#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
AGRN	375790	broad.mit.edu	37	1	979091	979091	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:979091G>T	ENST00000379370.2	+	9	1827	c.1777G>T	c.(1777-1779)Gtg>Ttg	p.V593L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	593	Kazal-like 6. {ECO:0000255|PROSITE- ProRule:PRU00798}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CAGCCTGCACGTGGCCTCAGC	0.706																																							uc001ack.1		NA																	0				central_nervous_system(2)|breast(1)	3						c.(1777-1779)GTG>TTG		agrin precursor							46.0	46.0	46.0					1																	979091		2203	4298	6501	SO:0001583	missense	375790				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton	g.chr1:979091G>T	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1777G>T	1.37:g.979091G>T	ENSP00000368678:p.Val593Leu		Somatic					p.V593L	NM_198576	NP_940978	WXS	Illumina HiSeq	Unspecified	O00468	AGRIN_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)	9	1827	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	593			Kazal-like 6.		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	c.1777G>T	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693697	0.48202	.	.	ENSG00000188157	ENST00000379370	T	0.74209	-0.82	4.04	4.04	0.47022	Proteinase inhibitor I1, Kazal (2);	0.000000	0.64402	D	0.000018	T	0.82195	0.4984	L	0.45470	1.425	0.51767	D	0.999936	D	0.76494	0.999	D	0.91635	0.999	D	0.84445	0.0585	10	0.62326	D	0.03	-21.1412	16.5483	0.84457	0.0:0.0:1.0:0.0	.	593	O00468	AGRIN_HUMAN	L	593	ENSP00000368678:V593L	ENSP00000368678:V593L	V	+	1	0	AGRN	968954	1.000000	0.71417	0.374000	0.26016	0.012000	0.07955	9.172000	0.94808	1.961000	0.56991	0.561000	0.74099	GTG		0.706	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576		5	57	1	0	8.12818e-05	0.001984	8.7378e-05	5	57				
MST1L	11223	broad.mit.edu	37	1	17085795	17085795	+	RNA	SNP	G	G	T	rs1057379	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:17085795G>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.I332I(2)|p.I342I(2)									TACAACGCCGGATCTGGTAGC	0.687																																							uc010ock.1		NA																	4	Substitution - coding silent(4)		kidney(2)|endometrium(2)		0						c.(1024-1026)ATC>ATA		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085795G>T	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085795G>T			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.I342I	NR_002729		WXS	Illumina HiSeq	Unspecified					8	1026	-								B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37	c.1026C>A																																																																																					0.687	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		5	20	1	0	1.5842e-08	0.016723	1.90992e-08	5	20				
NBPF3	84224	broad.mit.edu	37	1	21804741	21804741	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:21804741A>T	ENST00000318249.5	+	9	1447	c.1097A>T	c.(1096-1098)gAc>gTc	p.D366V	NBPF3_ENST00000318220.6_Missense_Mutation_p.D310V|NBPF3_ENST00000342104.5_Intron|NBPF3_ENST00000454000.2_Missense_Mutation_p.D296V	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	366	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TACCAGTCTGACAGGAGCACC	0.512																																							uc001ber.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1096-1098)GAC>GTC		neuroblastoma breakpoint family, member 3							182.0	180.0	181.0					1																	21804741		2203	4300	6503	SO:0001583	missense	84224					cytoplasm		g.chr1:21804741A>T	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1097A>T	1.37:g.21804741A>T	ENSP00000316782:p.Asp366Val		Somatic				NBPF3_uc001bes.2_Missense_Mutation_p.D310V|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Missense_Mutation_p.D296V	p.D366V	NM_032264	NP_115640	WXS	Illumina HiSeq	Unspecified	Q9H094	NBPF3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	9	1447	+		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)	366			NBPF 2.		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	c.1097A>T	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.030	-1.343307	0.01277	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000417552;ENST00000434838	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	1.13	-2.25	0.06888	DUF1220 (2);	.	.	.	.	T	0.04092	0.0114	N	0.22421	0.69	0.09310	N	1	B;B	0.33266	0.404;0.224	B;B	0.36608	0.229;0.091	T	0.46005	-0.9222	9	0.19590	T	0.45	.	5.2844	0.15692	0.4278:0.5722:0.0:0.0	.	296;366	B4DSP2;Q9H094	.;NBPF3_HUMAN	V	296;310;366;310;310	ENSP00000415711:D296V;ENSP00000316739:D310V;ENSP00000316782:D366V;ENSP00000391865:D310V	ENSP00000316739:D310V	D	+	2	0	NBPF3	21677328	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.725000	0.04942	-0.684000	0.05183	0.164000	0.16699	GAC		0.512	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264		34	226	0	0	0	0.012213	0	34	226				
YTHDF2	51441	broad.mit.edu	37	1	29069392	29069392	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:29069392C>G	ENST00000373812.3	+	4	972	c.610C>G	c.(610-612)Cca>Gca	p.P204A	YTHDF2_ENST00000541996.1_Missense_Mutation_p.P154A|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000542507.1_Missense_Mutation_p.P204A	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	204	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCAATGTTCCAAAAGTTGT	0.478																																							uc001brc.2		NA																	0				ovary(1)|skin(1)	2						c.(610-612)CCA>GCA		high glucose-regulated protein 8							64.0	62.0	63.0					1																	29069392		1927	4127	6054	SO:0001583	missense	51441				humoral immune response			g.chr1:29069392C>G	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.610C>G	1.37:g.29069392C>G	ENSP00000362918:p.Pro204Ala		Somatic				YTHDF2_uc001brd.2_Missense_Mutation_p.P201A|YTHDF2_uc010ofx.1_Missense_Mutation_p.P154A|YTHDF2_uc001bre.2_Missense_Mutation_p.P154A	p.P204A	NM_016258	NP_057342	WXS	Illumina HiSeq	Unspecified	Q9Y5A9	YTHD2_HUMAN		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)	4	1107	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	204					A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	ENST00000373812.3	37	c.610C>G	CCDS41296.1	.	.	.	.	.	.	.	.	.	.	C	9.845	1.192113	0.21954	.	.	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.39787	1.06;1.06;1.06	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	L	0.44542	1.39	0.53688	D	0.999972	B;B	0.29716	0.255;0.255	B;B	0.29862	0.108;0.108	T	0.08472	-1.0720	9	.	.	.	-11.5857	13.5171	0.61547	0.1562:0.8437:0.0:0.0	.	204;204	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	A	204;204;154;204	ENSP00000444660:P204A;ENSP00000362918:P204A;ENSP00000439394:P154A	.	P	+	1	0	YTHDF2	28941979	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.784000	0.55416	2.748000	0.94277	0.650000	0.86243	CCA		0.478	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258		11	64	0	0	0	0.010729	0	11	64				
