.05	5.3	-10.6	0.00265	.	0.651877	0.16437	N	0.214467	T	0.09379	0.0231	N	0.02539	-0.55	0.34204	D	0.673525	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43572	-0.9383	10	0.12430	T	0.62	-5.2863	2.6577	0.05017	0.2076:0.4371:0.2227:0.1326	.	57;57	Q9H3R7;Q9UBU2	.;DKK2_HUMAN	I	57	ENSP00000285311:M57I	ENSP00000285311:M57I	M	-	3	0	DKK2	108176027	0.717000	0.27966	0.020000	0.16555	0.263000	0.26337	-0.565000	0.05929	-3.439000	0.00163	-1.873000	0.00551	ATG		0.587	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			21	46	1	0	9.95505e-16	0.002299	2.34296e-15	21	46				
FAT4	79633	broad.mit.edu	37	4	126238974	126238974	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:126238974G>A	ENST00000394329.3	+	1	1421	c.1408G>A	c.(1408-1410)Gac>Aac	p.D470N		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	470	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGACATCAATGACCATCCTCC	0.552											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(1408-1410)GAC>AAC		FAT tumor suppressor homolog 4 precursor							46.0	49.0	48.0					4																	126238974		2175	4283	6458	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126238974G>A	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.1408G>A	4.37:g.126238974G>A	ENSP00000377862:p.Asp470Asn		Somatic	OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1548		p.D470N	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			1	1408	+			470			Cadherin 4.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.1408G>A	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279069	0.80692	.	.	ENSG00000196159	ENST00000394329	T	0.71579	-0.58	4.66	4.66	0.58398	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.35805	U	0.002968	D	0.87736	0.6252	M	0.93106	3.38	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.90643	0.4576	10	0.62326	D	0.03	.	17.7681	0.88484	0.0:0.0:1.0:0.0	.	470	Q6V0I7	FAT4_HUMAN	N	470	ENSP00000377862:D470N	ENSP00000377862:D470N	D	+	1	0	FAT4	126458424	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.454000	0.97621	2.419000	0.82065	0.561000	0.74099	GAC		0.552	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		4	32	0	0	0	0.000248	0	4	32				
FAT4	79633	broad.mit.edu	37	4	126370200	126370200	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:126370200G>C	ENST00000394329.3	+	9	8042	c.8029G>C	c.(8029-8031)Gaa>Caa	p.E2677Q	FAT4_ENST00000335110.5_Missense_Mutation_p.E975Q	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2677	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATTTATATCTGAAATATTGGA	0.378																																							uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(8029-8031)GAA>CAA		FAT tumor suppressor homolog 4 precursor							96.0	103.0	101.0					4																	126370200		2197	4297	6494	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126370200G>C	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8029G>C	4.37:g.126370200G>C	ENSP00000377862:p.Glu2677Gln		Somatic				FAT4_uc011cgp.1_Missense_Mutation_p.E975Q|FAT4_uc003ifi.1_Missense_Mutation_p.E155Q	p.E2677Q	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			9	8029	+			2677			Cadherin 26.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.8029G>C	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846656	0.71603	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01745	4.66;4.66	5.9	5.06	0.68205	Cadherin (3);Cadherin-like (1);	0.000000	0.35040	U	0.003493	T	0.04907	0.0132	N	0.25647	0.755	0.46203	D	0.998925	D;D;D	0.71674	0.998;0.993;0.995	D;D;D	0.68353	0.957;0.953;0.921	T	0.61327	-0.7085	10	0.32370	T	0.25	.	15.1658	0.72825	0.0674:0.0:0.9326:0.0	.	975;2677;2677	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	Q	2677;975	ENSP00000377862:E2677Q;ENSP00000335169:E975Q	ENSP00000335169:E975Q	E	+	1	0	FAT4	126589650	1.000000	0.71417	0.089000	0.20774	0.964000	0.63967	5.667000	0.68067	1.499000	0.48617	0.650000	0.86243	GAA		0.378	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		5	97	0	0	0	0.001168	0	5	97				
CLGN	1047	broad.mit.edu	37	4	141334183	141334183	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:141334183A>G	ENST00000325617.5	-	2	490	c.50T>C	c.(49-51)aTt>aCt	p.I17T	CLGN_ENST00000537281.1_Missense_Mutation_p.I17T|CLGN_ENST00000414773.1_Missense_Mutation_p.I17T	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	17					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					TTCTGCATTAATTGAGATGAA	0.313																																							uc011chi.1		NA																	0				ovary(2)|skin(1)	3						c.(49-51)ATT>ACT		calmegin precursor							78.0	75.0	76.0					4																	141334183		2203	4298	6501	SO:0001583	missense	1047				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding	g.chr4:141334183A>G	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.50T>C	4.37:g.141334183A>G	ENSP00000326699:p.Ile17Thr		Somatic				CLGN_uc003iii.2_Missense_Mutation_p.I17T	p.I17T	NM_001130675	NP_001124147	WXS	Illumina HiSeq	Unspecified	O14967	CLGN_HUMAN			3	268	-	all_hematologic(180;0.162)		17					B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	ENST00000325617.5	37	c.50T>C	CCDS3751.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.105470	0.37145	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000509477	T;T;T;T	0.72835	0.67;0.67;0.67;-0.69	5.45	2.96	0.34315	.	0.764642	0.12563	N	0.457979	T	0.54240	0.1846	N	0.22421	0.69	0.26752	N	0.970183	B	0.14805	0.011	B	0.10450	0.005	T	0.39981	-0.9587	10	0.27082	T	0.32	-3.7279	8.9875	0.36003	0.8618:0.0:0.1382:0.0	.	17	O14967	CLGN_HUMAN	T	17	ENSP00000326699:I17T;ENSP00000392782:I17T;ENSP00000439381:I17T;ENSP00000424593:I17T	ENSP00000326699:I17T	I	-	2	0	CLGN	141553633	0.009000	0.17119	0.787000	0.31911	0.989000	0.77384	2.440000	0.44855	0.430000	0.26230	0.477000	0.44152	ATT		0.313	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2	NM_004362		24	28	0	0	0	0.004656	0	24	28				
LRBA	987	broad.mit.edu	37	4	151509335	151509335	+	Splice_Site	SNP	A	A	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:151509335A>C	ENST00000357115.3	-	41	6471	c.6228T>G	c.(6226-6228)ggT>ggG	p.G2076G	LRBA_ENST00000535741.1_Splice_Site_p.G2065G|LRBA_ENST00000510413.1_Splice_Site_p.G2065G|LRBA_ENST00000507224.1_Splice_Site_p.G2065G	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2076						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G2076G(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GGCTAACAGGACCTGCCAAAA	0.433																																							uc010ipj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(6226-6228)GGT>GGG		LPS-responsive vesicle trafficking, beach and							34.0	41.0	39.0					4																	151509335		2203	4299	6502	SO:0001630	splice_region_variant	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151509335A>C	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6227-1T>G	4.37:g.151509335A>C			Somatic				LRBA_uc003ilt.3_Silent_p.G724G|LRBA_uc003ilu.3_Silent_p.G2065G	p.G2076G	NM_006726	NP_006717	WXS	Illumina HiSeq	Unspecified	P50851	LRBA_HUMAN			41	6702	-	all_hematologic(180;0.151)		2076					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	c.6228T>G	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	A	7.924	0.739226	0.15642	.	.	ENSG00000198589	ENST00000509835	.	.	.	6.03	0.604	0.17547	.	.	.	.	.	T	0.52338	0.1728	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40156	-0.9578	4	.	.	.	.	6.4434	0.21863	0.625:0.2462:0.1288:0.0	.	.	.	.	G	718	.	.	V	-	2	0	LRBA	151728785	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.866000	0.27954	0.164000	0.19529	0.533000	0.62120	GTC		0.433	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		Silent	7	21	0	0	0	0.003954	0	7	21				
GRIA2	2891	broad.mit.edu	37	4	158282204	158282204	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr4:158282204C>G	ENST00000264426.9	+	14	2613	c.2334C>G	c.(2332-2334)ggC>ggG	p.G778G	GRIA2_ENST00000393815.2_Intron|GRIA2_ENST00000449365.1_Intron|GRIA2_ENST00000507898.1_Intron|GRIA2_ENST00000296526.7_Intron|AC079233.1_ENST00000578227.1_RNA	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	778					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ATGAACAAGGCCTGTTGGACA	0.433																																							uc003ipm.3		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(2332-2334)GGC>GGG		glutamate receptor, ionotropic, AMPA 2 isoform 2	L-Glutamic Acid(DB00142)						84.0	84.0	84.0					4																	158282204		2203	4300	6503	SO:0001819	synonymous_variant	2891				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr4:158282204C>G		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2334C>G	4.37:g.158282204C>G			Somatic				GRIA2_uc011cit.1_Intron|GRIA2_uc003ipl.3_Intron|GRIA2_uc003ipk.3_Intron|GRIA2_uc010iqh.1_RNA|GRIA2_uc011ciu.1_Silent_p.G88G|GRIA2_uc011civ.1_RNA|GRIA2_uc011ciw.1_RNA|GRIA2_uc011cix.1_Intron|GRIA2_uc011ciy.1_Intron|GRIA2_uc011ciz.1_RNA	p.G778G	NM_001083619	NP_001077088	WXS	Illumina HiSeq	Unspecified	P42262	GRIA2_HUMAN		COAD - Colon adenocarcinoma(41;0.0294)	14	2793	+	all_hematologic(180;0.24)	Renal(120;0.0458)	778			Extracellular (Potential).		A8MT92|I6L997|Q96FP6	Silent	SNP	ENST00000264426.9	37	c.2334C>G	CCDS43274.1																																																																																				0.433	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			12	22	0	0	0	0.004007	0	12	22				
SDHA	6389	broad.mit.edu	37	5	251218	251218	+	Splice_Site	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:251218G>T	ENST00000264932.6	+	12	1778	c.1663G>T	c.(1663-1665)Gga>Tga	p.G555*	SDHA_ENST00000510361.1_Splice_Site_p.G507*|SDHA_ENST00000504309.1_Intron	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	555			G -> E (in MT-C2D and CMD1GG). {ECO:0000269|PubMed:12794685, ECO:0000269|PubMed:20551992}.		cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTTCGACCGGGGTGAGCAGAC	0.567									Familial Paragangliomas																														uc003jao.3		NA																	0					0						c.(1663-1665)GGA>TGA		succinate dehydrogenase complex, subunit A,	Succinic acid(DB00139)						77.0	73.0	74.0					5																	251218		2203	4300	6503	SO:0001630	splice_region_variant	6389	Familial_Paragangliomas	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity	g.chr5:251218G>T	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1663+1G>T	5.37:g.251218G>T			Somatic				SDHA_uc011clv.1_Nonsense_Mutation_p.G555*|SDHA_uc011clw.1_Nonsense_Mutation_p.G507*|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Nonsense_Mutation_p.G330*|SDHA_uc003jar.3_Nonsense_Mutation_p.G149*	p.G555*	NM_004168	NP_004159	WXS	Illumina HiSeq	Unspecified	P31040	DHSA_HUMAN	Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		12	1778	+			555		G -> E (in MT-C2D and CMD1GG).			A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Nonsense_Mutation	SNP	ENST00000264932.6	37	c.1663G>T	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	N	34	5.291558	0.95546	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000510361	.	.	.	3.62	3.62	0.41486	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.1329	0.59393	0.0:0.0:1.0:0.0	.	.	.	.	X	555;410;507	.	ENSP00000264932:G555X	G	+	1	0	SDHA	304218	1.000000	0.71417	0.999000	0.59377	0.169000	0.22640	8.321000	0.89997	1.757000	0.51966	0.195000	0.17529	GGA		0.567	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	Nonsense_Mutation	20	37	1	0	1.22574e-08	0.002299	2.55758e-08	20	37				
CDH10	1008	broad.mit.edu	37	5	24488006	24488006	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:24488006C>A	ENST00000264463.4	-	12	2640	c.2133G>T	c.(2131-2133)cgG>cgT	p.R711R	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	711					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAATGAAATCCCGGACGTCCG	0.468										HNSCC(23;0.051)																													uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(2131-2133)CGG>CGT		cadherin 10, type 2 preproprotein							87.0	92.0	90.0					5																	24488006		2203	4300	6503	SO:0001819	synonymous_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24488006C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2133G>T	5.37:g.24488006C>A		HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.R711R	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	12	2465	-			711			Cytoplasmic (Potential).		Q9ULB3	Silent	SNP	ENST00000264463.4	37	c.2133G>T	CCDS3892.1																																																																																				0.468	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		26	33	1	0	4.72057e-08	0.003954	9.70494e-08	26	33				
ADAMTS12	81792	broad.mit.edu	37	5	33561210	33561210	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:33561210C>A	ENST00000504830.1	-	20	4382	c.4047G>T	c.(4045-4047)gcG>gcT	p.A1349A	ADAMTS12_ENST00000352040.3_Silent_p.A1264A	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1349	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCTGGATGGCCGCACAGTCAG	0.572										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(4045-4047)GCG>GCT		ADAM metallopeptidase with thrombospondin type 1							122.0	108.0	113.0					5																	33561210		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33561210C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4047G>T	5.37:g.33561210C>A		HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Silent_p.A1264A	p.A1349A	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			20	4210	-			1349			TSP type-1 5.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.4047G>T	CCDS34140.1																																																																																				0.572	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		31	46	1	0	5.45727e-16	0.001512	1.29749e-15	31	46				
NUP155	9631	broad.mit.edu	37	5	37303423	37303423	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:37303423C>T	ENST00000231498.3	-	28	3459	c.3256G>A	c.(3256-3258)Gag>Aag	p.E1086K	NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000513532.1_Missense_Mutation_p.E1022K|NUP155_ENST00000381843.2_Missense_Mutation_p.E1027K	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1086					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGTTCTTCTCGTAATACCGC	0.403																																							uc003jku.1		NA																	0				ovary(1)	1						c.(3256-3258)GAG>AAG		nucleoporin 155kDa isoform 1							115.0	104.0	108.0					5																	37303423		2203	4300	6503	SO:0001583	missense	9631				carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity	g.chr5:37303423C>T	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.3256G>A	5.37:g.37303423C>T	ENSP00000231498:p.Glu1086Lys		Somatic				NUP155_uc003jkt.1_Missense_Mutation_p.E1027K|NUP155_uc010iuz.1_Missense_Mutation_p.E1022K	p.E1086K	NM_153485	NP_705618	WXS	Illumina HiSeq	Unspecified	O75694	NU155_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		28	3374	-	all_lung(31;0.000137)		1086					Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	c.3256G>A	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	C	36	5.739162	0.96873	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.78595	-1.19;-1.18;-1.17	5.71	5.71	0.89125	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87888	0.6291	M	0.80332	2.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83400	0.0022	10	0.10902	T	0.67	-2.7534	19.8677	0.96824	0.0:1.0:0.0:0.0	.	1022;1086	E9PF10;O75694	.;NU155_HUMAN	K	1086;1027;1048;1022	ENSP00000231498:E1086K;ENSP00000371265:E1027K;ENSP00000422019:E1022K	ENSP00000231498:E1086K	E	-	1	0	NUP155	37339180	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.709000	0.92574	0.655000	0.94253	GAG		0.403	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298		6	36	0	0	0	0.001984	0	6	36				
GCNT4	51301	broad.mit.edu	37	5	74324704	74324704	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:74324704G>C	ENST00000322348.4	-	1	2020	c.1159C>G	c.(1159-1161)Ctt>Gtt	p.L387V		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	387					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		ACGCTTCGAAGGTGAGATCCA	0.423																																							uc003kdn.2		NA																	0				ovary(2)|skin(1)	3						c.(1159-1161)CTT>GTT		core 2 beta-1,6-N-acetylglucosaminyltransferase							83.0	81.0	82.0					5																	74324704		2203	4300	6503	SO:0001583	missense	51301				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity	g.chr5:74324704G>C	AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.1159C>G	5.37:g.74324704G>C	ENSP00000317027:p.Leu387Val		Somatic					p.L387V	NM_016591	NP_057675	WXS	Illumina HiSeq	Unspecified	Q9P109	GCNT4_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)	1	2021	-		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)	387			Lumenal (Potential).			Missense_Mutation	SNP	ENST00000322348.4	37	c.1159C>G	CCDS4026.1	.	.	.	.	.	.	.	.	.	.	.	5.752	0.323239	0.10900	.	.	ENSG00000176928	ENST00000322348	T	0.05717	3.4	6.06	6.06	0.98353	.	0.514144	0.22068	N	0.065077	T	0.02727	0.0082	N	0.02129	-0.67	0.26729	N	0.970635	B	0.16802	0.019	B	0.16722	0.016	T	0.35276	-0.9795	10	0.02654	T	1	-16.9841	16.0336	0.80603	0.0:0.1334:0.8666:0.0	.	387	Q9P109	GCNT4_HUMAN	V	387	ENSP00000317027:L387V	ENSP00000317027:L387V	L	-	1	0	GCNT4	74360460	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.276000	0.43408	2.879000	0.98667	0.650000	0.86243	CTT		0.423	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591		33	36	0	0	0	0.003755	0	33	36				
IQGAP2	10788	broad.mit.edu	37	5	75997028	75997028	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:75997028C>G	ENST00000274364.6	+	34	4792	c.4495C>G	c.(4495-4497)Caa>Gaa	p.Q1499E	IQGAP2_ENST00000502745.1_Missense_Mutation_p.Q995E|CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000396234.3_Missense_Mutation_p.Q995E|IQGAP2_ENST00000379730.3_Missense_Mutation_p.Q1001E	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1499					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGATGATCTTCAAACAAACCA	0.468																																							uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(4495-4497)CAA>GAA		IQ motif containing GTPase activating protein 2							143.0	133.0	136.0					5																	75997028		2203	4300	6503	SO:0001583	missense	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75997028C>G	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4495C>G	5.37:g.75997028C>G	ENSP00000274364:p.Gln1499Glu		Somatic				IQGAP2_uc011csv.1_Missense_Mutation_p.Q995E|IQGAP2_uc003kel.2_Missense_Mutation_p.Q995E	p.Q1499E	NM_006633	NP_006624	WXS	Illumina HiSeq	Unspecified	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	34	4717	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	1499					A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	c.4495C>G	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	C	0.088	-1.172161	0.01646	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000396234;ENST00000502745	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.46	3.54	0.40534	RasGAP protein, C-terminal (1);	0.186062	0.49305	D	0.000143	T	0.42630	0.1211	L	0.55481	1.735	0.58432	D	0.999998	B;B;B	0.24675	0.109;0.04;0.043	B;B;B	0.33960	0.061;0.061;0.173	T	0.45101	-0.9284	10	0.52906	T	0.07	-12.0468	12.8558	0.57884	0.1289:0.7468:0.1243:0.0	.	1001;995;1499	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	E	1499;1001;995;995	ENSP00000274364:Q1499E;ENSP00000442313:Q1001E;ENSP00000379535:Q995E;ENSP00000426027:Q995E	ENSP00000274364:Q1499E	Q	+	1	0	IQGAP2	76032784	1.000000	0.71417	0.004000	0.12327	0.065000	0.16274	4.714000	0.61902	1.400000	0.46741	0.655000	0.94253	CAA		0.468	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		3	63	0	0	0	0.004672	0	3	63				
CDC23	8697	broad.mit.edu	37	5	137548748	137548748	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:137548748C>A	ENST00000394886.2	-	2	196	c.166G>T	c.(166-168)Gcg>Tcg	p.A56S	CDC23_ENST00000505120.1_Missense_Mutation_p.A56S|CDC23_ENST00000394884.3_Missense_Mutation_p.A56S	NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	56					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCCAACTCCGCCGACCTGGAA	0.572																																							uc003lcl.2		NA																	0					0						c.(166-168)GCG>TCG		cell division cycle protein 23							100.0	105.0	104.0					5																	137548748		2203	4300	6503	SO:0001583	missense	8697				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity	g.chr5:137548748C>A	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.166G>T	5.37:g.137548748C>A	ENSP00000378350:p.Ala56Ser		Somatic				CDC23_uc003lcm.1_Missense_Mutation_p.A56S	p.A56S	NM_004661	NP_004652	WXS	Illumina HiSeq	Unspecified	Q9UJX2	CDC23_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		2	197	-			56					A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Missense_Mutation	SNP	ENST00000394886.2	37	c.166G>T	CCDS4200.2	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244920	0.59103	.	.	ENSG00000094880	ENST00000394886;ENST00000394884;ENST00000505120	T;T;T	0.55234	0.53;0.53;0.53	5.93	4.99	0.66335	Cdc23 (1);	0.051854	0.85682	D	0.000000	T	0.40094	0.1103	N	0.19112	0.55	0.45648	D	0.99857	B;B	0.26975	0.165;0.033	B;B	0.34779	0.121;0.189	T	0.22730	-1.0208	10	0.32370	T	0.25	-12.708	11.5386	0.50653	0.366:0.634:0.0:0.0	.	56;56	Q9UJX2-2;Q9UJX2	.;CDC23_HUMAN	S	56	ENSP00000378350:A56S;ENSP00000378348:A56S;ENSP00000423704:A56S	ENSP00000378348:A56S	A	-	1	0	CDC23	137576647	1.000000	0.71417	0.992000	0.48379	0.785000	0.44390	3.389000	0.52516	2.826000	0.97356	0.655000	0.94253	GCG		0.572	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2			50	68	1	0	4.02871e-13	0.00361	9.26337e-13	50	68				
PCDHA2	56146	broad.mit.edu	37	5	140176113	140176113	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:140176113C>T	ENST00000526136.1	+	1	1564	c.1564C>T	c.(1564-1566)Ccg>Tcg	p.P522S	PCDHA2_ENST00000378132.1_Missense_Mutation_p.P522S|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.P522S|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCTGCAGCCGCTGGACCA	0.687																																							uc003lhd.2		NA																	0				ovary(4)	4						c.(1564-1566)CCG>TCG		protocadherin alpha 2 isoform 1 precursor							58.0	64.0	62.0					5																	140176113		2203	4293	6496	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140176113C>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1564C>T	5.37:g.140176113C>T	ENSP00000431748:p.Pro522Ser		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.P522S|PCDHA2_uc011czy.1_Missense_Mutation_p.P522S	p.P522S	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1670	+			522			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1564C>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	7.353	0.623344	0.14193	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.54675	0.56;0.56;0.56	3.88	3.88	0.44766	Cadherin (5);Cadherin-like (1);	0.000000	0.39615	U	0.001313	T	0.39279	0.1072	N	0.04335	-0.225	0.23459	N	0.997637	P;P;P	0.39216	0.664;0.518;0.664	B;P;B	0.55667	0.279;0.781;0.279	T	0.39522	-0.9610	10	0.09084	T	0.74	.	7.5701	0.27902	0.0:0.744:0.0:0.256	.	522;522;522	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	S	522	ENSP00000430584:P522S;ENSP00000367372:P522S;ENSP00000431748:P522S	ENSP00000367372:P522S	P	+	1	0	PCDHA2	140156297	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.314000	0.08092	1.903000	0.55091	0.644000	0.83932	CCG		0.687	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		45	73	0	0	0	0.00361	0	45	73				
PCDHA7	56141	broad.mit.edu	37	5	140215665	140215665	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:140215665T>A	ENST00000525929.1	+	1	1697	c.1697T>A	c.(1696-1698)cTg>cAg	p.L566Q	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L566Q|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	566					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGCACTGCTGGCGCCTCGG	0.687																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(1696-1698)CTG>CAG		protocadherin alpha 7 isoform 1 precursor							83.0	90.0	88.0					5																	140215665		2203	4298	6501	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215665T>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1697T>A	5.37:g.140215665T>A	ENSP00000436426:p.Leu566Gln		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.L566Q	p.L566Q	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1697	+			566			Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.1697T>A	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.415853	0.25552	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.61510	0.1;0.1	3.91	3.91	0.45181	Cadherin (1);Cadherin-like (1);	0.402050	0.14384	U	0.322955	T	0.67748	0.2926	L	0.55213	1.73	0.26164	N	0.979952	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.985	T	0.56691	-0.7937	10	0.87932	D	0	.	6.3913	0.21589	0.0:0.1985:0.0:0.8015	.	566;566	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	Q	566	ENSP00000436426:L566Q;ENSP00000367365:L566Q	ENSP00000367365:L566Q	L	+	2	0	PCDHA7	140195849	0.968000	0.33430	0.110000	0.21437	0.028000	0.11728	3.703000	0.54808	1.530000	0.49136	0.260000	0.18958	CTG		0.687	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		44	73	0	0	0	0.002852	0	44	73				
PCDHB2	56133	broad.mit.edu	37	5	140475158	140475158	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:140475158C>A	ENST00000194155.4	+	1	932	c.784C>A	c.(784-786)Cag>Aag	p.Q262K		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	262	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGTTGGATCCCAGGTTGCCAT	0.483																																							uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(784-786)CAG>AAG		protocadherin beta 2 precursor							66.0	67.0	66.0					5																	140475158		2203	4300	6503	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475158C>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.784C>A	5.37:g.140475158C>A	ENSP00000194155:p.Gln262Lys		Somatic				PCDHB2_uc003lim.1_5'UTR	p.Q262K	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	922	+			262			Extracellular (Potential).|Cadherin 3.		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.784C>A	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	3.614	-0.078877	0.07141	.	.	ENSG00000112852	ENST00000194155	T	0.49432	0.78	5.42	4.54	0.55810	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.28433	0.0703	N	0.10664	0.02	0.09310	N	1	B	0.21381	0.055	B	0.29524	0.103	T	0.06807	-1.0806	9	0.51188	T	0.08	.	6.2398	0.20785	0.1613:0.695:0.0:0.1436	.	262	Q9Y5E7	PCDB2_HUMAN	K	262	ENSP00000194155:Q262K	ENSP00000194155:Q262K	Q	+	1	0	PCDHB2	140455342	0.000000	0.05858	0.257000	0.24404	0.081000	0.17604	-1.027000	0.03592	2.695000	0.91970	0.655000	0.94253	CAG		0.483	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		18	31	1	0	5.01169e-05	0.00499	9.8681e-05	18	31				
PCDHB4	56131	broad.mit.edu	37	5	140503412	140503412	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:140503412C>A	ENST00000194152.1	+	1	1832	c.1832C>A	c.(1831-1833)cCt>cAt	p.P611H		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	611	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCACGGAGCCTGGGCTGTTC	0.697																																							uc003lip.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1831-1833)CCT>CAT		protocadherin beta 4 precursor							23.0	24.0	24.0					5																	140503412		2133	4180	6313	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503412C>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1832C>A	5.37:g.140503412C>A	ENSP00000194152:p.Pro611His		Somatic					p.P611H	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1832	+			611			Cadherin 6.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1832C>A	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850174	0.51270	.	.	ENSG00000081818	ENST00000194152	T	0.52295	0.67	4.01	4.01	0.46588	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70107	0.3186	M	0.80616	2.505	0.34528	D	0.708914	D	0.89917	1.0	D	0.80764	0.994	T	0.81625	-0.0848	9	0.87932	D	0	.	16.3389	0.83075	0.0:1.0:0.0:0.0	.	611	Q9Y5E5	PCDB4_HUMAN	H	611	ENSP00000194152:P611H	ENSP00000194152:P611H	P	+	2	0	PCDHB4	140483596	0.000000	0.05858	1.000000	0.80357	0.919000	0.55068	0.681000	0.25320	2.235000	0.73313	0.485000	0.47835	CCT		0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		51	68	1	0	3.94638e-17	0.00361	9.54504e-17	51	68				
PCDHB12	56124	broad.mit.edu	37	5	140589218	140589218	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:140589218T>A	ENST00000239450.2	+	1	928	c.739T>A	c.(739-741)Tat>Aat	p.Y247N	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	247	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCAGGCTTTTTATGAGGTGAA	0.502																																							uc003liz.2		NA																	0				skin(2)|ovary(1)	3						c.(739-741)TAT>AAT		protocadherin beta 12 precursor							138.0	145.0	142.0					5																	140589218		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589218T>A	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.739T>A	5.37:g.140589218T>A	ENSP00000239450:p.Tyr247Asn		Somatic				PCDHB12_uc011dak.1_Intron	p.Y247N	NM_018932	NP_061755	WXS	Illumina HiSeq	Unspecified	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	928	+			247			Extracellular (Potential).|Cadherin 3.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.739T>A	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.429582	0.43122	.	.	ENSG00000120328	ENST00000239450	T	0.56776	0.44	4.16	4.16	0.48862	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.82171	0.4979	H	0.98276	4.19	0.47441	D	0.999426	D	0.89917	1.0	D	0.91635	0.999	D	0.88594	0.3145	9	0.87932	D	0	.	13.1424	0.59442	0.0:0.0:0.0:1.0	.	247	Q9Y5F1	PCDBC_HUMAN	N	247	ENSP00000239450:Y247N	ENSP00000239450:Y247N	Y	+	1	0	PCDHB12	140569402	1.000000	0.71417	0.327000	0.25402	0.085000	0.17905	4.993000	0.63895	1.648000	0.50643	0.402000	0.26972	TAT		0.502	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		9	134	0	0	0	0.000978	0	9	134				
SH3RF2	153769	broad.mit.edu	37	5	145439754	145439754	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:145439754G>A	ENST00000511217.1	+	8	1933	c.1881G>A	c.(1879-1881)gtG>gtA	p.V627V	SH3RF2_ENST00000359120.4_Silent_p.V627V|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	627					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCATCCTGGTGAAACCAGAAA	0.517																																							uc003lnt.2		NA																	0				ovary(1)|skin(1)	2						c.(1879-1881)GTG>GTA		SH3 domain containing ring finger 2							67.0	72.0	70.0					5																	145439754		2203	4300	6503	SO:0001819	synonymous_variant	153769						ligase activity|protein phosphatase 1 binding|zinc ion binding	g.chr5:145439754G>A	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1881G>A	5.37:g.145439754G>A			Somatic				SH3RF2_uc011dbl.1_Silent_p.V627V|SH3RF2_uc011dbm.1_Silent_p.V112V|SH3RF2_uc003lnu.2_Silent_p.V118V|SH3RF2_uc011dbn.1_Silent_p.V118V|SH3RF2_uc011dbo.1_Silent_p.V84V	p.V627V	NM_152550	NP_689763	WXS	Illumina HiSeq	Unspecified	Q8TEC5	SH3R2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	2119	+			627					A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	ENST00000511217.1	37	c.1881G>A	CCDS4280.1																																																																																				0.517	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550		11	64	0	0	0	0.001368	0	11	64				
JAKMIP2	9832	broad.mit.edu	37	5	147051274	147051274	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:147051274G>A	ENST00000265272.5	-	2	563	c.96C>T	c.(94-96)gaC>gaT	p.D32D	JAKMIP2_ENST00000333010.6_Intron|JAKMIP2_ENST00000507386.1_Silent_p.D32D	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	32						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTATCTGAATGTCTGTGAGCT	0.532																																							uc003loq.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(94-96)GAC>GAT		janus kinase and microtubule interacting protein							166.0	137.0	147.0					5																	147051274		2203	4300	6503	SO:0001819	synonymous_variant	9832					Golgi apparatus		g.chr5:147051274G>A	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.96C>T	5.37:g.147051274G>A			Somatic				JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Silent_p.D32D|JAKMIP2_uc010jgo.1_Silent_p.D32D	p.D32D	NM_014790	NP_055605	WXS	Illumina HiSeq	Unspecified	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	478	-			32			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	ENST00000265272.5	37	c.96C>T	CCDS4285.1																																																																																				0.532	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		14	11	0	0	0	0.00245	0	14	11				
GABRA1	2554	broad.mit.edu	37	5	161309626	161309626	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:161309626G>T	ENST00000428797.2	+	8	977	c.622G>T	c.(622-624)Gta>Tta	p.V208L	GABRA1_ENST00000420560.1_Missense_Mutation_p.V208L|GABRA1_ENST00000444819.1_Missense_Mutation_p.V208L|GABRA1_ENST00000437025.2_Missense_Mutation_p.V208L|GABRA1_ENST00000393943.4_Missense_Mutation_p.V208L|GABRA1_ENST00000023897.6_Missense_Mutation_p.V208L	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	208					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTCAGTGGTTGTAGCAGAAGA	0.398																																							uc010jiw.2		NA																	0				ovary(2)|pancreas(1)	3						c.(622-624)GTA>TTA		gamma-aminobutyric acid (GABA) A receptor, alpha	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)						154.0	135.0	142.0					5																	161309626		2203	4300	6503	SO:0001583	missense	2554				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:161309626G>T		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.622G>T	5.37:g.161309626G>T	ENSP00000393097:p.Val208Leu		Somatic				GABRA1_uc010jix.2_Missense_Mutation_p.V208L|GABRA1_uc010jiy.2_Missense_Mutation_p.V208L|GABRA1_uc003lyx.3_Missense_Mutation_p.V208L|GABRA1_uc010jiz.2_Missense_Mutation_p.V208L|GABRA1_uc010jja.2_Missense_Mutation_p.V208L|GABRA1_uc010jjb.2_Missense_Mutation_p.V208L	p.V208L	NM_000806	NP_000797	WXS	Illumina HiSeq	Unspecified	P14867	GBRA1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	8	1090	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	208			Extracellular (Probable).		D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	c.622G>T	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213872	0.95104	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.19	5.19	0.71726	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85600	0.5734	L	0.52759	1.655	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.86638	0.1890	10	0.72032	D	0.01	.	18.0499	0.89344	0.0:0.0:1.0:0.0	.	208	P14867	GBRA1_HUMAN	L	208	ENSP00000023897:V208L;ENSP00000393097:V208L;ENSP00000377517:V208L;ENSP00000415441:V208L;ENSP00000408041:V208L;ENSP00000414232:V208L	ENSP00000023897:V208L	V	+	1	0	GABRA1	161242204	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.695000	0.98691	2.580000	0.87095	0.650000	0.86243	GTA		0.398	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5		7	20	1	0	0.00307968	0.00308	0.00574052	7	20				
HRH2	3274	broad.mit.edu	37	5	175111128	175111128	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:175111128G>T	ENST00000231683.2	+	1	2665	c.892G>T	c.(892-894)Ggg>Tgg	p.G298W	HRH2_ENST00000377291.2_Missense_Mutation_p.G298W	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	298					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.G298W(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CTTCCGCACCGGGTACCAACA	0.567																																							uc003mdd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(892-894)GGG>TGG		histamine receptor H2 isoform 2	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)						97.0	84.0	88.0					5																	175111128		2203	4300	6503	SO:0001583	missense	3274				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity	g.chr5:175111128G>T		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.892G>T	5.37:g.175111128G>T	ENSP00000231683:p.Gly298Trp		Somatic				HRH2_uc003mdc.3_Missense_Mutation_p.G298W	p.G298W	NM_022304	NP_071640	WXS	Illumina HiSeq	Unspecified	P25021	HRH2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	1	2665	+	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	298			Cytoplasmic (Potential).		B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	c.892G>T	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286347	0.59867	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.37915	1.17;1.17	5.21	5.21	0.72293	.	0.425026	0.24323	N	0.039529	T	0.37785	0.1016	N	0.08118	0	0.45108	D	0.998125	P;D	0.56746	0.811;0.977	P;P	0.58721	0.6;0.844	T	0.50329	-0.8841	10	0.87932	D	0	.	17.7435	0.88413	0.0:0.0:1.0:0.0	.	298;298	P25021;Q7Z5R9	HRH2_HUMAN;.	W	298	ENSP00000366506:G298W;ENSP00000231683:G298W	ENSP00000231683:G298W	G	+	1	0	HRH2	175043734	1.000000	0.71417	0.027000	0.17364	0.195000	0.23768	9.736000	0.98828	2.442000	0.82660	0.650000	0.86243	GGG		0.567	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1			25	21	1	0	1.33986e-20	0.004656	3.32115e-20	25	21				
RIPK1	8737	broad.mit.edu	37	6	3105914	3105914	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:3105914A>G	ENST00000259808.4	+	9	1503	c.1205A>G	c.(1204-1206)aAt>aGt	p.N402S	RIPK1_ENST00000380409.2_Missense_Mutation_p.N402S|RIPK1_ENST00000541791.1_Missense_Mutation_p.N356S|RIPK1_ENST00000479389.1_3'UTR			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	402	Interaction with SQSTM1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CCCAGACAGAATGTGGCTTAC	0.502																																							uc010jni.2		NA																	0				large_intestine(3)|lung(1)|skin(1)	5						c.(1204-1206)AAT>AGT		receptor (TNFRSF)-interacting serine-threonine							69.0	73.0	72.0					6																	3105914		2203	4300	6503	SO:0001583	missense	8737				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity	g.chr6:3105914A>G	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1205A>G	6.37:g.3105914A>G	ENSP00000259808:p.Asn402Ser		Somatic				RIPK1_uc003muv.3_Missense_Mutation_p.N239S|RIPK1_uc003muw.3_Missense_Mutation_p.N337S|RIPK1_uc011dhs.1_Missense_Mutation_p.N356S|RIPK1_uc003mux.2_Missense_Mutation_p.N402S	p.N402S	NM_003804	NP_003795	WXS	Illumina HiSeq	Unspecified	Q13546	RIPK1_HUMAN			9	1437	+	Ovarian(93;0.0386)	all_hematologic(90;0.0895)	402			Interaction with SQSTM1.		A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	ENST00000259808.4	37	c.1205A>G	CCDS4482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.678|9.678	1.148420|1.148420	0.21288|0.21288	.|.	.|.	ENSG00000137275|ENSG00000137275	ENST00000453483|ENST00000259808;ENST00000541791;ENST00000380409	.|T;T;T	.|0.76316	.|-1.01;-0.45;-1.01	5.6|5.6	-8.65|-8.65	0.00870|0.00870	.|.	.|1.461890	.|0.03202	.|N	.|0.174871	T|T	0.33206|0.33206	0.0855|0.0855	N|N	0.16656|0.16656	0.425|0.425	0.09310|0.09310	N|N	1|1	.|B;B	.|0.13145	.|0.007;0.006	.|B;B	.|0.08055	.|0.003;0.001	T|T	0.13072|0.13072	-1.0523|-1.0523	6|10	0.34782|0.11794	T|T	0.22|0.64	-2.7032|-2.7032	10.4533|10.4533	0.44535|0.44535	0.2104:0.2336:0.556:0.0|0.2104:0.2336:0.556:0.0	.|.	.|356;402	.|Q13546-2;Q13546	.|.;RIPK1_HUMAN	V|S	33|402;356;402	.|ENSP00000259808:N402S;ENSP00000442294:N356S;ENSP00000369773:N402S	ENSP00000415981:M33V|ENSP00000259808:N402S	M|N	+|+	1|2	0|0	RIPK1|RIPK1	3050913|3050913	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.923000|0.923000	0.55619|0.55619	-0.081000|-0.081000	0.11321|0.11321	-1.183000|-1.183000	0.02723|0.02723	0.533000|0.533000	0.62120|0.62120	ATG|AAT		0.502	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2	NM_003804		20	39	0	0	0	0.001523	0	20	39				