KCNA10	3744	broad.mit.edu	37	1	111061194	111061194	+	Missense_Mutation	SNP	G	G	C	rs140376600	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:111061194G>C	ENST00000369771.2	-	1	603	c.216C>G	c.(214-216)gaC>gaG	p.D72E		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	72					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	GCCCTGGGGGGTCAGCATAGT	0.577													G|||	4	0.000798722	0.0	0.0	5008	,	,		17100	0.0		0.001	False		,,,				2504	0.0031						uc001dzt.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(214-216)GAC>GAG		potassium voltage-gated channel, shaker-related		G	GLU/ASP	0,4406		0,0,2203	80.0	87.0	85.0		216	-0.8	0.2	1	dbSNP_134	85	6,8594	5.0+/-18.6	0,6,4294	yes	missense	KCNA10	NM_005549.2	45	0,6,6497	CC,CG,GG		0.0698,0.0,0.0461	benign	72/512	111061194	6,13000	2203	4300	6503	SO:0001583	missense	3744					voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity	g.chr1:111061194G>C	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.216C>G	1.37:g.111061194G>C	ENSP00000358786:p.Asp72Glu		Somatic					p.D72E	NM_005549	NP_005540	WXS	Illumina HiSeq	Unspecified	Q16322	KCA10_HUMAN		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	1	604	-		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	72						Missense_Mutation	SNP	ENST00000369771.2	37	c.216C>G	CCDS826.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	0.333	-0.954742	0.02285	0.0	6.98E-4	ENSG00000143105	ENST00000369771	D	0.96459	-4.02	5.65	-0.766	0.11020	.	0.164203	0.20969	U	0.082436	T	0.78188	0.4244	N	0.16098	0.37	0.20638	N	0.999871	B	0.02656	0.0	B	0.04013	0.001	T	0.72947	-0.4137	10	0.14656	T	0.56	.	6.1557	0.20335	0.4306:0.2377:0.3317:0.0	.	72	Q16322	KCA10_HUMAN	E	72	ENSP00000358786:D72E	ENSP00000358786:D72E	D	-	3	2	KCNA10	110862717	0.002000	0.14202	0.150000	0.22450	0.051000	0.14879	-0.192000	0.09587	-0.151000	0.11176	-0.892000	0.02923	GAC		0.577	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549		4	86	0	0	0	0.009096	0	4	86				
SEMA6C	10500	broad.mit.edu	37	1	151107690	151107690	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:151107690C>G	ENST00000341697.3	-	15	3220	c.1529G>C	c.(1528-1530)tGt>tCt	p.C510S	SEMA6C_ENST00000479820.1_5'Flank			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	510	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTAGACAATACAGCCAGAAAA	0.627																																							uc001ewu.2		NA																	0				ovary(1)|skin(1)	2						c.(1528-1530)TGT>TCT		semaphorin Y precursor							153.0	143.0	147.0					1																	151107690		2203	4300	6503	SO:0001583	missense	10500					integral to membrane	receptor activity	g.chr1:151107690C>G	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1529G>C	1.37:g.151107690C>G	ENSP00000344148:p.Cys510Ser		Somatic				SEMA6C_uc001ewv.2_Missense_Mutation_p.C510S|SEMA6C_uc001eww.2_Missense_Mutation_p.C470S|SEMA6C_uc010pcq.1_Missense_Mutation_p.C510S	p.C510S	NM_030913	NP_112175	WXS	Illumina HiSeq	Unspecified	Q9H3T2	SEM6C_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		15	1829	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		510			Extracellular (Potential).|Sema.		D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	c.1529G>C	CCDS984.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615329	0.87359	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	4.82	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.000000	0.85682	D	0.000000	T	0.35189	0.0923	M	0.66439	2.03	0.80722	D	1	D;D;D;D	0.89917	1.0;0.984;1.0;0.996	D;D;D;D	0.80764	0.991;0.974;0.994;0.978	T	0.03249	-1.1056	10	0.44086	T	0.13	.	15.4519	0.75279	0.0:1.0:0.0:0.0	.	510;470;510;510	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	S	510;470;510;510	ENSP00000357910:C510S;ENSP00000357908:C470S;ENSP00000357909:C510S;ENSP00000344148:C510S	ENSP00000344148:C510S	C	-	2	0	SEMA6C	149374314	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.243000	0.78219	2.526000	0.85167	0.561000	0.74099	TGT		0.627	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913		7	92	0	0	0	0.004482	0	7	92				
LY9	4063	broad.mit.edu	37	1	160793521	160793521	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:160793521T>C	ENST00000263285.6	+	8	1795	c.1765T>C	c.(1765-1767)Tat>Cat	p.Y589H	LY9_ENST00000368037.5_Missense_Mutation_p.Y575H|LY9_ENST00000368040.1_Missense_Mutation_p.Y227H|LY9_ENST00000392203.4_Missense_Mutation_p.Y499H|LY9_ENST00000368041.2_Missense_Mutation_p.Y459H|LY9_ENST00000341032.4_Missense_Mutation_p.Y455H			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	589					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CGTCACTCCATATGTCACGGA	0.512																																							uc001fwu.2		NA																	0				ovary(1)	1						c.(1765-1767)TAT>CAT		lymphocyte antigen 9 isoform a							179.0	170.0	173.0					1																	160793521		2203	4300	6503	SO:0001583	missense	4063				cell adhesion|immunoglobulin mediated immune response	integral to membrane		g.chr1:160793521T>C	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.1765T>C	1.37:g.160793521T>C	ENSP00000263285:p.Tyr589His		Somatic				LY9_uc001fwv.2_Missense_Mutation_p.Y575H|LY9_uc001fww.2_Missense_Mutation_p.Y499H|LY9_uc001fwx.2_Missense_Mutation_p.Y499H|LY9_uc001fwy.1_Missense_Mutation_p.Y387H|LY9_uc001fwz.2_Missense_Mutation_p.Y227H	p.Y589H	NM_002348	NP_002339	WXS	Illumina HiSeq	Unspecified	Q9HBG7	LY9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		8	1815	+	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		589			Cytoplasmic (Potential).		A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	c.1765T>C	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	T	7.152	0.584050	0.13749	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000368040;ENST00000263285;ENST00000392203;ENST00000368037;ENST00000368036;ENST00000368035	T;T;T;T	0.35421	1.32;2.41;1.31;2.41	3.34	-4.85	0.03142	.	.	.	.	.	T	0.12646	0.0307	L	0.40543	1.245	0.09310	N	1	D;P;P;P;D;D	0.61080	0.981;0.952;0.574;0.574;0.989;0.981	P;B;B;B;P;B	0.48840	0.592;0.288;0.094;0.094;0.578;0.374	T	0.03240	-1.1057	9	0.39692	T	0.17	3.6959	3.4581	0.07523	0.3265:0.0:0.2152:0.4583	.	227;535;459;455;575;589	Q5VYI1;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	H	589;455;227;589;459;535;357;227	ENSP00000342921:Y455H;ENSP00000357019:Y227H;ENSP00000263285:Y589H;ENSP00000357014:Y227H	ENSP00000263285:Y589H	Y	+	1	0	LY9	159060145	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.019000	0.03622	-1.061000	0.03185	-0.695000	0.03696	TAT		0.512	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348		12	220	0	0	0	0.003163	0	12	220				