OR2W1	26692	broad.mit.edu	37	6	29012475	29012475	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:29012475A>T	ENST00000377175.1	-	1	542	c.478T>A	c.(478-480)Tgt>Agt	p.C160S		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GTGAGTGTACATAATACTACA	0.393																																							uc003nlw.2		NA																	0				ovary(2)|skin(1)	3						c.(478-480)TGT>AGT		olfactory receptor, family 2, subfamily W,							102.0	100.0	101.0					6																	29012475		1511	2709	4220	SO:0001583	missense	26692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29012475A>T	AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.478T>A	6.37:g.29012475A>T	ENSP00000366380:p.Cys160Ser		Somatic					p.C160S	NM_030903	NP_112165	WXS	Illumina HiSeq	Unspecified	Q9Y3N9	OR2W1_HUMAN			1	478	-			160			Extracellular (Potential).		B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	ENST00000377175.1	37	c.478T>A	CCDS4656.1	.	.	.	.	.	.	.	.	.	.	A	3.235	-0.156638	0.06544	.	.	ENSG00000204704	ENST00000377175	T	0.00069	8.77	4.79	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000034	T	0.00012	0.0000	N	0.00098	-2.145	0.43021	D	0.994577	P	0.36599	0.56	B	0.35931	0.214	T	0.00759	-1.1578	10	0.02654	T	1	.	13.1476	0.59472	1.0:0.0:0.0:0.0	.	160	Q9Y3N9	OR2W1_HUMAN	S	160	ENSP00000366380:C160S	ENSP00000366380:C160S	C	-	1	0	OR2W1	29120454	0.000000	0.05858	0.977000	0.42913	0.600000	0.36913	-0.326000	0.07965	1.766000	0.52107	0.482000	0.46254	TGT		0.393	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2			20	31	0	0	0	0.000958	0	20	31				
OR10C1	442194	broad.mit.edu	37	6	29408052	29408052	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:29408052G>T	ENST00000444197.2	+	1	970	c.260G>T	c.(259-261)gGc>gTc	p.G87V	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTCCTTACTGGCCGGCGCCAC	0.587																																							uc011dlp.1		NA																	0					0						c.(259-261)GGC>GTC		olfactory receptor, family 10, subfamily C,							128.0	122.0	124.0					6																	29408052		1508	2708	4216	SO:0001583	missense	442194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29408052G>T		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.260G>T	6.37:g.29408052G>T	ENSP00000419119:p.Gly87Val		Somatic				OR11A1_uc010jrh.1_Intron	p.G87V	NM_013941	NP_039229	WXS	Illumina HiSeq	Unspecified	Q96KK4	O10C1_HUMAN			1	260	+			87			Extracellular (Potential).		Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	c.260G>T	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	G	2.705	-0.269983	0.05716	.	.	ENSG00000206474	ENST00000444197	T	0.03004	4.08	2.95	1.73	0.24493	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38164	U	0.001782	T	0.01189	0.0039	L	0.39245	1.2	0.18873	N	0.999985	B	0.26845	0.161	B	0.29598	0.104	T	0.45731	-0.9241	10	0.51188	T	0.08	.	6.0856	0.19964	0.3282:0.0:0.6718:0.0	.	87	Q96KK4	O10C1_HUMAN	V	87	ENSP00000419119:G87V	ENSP00000419119:G87V	G	+	2	0	OR10C1	29516031	0.000000	0.05858	0.008000	0.14137	0.049000	0.14656	-0.119000	0.10676	0.316000	0.23135	0.196000	0.17591	GGC		0.587	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2			32	72	1	0	1.22384e-17	0.002836	2.9807e-17	32	72				
C6orf136	221545	broad.mit.edu	37	6	30619070	30619070	+	Silent	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:30619070G>A	ENST00000376473.5	+	4	750	c.591G>A	c.(589-591)ctG>ctA	p.L197L	C6orf136_ENST00000293604.6_Silent_p.L378L|C6orf136_ENST00000528347.2_Silent_p.L54L|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000376471.4_Silent_p.L63L	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	197						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TTCTTTCACTGACCCTCTGCC	0.507																																							uc003nqw.3		NA																	0					0						c.(589-591)CTG>CTA		hypothetical protein LOC221545 isoform 1							255.0	255.0	255.0					6																	30619070		2203	4300	6503	SO:0001819	synonymous_variant	221545							g.chr6:30619070G>A	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.591G>A	6.37:g.30619070G>A			Somatic				C6orf136_uc003nqx.3_Silent_p.L378L|C6orf136_uc011dmn.1_Silent_p.L63L	p.L197L	NM_001109938	NP_001103408	WXS	Illumina HiSeq	Unspecified	Q5SQH8	CF136_HUMAN			4	784	+			197					A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	ENST00000376473.5	37	c.591G>A	CCDS43443.1																																																																																				0.507	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029		32	327	0	0	0	0.003755	0	32	327				
LRFN2	57497	broad.mit.edu	37	6	40359880	40359880	+	Missense_Mutation	SNP	G	G	T	rs144850104	byFrequency	TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:40359880G>T	ENST00000338305.6	-	3	2714	c.2172C>A	c.(2170-2172)ttC>ttA	p.F724L		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	724						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.F724F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCCCATGTCGAAGGAGTGGC	0.692																																							uc003oph.1		NA																	1	Substitution - coding silent(1)		prostate(1)	ovary(2)|skin(1)	3						c.(2170-2172)TTC>TTA		leucine rich repeat and fibronectin type III							17.0	16.0	17.0					6																	40359880		2191	4296	6487	SO:0001583	missense	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40359880G>T	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.2172C>A	6.37:g.40359880G>T	ENSP00000345985:p.Phe724Leu		Somatic					p.F724L	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			3	2637	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		724			Cytoplasmic (Potential).		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	c.2172C>A	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514110	0.64522	.	.	ENSG00000156564	ENST00000338305	T	0.52983	0.64	5.27	-3.4	0.04853	.	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	L	0.29908	0.895	0.50632	D	0.999888	D	0.58268	0.982	D	0.69142	0.962	T	0.34279	-0.9835	10	0.36615	T	0.2	.	14.1196	0.65177	0.7679:0.0:0.2321:0.0	.	724	Q9ULH4	LRFN2_HUMAN	L	724	ENSP00000345985:F724L	ENSP00000345985:F724L	F	-	3	2	LRFN2	40467858	0.005000	0.15991	0.934000	0.37439	0.942000	0.58702	-0.933000	0.03959	-1.061000	0.03185	0.555000	0.69702	TTC		0.692	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		8	10	1	0	0.000274275	0.004482	0.000529609	8	10				
LRFN2	57497	broad.mit.edu	37	6	40360011	40360011	+	Missense_Mutation	SNP	C	C	T	rs539211841		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:40360011C>T	ENST00000338305.6	-	3	2583	c.2041G>A	c.(2041-2043)Ggg>Agg	p.G681R		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	681						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCCCTCTCCCGGCTGGAGTC	0.716													C|||	1	0.000199681	0.0	0.0	5008	,	,		12814	0.0		0.0	False		,,,				2504	0.001						uc003oph.1		NA																	0				ovary(2)|skin(1)	3						c.(2041-2043)GGG>AGG		leucine rich repeat and fibronectin type III							7.0	9.0	8.0					6																	40360011		2166	4238	6404	SO:0001583	missense	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40360011C>T	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.2041G>A	6.37:g.40360011C>T	ENSP00000345985:p.Gly681Arg		Somatic					p.G681R	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			3	2506	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		681			Cytoplasmic (Potential).		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	c.2041G>A	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801903	0.31869	.	.	ENSG00000156564	ENST00000338305	T	0.57752	0.38	4.42	3.55	0.40652	.	0.221207	0.39834	N	0.001242	T	0.19327	0.0464	N	0.08118	0	0.26799	N	0.969232	D	0.62365	0.991	P	0.47102	0.537	T	0.04128	-1.0975	10	0.56958	D	0.05	.	8.5445	0.33413	0.0:0.8931:0.0:0.1069	.	681	Q9ULH4	LRFN2_HUMAN	R	681	ENSP00000345985:G681R	ENSP00000345985:G681R	G	-	1	0	LRFN2	40467989	0.922000	0.31269	1.000000	0.80357	0.940000	0.58332	1.719000	0.38011	1.221000	0.43506	0.555000	0.69702	GGG		0.716	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		7	11	0	0	0	0.00308	0	7	11				
TREM1	54210	broad.mit.edu	37	6	41243937	41243937	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:41243937C>A	ENST00000244709.4	-	4	694	c.631G>T	c.(631-633)Gct>Tct	p.A211S	TREM1_ENST00000334475.6_Missense_Mutation_p.W146C|TREM1_ENST00000589614.1_Intron	NM_018643.3	NP_061113.1	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	211					blood coagulation (GO:0007596)|chemokine metabolic process (GO:0050755)|cytokine secretion involved in immune response (GO:0002374)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			NS(1)|breast(2)|endometrium(2)|large_intestine(5)|lung(5)|skin(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					AATCCACCAGCCAGGAGAATG	0.542																																							uc003oqf.1		NA																	0				breast(1)	1						c.(631-633)GCT>TCT		triggering receptor expressed on myeloid cells 1	Glutathione(DB00143)						161.0	134.0	143.0					6																	41243937		2203	4300	6503	SO:0001583	missense	54210				blood coagulation|humoral immune response|intracellular signal transduction|leukocyte migration	extracellular region|integral to membrane|intracellular|plasma membrane	receptor activity	g.chr6:41243937C>A	AF196329	CCDS4854.1, CCDS56427.1, CCDS59499.1	6p21.1	2013-01-11			ENSG00000124731	ENSG00000124731		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17760	protein-coding gene	gene with protein product		605085				11922939, 10799849	Standard	NM_018643		Approved	TREM-1, CD354	uc003oqf.2	Q9NP99	OTTHUMG00000014674	ENST00000244709.4:c.631G>T	6.37:g.41243937C>A	ENSP00000244709:p.Ala211Ser		Somatic				TREM1_uc003oqg.1_Missense_Mutation_p.W146C	p.A211S	NM_018643	NP_061113	WXS	Illumina HiSeq	Unspecified	Q9NP99	TREM1_HUMAN			4	695	-	Ovarian(28;0.0327)|Colorectal(47;0.196)		211			Helical; (Potential).		B4DWG2|K7EJW1|Q53FL8|Q5T2C9|Q86YU1	Missense_Mutation	SNP	ENST00000244709.4	37	c.631G>T	CCDS4854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.26|13.26	2.184387|2.184387	0.38609|0.38609	.|.	.|.	ENSG00000124731|ENSG00000124731	ENST00000244709|ENST00000334475	T|T	0.08546|0.13778	3.08|2.56	4.86|4.86	-0.173|-0.173	0.13322|0.13322	.|.	1.854110|.	0.03099|.	N|.	0.160784|.	T|T	0.02848|0.02848	0.0085|0.0085	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	P|B	0.39480|0.17667	0.675|0.023	B|B	0.33960|0.19391	0.173|0.025	T|T	0.44513|0.44513	-0.9323|-0.9323	9|8	0.62326|0.87932	D|D	0.03|0	0.4827|0.4827	1.7973|1.7973	0.03064|0.03064	0.1434:0.3096:0.3553:0.1916|0.1434:0.3096:0.3553:0.1916	.|.	211|146	Q9NP99|Q9NP99-2	TREM1_HUMAN|.	S|C	211|146	ENSP00000244709:A211S|ENSP00000334284:W146C	ENSP00000244709:A211S|ENSP00000334284:W146C	A|W	-|-	1|3	0|0	TREM1|TREM1	41351915|41351915	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.026000|0.026000	0.11368|0.11368	-0.384000|-0.384000	0.07389|0.07389	0.072000|0.072000	0.16694|0.16694	0.655000|0.655000	0.94253|0.94253	GCT|TGG		0.542	TREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040505.2	NM_018643		16	25	1	0	8.60227e-14	0.004007	1.99106e-13	16	25				
CUL9	23113	broad.mit.edu	37	6	43155663	43155663	+	Silent	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:43155663C>G	ENST00000252050.4	+	7	1878	c.1794C>G	c.(1792-1794)tcC>tcG	p.S598S	CUL9_ENST00000354495.3_Silent_p.S488S|CUL9_ENST00000372647.2_Silent_p.S598S	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	598					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AAGAGGAGTCCAAGTCGGAGG	0.547																																							uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(1792-1794)TCC>TCG		p53-associated parkin-like cytoplasmic protein							65.0	61.0	63.0					6																	43155663		2203	4300	6503	SO:0001819	synonymous_variant	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43155663C>G	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1794C>G	6.37:g.43155663C>G			Somatic				CUL9_uc003ouj.1_Silent_p.S488S|CUL9_uc003oul.2_Silent_p.S598S|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_Silent_p.S56S	p.S598S	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			7	1869	+			598					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	c.1794C>G	CCDS4890.1																																																																																				0.547	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		14	22	0	0	0	0.001855	0	14	22				
RUNX2	860	broad.mit.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000352853.5_Silent_p.Q133Q|RUNX2_ENST00000576263.1_Silent_p.Q65Q|RUNX2_ENST00000359524.5_Silent_p.Q51Q|RUNX2_ENST00000541979.1_Silent_p.Q133Q|RUNX2_ENST00000371432.3_Silent_p.Q51Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000371436.6_Silent_p.Q65Q|RP1-244F24.1_ENST00000606796.1_RNA	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031						uc011dvx.1		NA																	0				ovary(2)|skin(1)	3						c.(193-195)CAA>CAG		runt-related transcription factor 2 isoform a							10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:45390466A>G	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	6.37:g.45390466A>G			Somatic				RUNX2_uc011dvy.1_Silent_p.Q65Q|RUNX2_uc003oxt.2_Silent_p.Q51Q	p.Q65Q	NM_001024630	NP_001019801	WXS	Illumina HiSeq	Unspecified	Q13950	RUNX2_HUMAN			3	405	+			65			Poly-Gln.		O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	c.195A>G	CCDS43467.2																																																																																				0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348		3	41	0	0	0	0.004672	0	3	41				
FAM135A	57579	broad.mit.edu	37	6	71242879	71242879	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:71242879C>T	ENST00000418814.2	+	17	4406	c.3792C>T	c.(3790-3792)ctC>ctT	p.L1264L	FAM135A_ENST00000370479.3_Silent_p.L1051L|FAM135A_ENST00000361499.3_Silent_p.L1068L|FAM135A_ENST00000457062.2_Silent_p.L1051L|FAM135A_ENST00000505769.1_Silent_p.L844L|FAM135A_ENST00000505868.1_Silent_p.L1264L	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1264										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						GTGCAGATCTCCGATTAGTAA	0.323																																							uc003pfj.2		NA																	0				central_nervous_system(1)	1						c.(3790-3792)CTC>CTT		hypothetical protein LOC57579 isoform c							76.0	78.0	77.0					6																	71242879		2203	4299	6502	SO:0001819	synonymous_variant	57579							g.chr6:71242879C>T	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3792C>T	6.37:g.71242879C>T			Somatic				FAM135A_uc003pfi.2_Silent_p.L1068L|FAM135A_uc003pfh.2_Silent_p.L1051L|FAM135A_uc003pfl.2_Silent_p.L931L|FAM135A_uc003pfn.2_Silent_p.L470L|FAM135A_uc003pfo.1_Silent_p.L635L|FAM135A_uc010kan.1_Silent_p.L43L	p.L1264L	NM_001162529	NP_001156001	WXS	Illumina HiSeq	Unspecified	Q9P2D6	F135A_HUMAN			15	3925	+			1264					A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Silent	SNP	ENST00000418814.2	37	c.3792C>T	CCDS55028.1																																																																																				0.323	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819		3	10	0	0	0	0.004672	0	3	10				
C6orf165	154313	broad.mit.edu	37	6	88144689	88144689	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:88144689G>A	ENST00000507897.1	+	11	1495	c.1412G>A	c.(1411-1413)aGa>aAa	p.R471K	C6ORF165_ENST00000369562.4_Missense_Mutation_p.R471K			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	471										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		GACATAGTTAGAGAAAAGGCC	0.274																																							uc003plv.2		NA																	0				central_nervous_system(1)	1						c.(1411-1413)AGA>AAA		hypothetical protein LOC154313 isoform 1							55.0	58.0	57.0					6																	88144689		2203	4296	6499	SO:0001583	missense	154313							g.chr6:88144689G>A	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1412G>A	6.37:g.88144689G>A	ENSP00000426769:p.Arg471Lys		Somatic				SLC35A1_uc003plx.2_5'Flank|C6orf165_uc003plw.2_Missense_Mutation_p.R283K|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.R471K	p.R471K	NM_001031743	NP_001026913	WXS	Illumina HiSeq	Unspecified	Q8IYR0	CF165_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0419)	11	1504	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	471					A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	c.1412G>A	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	G	3.029	-0.200139	0.06219	.	.	ENSG00000213204	ENST00000369562	T	0.28454	1.61	4.87	-1.71	0.08133	.	0.883271	0.10110	N	0.714863	T	0.02929	0.0087	N	0.16478	0.41	0.23043	N	0.998388	B	0.02656	0.0	B	0.08055	0.003	T	0.39522	-0.9610	10	0.05959	T	0.93	.	1.9225	0.03310	0.304:0.3504:0.2282:0.1174	.	471	Q8IYR0	CF165_HUMAN	K	471	ENSP00000358575:R471K	ENSP00000358575:R471K	R	+	2	0	C6orf165	88201408	0.043000	0.20138	0.276000	0.24689	0.978000	0.69477	-0.749000	0.04813	-0.866000	0.04068	0.491000	0.48974	AGA		0.274	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823		4	19	0	0	0	0.000248	0	4	19				
GRM1	2911	broad.mit.edu	37	6	146720753	146720753	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:146720753G>T	ENST00000282753.1	+	7	2813	c.2578G>T	c.(2578-2580)Gtt>Ttt	p.V860F	GRM1_ENST00000492807.2_Missense_Mutation_p.V860F|GRM1_ENST00000507907.1_Missense_Mutation_p.V860F|GRM1_ENST00000355289.4_Missense_Mutation_p.V860F|GRM1_ENST00000392299.2_Missense_Mutation_p.V860F|GRM1_ENST00000361719.2_Missense_Mutation_p.V860F			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	860					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCGCATGCATGTTGGCGATGG	0.527																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(2578-2580)GTT>TTT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						59.0	50.0	53.0					6																	146720753		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146720753G>T	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2578G>T	6.37:g.146720753G>T	ENSP00000282753:p.Val860Phe		Somatic				GRM1_uc010khv.1_Missense_Mutation_p.V860F|GRM1_uc003qll.2_Missense_Mutation_p.V860F|GRM1_uc011edz.1_Missense_Mutation_p.V860F|GRM1_uc011eea.1_Missense_Mutation_p.V860F	p.V860F	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	8	3048	+		Ovarian(120;0.0387)	860			Cytoplasmic (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.2578G>T	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994679	0.54041	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89123	-2.38;-2.42;-2.42;-2.38;-2.47;-2.42	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.88066	0.6337	M	0.80183	2.485	0.80722	D	1	B;B;B	0.19073	0.033;0.012;0.033	B;B;B	0.23150	0.044;0.012;0.044	D	0.85171	0.0998	10	0.87932	D	0	.	19.7753	0.96389	0.0:0.0:1.0:0.0	.	860;860;860	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	F	860	ENSP00000354896:V860F;ENSP00000376119:V860F;ENSP00000424095:V860F;ENSP00000282753:V860F;ENSP00000347437:V860F;ENSP00000425599:V860F	ENSP00000282753:V860F	V	+	1	0	GRM1	146762446	1.000000	0.71417	0.977000	0.42913	0.990000	0.78478	7.944000	0.87722	2.686000	0.91538	0.585000	0.79938	GTT		0.527	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		22	13	1	0	1.96895e-08	0.00278	4.07188e-08	22	13				
THBS2	7058	broad.mit.edu	37	6	169628232	169628232	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr6:169628232C>G	ENST00000366787.3	-	16	2653	c.2404G>C	c.(2404-2406)Gac>Cac	p.D802H	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	802					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCATCAATGTCCACGGAGCAG	0.532																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	0				ovary(5)	5						c.(2404-2406)GAC>CAC		thrombospondin 2 precursor							213.0	151.0	172.0					6																	169628232		2203	4300	6503	SO:0001583	missense	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169628232C>G		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.2404G>C	6.37:g.169628232C>G	ENSP00000355751:p.Asp802His		Somatic					p.D802H	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	16	2652	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	802			TSP type-3 4.		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	c.2404G>C	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.314088	0.60414	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.99923	-8.01	4.27	4.27	0.50696	.	0.000000	0.42548	U	0.000681	D	0.99947	0.9977	H	0.96365	3.81	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95644	0.8701	10	0.87932	D	0	-58.0186	17.0508	0.86518	0.0:1.0:0.0:0.0	.	802	P35442	TSP2_HUMAN	H	802;60	ENSP00000355751:D802H	ENSP00000355751:D802H	D	-	1	0	THBS2	169370157	1.000000	0.71417	0.997000	0.53966	0.340000	0.28889	7.203000	0.77864	2.083000	0.62718	0.478000	0.44815	GAC		0.532	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		3	20	0	0	0	0.004672	0	3	20				
CARD11	84433	broad.mit.edu	37	7	2976727	2976727	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:2976727C>T	ENST00000396946.4	-	9	1688	c.1285G>A	c.(1285-1287)Gtc>Atc	p.V429I		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	429					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TCCAGGTTGACGATGCAGGCC	0.622			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(1285-1287)GTC>ATC		caspase recruitment domain family, member 11							121.0	99.0	107.0					7																	2976727		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2976727C>T	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1285G>A	7.37:g.2976727C>T	ENSP00000380150:p.Val429Ile		Somatic					p.V429I	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	9	1689	-		Ovarian(82;0.0115)	429			Potential.		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.1285G>A	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	14.48	2.546695	0.45383	.	.	ENSG00000198286	ENST00000396946	T	0.33216	1.42	5.22	4.3	0.51218	.	0.065841	0.64402	D	0.000011	T	0.15739	0.0379	N	0.14661	0.345	0.48040	D	0.999579	B	0.27765	0.188	B	0.16722	0.016	T	0.08513	-1.0718	10	0.21540	T	0.41	-45.2816	9.7246	0.40324	0.1592:0.6873:0.1535:0.0	.	429	Q9BXL7	CAR11_HUMAN	I	429	ENSP00000380150:V429I	ENSP00000380150:V429I	V	-	1	0	CARD11	2943253	0.986000	0.35501	0.994000	0.49952	0.776000	0.43924	2.429000	0.44758	1.135000	0.42183	0.561000	0.74099	GTC		0.622	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		15	13	0	0	0	0.00245	0	15	13				
RSPH10B2	728194	broad.mit.edu	37	7	6797501	6797501	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:6797501C>T	ENST00000403107.1	+	2	580	c.193C>T	c.(193-195)Cag>Tag	p.Q65*	RSPH10B2_ENST00000404077.1_Nonsense_Mutation_p.Q65*|RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000297186.3_Nonsense_Mutation_p.Q65*|RSPH10B2_ENST00000433859.2_Nonsense_Mutation_p.Q65*			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	65										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CCAAAACGTTCAGCAGAACGA	0.493																																							uc003sqw.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(193-195)CAG>TAG		radial spoke head 10 homolog B							149.0	165.0	160.0					7																	6797501		2161	4263	6424	SO:0001587	stop_gained	728194							g.chr7:6797501C>T		CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.193C>T	7.37:g.6797501C>T	ENSP00000384766:p.Gln65*		Somatic				RSPH10B2_uc010ktk.1_Nonsense_Mutation_p.Q65*	p.Q65*	NM_173565	NP_775836	WXS	Illumina HiSeq	Unspecified	B2RC85	R10B2_HUMAN			3	464	+			65					A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Nonsense_Mutation	SNP	ENST00000403107.1	37	c.193C>T	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650023	0.67472	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	.	.	.	2.42	0.397	0.16314	.	1.150850	0.06885	U	0.803197	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	1.1477	0.01779	0.2276:0.4018:0.2236:0.147	.	.	.	.	X	65	.	ENSP00000297186:Q65X	Q	+	1	0	RSPH10B2	6764026	0.000000	0.05858	0.040000	0.18447	0.228000	0.25075	-0.382000	0.07408	-0.044000	0.13491	0.392000	0.25879	CAG		0.493	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697		61	196	0	0	0	0.00361	0	61	196				
DNAH11	8701	broad.mit.edu	37	7	21744058	21744058	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:21744058A>G	ENST00000409508.3	+	38	6311	c.6280A>G	c.(6280-6282)Atg>Gtg	p.M2094V	DNAH11_ENST00000328843.6_Missense_Mutation_p.M2101V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2101					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTAGGTACTCATGAGAGCATT	0.388									Kartagener syndrome																														uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(6301-6303)ATG>GTG		dynein, axonemal, heavy chain 11							49.0	49.0	49.0					7																	21744058		1878	4092	5970	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21744058A>G	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6280A>G	7.37:g.21744058A>G	ENSP00000475939:p.Met2094Val		Somatic					p.M2101V	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			39	6332	+			2101					Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.6301A>G		.	.	.	.	.	.	.	.	.	.	A	23.3	4.401144	0.83120	.	.	ENSG00000105877	ENST00000328843	T	0.23754	1.89	5.44	5.44	0.79542	.	0.458674	0.20781	N	0.085792	T	0.23727	0.0574	.	.	.	0.58432	D	0.999998	P	0.35959	0.53	B	0.29716	0.106	T	0.05178	-1.0901	9	0.87932	D	0	.	15.7688	0.78149	1.0:0.0:0.0:0.0	.	2101	Q96DT5	DYH11_HUMAN	V	2101	ENSP00000330671:M2101V	ENSP00000330671:M2101V	M	+	1	0	DNAH11	21710583	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.454000	0.80714	2.184000	0.69523	0.460000	0.39030	ATG		0.388	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		9	15	0	0	0	0.000443	0	9	15				
OSBPL3	26031	broad.mit.edu	37	7	24902839	24902839	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:24902839C>G	ENST00000313367.2	-	9	1301	c.850G>C	c.(850-852)Gat>Cat	p.D284H	OSBPL3_ENST00000431825.2_Intron|OSBPL3_ENST00000396429.1_Missense_Mutation_p.D284H|OSBPL3_ENST00000353930.1_Missense_Mutation_p.D284H|OSBPL3_ENST00000396431.1_Intron|OSBPL3_ENST00000352860.1_Intron|OSBPL3_ENST00000409069.1_Intron	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	284					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CCTTTAGCATCTTTGCCAATA	0.493																																							uc003sxf.2		NA																	0				skin(1)	1						c.(850-852)GAT>CAT		oxysterol-binding protein-like protein 3 isoform							159.0	129.0	139.0					7																	24902839		2203	4300	6503	SO:0001583	missense	26031				lipid transport		lipid binding|protein binding	g.chr7:24902839C>G	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.850G>C	7.37:g.24902839C>G	ENSP00000315410:p.Asp284His		Somatic				OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Missense_Mutation_p.D284H|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron|OSBPL3_uc003sxj.1_Missense_Mutation_p.D49H|OSBPL3_uc003sxk.1_Intron	p.D284H	NM_015550	NP_056365	WXS	Illumina HiSeq	Unspecified	Q9H4L5	OSBL3_HUMAN			9	1255	-			284					A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	ENST00000313367.2	37	c.850G>C	CCDS5390.1	.	.	.	.	.	.	.	.	.	.	C	32	5.173539	0.94807	.	.	ENSG00000070882	ENST00000313367;ENST00000353930;ENST00000396429	T;T;T	0.55052	1.96;0.54;0.54	5.87	5.87	0.94306	.	0.106893	0.64402	D	0.000006	T	0.71904	0.3395	M	0.67397	2.05	0.80722	D	1	D;P;D	0.69078	0.997;0.915;0.965	D;P;P	0.65684	0.937;0.808;0.761	T	0.72603	-0.4243	10	0.72032	D	0.01	-7.7632	20.2192	0.98319	0.0:1.0:0.0:0.0	.	284;284;284	Q9H4L5-7;Q9H4L5-3;Q9H4L5	.;.;OSBL3_HUMAN	H	284	ENSP00000315410:D284H;ENSP00000315277:D284H;ENSP00000379706:D284H	ENSP00000315410:D284H	D	-	1	0	OSBPL3	24869364	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.757000	0.68766	2.780000	0.95670	0.655000	0.94253	GAT		0.493	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2			33	40	0	0	0	0.004289	0	33	40				
CYCS	54205	broad.mit.edu	37	7	25163619	25163619	+	Silent	SNP	C	C	T	rs11548812		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:25163619C>T	ENST00000305786.2	-	2	289	c.120G>A	c.(118-120)aaG>aaA	p.K40K	CYCS_ENST00000409409.1_Silent_p.K40K|CYCS_ENST00000409764.1_Silent_p.K40K	NM_018947.5	NP_061820.1	P99999	CYC_HUMAN	cytochrome c, somatic	40					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|dephosphorylation (GO:0016311)|intrinsic apoptotic signaling pathway (GO:0097193)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	4					Minocycline(DB01017)	CCTGACCTGTCTTCCGCCCAA	0.443																																							uc003sxl.2		NA																	0				ovary(1)|lung(1)	2						c.(118-120)AAG>AAA		cytochrome c	Melatonin(DB01065)|Minocycline(DB01017)						61.0	64.0	63.0					7																	25163619		2203	4300	6503	SO:0001819	synonymous_variant	54205				activation of caspase activity by cytochrome c|DNA fragmentation involved in apoptotic nuclear change|induction of apoptosis by intracellular signals|respiratory electron transport chain|transport	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|mitochondrial matrix|nucleus|protein phosphatase type 2A complex|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding|protein binding	g.chr7:25163619C>T	M22877	CCDS5393.1	7p21.2	2014-09-17			ENSG00000172115	ENSG00000172115			19986	protein-coding gene	gene with protein product		123970				11790791	Standard	NM_018947		Approved	HCS, CYC	uc003sxl.3	P99999	OTTHUMG00000128495	ENST00000305786.2:c.120G>A	7.37:g.25163619C>T			Somatic					p.K40K	NM_018947	NP_061820	WXS	Illumina HiSeq	Unspecified	P99999	CYC_HUMAN			2	265	-			40					A4D166|B2R4I1|P00001|Q6NUR2|Q6NX69|Q96BV4	Silent	SNP	ENST00000305786.2	37	c.120G>A	CCDS5393.1																																																																																				0.443	CYCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250299.2			20	27	0	0	0	0.00278	0	20	27				
HNRNPA2B1	3181	broad.mit.edu	37	7	26236976	26236976	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:26236976C>G	ENST00000354667.4	-	4	427	c.259G>C	c.(259-261)Gat>Cat	p.D87H	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.D75H	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	87	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						ACTCTCCCATCAATTGAATGA	0.448			T	ETV1	prostate																																		uc003sxr.3		NA		Dom	yes		7	7p15	3181	T	heterogeneous nuclear ribonucleoprotein A2/B1			E	ETV1		prostate		0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(259-261)GAT>CAT		heterogeneous nuclear ribonucleoprotein A2/B1							209.0	184.0	192.0					7																	26236976		2203	4300	6503	SO:0001583	missense	3181				RNA transport	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|protein binding|RNA binding|single-stranded telomeric DNA binding	g.chr7:26236976C>G	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.259G>C	7.37:g.26236976C>G	ENSP00000346694:p.Asp87His		Somatic				HNRNPA2B1_uc003sxs.3_Missense_Mutation_p.D75H	p.D87H	NM_031243	NP_112533	WXS	Illumina HiSeq	Unspecified	P22626	ROA2_HUMAN			4	475	-			87			RRM 1.		A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	c.259G>C	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377805	0.61735	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	D;D	0.92965	-3.14;-3.14	6.07	5.19	0.71726	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000001	D	0.96463	0.8846	M	0.85197	2.74	0.51233	D	0.999914	D;D	0.89917	0.999;1.0	D;D	0.97110	0.952;1.0	D	0.97078	0.9782	10	0.87932	D	0	.	17.4012	0.87460	0.0:0.8753:0.1247:0.0	.	75;87	P22626-2;P22626	.;ROA2_HUMAN	H	87;75;75	ENSP00000346694:D87H;ENSP00000349101:D75H	ENSP00000346694:D87H	D	-	1	0	HNRNPA2B1	26203501	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	7.747000	0.85070	1.556000	0.49512	0.655000	0.94253	GAT		0.448	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137		12	127	0	0	0	0.000978	0	12	127				
AEBP1	165	broad.mit.edu	37	7	44151804	44151804	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:44151804G>A	ENST00000223357.3	+	17	2406	c.2101G>A	c.(2101-2103)Gat>Aat	p.D701N	AEBP1_ENST00000450684.2_Missense_Mutation_p.D276N|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	701	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CATCTTTGAAGATTTCCCGGA	0.582																																							uc003tkb.2		NA																	0					0						c.(2101-2103)GAT>AAT		adipocyte enhancer binding protein 1 precursor							81.0	81.0	81.0					7																	44151804		2203	4300	6503	SO:0001583	missense	165				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:44151804G>A	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2101G>A	7.37:g.44151804G>A	ENSP00000223357:p.Asp701Asn		Somatic				AEBP1_uc003tkc.3_Missense_Mutation_p.D276N|AEBP1_uc003tkd.2_Splice_Site	p.D701N	NM_001129	NP_001120	WXS	Illumina HiSeq	Unspecified	Q8IUX7	AEBP1_HUMAN			17	2406	+			701			Interaction with PTEN (By similarity).		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	c.2101G>A	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264687	0.59431	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.02158	4.42;4.42	5.12	4.22	0.49857	Peptidase M14, carboxypeptidase A (2);	0.064564	0.64402	D	0.000001	T	0.00695	0.0023	N	0.00599	-1.345	0.44366	D	0.997266	B;B	0.16603	0.005;0.018	B;B	0.25291	0.01;0.059	T	0.48681	-0.9014	10	0.02654	T	1	-52.2455	6.1554	0.20334	0.2511:0.0:0.7489:0.0	.	276;701	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	N	701;276	ENSP00000223357:D701N;ENSP00000398878:D276N	ENSP00000223357:D701N	D	+	1	0	AEBP1	44118329	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.290000	0.72712	2.538000	0.85594	0.462000	0.41574	GAT		0.582	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129		5	51	0	0	0	0.001984	0	5	51				
ZNF713	349075	broad.mit.edu	37	7	56007380	56007380	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:56007380G>C	ENST00000429591.2	+	4	1012	c.974G>C	c.(973-975)gGa>gCa	p.G325A	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ATTCATACTGGAGAAAAGCCC	0.408																																							uc003trc.1		NA																	0				ovary(2)	2						c.(973-975)GGA>GCA		zinc finger protein 713							91.0	98.0	95.0					7																	56007380		2203	4300	6503	SO:0001583	missense	349075				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:56007380G>C	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.974G>C	7.37:g.56007380G>C	ENSP00000416662:p.Gly325Ala		Somatic				ZNF713_uc003tra.1_Missense_Mutation_p.G338A|MRPS17_uc003trb.2_Intron	p.G325A	NM_182633	NP_872439	WXS	Illumina HiSeq	Unspecified	Q8N859	ZN713_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	1012	+	Breast(14;0.214)		325						Missense_Mutation	SNP	ENST00000429591.2	37	c.974G>C	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272318	0.40194	.	.	ENSG00000178665	ENST00000429591	T	0.26373	1.74	3.26	3.26	0.37387	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38436	N	0.001683	T	0.42966	0.1226	L	0.49126	1.545	0.49687	D	0.999811	D	0.89917	1.0	D	0.87578	0.998	T	0.40478	-0.9561	10	0.72032	D	0.01	.	12.8046	0.57605	0.0:0.0:1.0:0.0	.	325	Q8N859	ZN713_HUMAN	A	325	ENSP00000416662:G325A	ENSP00000416662:G325A	G	+	2	0	ZNF713	55974874	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	7.169000	0.77578	2.129000	0.65627	0.467000	0.42956	GGA		0.408	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633		4	109	0	0	0	0.000248	0	4	109				
ZNF716	441234	broad.mit.edu	37	7	57522864	57522864	+	Silent	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:57522864C>A	ENST00000420713.1	+	3	364	c.252C>A	c.(250-252)gcC>gcA	p.A84A		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	84	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						AGATGGTAGCCAAACACCCAG	0.443																																							uc011kdi.1		NA																	0				ovary(2)	2						c.(250-252)GCC>GCA		zinc finger protein 716							90.0	71.0	77.0					7																	57522864		692	1591	2283	SO:0001819	synonymous_variant	441234							g.chr7:57522864C>A	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.252C>A	7.37:g.57522864C>A			Somatic					p.A84A	NM_001159279	NP_001152751	WXS	Illumina HiSeq	Unspecified					3	364	+									Silent	SNP	ENST00000420713.1	37	c.252C>A	CCDS55112.1																																																																																				0.443	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		33	56	1	0	1.62565e-12	0.002445	3.70139e-12	33	56				
POM121C	100101267	broad.mit.edu	37	7	75051137	75051137	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:75051137C>A	ENST00000257665.5	-	11	3123	c.3124G>T	c.(3124-3126)Gtc>Ttc	p.V1042F	POM121C_ENST00000473168.1_5'Flank|POM121C_ENST00000453279.2_Missense_Mutation_p.V800F			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	1042	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						AAGGAGAAGACAGCAGTGGAG	0.657																																							uc003udk.3		NA																	0					0						c.(2398-2400)GTC>TTC		POM121 membrane glycoprotein (rat)-like							25.0	32.0	30.0					7																	75051137		2201	4298	6499	SO:0001583	missense	100101267				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding	g.chr7:75051137C>A		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.3124G>T	7.37:g.75051137C>A	ENSP00000257665:p.Val1042Phe		Somatic					p.V800F	NM_001099415	NP_001092885	WXS	Illumina HiSeq	Unspecified	A8CG34	P121C_HUMAN			13	3283	-			1042			Pore side (Potential).		O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000257665.5	37	c.2398G>T		.	.	.	.	.	.	.	.	.	.	C	9.348	1.064718	0.20067	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.20200	3.55;2.09	2.89	2.89	0.33648	.	0.000000	0.35708	N	0.003035	T	0.35998	0.0951	M	0.62723	1.935	0.09310	N	1	D	0.58620	0.983	P	0.59424	0.857	T	0.06427	-1.0827	10	0.59425	D	0.04	.	11.3405	0.49531	0.0:1.0:0.0:0.0	.	1042	A8CG34	P121C_HUMAN	F	1042;800	ENSP00000257665:V1042F;ENSP00000414208:V800F	ENSP00000257665:V1042F	V	-	1	0	POM121C	74889073	0.000000	0.05858	0.017000	0.16124	0.078000	0.17371	-0.038000	0.12144	1.606000	0.50161	0.404000	0.27445	GTC		0.657	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415		10	68	1	0	5.16669e-11	0.000978	1.15384e-10	10	68				
PCLO	27445	broad.mit.edu	37	7	82784235	82784235	+	Silent	SNP	T	T	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:82784235T>G	ENST00000333891.9	-	2	2059	c.1722A>C	c.(1720-1722)ccA>ccC	p.P574P	PCLO_ENST00000423517.2_Silent_p.P574P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTTTGCAGATGGAGACACTG	0.483																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(1720-1722)CCA>CCC		piccolo isoform 1							372.0	371.0	371.0					7																	82784235		2016	4173	6189	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82784235T>G	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1722A>C	7.37:g.82784235T>G			Somatic				PCLO_uc003uhv.2_Silent_p.P574P	p.P574P	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			2	2011	-			520			Pro-rich.			Silent	SNP	ENST00000333891.9	37	c.1722A>C	CCDS47630.1																																																																																				0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		137	231	0	0	0	0.00361	0	137	231				
NRCAM	4897	broad.mit.edu	37	7	107822364	107822364	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:107822364C>A	ENST00000425651.2	-	21	2547	c.2548G>T	c.(2548-2550)Ggg>Tgg	p.G850W	NRCAM_ENST00000379022.4_Missense_Mutation_p.G850W|NRCAM_ENST00000379028.3_Missense_Mutation_p.G850W|NRCAM_ENST00000351718.4_Missense_Mutation_p.G834W|NRCAM_ENST00000413765.2_Missense_Mutation_p.G831W|NRCAM_ENST00000379024.4_Missense_Mutation_p.G831W	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	850	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CGCACGTTCCCAGGAGCCACC	0.458																																							uc003vfb.2		NA																	0				ovary(3)|breast(2)	5						c.(2548-2550)GGG>TGG		neuronal cell adhesion molecule isoform A							85.0	72.0	77.0					7																	107822364		2203	4300	6503	SO:0001583	missense	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107822364C>A		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2548G>T	7.37:g.107822364C>A	ENSP00000401244:p.Gly850Trp		Somatic				NRCAM_uc003vfc.2_Missense_Mutation_p.G834W|NRCAM_uc011kmk.1_Missense_Mutation_p.G845W|NRCAM_uc003vfd.2_Missense_Mutation_p.G826W|NRCAM_uc003vfe.2_Missense_Mutation_p.G826W	p.G850W	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			24	3019	-			850			Fibronectin type-III 3.|Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	c.2548G>T	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473143	0.43942	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33	5.36	4.46	0.54185	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.270920	0.42172	D	0.000749	T	0.69387	0.3105	L	0.57536	1.79	0.45330	D	0.998322	D;D;P;P;D	0.61697	0.99;0.982;0.85;0.819;0.989	D;D;D;D;D	0.70227	0.934;0.956;0.961;0.934;0.968	T	0.71080	-0.4696	10	0.72032	D	0.01	.	11.2636	0.49097	0.0:0.8555:0.0:0.1445	.	850;831;831;834;850	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	W	850;850;831;850;834;831;850;850	ENSP00000368314:G850W;ENSP00000407858:G831W;ENSP00000325269:G834W;ENSP00000368310:G831W;ENSP00000401244:G850W;ENSP00000368308:G850W	ENSP00000325269:G834W	G	-	1	0	NRCAM	107609600	0.868000	0.29978	0.950000	0.38849	0.338000	0.28826	2.468000	0.45102	2.652000	0.90054	0.655000	0.94253	GGG		0.458	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		18	24	1	0	5.35267e-07	0.000958	1.0845e-06	18	24				