LRRC52	440699	broad.mit.edu	37	1	165513896	165513896	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:165513896C>T	ENST00000294818.1	+	1	653	c.363C>T	c.(361-363)ttC>ttT	p.F121F	RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000438275.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	121					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F121L(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CATTCACTTTCTCGGTGCTCA	0.498																																							uc001gde.2		NA																	1	Substitution - Missense(1)		cervix(1)	ovary(1)	1						c.(361-363)TTC>TTT		leucine rich repeat containing 52 precursor							206.0	191.0	197.0					1																	165513896		2203	4300	6503	SO:0001819	synonymous_variant	440699					integral to membrane		g.chr1:165513896C>T	AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.363C>T	1.37:g.165513896C>T			Somatic				LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	p.F121F	NM_001005214	NP_001005214	WXS	Illumina HiSeq	Unspecified	Q8N7C0	LRC52_HUMAN			1	419	+	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		121			LRR 3.|Extracellular (Potential).		A2RUN7|Q5T9K5	Silent	SNP	ENST00000294818.1	37	c.363C>T	CCDS30930.1																																																																																				0.498	LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214		9	273	0	0	0	0.004482	0	9	273				
BLZF1	8548	broad.mit.edu	37	1	169356302	169356302	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:169356302C>T	ENST00000367808.3	+	7	1508	c.1085C>T	c.(1084-1086)tCa>tTa	p.S362L	BLZF1_ENST00000329281.2_Missense_Mutation_p.S362L			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	362					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					TTTGAGTCTTCACCAACCACC	0.348																																							uc001gfx.1		NA																	0				skin(1)	1						c.(1084-1086)TCA>TTA		basic leucine zipper nuclear factor 1							92.0	96.0	95.0					1																	169356302		2203	4300	6503	SO:0001583	missense	8548				cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding	g.chr1:169356302C>T	U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.1085C>T	1.37:g.169356302C>T	ENSP00000356782:p.Ser362Leu		Somatic				BLZF1_uc001gfy.2_Missense_Mutation_p.S362L|BLZF1_uc009wvp.1_3'UTR	p.S362L	NM_003666	NP_003657	WXS	Illumina HiSeq	Unspecified	Q9H2G9	GO45_HUMAN			7	1522	+	all_hematologic(923;0.208)		362					O15298|Q5T531|Q5T533|Q9GZX4	Missense_Mutation	SNP	ENST00000367808.3	37	c.1085C>T	CCDS1278.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928027	0.73327	.	.	ENSG00000117475	ENST00000367808;ENST00000329281	T;T	0.35236	1.32;1.32	5.54	5.54	0.83059	.	0.195954	0.46145	D	0.000317	T	0.23330	0.0564	L	0.53249	1.67	0.48762	D	0.999707	P	0.36222	0.544	B	0.27887	0.084	T	0.16600	-1.0397	9	0.54805	T	0.06	-19.3852	19.4949	0.95069	0.0:1.0:0.0:0.0	.	362	Q9H2G9	GO45_HUMAN	L	362	ENSP00000356782:S362L;ENSP00000327541:S362L	ENSP00000327541:S362L	S	+	2	0	BLZF1	167622926	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	6.765000	0.74965	2.601000	0.87937	0.655000	0.94253	TCA		0.348	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086109.1	NM_003666		5	94	0	0	0	0.014758	0	5	94				
TNN	63923	broad.mit.edu	37	1	175086232	175086232	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:175086232G>C	ENST00000239462.4	+	10	2390	c.2277G>C	c.(2275-2277)caG>caC	p.Q759H		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	759	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGAAGGAGCAGAGTAGCACTG	0.647																																							uc001gkl.1		NA																	0				large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2275-2277)CAG>CAC		tenascin N precursor							94.0	87.0	89.0					1																	175086232		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086232G>C	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2277G>C	1.37:g.175086232G>C	ENSP00000239462:p.Gln759His		Somatic					p.Q759H	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2390	+		Breast(1374;0.000962)	759			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2277G>C	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	7.014	0.557297	0.13436	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.57436	0.4	5.37	4.44	0.53790	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.672389	0.15435	N	0.262483	T	0.47857	0.1468	L	0.52573	1.65	0.22940	N	0.998532	B	0.06786	0.001	B	0.15870	0.014	T	0.45542	-0.9254	10	0.59425	D	0.04	.	11.4689	0.50257	0.0854:0.0:0.9146:0.0	.	759	Q9UQP3	TENN_HUMAN	H	759;582	ENSP00000239462:Q759H	ENSP00000239462:Q759H	Q	+	3	2	TNN	173352855	0.437000	0.25593	0.027000	0.17364	0.002000	0.02628	1.991000	0.40727	1.374000	0.46228	0.655000	0.94253	CAG		0.647	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		6	140	0	0	0	0.001984	0	6	140				
TEDDM1	127670	broad.mit.edu	37	1	182369568	182369568	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:182369568T>G	ENST00000367565.1	-	1	183	c.53A>C	c.(52-54)cAa>cCa	p.Q18P		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	18						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						GGCACATCTTTGCTTATTCCT	0.448																																							uc001gpe.2		NA																	0				ovary(2)	2						c.(52-54)CAA>CCA		putative membrane protein HE9							102.0	98.0	99.0					1																	182369568		2203	4300	6503	SO:0001583	missense	127670					integral to membrane		g.chr1:182369568T>G	AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.53A>C	1.37:g.182369568T>G	ENSP00000356536:p.Gln18Pro		Somatic					p.Q18P	NM_172000	NP_741997	WXS	Illumina HiSeq	Unspecified	Q5T9Z0	TEDM1_HUMAN			1	184	-			18					Q8IVJ0	Missense_Mutation	SNP	ENST00000367565.1	37	c.53A>C	CCDS30953.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.322244	0.23994	.	.	ENSG00000203730	ENST00000367565	T	0.44482	0.92	5.25	-1.89	0.07689	.	1.547610	0.03662	N	0.242738	T	0.21186	0.0510	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.12708	-1.0537	10	0.25751	T	0.34	-5.5267	5.1311	0.14911	0.0:0.3622:0.1665:0.4713	.	18	Q5T9Z0	TEDM1_HUMAN	P	18	ENSP00000356536:Q18P	ENSP00000356536:Q18P	Q	-	2	0	TEDDM1	180636191	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.080000	0.11339	-0.137000	0.11455	-1.398000	0.01145	CAA		0.448	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091029.1	NM_172000		30	113	0	0	0	0.012213	0	30	113				