EIF3IP1	442720	broad.mit.edu	37	7	109599766	109599766	+	IGR	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:109599766A>T								AC073071.1 (362543 upstream) : AC003088.1 (472529 downstream)																							GCCTGCAATGATGCACTCCCC	0.488																																							uc003vfp.1		NA																	0					0						c.(331-333)ATC>AAC		Homo sapiens eukaryotic translation initiation factor 3, subunit I pseudogene 1 (EIF3IP1), non-coding RNA.																																				SO:0001628	intergenic_variant	442720							g.chr7:109599766A>T																													7.37:g.109599766A>T			Somatic					p.I111N	NR_003024		WXS	Illumina HiSeq	Unspecified					1	505	-									Missense_Mutation	SNP		37	c.332T>A																																																																																				0	0.488									11	31	0	0	0	0.001855	0	11	31				
GPR37	2861	broad.mit.edu	37	7	124386633	124386633	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:124386633G>C	ENST00000303921.2	-	2	2438	c.1788C>G	c.(1786-1788)ttC>ttG	p.F596L		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	596					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTATGGTACTGAAAGGCGAGA	0.453																																							uc003vli.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1786-1788)TTC>TTG		G protein-coupled receptor 37 precursor							186.0	163.0	171.0					7																	124386633		2203	4300	6503	SO:0001583	missense	2861					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity	g.chr7:124386633G>C		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1788C>G	7.37:g.124386633G>C	ENSP00000306449:p.Phe596Leu		Somatic					p.F596L	NM_005302	NP_005293	WXS	Illumina HiSeq	Unspecified	O15354	GPR37_HUMAN			2	2439	-			596			Cytoplasmic (Potential).		A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	c.1788C>G	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929278	0.52759	.	.	ENSG00000170775	ENST00000303921	T	0.71103	-0.54	5.35	-1.2	0.09554	.	0.000000	0.64402	D	0.000012	T	0.65943	0.2740	L	0.29908	0.895	0.43421	D	0.995574	D	0.55800	0.973	P	0.55055	0.767	T	0.64007	-0.6508	10	0.48119	T	0.1	-28.7318	11.3973	0.49849	0.4616:0.0:0.5384:0.0	.	596	O15354	GPR37_HUMAN	L	596	ENSP00000306449:F596L	ENSP00000306449:F596L	F	-	3	2	GPR37	124173869	1.000000	0.71417	0.838000	0.33150	0.565000	0.35776	0.676000	0.25247	-0.155000	0.11098	-0.150000	0.13652	TTC		0.453	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302		4	95	0	0	0	0.000602	0	4	95				
GRM8	2918	broad.mit.edu	37	7	126544084	126544084	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:126544084C>A	ENST00000339582.2	-	5	1768	c.960G>T	c.(958-960)caG>caT	p.Q320H	GRM8_ENST00000444921.2_Missense_Mutation_p.Q320H|GRM8_ENST00000405249.1_Missense_Mutation_p.Q320H|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000358373.3_Missense_Mutation_p.Q320H			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	320					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TCTCCTCTTGCTGATAGACAG	0.418										HNSCC(24;0.065)																													uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(958-960)CAG>CAT		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						72.0	77.0	75.0					7																	126544084		2203	4296	6499	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126544084C>A		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.960G>T	7.37:g.126544084C>A	ENSP00000344173:p.Gln320His	HNSCC(24;0.065)	Somatic				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.Q320H|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.Q41H	p.Q320H	NM_000845	NP_000836	WXS	Illumina HiSeq	Unspecified	O00222	GRM8_HUMAN			4	1271	-		Prostate(267;0.186)	320			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.960G>T	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576259	0.28092	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	5.03	0.587	0.17439	Extracellular ligand-binding receptor (1);	0.487128	0.21742	N	0.069807	T	0.68320	0.2988	L	0.31664	0.95	0.36785	D	0.88456	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.12837	0.007;0.001;0.008	T	0.57636	-0.7777	10	0.37606	T	0.19	.	4.9104	0.13820	0.1421:0.4043:0.0:0.4536	.	320;320;320	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	H	320	ENSP00000344173:Q320H;ENSP00000409790:Q320H;ENSP00000351142:Q320H;ENSP00000385731:Q320H	ENSP00000344173:Q320H	Q	-	3	2	GRM8	126331320	0.014000	0.17966	1.000000	0.80357	0.995000	0.86356	-0.446000	0.06837	0.188000	0.20168	0.508000	0.49915	CAG		0.418	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			24	46	1	0	1.80694e-10	0.001786	3.9844e-10	24	46				
ZC3HAV1	56829	broad.mit.edu	37	7	138768723	138768723	+	Missense_Mutation	SNP	G	G	C	rs376619498		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:138768723G>C	ENST00000242351.5	-	3	816	c.500C>G	c.(499-501)cCg>cGg	p.P167R	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.P167R|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.P167R	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	167	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TCTTGAACACGGTGGCTGCTG	0.507																																							uc003vun.2		NA																	0				ovary(1)	1						c.(499-501)CCG>CGG		zinc finger antiviral protein isoform 1							122.0	114.0	117.0					7																	138768723		2203	4300	6503	SO:0001583	missense	56829				response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding	g.chr7:138768723G>C	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.500C>G	7.37:g.138768723G>C	ENSP00000242351:p.Pro167Arg		Somatic				ZC3HAV1_uc003vup.2_Missense_Mutation_p.P167R	p.P167R	NM_020119	NP_064504	WXS	Illumina HiSeq	Unspecified	Q7Z2W4	ZCCHV_HUMAN			3	888	-			167			C3H1-type 3.		A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	c.500C>G	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	G	6.221	0.408825	0.11812	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.39592	1.07;1.07;1.07	4.38	-2.65	0.06095	.	2.027420	0.01793	N	0.032452	T	0.30885	0.0779	N	0.16478	0.41	0.09310	N	1	P;P	0.50443	0.935;0.903	P;B	0.48425	0.577;0.317	T	0.14783	-1.0460	10	0.41790	T	0.15	.	2.692	0.05123	0.0889:0.2696:0.2303:0.4112	.	167;167	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	R	167	ENSP00000242351:P167R;ENSP00000418385:P167R;ENSP00000419855:P167R	ENSP00000242351:P167R	P	-	2	0	ZC3HAV1	138419263	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.244000	0.08903	-0.303000	0.08856	-0.868000	0.02995	CCG		0.507	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119		12	26	0	0	0	0.001855	0	12	26				
ADCK2	90956	broad.mit.edu	37	7	140373967	140373967	+	Silent	SNP	T	T	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:140373967T>C	ENST00000072869.4	+	1	1015	c.837T>C	c.(835-837)ccT>ccC	p.P279P	ADCK2_ENST00000476491.1_Silent_p.P279P	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	279	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					TGCTCCTCCCTAAAGCTGACC	0.552																																							uc003vvy.1		NA																	0					0						c.(835-837)CCT>CCC		aarF domain containing kinase 2							58.0	65.0	63.0					7																	140373967		2203	4300	6503	SO:0001819	synonymous_variant	90956					integral to membrane	ATP binding|protein serine/threonine kinase activity	g.chr7:140373967T>C	AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.837T>C	7.37:g.140373967T>C			Somatic				ADCK2_uc003vvz.2_Silent_p.P279P	p.P279P	NM_052853	NP_443085	WXS	Illumina HiSeq	Unspecified	Q7Z695	ADCK2_HUMAN			1	1015	+	Melanoma(164;0.00956)		279			Protein kinase.		Q96CN6|Q9Y6T5	Silent	SNP	ENST00000072869.4	37	c.837T>C	CCDS5861.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.571176	0.28003	.	.	ENSG00000133597	ENST00000483369	.	.	.	4.21	-4.27	0.03744	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.9076	3.6988	0.08375	0.101:0.4046:0.1414:0.353	.	.	.	.	Q	117	.	.	X	+	1	0	ADCK2	140020436	0.002000	0.14202	0.013000	0.15412	0.501000	0.33797	-0.264000	0.08658	-0.362000	0.08113	-0.379000	0.06801	TAA		0.552	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348734.1	NM_052853		3	66	0	0	0	0.004672	0	3	66				
EPHB6	2051	broad.mit.edu	37	7	142567669	142567669	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:142567669G>A	ENST00000392957.2	+	17	3344	c.2557G>A	c.(2557-2559)Gaa>Aaa	p.E853K	EPHB6_ENST00000442129.1_Missense_Mutation_p.E853K|EPHB6_ENST00000411471.2_Missense_Mutation_p.E576K|EPHB6_ENST00000476059.1_3'UTR	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	853	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ACTCATGTGGGAAGTGATGAG	0.542																																							uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(2557-2559)GAA>AAA		ephrin receptor EphB6 precursor							149.0	120.0	130.0					7																	142567669		2203	4300	6503	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142567669G>A	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2557G>A	7.37:g.142567669G>A	ENSP00000376684:p.Glu853Lys		Somatic				EPHB6_uc011ksu.1_Missense_Mutation_p.E853K|EPHB6_uc003wbs.2_Missense_Mutation_p.E561K|EPHB6_uc003wbt.2_Missense_Mutation_p.E327K|EPHB6_uc003wbu.2_Missense_Mutation_p.E561K|EPHB6_uc003wbv.2_Missense_Mutation_p.E237K	p.E853K	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			17	3344	+	Melanoma(164;0.059)		853			Cytoplasmic (Potential).|Protein kinase.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.2557G>A	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	36	5.630309	0.96671	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	D;D;D	0.94576	-3.46;-3.46;-3.46	5.69	5.69	0.88448	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47852	D	0.000206	D	0.98745	0.9578	H	0.99590	4.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.99437	1.0937	10	0.87932	D	0	.	18.8176	0.92084	0.0:0.0:1.0:0.0	.	853;576	O15197;O15197-2	EPHB6_HUMAN;.	K	853;853;576	ENSP00000376684:E853K;ENSP00000410789:E853K;ENSP00000409061:E576K	ENSP00000376684:E853K	E	+	1	0	EPHB6	142277791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.685000	0.98661	2.682000	0.91365	0.563000	0.77884	GAA		0.542	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			4	34	0	0	0	0.000248	0	4	34				
ZNF212	7988	broad.mit.edu	37	7	148950880	148950880	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr7:148950880C>G	ENST00000335870.2	+	5	990	c.862C>G	c.(862-864)Ccg>Gcg	p.P288A		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			TGTGGGCTGCCCGAAGCAGAA	0.547																																							uc003wfp.2		NA																	0				ovary(1)	1						c.(862-864)CCG>GCG		zinc finger protein 212							73.0	75.0	75.0					7																	148950880		2203	4300	6503	SO:0001583	missense	7988				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr7:148950880C>G	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.862C>G	7.37:g.148950880C>G	ENSP00000338572:p.Pro288Ala		Somatic					p.P288A	NM_012256	NP_036388	WXS	Illumina HiSeq	Unspecified	Q9UDV6	ZN212_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00171)		5	958	+	Melanoma(164;0.15)		288					B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	37	c.862C>G	CCDS5896.1	.	.	.	.	.	.	.	.	.	.	C	1.205	-0.631325	0.03584	.	.	ENSG00000170260	ENST00000335870	T	0.06849	3.25	5.52	1.74	0.24563	.	0.844418	0.10347	N	0.685600	T	0.06096	0.0158	L	0.29908	0.895	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.45131	-0.9282	10	0.23891	T	0.37	-1.0718	6.1893	0.20516	0.0:0.6423:0.1353:0.2224	.	288	Q9UDV6	ZN212_HUMAN	A	288	ENSP00000338572:P288A	ENSP00000338572:P288A	P	+	1	0	ZNF212	148581813	0.000000	0.05858	0.003000	0.11579	0.024000	0.10985	-0.692000	0.05127	0.044000	0.15775	-0.176000	0.13171	CCG		0.547	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256		25	36	0	0	0	0.00333	0	25	36				
RP1L1	94137	broad.mit.edu	37	8	10465978	10465978	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:10465978G>T	ENST00000382483.3	-	4	5853	c.5630C>A	c.(5629-5631)cCa>cAa	p.P1877Q		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1957					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTCTGCCTCTGGGGCCTCTAC	0.622																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(5629-5631)CCA>CAA		retinitis pigmentosa 1-like 1							160.0	175.0	171.0					8																	10465978		1920	4138	6058	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10465978G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5630C>A	8.37:g.10465978G>T	ENSP00000371923:p.Pro1877Gln		Somatic					p.P1877Q	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5859	-			1877					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.5630C>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.661169	0.00772	.	.	ENSG00000183638	ENST00000382483	T	0.18016	2.24	1.24	-2.47	0.06442	.	.	.	.	.	T	0.04227	0.0117	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32214	-0.9915	9	0.07813	T	0.8	.	3.8269	0.08858	0.0:0.1945:0.2623:0.5433	.	1877	A6NKC6	.	Q	1877	ENSP00000371923:P1877Q	ENSP00000371923:P1877Q	P	-	2	0	RP1L1	10503388	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-3.404000	0.00482	-1.913000	0.01079	-2.311000	0.00256	CCA		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			125	159	1	0	7.82854e-59	0.00361	2.0572e-58	125	159				
RP1L1	94137	broad.mit.edu	37	8	10466795	10466795	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:10466795G>C	ENST00000382483.3	-	4	5036	c.4813C>G	c.(4813-4815)Cag>Gag	p.Q1605E		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1685					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGTCTGCGCTGCTGGGTCTGC	0.692																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4813-4815)CAG>GAG		retinitis pigmentosa 1-like 1							12.0	16.0	15.0					8																	10466795		1966	4160	6126	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10466795G>C	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4813C>G	8.37:g.10466795G>C	ENSP00000371923:p.Gln1605Glu		Somatic					p.Q1605E	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5042	-			1605					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.4813C>G	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	8.901	0.956313	0.18507	.	.	ENSG00000183638	ENST00000382483	T	0.07114	3.22	4.66	4.66	0.58398	.	.	.	.	.	T	0.08223	0.0205	L	0.32530	0.975	0.09310	N	0.999992	P	0.42692	0.787	B	0.40134	0.32	T	0.26643	-1.0097	9	0.32370	T	0.25	-19.3393	12.194	0.54286	0.0:0.1726:0.8274:0.0	.	1605	A6NKC6	.	E	1605	ENSP00000371923:Q1605E	ENSP00000371923:Q1605E	Q	-	1	0	RP1L1	10504205	0.998000	0.40836	0.969000	0.41365	0.047000	0.14425	1.474000	0.35398	2.407000	0.81776	0.491000	0.48974	CAG		0.692	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			9	9	0	0	0	0.000673	0	9	9				
RP1L1	94137	broad.mit.edu	37	8	10470341	10470341	+	Silent	SNP	G	G	T	rs375440665		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:10470341G>T	ENST00000382483.3	-	4	1490	c.1267C>A	c.(1267-1269)Cgg>Agg	p.R423R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	423					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CACCTCTTCCGAGCTGCCACT	0.667																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1267-1269)CGG>AGG		retinitis pigmentosa 1-like 1							31.0	37.0	35.0					8																	10470341		1970	4142	6112	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10470341G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1267C>A	8.37:g.10470341G>T			Somatic					p.R423R	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1496	-			423					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.1267C>A	CCDS43708.1																																																																																				0.667	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			4	68	1	0	0.00024832	0.000248	0.000483498	4	68				
CHRNA2	1135	broad.mit.edu	37	8	27320615	27320615	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:27320615G>A	ENST00000520933.2	-	5	1498	c.1345C>T	c.(1345-1347)Ccc>Tcc	p.P449S	CHRNA2_ENST00000240132.2_Missense_Mutation_p.P434S|CHRNA2_ENST00000407991.1_Missense_Mutation_p.P449S			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	449					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	TCAGCCTTGGGACCTGAGGCC	0.642																																							uc010lur.2		NA																	0				ovary(1)	1						c.(1345-1347)CCC>TCC		cholinergic receptor, nicotinic, alpha	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Gallamine Triethiodide(DB00483)|Levallorphan(DB00504)|Mecamylamine(DB00657)|Metocurine(DB01336)|Metocurine Iodide(DB00416)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Rocuronium(DB00728)|Tubocurarine(DB01199)						81.0	72.0	75.0					8																	27320615		2203	4300	6503	SO:0001583	missense	1135					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr8:27320615G>A	U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.1345C>T	8.37:g.27320615G>A	ENSP00000429616:p.Pro449Ser		Somatic				CHRNA2_uc011lal.1_Missense_Mutation_p.P434S|CHRNA2_uc010lus.2_Missense_Mutation_p.P251S	p.P449S	NM_000742	NP_000733	WXS	Illumina HiSeq	Unspecified	Q15822	ACHA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	6	1954	-		Ovarian(32;2.61e-05)	449			Cytoplasmic.		A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	ENST00000520933.2	37	c.1345C>T	CCDS6059.1	.	.	.	.	.	.	.	.	.	.	G	0.226	-1.024951	0.02061	.	.	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132	D;D;D	0.84442	-1.85;-1.85;-1.85	4.66	0.413	0.16401	Neurotransmitter-gated ion-channel transmembrane domain (2);	7739.210000	0.00166	N	0.000000	T	0.65749	0.2721	N	0.02985	-0.445	0.09310	N	0.99999	B;B	0.10296	0.003;0.0	B;B	0.11329	0.006;0.006	T	0.59144	-0.7509	10	0.14252	T	0.57	.	3.9948	0.09553	0.3158:0.3479:0.3363:0.0	.	434;449	B4DK19;Q15822	.;ACHA2_HUMAN	S	449;449;434	ENSP00000385026:P449S;ENSP00000429616:P449S;ENSP00000240132:P434S	ENSP00000240132:P434S	P	-	1	0	CHRNA2	27376532	0.000000	0.05858	0.004000	0.12327	0.042000	0.13812	-0.344000	0.07780	0.186000	0.20125	0.462000	0.41574	CCC		0.642	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4			33	34	0	0	0	0.002096	0	33	34				
ELP3	55140	broad.mit.edu	37	8	27957430	27957430	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:27957430C>T	ENST00000256398.8	+	3	582	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	ELP3_ENST00000542181.1_Intron|ELP3_ENST00000524103.1_5'UTR|ELP3_ENST00000521015.1_Missense_Mutation_p.R55C|ELP3_ENST00000523760.1_3'UTR|ELP3_ENST00000537665.1_5'UTR|ELP3_ENST00000380353.4_Intron	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	69					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		TCCTCAGTATCGCAAGGTCTT	0.507																																							uc003xgo.3		NA																	0					0						c.(205-207)CGC>TGC		elongation protein 3 homolog							141.0	118.0	126.0					8																	27957430		2203	4300	6503	SO:0001583	missense	55140				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding	g.chr8:27957430C>T		CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.205C>T	8.37:g.27957430C>T	ENSP00000256398:p.Arg69Cys		Somatic				ELP3_uc003xgn.3_Missense_Mutation_p.R54C|ELP3_uc011laq.1_5'UTR|ELP3_uc011lar.1_Intron|ELP3_uc011las.1_5'UTR|ELP3_uc011lat.1_Intron	p.R69C	NM_018091	NP_060561	WXS	Illumina HiSeq	Unspecified	Q9H9T3	ELP3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)	3	353	+		Ovarian(32;0.0218)	69					B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	ENST00000256398.8	37	c.205C>T	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579706	0.86645	.	.	ENSG00000134014	ENST00000520270;ENST00000521015;ENST00000521570;ENST00000256398;ENST00000524024;ENST00000520288;ENST00000521099	.	.	.	5.33	5.33	0.75918	.	0.056320	0.64402	D	0.000001	D	0.83041	0.5168	M	0.90814	3.15	0.80722	D	1	D	0.64830	0.994	P	0.58873	0.847	D	0.86705	0.1932	9	0.87932	D	0	-1.6312	16.8682	0.86034	0.0:1.0:0.0:0.0	.	69	Q9H9T3	ELP3_HUMAN	C	55;55;55;69;69;55;55	.	ENSP00000256398:R69C	R	+	1	0	ELP3	28013349	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.174000	0.58256	2.657000	0.90304	0.591000	0.81541	CGC		0.507	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091		6	77	0	0	0	0.001168	0	6	77				
PXDNL	137902	broad.mit.edu	37	8	52336233	52336233	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:52336233G>A	ENST00000356297.4	-	14	1797	c.1697C>T	c.(1696-1698)aCt>aTt	p.T566I	PXDNL_ENST00000543296.1_Missense_Mutation_p.T566I	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	566	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTCGTAGATAGTCAGCGTGCC	0.483																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(1696-1698)ACT>ATT		peroxidasin homolog-like precursor							121.0	131.0	128.0					8																	52336233		2171	4275	6446	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52336233G>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1697C>T	8.37:g.52336233G>A	ENSP00000348645:p.Thr566Ile		Somatic					p.T566I	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			14	1798	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	566			Ig-like C2-type 4.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1697C>T	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	4.472	0.087489	0.08583	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69040	-0.37;-0.37	3.93	2.07	0.26955	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45236	0.1332	N	0.04260	-0.245	0.09310	N	1	B	0.29909	0.261	B	0.40329	0.326	T	0.43426	-0.9392	9	0.22706	T	0.39	.	4.8178	0.13376	0.1166:0.0:0.6719:0.2115	.	566	A1KZ92	PXDNL_HUMAN	I	566	ENSP00000348645:T566I;ENSP00000444865:T566I	ENSP00000348645:T566I	T	-	2	0	PXDNL	52498786	0.606000	0.26949	0.001000	0.08648	0.003000	0.03518	1.585000	0.36600	0.237000	0.21200	0.650000	0.86243	ACT		0.483	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		13	22	0	0	0	0.001368	0	13	22				
CNGB3	54714	broad.mit.edu	37	8	87588277	87588277	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:87588277C>G	ENST00000320005.5	-	18	2232	c.2185G>C	c.(2185-2187)Gaa>Caa	p.E729Q		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	729					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.E729fs*3(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						tcttcattttctttttgttta	0.343																																							uc003ydx.2		NA																	1	Insertion - Frameshift(1)		large_intestine(1)	ovary(2)|pancreas(1)	3						c.(2185-2187)GAA>CAA		cyclic nucleotide gated channel beta 3							118.0	122.0	121.0					8																	87588277		2203	4300	6503	SO:0001583	missense	54714				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr8:87588277C>G	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.2185G>C	8.37:g.87588277C>G	ENSP00000316605:p.Glu729Gln		Somatic				CNGB3_uc010maj.2_Missense_Mutation_p.E586Q	p.E729Q	NM_019098	NP_061971	WXS	Illumina HiSeq	Unspecified	Q9NQW8	CNGB3_HUMAN			18	2231	-			729			Cytoplasmic (Potential).		C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	c.2185G>C	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	C	4.436	0.080695	0.08533	.	.	ENSG00000170289	ENST00000320005	T	0.61980	0.06	0.637	0.637	0.17735	.	1.973700	0.02514	U	0.091852	T	0.36248	0.0960	N	0.08118	0	0.09310	N	1	P;P	0.40619	0.724;0.604	B;B	0.31614	0.133;0.063	T	0.35151	-0.9800	10	0.19590	T	0.45	.	6.7377	0.23419	0.0:1.0:0.0:0.0	.	724;729	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	Q	729	ENSP00000316605:E729Q	ENSP00000316605:E729Q	E	-	1	0	CNGB3	87657393	0.998000	0.40836	0.004000	0.12327	0.009000	0.06853	0.391000	0.20784	0.615000	0.30124	0.467000	0.42956	GAA		0.343	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		15	23	0	0	0	0.00245	0	15	23				
CDH17	1015	broad.mit.edu	37	8	95164106	95164106	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:95164106G>T	ENST00000027335.3	-	13	1910	c.1786C>A	c.(1786-1788)Ctg>Atg	p.L596M	CDH17_ENST00000450165.2_Missense_Mutation_p.L596M|CDH17_ENST00000441892.2_Missense_Mutation_p.L382M	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CTTATGTCCAGACCTTCTGGA	0.547																																							uc003ygh.2		NA																	0				ovary(5)|skin(1)	6						c.(1786-1788)CTG>ATG		cadherin 17 precursor							154.0	111.0	126.0					8																	95164106		2203	4300	6503	SO:0001583	missense	1015					integral to membrane	calcium ion binding	g.chr8:95164106G>T	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1786C>A	8.37:g.95164106G>T	ENSP00000027335:p.Leu596Met		Somatic				CDH17_uc011lgo.1_Missense_Mutation_p.L382M|CDH17_uc011lgp.1_Missense_Mutation_p.L596M	p.L596M	NM_004063	NP_004054	WXS	Illumina HiSeq	Unspecified	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)		13	1911	-	Breast(36;4.65e-06)		596			Cadherin 6.|Extracellular (Potential).		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	c.1786C>A	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624325	0.46840	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.51574	0.7;0.7;0.7	5.72	2.93	0.34026	Cadherin (4);Cadherin-like (1);	0.000000	0.43416	D	0.000561	T	0.56688	0.2002	L	0.57536	1.79	0.09310	N	1	D;D	0.69078	0.991;0.997	D;D	0.67231	0.95;0.949	T	0.43798	-0.9369	10	0.56958	D	0.05	-12.7535	5.7217	0.17990	0.2444:0.1457:0.6099:0.0	.	382;596	E7EN24;Q12864	.;CAD17_HUMAN	M	596;382;596	ENSP00000027335:L596M;ENSP00000392811:L382M;ENSP00000401468:L596M	ENSP00000027335:L596M	L	-	1	2	CDH17	95233282	0.006000	0.16342	0.979000	0.43373	0.963000	0.63663	0.500000	0.22562	0.885000	0.36088	0.655000	0.94253	CTG		0.547	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		25	48	1	0	2.65835e-16	0.001271	6.38551e-16	25	48				
DCSTAMP	81501	broad.mit.edu	37	8	105361554	105361554	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:105361554G>C	ENST00000297581.2	+	2	823	c.774G>C	c.(772-774)gaG>gaC	p.E258D	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.E258D|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	258					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											ATGAAAGGGAGAGACATCAAC	0.463																																							uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(772-774)GAG>GAC		dendritic cell-specific transmembrane protein							95.0	93.0	94.0					8																	105361554		2203	4300	6503	SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105361554G>C	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.774G>C	8.37:g.105361554G>C	ENSP00000297581:p.Glu258Asp		Somatic					p.E258D	NM_030788	NP_110415	WXS	Illumina HiSeq	Unspecified	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	823	+			258					B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	c.774G>C	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698045	0.48307	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T;T	0.31510	1.49;1.49	5.5	5.5	0.81552	Dendritic cell-specific transmembrane protein-like (1);	0.212263	0.43260	D	0.000586	T	0.35364	0.0929	M	0.75447	2.3	0.34781	D	0.734704	P	0.43231	0.801	B	0.40741	0.339	T	0.54186	-0.8331	9	.	.	.	-14.5028	11.3789	0.49746	0.09:0.0:0.91:0.0	.	258	Q9H295	TM7S4_HUMAN	D	258	ENSP00000297581:E258D;ENSP00000428869:E258D	.	E	+	3	2	TM7SF4	105430730	1.000000	0.71417	0.390000	0.26220	0.290000	0.27261	2.102000	0.41796	2.590000	0.87494	0.555000	0.69702	GAG		0.463	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		4	82	0	0	0	0.000248	0	4	82				
CSMD3	114788	broad.mit.edu	37	8	113662525	113662525	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:113662525G>T	ENST00000297405.5	-	19	3302	c.3058C>A	c.(3058-3060)Cgt>Agt	p.R1020S	CSMD3_ENST00000352409.3_Missense_Mutation_p.R1020S|CSMD3_ENST00000343508.3_Missense_Mutation_p.R980S|CSMD3_ENST00000455883.2_Missense_Mutation_p.R916S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1020	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCATAGCGACGGCCATGTACA	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(3058-3060)CGT>AGT		CUB and Sushi multiple domains 3 isoform 1							138.0	138.0	138.0					8																	113662525		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113662525G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3058C>A	8.37:g.113662525G>T	ENSP00000297405:p.Arg1020Ser	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.R292S|CSMD3_uc003ynt.2_Missense_Mutation_p.R980S|CSMD3_uc011lhx.1_Missense_Mutation_p.R916S	p.R1020S	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			19	3217	-			1020			Extracellular (Potential).|Sushi 5.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.3058C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470469	0.26423	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	6.08	6.08	0.98989	Complement control module (2);Sushi/SCR/CCP (3);	0.354098	0.27735	N	0.018064	T	0.53110	0.1776	N	0.11284	0.12	0.32146	N	0.584878	B;B;P	0.36065	0.413;0.322;0.535	B;B;P	0.45474	0.229;0.258;0.482	T	0.49322	-0.8952	10	0.09590	T	0.72	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	916;1020;980	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	980;1020;360;916;1020	ENSP00000345799:R980S;ENSP00000297405:R1020S;ENSP00000341558:R360S;ENSP00000412263:R916S;ENSP00000343124:R1020S	ENSP00000297405:R1020S	R	-	1	0	CSMD3	113731701	0.903000	0.30736	1.000000	0.80357	0.711000	0.40976	4.358000	0.59442	2.894000	0.99253	0.655000	0.94253	CGT		0.423	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		34	50	1	0	6.53348e-20	0.003755	1.61375e-19	34	50				
ZHX2	22882	broad.mit.edu	37	8	123963987	123963987	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr8:123963987G>T	ENST00000314393.4	+	3	1072	c.237G>T	c.(235-237)gaG>gaT	p.E79D		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	79					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GTGGTTATGAGTGCAAATACT	0.483																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	Esophageal Squamous(94;1056 1388 11767 13799 49639)	uc003ypk.1		NA																	0				ovary(1)|skin(1)	2						c.(235-237)GAG>GAT		zinc fingers and homeoboxes 2							81.0	75.0	77.0					8																	123963987		2203	4300	6503	SO:0001583	missense	22882					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:123963987G>T	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.237G>T	8.37:g.123963987G>T	ENSP00000314709:p.Glu79Asp		Somatic					p.E79D	NM_014943	NP_055758	WXS	Illumina HiSeq	Unspecified	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	804	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		79			C2H2-type 1.			Missense_Mutation	SNP	ENST00000314393.4	37	c.237G>T	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106375	0.56291	.	.	ENSG00000178764	ENST00000314393	T	0.54071	0.59	5.56	-6.68	0.01778	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.69061	0.3069	M	0.78637	2.42	0.39739	D	0.971723	D	0.76494	0.999	D	0.78314	0.991	T	0.76130	-0.3072	10	0.72032	D	0.01	-20.4076	20.3414	0.98768	0.2414:0.0:0.7586:0.0	.	79	Q9Y6X8	ZHX2_HUMAN	D	79	ENSP00000314709:E79D	ENSP00000314709:E79D	E	+	3	2	ZHX2	124033168	0.902000	0.30710	0.388000	0.26195	0.925000	0.55904	0.082000	0.14847	-1.336000	0.02238	-0.391000	0.06502	GAG		0.483	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943		24	35	1	0	3.01185e-09	0.003954	6.37964e-09	24	35				
C9orf72	203228	broad.mit.edu	37	9	27556654	27556654	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:27556654C>T	ENST00000380003.3	-	8	1059	c.996G>A	c.(994-996)atG>atA	p.M332I	C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	332					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GCTCGGATCTCATGTATCTAC	0.448																																							uc003zqq.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(994-996)ATG>ATA		hypothetical protein LOC203228 isoform a							167.0	154.0	158.0					9																	27556654		2203	4300	6503	SO:0001583	missense	203228							g.chr9:27556654C>T	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.996G>A	9.37:g.27556654C>T	ENSP00000369339:p.Met332Ile		Somatic					p.M332I	NM_018325	NP_060795	WXS	Illumina HiSeq	Unspecified	Q96LT7	CI072_HUMAN		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)	8	1093	-		all_neural(11;7.57e-10)	332					A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	c.996G>A	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116737	0.77323	.	.	ENSG00000147894	ENST00000380003	T	0.44482	0.92	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	L	0.51422	1.61	0.80722	D	1	B	0.33171	0.4	B	0.33042	0.157	T	0.15954	-1.0419	9	.	.	.	.	20.0308	0.97536	0.0:1.0:0.0:0.0	.	332	Q96LT7	CI072_HUMAN	I	332	ENSP00000369339:M332I	.	M	-	3	0	C9orf72	27546654	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.732000	0.93576	0.585000	0.79938	ATG		0.448	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325		50	23	0	0	0	0.00361	0	50	23				
TAF1L	138474	broad.mit.edu	37	9	32634692	32634692	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:32634692C>T	ENST00000242310.4	-	1	975	c.886G>A	c.(886-888)Gag>Aag	p.E296K	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	296					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CATTCCACCTCCTGGATCTGC	0.502																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(886-888)GAG>AAG		TBP-associated factor RNA polymerase 1-like							174.0	161.0	165.0					9																	32634692		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32634692C>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.886G>A	9.37:g.32634692C>T	ENSP00000418379:p.Glu296Lys		Somatic				uc003zrh.1_RNA	p.E296K	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	976	-			296					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.886G>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957312	0.53400	.	.	ENSG00000122728	ENST00000242310	T	0.08634	3.07	1.04	1.04	0.20106	.	0.213189	0.48286	D	0.000189	T	0.03220	0.0094	N	0.08118	0	0.35784	D	0.821907	B	0.02656	0.0	B	0.04013	0.001	T	0.42882	-0.9425	10	0.09843	T	0.71	.	7.4859	0.27432	0.0:1.0:0.0:0.0	.	296	Q8IZX4	TAF1L_HUMAN	K	296	ENSP00000418379:E296K	ENSP00000418379:E296K	E	-	1	0	TAF1L	32624692	0.999000	0.42202	0.992000	0.48379	0.805000	0.45488	3.399000	0.52586	0.507000	0.28148	0.195000	0.17529	GAG		0.502	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			5	76	0	0	0	0.001984	0	5	76				
UBAP2	55833	broad.mit.edu	37	9	33953410	33953410	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:33953410G>A	ENST00000379238.1	-	12	1046	c.929C>T	c.(928-930)tCc>tTc	p.S310F	UBAP2_ENST00000360802.1_Missense_Mutation_p.S310F|SNORD121A_ENST00000459386.1_RNA|UBAP2_ENST00000379239.4_Missense_Mutation_p.S43F|UBAP2_ENST00000539807.1_Missense_Mutation_p.S65F|UBAP2_ENST00000418786.2_Missense_Mutation_p.S257F|UBAP2_ENST00000449054.1_Missense_Mutation_p.S310F					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		AGTTTCAAAGGAGTTGGCTTC	0.507																																							uc003ztq.1		NA																	0				ovary(3)	3						c.(928-930)TCC>TTC		ubiquitin associated protein 2							101.0	97.0	98.0					9																	33953410		2203	4300	6503	SO:0001583	missense	55833							g.chr9:33953410G>A	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.929C>T	9.37:g.33953410G>A	ENSP00000368540:p.Ser310Phe		Somatic				UBAP2_uc011loc.1_Missense_Mutation_p.S219F|UBAP2_uc011lod.1_Missense_Mutation_p.S43F|UBAP2_uc011loe.1_Missense_Mutation_p.S65F|UBAP2_uc011lof.1_Missense_Mutation_p.S235F|UBAP2_uc011log.1_Missense_Mutation_p.S256F|UBAP2_uc003ztr.2_Missense_Mutation_p.S182F|SNORD121A_uc010mjz.2_5'Flank	p.S310F	NM_018449	NP_060919	WXS	Illumina HiSeq	Unspecified	Q5T6F2	UBAP2_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)	12	1042	-			310						Missense_Mutation	SNP	ENST00000379238.1	37	c.929C>T	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525776	0.85600	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000412543;ENST00000421278	T;T;T;T;T;T;T	0.34072	2.58;2.58;2.58;2.34;2.38;2.07;1.38	5.85	5.85	0.93711	.	0.263447	0.45361	D	0.000372	T	0.60676	0.2287	M	0.62723	1.935	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	0.998;1.0;0.993;0.993;0.993;1.0;0.999	D;D;P;P;P;D;D	0.76575	0.93;0.988;0.837;0.884;0.837;0.972;0.972	T	0.59359	-0.7469	10	0.62326	D	0.03	-19.5707	20.1597	0.98130	0.0:0.0:1.0:0.0	.	257;235;65;43;219;235;310	E7EWG4;F5H4D5;F5H2U4;A6NCA8;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;.;.;UBAP2_HUMAN	F	310;310;310;219;228;43;65;257;257;164	ENSP00000368540:S310F;ENSP00000416932:S310F;ENSP00000354039:S310F;ENSP00000368541:S43F;ENSP00000439329:S65F;ENSP00000404436:S257F;ENSP00000414800:S257F	ENSP00000354039:S310F	S	-	2	0	UBAP2	33943410	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	5.367000	0.66127	2.763000	0.94921	0.505000	0.49811	TCC		0.507	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449		4	27	0	0	0	0.000248	0	4	27				
MAMDC2	256691	broad.mit.edu	37	9	72755089	72755089	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:72755089C>A	ENST00000377182.4	+	8	1640	c.1023C>A	c.(1021-1023)agC>agA	p.S341R	MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	341	MAM 3. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						TGGAAGCCAGCTGCAATTTTG	0.448																																							uc004ahm.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1021-1023)AGC>AGA		MAM domain containing 2 precursor							123.0	117.0	119.0					9																	72755089		2203	4300	6503	SO:0001583	missense	256691					endoplasmic reticulum|membrane		g.chr9:72755089C>A	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1023C>A	9.37:g.72755089C>A	ENSP00000366387:p.Ser341Arg		Somatic				MAMDC2_uc004ahn.2_RNA	p.S341R	NM_153267	NP_694999	WXS	Illumina HiSeq	Unspecified	Q7Z304	MAMC2_HUMAN			8	1640	+			341			MAM 3.		Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	ENST00000377182.4	37	c.1023C>A	CCDS6631.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261182	0.59431	.	.	ENSG00000165072	ENST00000377182	T	0.02236	4.38	6.01	6.01	0.97437	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.156215	0.64402	D	0.000001	T	0.03739	0.0106	L	0.50333	1.59	0.38965	D	0.958634	P	0.49090	0.919	P	0.47075	0.536	T	0.57528	-0.7796	10	0.16420	T	0.52	-32.4281	9.547	0.39286	0.1428:0.7868:0.0:0.0704	.	341	Q7Z304	MAMC2_HUMAN	R	341	ENSP00000366387:S341R	ENSP00000366387:S341R	S	+	3	2	MAMDC2	71944909	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	1.281000	0.33214	2.861000	0.98227	0.650000	0.86243	AGC		0.448	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267		33	48	1	0	1.21669e-08	0.003271	2.54631e-08	33	48				
PRUNE2	158471	broad.mit.edu	37	9	79321336	79321336	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:79321336C>T	ENST00000376718.3	-	8	5977	c.5854G>A	c.(5854-5856)Gaa>Aaa	p.E1952K	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E1593K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1952					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GTAGGTGTTTCAGGAGTCAGC	0.463																																							uc010mpk.2		NA																	0					0						c.(5854-5856)GAA>AAA		prune homolog 2							112.0	99.0	103.0					9																	79321336		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79321336C>T	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5854G>A	9.37:g.79321336C>T	ENSP00000365908:p.Glu1952Lys		Somatic				PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	p.E1952K	NM_015225	NP_056040	WXS	Illumina HiSeq	Unspecified	Q8WUY3	PRUN2_HUMAN			8	5978	-			1952					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.5854G>A	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	7.004	0.555428	0.13436	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.45668	0.89;0.89	6.04	5.13	0.70059	.	0.105490	0.42682	D	0.000679	T	0.31827	0.0809	L	0.46157	1.445	0.29375	N	0.86372	B	0.32071	0.355	B	0.28638	0.092	T	0.23833	-1.0177	10	0.38643	T	0.18	-19.9674	7.5001	0.27513	0.0:0.7065:0.1514:0.1421	.	1952	Q8WUY3	PRUN2_HUMAN	K	1952;1593;1951	ENSP00000365908:E1952K;ENSP00000397425:E1593K	ENSP00000365908:E1952K	E	-	1	0	PRUNE2	78511156	0.586000	0.26782	0.837000	0.33122	0.045000	0.14185	1.580000	0.36547	2.873000	0.98535	0.561000	0.74099	GAA		0.463	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		5	92	0	0	0	0.001168	0	5	92				