CFHR5	81494	broad.mit.edu	37	1	196973882	196973882	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:196973882G>A	ENST00000256785.4	+	9	1531	c.1422G>A	c.(1420-1422)gtG>gtA	p.V474V	CFHR5_ENST00000367414.5_Silent_p.V498V			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	474	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						GGTCAACAGTGACGTACCGTT	0.458																																							uc001gts.3		NA																	0				breast(1)|skin(1)	2						c.(1420-1422)GTG>GTA		complement factor H-related 5 precursor							138.0	131.0	133.0					1																	196973882		2203	4300	6503	SO:0001819	synonymous_variant	81494				complement activation, alternative pathway	extracellular region		g.chr1:196973882G>A	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.1422G>A	1.37:g.196973882G>A			Somatic					p.V474V	NM_030787	NP_110414	WXS	Illumina HiSeq	Unspecified	Q9BXR6	FHR5_HUMAN			9	1550	+			474			Sushi 8.		Q2NKK2	Silent	SNP	ENST00000256785.4	37	c.1422G>A	CCDS1387.1																																																																																				0.458	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787		8	144	0	0	0	0.00308	0	8	144				
PTPRC	5788	broad.mit.edu	37	1	198666011	198666011	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:198666011G>C	ENST00000367376.2	+	4	436	c.265G>C	c.(265-267)Gat>Cat	p.D89H	PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000442510.2_Missense_Mutation_p.D91H|PTPRC_ENST00000391970.3_Intron|PTPRC_ENST00000352140.3_Missense_Mutation_p.D89H	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	89					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GGACTCTTTGGATAATGCTAG	0.398																																							uc001gur.1		NA																	0				breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(265-267)GAT>CAT		protein tyrosine phosphatase, receptor type, C							118.0	118.0	118.0					1																	198666011		2203	4300	6503	SO:0001583	missense	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198666011G>C	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.265G>C	1.37:g.198666011G>C	ENSP00000356346:p.Asp89His		Somatic				PTPRC_uc001gus.1_Missense_Mutation_p.D89H|PTPRC_uc001gut.1_Intron|PTPRC_uc009wze.1_Intron|PTPRC_uc009wzf.1_Intron|PTPRC_uc010ppg.1_Intron|PTPRC_uc001guu.1_Missense_Mutation_p.D132H|PTPRC_uc001guv.1_Intron|PTPRC_uc001guw.1_Intron	p.D89H	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			4	445	+			89			Extracellular (Potential).		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37	c.265G>C		.	.	.	.	.	.	.	.	.	.	G	16.82	3.227897	0.58777	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000535566;ENST00000271610;ENST00000442510;ENST00000418674	T	0.03212	4.01	5.77	3.7	0.42460	.	0.595050	0.14985	N	0.287007	T	0.09202	0.0227	L	0.57536	1.79	0.09310	N	1	D;P;P	0.67145	0.996;0.93;0.93	P;P;P	0.58820	0.846;0.533;0.533	T	0.29912	-0.9996	10	0.87932	D	0	.	2.7597	0.05303	0.2355:0.2975:0.4669:0.0	.	130;89;89	Q6Q1P2;E9PC28;P08575	.;.;PTPRC_HUMAN	H	91;89;89;130;89;89	ENSP00000193532:D89H	ENSP00000271610:D130H	D	+	1	0	PTPRC	196932634	0.031000	0.19500	0.004000	0.12327	0.217000	0.24651	0.931000	0.28871	0.656000	0.30886	0.655000	0.94253	GAT		0.398	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				24	192	0	0	0	0.007291	0	24	192				
SPATA17	128153	broad.mit.edu	37	1	217947767	217947767	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:217947767C>A	ENST00000366933.4	+	7	666	c.611C>A	c.(610-612)cCt>cAt	p.P204H		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	204						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		CACCGAAGACCTAAAGTTAAG	0.438																																							uc001hlh.1		NA																	0				pancreas(1)	1						c.(610-612)CCT>CAT		spermatogenesis associated 17							107.0	101.0	103.0					1																	217947767		2203	4300	6503	SO:0001583	missense	128153					cytoplasm	calmodulin binding	g.chr1:217947767C>A	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.611C>A	1.37:g.217947767C>A	ENSP00000355900:p.Pro204His		Somatic				SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.P204H	p.P204H	NM_138796	NP_620151	WXS	Illumina HiSeq	Unspecified	Q96L03	SPT17_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)	7	637	+			204					A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	c.611C>A	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.393080	0.25118	.	.	ENSG00000162814	ENST00000366933	T	0.46451	0.87	5.45	-1.76	0.08006	.	0.679103	0.14012	N	0.347371	T	0.32704	0.0838	M	0.62723	1.935	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.28332	-1.0047	10	0.48119	T	0.1	-14.3659	4.2391	0.10640	0.3851:0.2893:0.2568:0.0689	.	204	Q96L03	SPT17_HUMAN	H	204	ENSP00000355900:P204H	ENSP00000355900:P204H	P	+	2	0	SPATA17	216014390	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	0.124000	0.15728	-0.162000	0.10964	0.563000	0.77884	CCT		0.438	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796		9	91	1	0	3.86212e-05	0.008291	4.29494e-05	9	91				
GPR137B	7107	broad.mit.edu	37	1	236306205	236306205	+	Missense_Mutation	SNP	C	C	A	rs369476831		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:236306205C>A	ENST00000366592.3	+	1	374	c.283C>A	c.(283-285)Ctc>Atc	p.L95I	GPR137B_ENST00000366591.4_Missense_Mutation_p.L95I	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	95						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			GCGGACCGTCCTCTTCTCCTT	0.587																																							uc001hxq.2		NA																	0					0						c.(283-285)CTC>ATC		G protein-coupled receptor 137B							165.0	159.0	161.0					1																	236306205		2203	4300	6503	SO:0001583	missense	7107					integral to plasma membrane|membrane fraction		g.chr1:236306205C>A	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.283C>A	1.37:g.236306205C>A	ENSP00000355551:p.Leu95Ile		Somatic					p.L95I	NM_003272	NP_003263	WXS	Illumina HiSeq	Unspecified	O60478	G137B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		1	374	+	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	95			Helical; (Potential).		Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	ENST00000366592.3	37	c.283C>A	CCDS1609.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367430	0.82463	.	.	ENSG00000077585	ENST00000366592;ENST00000366591;ENST00000391852	T;T	0.28895	1.59;1.59	4.89	3.96	0.45880	.	0.059874	0.64402	N	0.000002	T	0.56688	0.2002	M	0.82323	2.585	0.54753	D	0.999988	D	0.71674	0.998	D	0.83275	0.996	T	0.58504	-0.7625	10	0.29301	T	0.29	-24.4614	14.5204	0.67847	0.1479:0.8521:0.0:0.0	.	95	O60478	G137B_HUMAN	I	95;95;94	ENSP00000355551:L95I;ENSP00000355550:L95I	ENSP00000355550:L95I	L	+	1	0	GPR137B	234372828	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.560000	0.82277	1.035000	0.39972	-0.334000	0.08254	CTC		0.587	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272		22	142	1	0	9.86323e-18	0.021523	1.25976e-17	22	142				
AKT3	10000	broad.mit.edu	37	1	243727072	243727072	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:243727072C>T	ENST00000366539.1	-	10	1098	c.898G>A	c.(898-900)Gca>Aca	p.A300T	AKT3_ENST00000263826.5_Missense_Mutation_p.A300T|AKT3_ENST00000336199.5_Missense_Mutation_p.A300T|AKT3_ENST00000366540.1_Missense_Mutation_p.A300T			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			ATGGTGGCTGCATCTGTGATC	0.398																																							uc001iab.1		NA																	0				stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(898-900)GCA>ACA		AKT3 kinase isoform 1							170.0	156.0	161.0					1																	243727072		2203	4300	6503	SO:0001583	missense	10000				signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:243727072C>T	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.898G>A	1.37:g.243727072C>T	ENSP00000355497:p.Ala300Thr		Somatic				AKT3_uc001hzz.1_Missense_Mutation_p.A300T	p.A300T	NM_005465	NP_005456	WXS	Illumina HiSeq	Unspecified	Q9Y243	AKT3_HUMAN	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)		9	979	-	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	300			Protein kinase.		Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	37	c.898G>A	CCDS31077.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851175	0.71719	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.88	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.103505	0.64402	N	0.000003	T	0.45034	0.1322	N	0.11341	0.13	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35724	-0.9777	10	0.52906	T	0.07	.	15.0294	0.71694	0.0:0.9319:0.0:0.0681	.	300;300	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	T	300	ENSP00000336943:A300T;ENSP00000355498:A300T;ENSP00000355497:A300T;ENSP00000263826:A300T	ENSP00000263826:A300T	A	-	1	0	AKT3	241793695	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.337000	0.52120	1.496000	0.48567	0.591000	0.81541	GCA		0.398	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690		5	88	0	0	0	0.014758	0	5	88				
ZNF695	57116	broad.mit.edu	37	1	247162681	247162681	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:247162681G>A	ENST00000339986.7	-	3	375	c.228C>T	c.(226-228)aaC>aaT	p.N76N	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Silent_p.N76N	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	76	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTGTGTTCACGTTCCAGGGCT	0.468																																							uc009xgu.2		NA																	0					0						c.(226-228)AAC>AAT		zinc finger protein SBZF3							115.0	119.0	117.0					1																	247162681		2050	4246	6296	SO:0001819	synonymous_variant	57116				regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr1:247162681G>A		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.228C>T	1.37:g.247162681G>A			Somatic				ZNF695_uc001ica.2_RNA|ZNF695_uc001icb.1_RNA|ZNF695_uc009xgt.1_RNA|ZNF695_uc001ibx.2_Silent_p.N76N|ZNF695_uc001iby.2_RNA|ZNF695_uc001icc.2_Silent_p.N64N	p.N76N	NM_020394	NP_065127	WXS	Illumina HiSeq	Unspecified	Q8IW36	ZN695_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00271)		3	373	-	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	76			KRAB.		Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Silent	SNP	ENST00000339986.7	37	c.228C>T	CCDS44344.1																																																																																				0.468	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097823.5	NM_020394		9	84	0	0	0	0.006214	0	9	84				
OR2M5	127059	broad.mit.edu	37	1	248308622	248308622	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:248308622C>A	ENST00000366476.1	+	1	173	c.173C>A	c.(172-174)cCc>cAc	p.P58H		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CTCCACACCCCCATGTACTTC	0.522																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(172-174)CCC>CAC		olfactory receptor, family 2, subfamily M,							324.0	306.0	312.0					1																	248308622		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308622C>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.173C>A	1.37:g.248308622C>A	ENSP00000355432:p.Pro58His		Somatic					p.P58H	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	173	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		58			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.173C>A	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	c	13.68	2.309228	0.40895	.	.	ENSG00000162727	ENST00000366476	T	0.25749	1.78	3.28	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	0.267717	0.19771	U	0.106427	T	0.62756	0.2454	H	0.98256	4.185	0.28577	N	0.910332	D	0.89917	1.0	D	0.72338	0.977	T	0.63497	-0.6624	10	0.87932	D	0	.	10.1294	0.42669	0.0:0.8944:0.0:0.1056	.	58	A3KFT3	OR2M5_HUMAN	H	58	ENSP00000355432:P58H	ENSP00000355432:P58H	P	+	2	0	OR2M5	246375245	0.578000	0.26717	0.327000	0.25402	0.262000	0.26303	4.046000	0.57376	0.475000	0.27415	0.492000	0.49549	CCC		0.522	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		110	371	1	0	2.96211e-45	0.01441	3.85972e-45	110	371				
ZEB1	6935	broad.mit.edu	37	10	31815884	31815884	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr10:31815884G>A	ENST00000320985.10	+	9	3177	c.3067G>A	c.(3067-3069)Gac>Aac	p.D1023N	ZEB1_ENST00000560721.2_Missense_Mutation_p.D1003N|ZEB1_ENST00000446923.2_Missense_Mutation_p.D1007N|ZEB1_ENST00000361642.5_Missense_Mutation_p.D1024N|ZEB1_ENST00000542815.3_Missense_Mutation_p.D956N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	1023	Glu-rich (acidic).				cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GGGCGACTCGGACGAGAGAGA	0.522																																					Ovarian(40;423 959 14296 36701 49589)	Ovarian(40;423 959 14296 36701 49589)	uc001ivs.3		NA																	0				ovary(3)|central_nervous_system(2)	5						c.