SPTAN1	6709	broad.mit.edu	37	9	131371197	131371197	+	Silent	SNP	C	C	T	rs367772623		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:131371197C>T	ENST00000372731.4	+	35	4646	c.4536C>T	c.(4534-4536)atC>atT	p.I1512I	SPTAN1_ENST00000358161.5_Silent_p.I1512I|SPTAN1_ENST00000372739.3_Silent_p.I1512I	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1512					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ACCAGCTCATCGCTGCCGGCC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		19188	0.0		0.001	False		,,,				2504	0.0				NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	0				breast(5)|ovary(4)|pancreas(1)	10						c.(4534-4536)ATC>ATT		spectrin, alpha, non-erythrocytic 1		C	,,	1,4405	2.1+/-5.4	0,1,2202	174.0	178.0	177.0		4536,4476,4536	-5.6	0.2	9		177	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	SPTAN1	NM_001130438.2,NM_001195532.1,NM_003127.3	,,	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	,,	1512/2478,1492/2453,1512/2473	131371197	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131371197C>T	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4536C>T	9.37:g.131371197C>T			Somatic				SPTAN1_uc004bvm.3_Silent_p.I1512I|SPTAN1_uc004bvn.3_Silent_p.I1492I	p.I1512I	NM_003127	NP_003118	WXS	Illumina HiSeq	Unspecified	Q13813	SPTA2_HUMAN			35	4649	+			1512			Spectrin 16.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	c.4536C>T	CCDS6905.1																																																																																				0.577	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		9	230	0	0	0	0.000443	0	9	230				
C9orf171	389799	broad.mit.edu	37	9	135285781	135285781	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:135285781C>T	ENST00000343036.2	+	1	171	c.123C>T	c.(121-123)atC>atT	p.I41I	C9orf171_ENST00000393215.3_Silent_p.I41I|C9orf171_ENST00000393216.2_Silent_p.I41I	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	41										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						TGGCGGACATCCGTTCCGGCA	0.697																																							uc004cbn.2		NA																	0				ovary(4)|large_intestine(1)	5						c.(121-123)ATC>ATT		hypothetical protein LOC389799							17.0	14.0	15.0					9																	135285781		2117	4188	6305	SO:0001819	synonymous_variant	389799							g.chr9:135285781C>T	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.123C>T	9.37:g.135285781C>T			Somatic				C9orf171_uc004cbo.2_Silent_p.I41I	p.I41I	NM_207417	NP_997300	WXS	Illumina HiSeq	Unspecified	Q6ZQR2	CI171_HUMAN			1	171	+			41					Q147X1	Silent	SNP	ENST00000343036.2	37	c.123C>T	CCDS6949.1																																																																																				0.697	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		7	6	0	0	0	0.004482	0	7	6				
C9orf171	389799	broad.mit.edu	37	9	135285844	135285844	+	Silent	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:135285844C>T	ENST00000343036.2	+	1	234	c.186C>T	c.(184-186)ctC>ctT	p.L62L	C9orf171_ENST00000393215.3_Silent_p.L62L|C9orf171_ENST00000393216.2_Silent_p.L62L	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	62										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						AGAACCCTCTCATCGTCAAGG	0.746																																							uc004cbn.2		NA																	0				ovary(4)|large_intestine(1)	5						c.(184-186)CTC>CTT		hypothetical protein LOC389799							22.0	17.0	19.0					9																	135285844		2172	4246	6418	SO:0001819	synonymous_variant	389799							g.chr9:135285844C>T	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.186C>T	9.37:g.135285844C>T			Somatic				C9orf171_uc004cbo.2_Silent_p.L62L	p.L62L	NM_207417	NP_997300	WXS	Illumina HiSeq	Unspecified	Q6ZQR2	CI171_HUMAN			1	234	+			62					Q147X1	Silent	SNP	ENST00000343036.2	37	c.186C>T	CCDS6949.1																																																																																				0.746	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		12	5	0	0	0	0.001855	0	12	5				
PPP1R26	9858	broad.mit.edu	37	9	138377496	138377496	+	Silent	SNP	A	A	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:138377496A>T	ENST00000356818.2	+	4	1689	c.1140A>T	c.(1138-1140)acA>acT	p.T380T	PPP1R26_ENST00000605286.1_Silent_p.T380T|PPP1R26_ENST00000604351.1_Silent_p.T380T|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000401470.3_Silent_p.T380T|PPP1R26_ENST00000605660.1_Silent_p.T380T	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	380					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TGCAGAAAACACGCAAGGAGG	0.627																																							uc004cfr.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1138-1140)ACA>ACT		1A6/DRIM (down-regulated in metastasis)							41.0	46.0	44.0					9																	138377496		2203	4300	6503	SO:0001819	synonymous_variant	9858					nucleolus	protein binding	g.chr9:138377496A>T	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1140A>T	9.37:g.138377496A>T			Somatic					p.T380T	NM_014811	NP_055626	WXS	Illumina HiSeq	Unspecified	Q5T8A7	K0649_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)	4	1689	+			380					Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	ENST00000356818.2	37	c.1140A>T	CCDS6988.1																																																																																				0.627	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811		23	42	0	0	0	0.002299	0	23	42				
KCNT1	57582	broad.mit.edu	37	9	138657014	138657014	+	Missense_Mutation	SNP	C	C	A	rs374015551		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:138657014C>A	ENST00000263604.3	+	12	1116	c.1116C>A	c.(1114-1116)aaC>aaA	p.N372K	KCNT1_ENST00000491806.2_Missense_Mutation_p.N358K|KCNT1_ENST00000371757.2_Missense_Mutation_p.N391K|KCNT1_ENST00000298480.5_Missense_Mutation_p.N391K|KCNT1_ENST00000490355.2_Missense_Mutation_p.N372K|KCNT1_ENST00000488444.2_Missense_Mutation_p.N372K|KCNT1_ENST00000486577.2_Missense_Mutation_p.N352K|KCNT1_ENST00000487664.1_Missense_Mutation_p.N346K			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	372					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		ACTTCCTGAACGAGTTCTACG	0.642																																							uc011mdq.1		NA																	0				large_intestine(2)|ovary(1)|pancreas(1)	4						c.(1171-1173)AAC>AAA		potassium channel, subfamily T, member 1							185.0	170.0	175.0					9																	138657014		2203	4300	6503	SO:0001583	missense	57582					membrane	binding|calcium-activated potassium channel activity	g.chr9:138657014C>A	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1116C>A	9.37:g.138657014C>A	ENSP00000263604:p.Asn372Lys		Somatic				KCNT1_uc011mdr.1_Missense_Mutation_p.N218K|KCNT1_uc010nbf.2_Missense_Mutation_p.N346K|KCNT1_uc004cgo.1_Missense_Mutation_p.N140K	p.N391K	NM_020822	NP_065873	WXS	Illumina HiSeq	Unspecified	Q5JUK3	KCNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	12	1247	+		Myeloproliferative disorder(178;0.0821)	391					B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37	c.1173C>A		.	.	.	.	.	.	.	.	.	.	c	13.57	2.277606	0.40294	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	4.21	-7.74	0.01241	NAD(P)-binding domain (1);	0.000000	0.85682	U	0.000000	T	0.25865	0.0630	L	0.54908	1.71	0.44871	D	0.99788	P;P;P;B	0.38335	0.596;0.627;0.556;0.056	P;P;B;B	0.48166	0.569;0.448;0.425;0.082	T	0.32693	-0.9897	10	0.40728	T	0.16	-14.8831	17.2825	0.87132	0.0:0.2241:0.0:0.7759	.	358;391;346;372	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	K	346;391;391;352;358;372;372;372	ENSP00000417851:N346K;ENSP00000298480:N391K;ENSP00000360822:N391K;ENSP00000263604:N372K	ENSP00000263604:N372K	N	+	3	2	KCNT1	137796835	0.001000	0.12720	0.673000	0.29887	0.941000	0.58515	-1.779000	0.01777	-1.807000	0.01236	-0.355000	0.07637	AAC		0.642	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822		30	71	1	0	9.65963e-10	0.003271	2.08398e-09	30	71				
TUBBP5	643224	broad.mit.edu	37	9	141070935	141070935	+	RNA	SNP	C	C	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr9:141070935C>T	ENST00000503395.1	+	0	1710									tubulin, beta pseudogene 5									p.A185V(2)									CCCTACAACGCCACCCTCTCA	0.517																																							uc004com.2		NA																	2	Substitution - Missense(2)		kidney(2)		0						c.(337-339)GCC>GTC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070935C>T	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070935C>T			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.A113V			WXS	Illumina HiSeq	Unspecified					4	599	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.338C>T																																																																																					0.517	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		5	75	0	0	0	0.001168	0	5	75				
FAM47C	442444	broad.mit.edu	37	X	37028632	37028632	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:37028632G>T	ENST00000358047.3	+	1	2201	c.2149G>T	c.(2149-2151)Gag>Tag	p.E717*		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	717										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCTCCACGCGGAGCCTCCTGA	0.627																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(2149-2151)GAG>TAG		hypothetical protein LOC442444							46.0	45.0	45.0					X																	37028632		2202	4300	6502	SO:0001587	stop_gained	442444							g.chrX:37028632G>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2149G>T	X.37:g.37028632G>T	ENSP00000367913:p.Glu717*		Somatic					p.E717*	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2163	+			717					Q6ZU46	Nonsense_Mutation	SNP	ENST00000358047.3	37	c.2149G>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	20.8	4.057310	0.76074	.	.	ENSG00000198173	ENST00000358047	.	.	.	0.99	0.99	0.19807	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	3.9375	0.09311	0.3041:0.0:0.6959:0.0	.	.	.	.	X	717	.	ENSP00000367913:E717X	E	+	1	0	FAM47C	36938553	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	1.022000	0.30052	0.354000	0.24105	0.354000	0.21935	GAG		0.627	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		50	14	1	0	1.81118e-26	0.00361	4.57046e-26	50	14				
MED12	9968	broad.mit.edu	37	X	70346925	70346925	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:70346925G>C	ENST00000374080.3	+	20	2824	c.2792G>C	c.(2791-2793)cGg>cCg	p.R931P	MED12_ENST00000462984.1_3'UTR|MED12_ENST00000333646.6_Missense_Mutation_p.R931P|MED12_ENST00000374102.1_Missense_Mutation_p.R931P			Q93074	MED12_HUMAN	mediator complex subunit 12	931					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCTGTCCTGCGGCACTATCAT	0.527			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2791-2793)CGG>CCG		mediator complex subunit 12							71.0	64.0	66.0					X																	70346925		2103	4216	6319	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70346925G>C	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2792G>C	X.37:g.70346925G>C	ENSP00000363193:p.Arg931Pro		Somatic				MED12_uc011mpq.1_Missense_Mutation_p.R931P|MED12_uc004dyz.2_Missense_Mutation_p.R931P|MED12_uc004dza.2_Missense_Mutation_p.R778P|MED12_uc010nla.2_5'Flank	p.R931P	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			20	2991	+	Renal(35;0.156)		931					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.2792G>C	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	27.2	4.813398	0.90790	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.89097	0.6618	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.91635	0.999;0.988;0.991;0.999	D	0.90538	0.4500	10	0.87932	D	0	-22.4031	17.2458	0.87027	0.0:0.0:1.0:0.0	.	931;778;931;931	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	P	931;931;931;931;899	ENSP00000333125:R931P;ENSP00000363215:R931P;ENSP00000363193:R931P;ENSP00000414203:R899P	ENSP00000333125:R931P	R	+	2	0	MED12	70263650	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.986000	0.93492	2.252000	0.74401	0.436000	0.28706	CGG		0.527	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		20	9	0	0	0	0.000958	0	20	9				
CYLC1	1538	broad.mit.edu	37	X	83128707	83128707	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:83128707G>C	ENST00000329312.4	+	4	1028	c.991G>C	c.(991-993)Gag>Cag	p.E331Q		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	331					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAAGGACACAGAGTCTACTGA	0.333																																							uc004eei.1		NA																	0				ovary(4)|skin(1)	5						c.(991-993)GAG>CAG		cylicin, basic protein of sperm head							48.0	42.0	44.0					X																	83128707		2197	4294	6491	SO:0001583	missense	1538				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity	g.chrX:83128707G>C	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.991G>C	X.37:g.83128707G>C	ENSP00000331556:p.Glu331Gln		Somatic				CYLC1_uc004eeh.1_Missense_Mutation_p.E330Q	p.E331Q	NM_021118	NP_066941	WXS	Illumina HiSeq	Unspecified	P35663	CYLC1_HUMAN			4	1012	+			331			2.		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	c.991G>C	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	13.14	2.147646	0.37923	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.25414	1.8	4.7	4.7	0.59300	.	.	.	.	.	T	0.33265	0.0857	L	0.49778	1.585	0.09310	N	1	P;P	0.39250	0.665;0.527	P;B	0.46208	0.507;0.407	T	0.16276	-1.0408	9	0.59425	D	0.04	-1.6626	11.9657	0.53033	0.0:0.0:1.0:0.0	.	331;331	P35663;F5H4V5	CYLC1_HUMAN;.	Q	331	ENSP00000331556:E331Q	ENSP00000331556:E331Q	E	+	1	0	CYLC1	83015363	0.138000	0.22547	0.007000	0.13788	0.950000	0.60333	3.306000	0.51881	2.310000	0.77875	0.436000	0.28706	GAG		0.333	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		9	1	0	0	0	0.004482	0	9	1				
THOC2	57187	broad.mit.edu	37	X	122830595	122830595	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:122830595G>A	ENST00000245838.8	-	6	474	c.443C>T	c.(442-444)tCa>tTa	p.S148L	THOC2_ENST00000355725.4_Missense_Mutation_p.S148L|THOC2_ENST00000491737.1_Missense_Mutation_p.S33L	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	148					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GATTTTAACTGACTTTTGATT	0.348																																							uc004etu.2		NA																	0				ovary(3)	3						c.(442-444)TCA>TTA		THO complex 2							193.0	176.0	181.0					X																	122830595		1841	4086	5927	SO:0001583	missense	57187				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding	g.chrX:122830595G>A	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.443C>T	X.37:g.122830595G>A	ENSP00000245838:p.Ser148Leu		Somatic				THOC2_uc011muh.1_Missense_Mutation_p.S69L|THOC2_uc011mui.1_Missense_Mutation_p.S33L	p.S148L	NM_001081550	NP_001075019	WXS	Illumina HiSeq	Unspecified	Q8NI27	THOC2_HUMAN			6	475	-			148					A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	c.443C>T	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133508	0.56828	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.62	5.62	0.85841	.	0.000000	0.56097	D	0.000027	T	0.39963	0.1098	N	0.12182	0.205	0.48341	D	0.99963	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.33214	-0.9877	9	0.09338	T	0.73	-4.5538	18.6571	0.91458	0.0:0.0:1.0:0.0	.	69;148	B4DKZ6;Q8NI27	.;THOC2_HUMAN	L	148;148;33;69	.	ENSP00000245838:S148L	S	-	2	0	THOC2	122658276	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.295000	0.78780	2.350000	0.79820	0.544000	0.68410	TCA		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			5	29	0	0	0	0.000602	0	5	29				
STAG2	10735	broad.mit.edu	37	X	123224615	123224615	+	Splice_Site	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:123224615G>A	ENST00000371160.1	+	31	3757		c.e31+1		STAG2_ENST00000371144.3_Splice_Site|STAG2_ENST00000218089.9_Splice_Site|STAG2_ENST00000371157.3_Splice_Site|STAG2_ENST00000371145.3_Splice_Site|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000354548.5_Splice_Site	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2						meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTGATTATAAGTAAGTACATT	0.338																																							uc004etz.3		NA																	0				ovary(4)|skin(1)	5						c.e30+1		stromal antigen 2 isoform b							112.0	94.0	100.0					X																	123224615		2203	4300	6503	SO:0001630	splice_region_variant	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123224615G>A	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.3467+1G>A	X.37:g.123224615G>A			Somatic				STAG2_uc004eua.2_Splice_Site_p.N1156_splice|STAG2_uc004eub.2_Splice_Site_p.N1156_splice|STAG2_uc004euc.2_Splice_Site_p.N1156_splice|STAG2_uc004eud.2_Splice_Site_p.N1156_splice|STAG2_uc004eue.2_Splice_Site_p.N1156_splice	p.N1156_splice	NM_006603	NP_006594	WXS	Illumina HiSeq	Unspecified	Q8N3U4	STAG2_HUMAN			30	3806	+								B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Splice_Site	SNP	ENST00000371160.1	37	c.3467_splice	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652609	0.67472	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9589	0.89078	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAG2	123052296	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.979000	0.93455	2.174000	0.68829	0.544000	0.68410	.		0.338	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	Intron	6	19	0	0	0	0.001984	0	6	19				
SMARCA1	6594	broad.mit.edu	37	X	128650465	128650465	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:128650465G>A	ENST00000371122.4	-	3	400	c.271C>T	c.(271-273)Cga>Tga	p.R91*	SMARCA1_ENST00000371123.1_Nonsense_Mutation_p.R91*|SMARCA1_ENST00000478420.1_Intron|SMARCA1_ENST00000371121.3_Nonsense_Mutation_p.R91*	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	91					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CTCTTTGCTCGGTCGGCTTTC	0.343																																							uc004eun.3		NA																	0				ovary(3)|skin(1)	4						c.(271-273)CGA>TGA		SWI/SNF-related matrix-associated							102.0	103.0	103.0					X																	128650465		2203	4300	6503	SO:0001587	stop_gained	6594				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding	g.chrX:128650465G>A	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.271C>T	X.37:g.128650465G>A	ENSP00000360163:p.Arg91*		Somatic				SMARCA1_uc004eup.3_Nonsense_Mutation_p.R91*|SMARCA1_uc011muk.1_Nonsense_Mutation_p.R91*|SMARCA1_uc011mul.1_Nonsense_Mutation_p.R91*	p.R91*	NM_003069	NP_003060	WXS	Illumina HiSeq	Unspecified	P28370	SMCA1_HUMAN			3	384	-			91					Q5JV41|Q5JV42	Nonsense_Mutation	SNP	ENST00000371122.4	37	c.271C>T	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	G	37	6.608089	0.97701	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	.	.	.	5.37	3.55	0.40652	.	0.100545	0.39615	N	0.001313	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3201	13.8263	0.63352	0.0:0.0:0.7222:0.2778	.	.	.	.	X	91;91;91;70	.	ENSP00000360162:R91X	R	-	1	2	SMARCA1	128478146	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	3.364000	0.52328	0.424000	0.26061	0.600000	0.82982	CGA		0.343	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		41	10	0	0	0	0.001951	0	41	10				