(3067-3069)GAC>AAC		zinc finger E-box binding homeobox 1 isoform b							65.0	62.0	63.0					10																	31815884		2203	4300	6503	SO:0001583	missense	6935				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr10:31815884G>A	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.3067G>A	10.37:g.31815884G>A	ENSP00000319248:p.Asp1023Asn		Somatic				ZEB1_uc001ivr.3_Missense_Mutation_p.D805N|ZEB1_uc010qee.1_Missense_Mutation_p.D805N|ZEB1_uc010qef.1_Missense_Mutation_p.D805N|ZEB1_uc001ivt.3_Missense_Mutation_p.D805N|ZEB1_uc001ivu.3_Missense_Mutation_p.D1024N|ZEB1_uc001ivv.3_Missense_Mutation_p.D1003N|ZEB1_uc010qeh.1_Missense_Mutation_p.D956N|ZEB1_uc009xlp.2_Missense_Mutation_p.D1007N	p.D1023N	NM_030751	NP_110378	WXS	Illumina HiSeq	Unspecified	P37275	ZEB1_HUMAN			9	3130	+		Prostate(175;0.0156)	1023			Glu-rich (acidic).		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	c.3067G>A	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319171	0.81469	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.14022	2.84;2.54;2.58;2.54;2.59	5.19	5.19	0.71726	.	1.161370	0.06406	N	0.719811	T	0.40909	0.1136	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.996;0.997;0.997	D;D;D;D;D	0.77004	0.987;0.989;0.917;0.989;0.989	T	0.02150	-1.1205	10	0.52906	T	0.07	-15.9864	18.7127	0.91664	0.0:0.0:1.0:0.0	.	956;1007;1003;1024;1023	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	N	805;1023;1024;1018;956;1023;1003;914;1007	ENSP00000444282:D805N;ENSP00000354487:D1024N;ENSP00000444891:D956N;ENSP00000319248:D1023N;ENSP00000391612:D1007N	ENSP00000319248:D1023N	D	+	1	0	ZEB1	31855890	1.000000	0.71417	0.778000	0.31720	0.279000	0.26890	7.871000	0.87180	2.425000	0.82216	0.650000	0.86243	GAC		0.522	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		3	29	0	0	0	0.004672	0	3	29				
TACR2	6865	broad.mit.edu	37	10	71168743	71168743	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr10:71168743T>C	ENST00000373306.4	-	3	1219	c.676A>G	c.(676-678)Agg>Ggg	p.R226G	TACR2_ENST00000373307.1_Missense_Mutation_p.R14G	NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	226					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						ACTGCGCGCCTCCAGAGCGTG	0.687																																							uc001jpn.2		NA																	0				prostate(1)	1						c.(676-678)AGG>GGG		tachykinin receptor 2	Clonidine(DB00575)|Octreotide(DB00104)						38.0	36.0	37.0					10																	71168743		2203	4300	6503	SO:0001583	missense	6865				excretion|muscle contraction	integral to plasma membrane	tachykinin receptor activity	g.chr10:71168743T>C		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.676A>G	10.37:g.71168743T>C	ENSP00000362403:p.Arg226Gly		Somatic				TACR2_uc001jpm.2_Missense_Mutation_p.R14G	p.R226G	NM_001057	NP_001048	WXS	Illumina HiSeq	Unspecified	P21452	NK2R_HUMAN			3	1271	-			226			Cytoplasmic (Potential).		A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	ENST00000373306.4	37	c.676A>G	CCDS7293.1	.	.	.	.	.	.	.	.	.	.	T	7.583	0.669095	0.14776	.	.	ENSG00000075073	ENST00000373307;ENST00000373306	T;T	0.42900	0.96;0.96	4.88	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.219986	0.47852	D	0.000210	T	0.12050	0.0293	N	0.01277	-0.915	0.38205	D	0.940303	B	0.02656	0.0	B	0.06405	0.002	T	0.22208	-1.0223	10	0.02654	T	1	.	6.5657	0.22511	0.0:0.0787:0.1573:0.764	.	226	P21452	NK2R_HUMAN	G	14;226	ENSP00000362404:R14G;ENSP00000362403:R226G	ENSP00000362403:R226G	R	-	1	2	TACR2	70838749	0.997000	0.39634	0.996000	0.52242	0.984000	0.73092	2.949000	0.49074	0.788000	0.33755	0.459000	0.35465	AGG		0.687	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1			3	30	0	0	0	0.004672	0	3	30				
OR52K2	119774	broad.mit.edu	37	11	4470976	4470976	+	Missense_Mutation	SNP	A	A	C	rs147450058		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr11:4470976A>C	ENST00000325719.4	+	1	452	c.407A>C	c.(406-408)aAg>aCg	p.K136T		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACTACACCAAGGTCCTGACT	0.552													A|||	1	0.000199681	0.0	0.0	5008	,	,		21429	0.0		0.001	False		,,,				2504	0.0						uc001lyz.1		NA																	0				skin(2)	2						c.(406-408)AAG>ACG		olfactory receptor, family 52, subfamily K,							111.0	98.0	103.0					11																	4470976		2201	4298	6499	SO:0001583	missense	119774				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4470976A>C	AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.407A>C	11.37:g.4470976A>C	ENSP00000318956:p.Lys136Thr		Somatic					p.K136T	NM_001005172	NP_001005172	WXS	Illumina HiSeq	Unspecified	Q8NGK3	O52K2_HUMAN		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	407	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	136			Cytoplasmic (Potential).		A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	ENST00000325719.4	37	c.407A>C	CCDS31351.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.849004	0.00067	.	.	ENSG00000181963	ENST00000325719	T	0.08370	3.1	4.16	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.288673	0.24573	N	0.037368	T	0.01189	0.0039	N	0.00018	-2.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42949	-0.9421	10	0.02654	T	1	.	12.0893	0.53717	0.1753:0.8247:0.0:0.0	.	136	Q8NGK3	O52K2_HUMAN	T	136	ENSP00000318956:K136T	ENSP00000318956:K136T	K	+	2	0	OR52K2	4427552	0.000000	0.05858	0.739000	0.30968	0.085000	0.17905	0.479000	0.22228	0.969000	0.38237	-0.395000	0.06472	AAG		0.552	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385844.1	NM_001005172		9	73	0	0	0	0.006214	0	9	73				
SYT9	143425	broad.mit.edu	37	11	7335023	7335023	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr11:7335023G>A	ENST00000318881.6	+	3	1132	c.895G>A	c.(895-897)Gaa>Aaa	p.E299K	SYT9_ENST00000396716.2_Missense_Mutation_p.E267K	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	299	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CAATGACCTTGAAGCACGGAA	0.453																																							uc001mfe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(895-897)GAA>AAA		synaptotagmin IX							206.0	208.0	208.0					11																	7335023		2201	4296	6497	SO:0001583	missense	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7335023G>A	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.895G>A	11.37:g.7335023G>A	ENSP00000324419:p.Glu299Lys		Somatic				SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	p.E299K	NM_175733	NP_783860	WXS	Illumina HiSeq	Unspecified	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	3	1132	+			299			Cytoplasmic (Potential).|C2 1.			Missense_Mutation	SNP	ENST00000318881.6	37	c.895G>A	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296513	0.40594	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.68903	-0.36;-0.36	5.97	3.98	0.46160	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.501379	0.20000	N	0.101343	T	0.43722	0.1260	N	0.12471	0.22	0.26646	N	0.972196	B	0.02656	0.0	B	0.06405	0.002	T	0.21280	-1.0250	9	.	.	.	.	8.5909	0.33686	0.0:0.1486:0.544:0.3073	.	299	Q86SS6	SYT9_HUMAN	K	267;299	ENSP00000379944:E267K;ENSP00000324419:E299K	.	E	+	1	0	SYT9	7291599	0.774000	0.28592	0.955000	0.39395	0.999000	0.98932	4.000000	0.57039	1.512000	0.48834	0.655000	0.94253	GAA		0.453	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		11	268	0	0	0	0.010729	0	11	268				