GPR112	139378	broad.mit.edu	37	X	135405197	135405197	+	Missense_Mutation	SNP	C	C	A	rs374820774		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:135405197C>A	ENST00000394143.1	+	5	622	c.331C>A	c.(331-333)Cgt>Agt	p.R111S	GPR112_ENST00000412101.1_Intron|GPR112_ENST00000370652.1_Missense_Mutation_p.R111S|GPR112_ENST00000287534.4_Missense_Mutation_p.R48S|GPR112_ENST00000394141.1_Intron	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	111					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTTTTCTATCCGTCACCACCT	0.433																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(331-333)CGT>AGT		G-protein coupled receptor 112							177.0	159.0	165.0					X																	135405197		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135405197C>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.331C>A	X.37:g.135405197C>A	ENSP00000377699:p.Arg111Ser		Somatic				GPR112_uc010nsb.1_Intron	p.R111S	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			5	622	+	Acute lymphoblastic leukemia(192;0.000127)		111			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.331C>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	C	0.059	-1.229790	0.01518	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.60299	0.2;0.2;0.2	5.62	1.24	0.21308	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.31670	0.0804	N	0.13235	0.315	0.09310	N	1	B	0.22909	0.077	B	0.15870	0.014	T	0.20075	-1.0286	9	0.08381	T	0.77	.	6.5147	0.22242	0.5261:0.2612:0.2127:0.0	.	111	Q8IZF6	GP112_HUMAN	S	111;111;48	ENSP00000377699:R111S;ENSP00000359686:R111S;ENSP00000287534:R48S	ENSP00000287534:R48S	R	+	1	0	GPR112	135232863	0.009000	0.17119	0.009000	0.14445	0.192000	0.23643	-0.001000	0.12947	0.451000	0.26802	0.513000	0.50165	CGT		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			53	14	1	0	5.99346e-17	0.00361	1.44463e-16	53	14				
SLITRK2	84631	broad.mit.edu	37	X	144903954	144903954	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:144903954G>A	ENST00000370490.1	+	1	4266	c.11G>A	c.(10-12)gGc>gAc	p.G4D	SLITRK2_ENST00000413937.2_Missense_Mutation_p.G4D|SLITRK2_ENST00000447897.2_Missense_Mutation_p.G4D|SLITRK2_ENST00000428560.2_Missense_Mutation_p.G4D|SLITRK2_ENST00000434188.2_Missense_Mutation_p.G4D			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	4					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					ATGCTGAGCGGCGTTTGGTTC	0.532																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(10-12)GGC>GAC		SLIT and NTRK-like family, member 2 precursor							56.0	54.0	55.0					X																	144903954		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144903954G>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.11G>A	X.37:g.144903954G>A	ENSP00000359521:p.Gly4Asp		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.G4D|SLITRK2_uc010nso.2_Missense_Mutation_p.G4D|SLITRK2_uc011mwq.1_Missense_Mutation_p.G4D|SLITRK2_uc011mwr.1_Missense_Mutation_p.G4D|SLITRK2_uc011mws.1_Missense_Mutation_p.G4D|SLITRK2_uc004fcg.2_Missense_Mutation_p.G4D|SLITRK2_uc011mwt.1_Missense_Mutation_p.G4D	p.G4D	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1001	+	Acute lymphoblastic leukemia(192;6.56e-05)		4					A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.11G>A	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978707	0.53720	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.53423	0.69;0.62;0.62;0.62;0.62;0.62	4.56	4.56	0.56223	.	0.341686	0.30556	U	0.009372	T	0.26593	0.0650	N	0.08118	0	0.33590	D	0.601019	B	0.22746	0.074	B	0.26310	0.068	T	0.25012	-1.0144	10	0.07990	T	0.79	-1.9777	13.8997	0.63794	0.0:0.0:1.0:0.0	.	4	Q9H156	SLIK2_HUMAN	D	4	ENSP00000334374:G4D;ENSP00000411681:G4D;ENSP00000359521:G4D;ENSP00000397015:G4D;ENSP00000407347:G4D;ENSP00000412010:G4D	ENSP00000334374:G4D	G	+	2	0	SLITRK2	144711646	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.192000	0.77771	1.846000	0.53633	0.436000	0.28706	GGC		0.532	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		17	6	0	0	0	0.000958	0	17	6				
MTMR1	8776	broad.mit.edu	37	X	149905079	149905079	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:149905079G>A	ENST00000370390.3	+	10	1226	c.1069G>A	c.(1069-1071)Gga>Aga	p.G357R	MTMR1_ENST00000541925.1_Missense_Mutation_p.G263R|MTMR1_ENST00000544228.1_Missense_Mutation_p.G357R|MTMR1_ENST00000445323.2_Missense_Mutation_p.G365R|MTMR1_ENST00000538506.1_Intron|MTMR1_ENST00000451863.2_Missense_Mutation_p.G357R	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	357	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGGGTGGAGGATATGAAAG	0.363																																							uc004fei.2		NA																	0				ovary(1)	1						c.(1069-1071)GGA>AGA		myotubularin-related protein 1							142.0	115.0	124.0					X																	149905079		2203	4300	6503	SO:0001583	missense	8776					plasma membrane	protein tyrosine phosphatase activity	g.chrX:149905079G>A	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1069G>A	X.37:g.149905079G>A	ENSP00000359417:p.Gly357Arg		Somatic				MTMR1_uc011mya.1_Missense_Mutation_p.G263R|MTMR1_uc004feh.1_Missense_Mutation_p.G365R|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_Intron	p.G357R	NM_003828	NP_003819	WXS	Illumina HiSeq	Unspecified	Q13613	MTMR1_HUMAN			10	1204	+	Acute lymphoblastic leukemia(192;6.56e-05)		357			Myotubularin phosphatase.		A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	c.1069G>A	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903287	0.72754	.	.	ENSG00000063601	ENST00000541925;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863	D;D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61;-3.61	5.26	4.4	0.53042	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.98529	0.9509	H	0.99425	4.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98498	1.0613	10	0.87932	D	0	.	13.2841	0.60232	0.0789:0.0:0.9211:0.0	.	357;365	Q13613;F8WA39	MTMR1_HUMAN;.	R	263;357;365;357;357	ENSP00000441879:G263R;ENSP00000359417:G357R;ENSP00000414178:G365R;ENSP00000440534:G357R;ENSP00000387446:G357R	ENSP00000359417:G357R	G	+	1	0	MTMR1	149655737	1.000000	0.71417	0.876000	0.34364	0.686000	0.39977	9.869000	0.99810	0.998000	0.38996	0.544000	0.68410	GGA		0.363	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789		17	8	0	0	0	0.001216	0	17	8				
SLC18A3	6572	broad.mit.edu	37	10	50819502	50819502	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr10:50819502delC	ENST00000374115.3	+	1	1156	c.716delC	c.(715-717)gccfs	p.A239fs	CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000455728.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	239					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TATGAGTTCGCCGGCAAGCGC	0.662																																							uc001jhw.2		NA																	0				ovary(2)	2						c.(715-717)GCCfs		vesicular acetylcholine transporter							21.0	24.0	23.0					10																	50819502		2203	4300	6503	SO:0001589	frameshift_variant	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50819502delC	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.716delC	10.37:g.50819502delC	ENSP00000363229:p.Ala239fs		Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	p.A239fs	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	1156	+			239			Lumenal, vesicle (Potential).		B2R7S1	Frame_Shift_Del	DEL	ENST00000374115.3	37	c.716delC	CCDS7231.1																																																																																				0.662	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		7	10	NA	NA	NA	NA	NA	7	10	---	---	---	---
OR4C16	219428	broad.mit.edu	37	11	55339854	55339854	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr11:55339854delT	ENST00000314634.3	+	1	251	c.251delT	c.(250-252)cttfs	p.L85fs		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GTGGATGCCCTTTTGAAGAAG	0.443																																							uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(250-252)CTTfs		olfactory receptor, family 4, subfamily C,							268.0	249.0	256.0					11																	55339854		2201	4296	6497	SO:0001589	frameshift_variant	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55339854delT	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.251delT	11.37:g.55339854delT	ENSP00000324913:p.Leu85fs		Somatic					p.L84fs	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	251	+		all_epithelial(135;0.0748)	84			Extracellular (Potential).		Q6IEV8	Frame_Shift_Del	DEL	ENST00000314634.3	37	c.251delT	CCDS31502.1																																																																																				0.443	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		81	159	NA	NA	NA	NA	NA	81	159	---	---	---	---
OR11H12	440153	broad.mit.edu	37	14	19378148	19378149	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr14:19378148_19378149delCC	ENST00000550708.1	+	1	627_628	c.555_556delCC	c.(553-558)ggcccafs	p.P186fs		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTTCTGTGGCCCAAACATTAT	0.485																																							uc010tkp.1		NA																	0				ovary(2)	2						c.(553-558)GGCCCAfs		olfactory receptor, family 11, subfamily H,																																				SO:0001589	frameshift_variant	440153				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:19378148_19378149delCC		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.555_556delCC	14.37:g.19378148_19378149delCC	ENSP00000449002:p.Pro186fs		Somatic					p.G185fs	NM_001013354	NP_001013372	WXS	Illumina HiSeq	Unspecified	B2RN74	O11HC_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	555_556	+	all_cancers(95;0.00108)		185_186			Extracellular (Potential).			Frame_Shift_Del	DEL	ENST00000550708.1	37	c.555_556delCC	CCDS32017.1																																																																																				0.485	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354		10	74	NA	NA	NA	NA	NA	10	74	---	---	---	---
MKRN3	7681	broad.mit.edu	37	15	23811405	23811405	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr15:23811405delC	ENST00000314520.3	+	1	952	c.476delC	c.(475-477)gccfs	p.A159fs	MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	159					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GTGGCGGAAGCCCCCCCGGCT	0.642																																							uc001ywh.3		NA																	0				lung(6)|large_intestine(2)|ovary(2)	10						c.(475-477)GCCfs		makorin ring finger protein 3							25.0	27.0	27.0					15																	23811405		2203	4300	6503	SO:0001589	frameshift_variant	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811405delC	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.476delC	15.37:g.23811405delC	ENSP00000313881:p.Ala159fs		Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Frame_Shift_Del_p.A159fs	p.A159fs	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	952	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	159						Frame_Shift_Del	DEL	ENST00000314520.3	37	c.476delC	CCDS10013.1																																																																																				0.642	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		9	27	NA	NA	NA	NA	NA	9	27	---	---	---	---
PHF23	79142	broad.mit.edu	37	17	7139891	7139891	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr17:7139891delG	ENST00000320316.3	-	4	581	c.355delC	c.(355-357)ctgfs	p.L119fs	PHF23_ENST00000570753.1_5'Flank|DVL2_ENST00000005340.5_5'Flank|PHF23_ENST00000576955.1_5'UTR|DVL2_ENST00000575458.1_5'Flank|PHF23_ENST00000454255.2_Frame_Shift_Del_p.L115fs|PHF23_ENST00000571362.1_Intron	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	119							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						GGGGCCTGCAGACGAGAGAAA	0.537																																							uc002gfa.2		NA																	0					0						c.(355-357)CTGfs		PHD finger protein 23							88.0	98.0	95.0					17																	7139891		1961	4148	6109	SO:0001589	frameshift_variant	79142						zinc ion binding	g.chr17:7139891delG	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.355delC	17.37:g.7139891delG	ENSP00000322579:p.Leu119fs		Somatic				DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Intron|PHF23_uc010cma.2_5'UTR	p.L119fs	NM_024297	NP_077273	WXS	Illumina HiSeq	Unspecified	Q9BUL5	PHF23_HUMAN			4	582	-			119					A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Frame_Shift_Del	DEL	ENST00000320316.3	37	c.355delC	CCDS42250.1																																																																																				0.537	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1	NM_024297		39	69	NA	NA	NA	NA	NA	39	69	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1221313	1221314	+	Frame_Shift_Ins	INS	-	-	C	rs121913321|rs373021819		TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:1221313_1221314insC	ENST00000326873.7	+	6	2009_2010	c.836_837insC	c.(835-840)ggccccfs	p.GP279fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.P281fs*6(2)|p.?(2)|p.G279F(1)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGACTGTGGCCCCCCGCTCT	0.604		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		26	Whole gene deletion(20)|Deletion - Frameshift(3)|Unknown(2)|Substitution - Missense(1)	p.0?(19)|p.P281fs*6(2)|p.?(2)|p.G279F(1)|p.Y246fs*3(1)	cervix(14)|lung(7)|large_intestine(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(835-837)GGCfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221313_1221314insC	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.842dupC	19.37:g.1221319_1221319dupC	ENSP00000324856:p.Gly279fs	TSP Lung(3;<1E-08)	Somatic					p.G279fs	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1951_1952	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	279			Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Ins	INS	ENST00000326873.7	37	c.836_837insC	CCDS45896.1																																																																																				0.604	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		4	5	NA	NA	NA	NA	NA	4	5	---	---	---	---
KEAP1	9817	broad.mit.edu	37	19	10600425	10600425	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr19:10600425delC	ENST00000171111.5	-	4	1977	c.1430delG	c.(1429-1431)ggcfs	p.G477fs	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Frame_Shift_Del_p.G477fs	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	477					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CCCGTCAAAGCCCCCCACGGC	0.577																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1429-1431)GGCfs		kelch-like ECH-associated protein 1							86.0	70.0	75.0					19																	10600425		2203	4300	6503	SO:0001589	frameshift_variant	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600425delC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1430delG	19.37:g.10600425delC	ENSP00000171111:p.Gly477fs		Somatic				KEAP1_uc002mop.1_Frame_Shift_Del_p.G195fs|KEAP1_uc002mor.1_Frame_Shift_Del_p.G477fs	p.G477fs	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1586	-			477			Kelch 4.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Frame_Shift_Del	DEL	ENST00000171111.5	37	c.1430delG	CCDS12239.1																																																																																				0.577	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		25	17	NA	NA	NA	NA	NA	25	17	---	---	---	---
CSNK1A1	1452	broad.mit.edu	37	5	148930440	148930440	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chr5:148930440delC	ENST00000377843.2	-	1	567	c.88delG	c.(88-90)gacfs	p.D30fs	CSNK1A1_ENST00000515435.1_5'Flank|CSNK1A1_ENST00000504676.1_5'Flank|CSNK1A1_ENST00000515768.1_Frame_Shift_Del_p.D30fs|CSNK1A1_ENST00000261798.5_Frame_Shift_Del_p.D30fs|CSNK1A1_ENST00000515748.2_Frame_Shift_Del_p.D30fs	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	30	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		AAATAGATGTCCCCGAAGGAG	0.537																																					Colon(5;64 69 1309 10383)	Colon(5;64 69 1309 10383)	uc003lqx.1		NA																	0				breast(1)	1						c.(88-90)GACfs		casein kinase 1, alpha 1 isoform 2							97.0	108.0	104.0					5																	148930440		2147	4285	6432	SO:0001589	frameshift_variant	1452				cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity	g.chr5:148930440delC	AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.88delG	5.37:g.148930440delC	ENSP00000367074:p.Asp30fs		Somatic				CSNK1A1_uc011dcc.1_5'Flank|CSNK1A1_uc003lqv.1_5'Flank|CSNK1A1_uc003lqw.1_Frame_Shift_Del_p.D30fs|CSNK1A1_uc003lqy.1_Frame_Shift_Del_p.D30fs|CSNK1A1_uc010jha.1_Frame_Shift_Del_p.D30fs	p.D30fs	NM_001892	NP_001883	WXS	Illumina HiSeq	Unspecified	P48729	KC1A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)	1	568	-			30			ATP (By similarity).|Protein kinase.		D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Frame_Shift_Del	DEL	ENST00000377843.2	37	c.88delG	CCDS47303.1																																																																																				0.537	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001892		25	50	NA	NA	NA	NA	NA	25	50	---	---	---	---
FTSJ1	24140	broad.mit.edu	37	X	48339704	48339704	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:48339704delA	ENST00000348411.2	+	7	765	c.442delA	c.(442-444)aagfs	p.K148fs	FTSJ1_ENST00000456787.1_Frame_Shift_Del_p.K148fs|FTSJ1_ENST00000019019.2_Frame_Shift_Del_p.K148fs|FTSJ1_ENST00000496365.1_3'UTR|FTSJ1_ENST00000396894.4_Frame_Shift_Del_p.K11fs	NM_012280.2	NP_036412.1			FtsJ RNA methyltransferase homolog 1 (E. coli)											breast(1)|central_nervous_system(1)|lung(4)|skin(1)	7						ACATGTCCTGAAGCCAGGGGG	0.612																																							uc004djo.1		NA																	0					0						c.(442-444)AAGfs		FtsJ homolog 1 isoform a							73.0	60.0	65.0					X																	48339704		2202	4300	6502	SO:0001589	frameshift_variant	24140				RNA methylation|rRNA processing		methyltransferase activity|nucleic acid binding	g.chrX:48339704delA	AJ005892	CCDS14294.1, CCDS14295.1, CCDS75972.1	Xp11.23	2012-06-12	2012-06-12		ENSG00000068438	ENSG00000068438			13254	protein-coding gene	gene with protein product	"""tRNA methyltransferase 7 homolog (S. cerevisiae)"""	300499	"""mental retardation, X-linked 9"", ""mental retardation, X-linked 44"""	MRX9, MRX44		15342698, 15162322	Standard	XR_246715		Approved	JM23, CDLIV, SPB1, TRM7, TRMT7	uc004djo.1	Q9UET6	OTTHUMG00000024118	ENST00000348411.2:c.442delA	X.37:g.48339704delA	ENSP00000326948:p.Lys148fs		Somatic				FTSJ1_uc004djl.2_Frame_Shift_Del_p.K148fs|FTSJ1_uc004djm.2_Frame_Shift_Del_p.K148fs|FTSJ1_uc004djn.1_Frame_Shift_Del_p.K148fs|FTSJ1_uc004djp.1_Frame_Shift_Del_p.K148fs|FTSJ1_uc011mlw.1_Frame_Shift_Del_p.K11fs	p.K148fs	NM_012280	NP_036412	WXS	Illumina HiSeq	Unspecified	Q9UET6	RRMJ1_HUMAN			7	765	+			148						Frame_Shift_Del	DEL	ENST00000348411.2	37	c.442delA	CCDS14294.1																																																																																				0.612	FTSJ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060726.1			12	3	NA	NA	NA	NA	NA	12	3	---	---	---	---
STAG2	10735	broad.mit.edu	37	X	123197866	123197866	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7156-01A-11D-2036-08	TCGA-78-7156-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d17eda6c-b986-4ba3-b0e9-bac7a751c26a	9e3e8148-b609-4b1d-9ac9-ac8f730b14ef	g.chrX:123197866delA	ENST00000371160.1	+	20	2280	c.1990delA	c.(1990-1992)aaafs	p.K664fs	STAG2_ENST00000371144.3_Frame_Shift_Del_p.K664fs|STAG2_ENST00000218089.9_Frame_Shift_Del_p.K664fs|STAG2_ENST00000354548.5_Frame_Shift_Del_p.K595fs|STAG2_ENST00000371157.3_Frame_Shift_Del_p.K664fs|STAG2_ENST00000371145.3_Frame_Shift_Del_p.K664fs|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	664					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						ATTGGCAGATAAATTTAACCG	0.343																																							uc004etz.3		NA																	0				ovary(4)|skin(1)	5						c.(1990-1992)AAAfs		stromal antigen 2 isoform b							43.0	39.0	40.0					X																	123197866		2203	4299	6502	SO:0001589	frameshift_variant	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123197866delA	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1990delA	X.37:g.123197866delA	ENSP00000360202:p.Lys664fs		Somatic				STAG2_uc004eua.2_Frame_Shift_Del_p.K664fs|STAG2_uc004eub.2_Frame_Shift_Del_p.K664fs|STAG2_uc004euc.2_Frame_Shift_Del_p.K664fs|STAG2_uc004eud.2_Frame_Shift_Del_p.K664fs|STAG2_uc004eue.2_Frame_Shift_Del_p.K664fs	p.K664fs	NM_006603	NP_006594	WXS	Illumina HiSeq	Unspecified	Q8N3U4	STAG2_HUMAN			19	2329	+			664					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	37	c.1990delA	CCDS14607.1																																																																																				0.343	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		9	8	NA	NA	NA	NA	NA	9	8	---	---	---	---