SCUBE2	57758	broad.mit.edu	37	11	9042630	9042630	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr11:9042630G>C	ENST00000309263.3	-	22	3034	c.2962C>G	c.(2962-2964)Cgt>Ggt	p.R988G	RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000520467.1_Missense_Mutation_p.R960G|SCUBE2_ENST00000457346.2_Missense_Mutation_p.R1017G|SCUBE2_ENST00000450649.2_Missense_Mutation_p.R796G			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	988						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		ACTTTGGAACGTAGCAATCGG	0.488																																							uc001mhh.1		NA																	0				ovary(1)|skin(1)	2						c.(2962-2964)CGT>GGT		CEGP1 protein precursor							154.0	131.0	139.0					11																	9042630		2201	4296	6497	SO:0001583	missense	57758					extracellular region	calcium ion binding	g.chr11:9042630G>C	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2962C>G	11.37:g.9042630G>C	ENSP00000310658:p.Arg988Gly		Somatic				SCUBE2_uc001mhi.1_Missense_Mutation_p.R960G|SCUBE2_uc001mhj.1_Missense_Mutation_p.R796G	p.R988G	NM_020974	NP_066025	WXS	Illumina HiSeq	Unspecified	Q9NQ36	SCUB2_HUMAN		all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)	22	3042	-			988					Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37	c.2962C>G		.	.	.	.	.	.	.	.	.	.	G	25.9	4.686740	0.88639	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	T;D;D;D	0.85339	-1.43;-1.51;-1.97;-1.51	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.93041	0.7785	.	.	.	0.80722	D	1	D;D;D	0.89917	0.99;0.998;1.0	P;D;D	0.91635	0.796;0.946;0.999	D	0.93412	0.6769	9	0.87932	D	0	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	796;960;988	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	G	1017;988;796;960	ENSP00000390481:R1017G;ENSP00000310658:R988G;ENSP00000415187:R796G;ENSP00000429969:R960G	ENSP00000310658:R988G	R	-	1	0	SCUBE2	8999206	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	5.421000	0.66447	2.652000	0.90054	0.655000	0.94253	CGT		0.488	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974		10	53	0	0	0	0.008291	0	10	53				
TMEM41B	440026	broad.mit.edu	37	11	9321238	9321238	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr11:9321238C>A	ENST00000528080.1	-	2	470	c.132G>T	c.(130-132)tgG>tgT	p.W44C	TMEM41B_ENST00000527813.1_Missense_Mutation_p.W44C|TMEM41B_ENST00000533723.1_Missense_Mutation_p.W44C	NM_015012.3	NP_055827.1	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B	44					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(2)	7				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		CAGCTTCTACCCAGGATTTTT	0.323																																							uc001mhm.2		NA																	0					0						c.(130-132)TGG>TGT		transmembrane protein 41B isoform 1							43.0	46.0	45.0					11																	9321238		2201	4296	6497	SO:0001583	missense	440026					integral to membrane		g.chr11:9321238C>A	D26067	CCDS31424.1, CCDS53600.1	11p15.3	2008-02-05			ENSG00000166471	ENSG00000166471			28948	protein-coding gene	gene with protein product						7584026, 7584028	Standard	NM_015012		Approved	KIAA0033	uc001mhn.2	Q5BJD5	OTTHUMG00000165719	ENST00000528080.1:c.132G>T	11.37:g.9321238C>A	ENSP00000433126:p.Trp44Cys		Somatic				TMEM41B_uc001mhn.1_Missense_Mutation_p.W44C	p.W44C	NM_015012	NP_055827	WXS	Illumina HiSeq	Unspecified	Q5BJD5	TM41B_HUMAN		all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)	2	440	-			44					D3DQU9|E9PP29|Q15055|Q4G0P0	Missense_Mutation	SNP	ENST00000528080.1	37	c.132G>T	CCDS31424.1	.	.	.	.	.	.	.	.	.	.	C	8.275	0.814202	0.16537	.	.	ENSG00000166471	ENST00000299596;ENST00000528080;ENST00000527813;ENST00000533723	.	.	.	5.15	-0.113	0.13568	.	1.205150	0.05395	N	0.539663	T	0.27765	0.0683	N	0.00926	-1.1	0.36089	D	0.843301	B	0.02656	0.0	B	0.01281	0.0	T	0.07790	-1.0754	9	0.48119	T	0.1	-10.9031	14.2121	0.65771	0.7032:0.2968:0.0:0.0	.	44	Q5BJD5	TM41B_HUMAN	C	44	.	ENSP00000299596:W44C	W	-	3	0	TMEM41B	9277814	0.729000	0.28090	0.991000	0.47740	0.956000	0.61745	0.110000	0.15437	0.050000	0.15949	0.591000	0.81541	TGG		0.323	TMEM41B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385940.2			5	49	1	0	0.00116845	0.001168	0.00121556	5	49				
KRT81	3887	broad.mit.edu	37	12	52681054	52681054	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr12:52681054G>T	ENST00000327741.5	-	7	1147	c.1079C>A	c.(1078-1080)gCc>gAc	p.A360D	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	360	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		ATCACTGAGGGCCGCCTCACC	0.617																																							uc001sab.2		NA																	0					0						c.(1078-1080)GCC>GAC		keratin, hair, basic, 1							29.0	30.0	30.0					12																	52681054		2202	4295	6497	SO:0001583	missense	3887					keratin filament	protein binding|structural molecule activity	g.chr12:52681054G>T	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1079C>A	12.37:g.52681054G>T	ENSP00000369349:p.Ala360Asp		Somatic				KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_5'UTR	p.A360D	NM_002281	NP_002272	WXS	Illumina HiSeq	Unspecified	Q14533	KRT81_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	7	1129	-			360			Rod.|Coil 2.		Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	37	c.1079C>A	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630234	0.67015	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	T	0.74737	-0.87	5.1	5.1	0.69264	Filament (1);	0.169818	0.27577	U	0.018749	D	0.86539	0.5957	M	0.77712	2.385	0.44595	D	0.997567	D	0.59767	0.986	D	0.70227	0.968	D	0.88340	0.2974	10	0.87932	D	0	.	18.5013	0.90882	0.0:0.0:1.0:0.0	.	360	Q14533	KRT81_HUMAN	D	360	ENSP00000369349:A360D	ENSP00000369349:A360D	A	-	2	0	KRT81	50967321	0.997000	0.39634	0.984000	0.44739	0.358000	0.29455	5.633000	0.67825	2.361000	0.80049	0.561000	0.74099	GCC		0.617	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281		6	61	1	0	0.00116845	0.001168	0.00121556	6	61				
NCKAP1L	3071	broad.mit.edu	37	12	54902264	54902264	+	Missense_Mutation	SNP	G	G	A	rs149360088	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr12:54902264G>A	ENST00000293373.6	+	5	534	c.455G>A	c.(454-456)cGg>cAg	p.R152Q	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.R102Q	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	152					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.R152Q(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						GAAGATCGGCGGATACTCATT	0.428													G|||	2	0.000399361	0.0	0.0014	5008	,	,		21431	0.0		0.001	False		,,,				2504	0.0						uc001sgc.3		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(3)|central_nervous_system(1)	4						c.(454-456)CGG>CAG		NCK-associated protein 1-like		G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	259.0	240.0	246.0		305,455	5.2	0.6	12	dbSNP_134	246	12,8588	9.8+/-36.6	0,12,4288	yes	missense,missense	NCKAP1L	NM_001184976.1,NM_005337.4	43,43	0,13,6490	AA,AG,GG		0.1395,0.0227,0.1	possibly-damaging,possibly-damaging	102/1078,152/1128	54902264	13,12993	2203	4300	6503	SO:0001583	missense	3071				actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity	g.chr12:54902264G>A	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.455G>A	12.37:g.54902264G>A	ENSP00000293373:p.Arg152Gln		Somatic				NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Missense_Mutation_p.R102Q	p.R152Q	NM_005337	NP_005328	WXS	Illumina HiSeq	Unspecified	P55160	NCKPL_HUMAN			5	534	+			152					B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	c.455G>A	CCDS31813.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	18.73	3.685489	0.68157	2.27E-4	0.001395	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.35048	1.33;1.33	6.07	5.19	0.71726	.	0.059618	0.64402	D	0.000004	T	0.23133	0.0559	L	0.29908	0.895	0.33067	D	0.534914	P	0.47604	0.898	B	0.35655	0.207	T	0.43410	-0.9393	10	0.87932	D	0	-14.9414	9.2226	0.37386	0.1614:0.0:0.8386:0.0	.	152	P55160	NCKPL_HUMAN	Q	152;102	ENSP00000293373:R152Q;ENSP00000445596:R102Q	ENSP00000293373:R152Q	R	+	2	0	NCKAP1L	53188531	0.304000	0.24472	0.607000	0.28956	0.974000	0.67602	3.574000	0.53863	1.578000	0.49821	0.655000	0.94253	CGG		0.428	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337		25	238	0	0	0	0.004656	0	25	238				
PTPRB	5787	broad.mit.edu	37	12	70964879	70964879	+	Silent	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr12:70964879G>T	ENST00000261266.5	-	11	2672	c.2643C>A	c.(2641-2643)ggC>ggA	p.G881G	PTPRB_ENST00000551525.1_Silent_p.G1098G|PTPRB_ENST00000451516.2_Silent_p.G791G|PTPRB_ENST00000550358.1_Silent_p.G1011G|PTPRB_ENST00000550857.1_Silent_p.G791G|PTPRB_ENST00000334414.6_Silent_p.G1099G|PTPRB_ENST00000538708.1_Silent_p.G881G	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	881	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGTATTGGCGGCCTGGTGTTA	0.428																																							uc001swb.3		NA																	0				lung(2)|skin(1)	3						c.(2641-2643)GGC>GGA		protein tyrosine phosphatase, receptor type, B							79.0	75.0	76.0					12																	70964879		1919	4138	6057	SO:0001819	synonymous_variant	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:70964879G>T	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2643C>A	12.37:g.70964879G>T			Somatic				PTPRB_uc010sto.1_Silent_p.G881G|PTPRB_uc010stp.1_Silent_p.G791G|PTPRB_uc001swc.3_Silent_p.G1099G|PTPRB_uc001swa.3_Silent_p.G1011G|PTPRB_uc001swd.3_Silent_p.G1098G|PTPRB_uc009zrr.1_Silent_p.G978G	p.G881G	NM_002837	NP_002828	WXS	Illumina HiSeq	Unspecified	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		11	2673	-	Renal(347;0.236)		881			Fibronectin type-III 10.|Extracellular (Potential).		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	37	c.2643C>A	CCDS44944.1																																																																																				0.428	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1			6	36	1	0	5.9392e-07	0.001168	6.84069e-07	6	36				
TMEM132D	121256	broad.mit.edu	37	12	130015687	130015687	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr12:130015687A>T	ENST00000422113.2	-	3	1358	c.1032T>A	c.(1030-1032)gaT>gaA	p.D344E		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	344					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCTCCTTGACATCCCAAATGG	0.537																																							uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(1030-1032)GAT>GAA		transmembrane protein 132D precursor							120.0	111.0	114.0					12																	130015687		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:130015687A>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1032T>A	12.37:g.130015687A>T	ENSP00000408581:p.Asp344Glu		Somatic					p.D344E	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	3	1360	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	344			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.1032T>A	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	0.057	-1.234088	0.01505	.	.	ENSG00000151952	ENST00000422113	T	0.12984	2.63	5.09	-6.85	0.01681	.	0.429798	0.20489	N	0.091339	T	0.08714	0.0216	M	0.63428	1.95	0.09310	N	0.999996	B	0.09022	0.002	B	0.11329	0.006	T	0.26643	-1.0097	9	.	.	.	-3.8639	1.6642	0.02798	0.2989:0.0999:0.353:0.2481	.	344	Q14C87	T132D_HUMAN	E	344	ENSP00000408581:D344E	.	D	-	3	2	TMEM132D	128581640	0.017000	0.18338	0.240000	0.24138	0.067000	0.16453	-1.172000	0.03112	-1.252000	0.02491	-1.100000	0.02121	GAT		0.537	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		4	56	0	0	0	0.014758	0	4	56				
KATNBL1	79768	broad.mit.edu	37	15	34455835	34455835	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr15:34455835T>C	ENST00000256544.3	-	2	185	c.43A>G	c.(43-45)Aat>Gat	p.N15D		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	15						nucleolus (GO:0005730)											TCAATCTTATTACAAAAGTTC	0.294																																							uc001zhp.2		NA																	0				ovary(1)	1						c.(43-45)AAT>GAT		hypothetical protein LOC79768							60.0	62.0	61.0					15																	34455835		2199	4286	6485	SO:0001583	missense	79768					nucleolus		g.chr15:34455835T>C	AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152			26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29		11230166	Standard	NM_024713		Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.43A>G	15.37:g.34455835T>C	ENSP00000256544:p.Asn15Asp		Somatic				C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Missense_Mutation_p.N15D	p.N15D	NM_024713	NP_078989	WXS	Illumina HiSeq	Unspecified	Q9H079	CO029_HUMAN		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)	2	203	-		all_lung(180;1.86e-06)	15					A8KAF6|Q2TAC0|Q9H670	Missense_Mutation	SNP	ENST00000256544.3	37	c.43A>G	CCDS10034.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.096949	0.37048	.	.	ENSG00000134152	ENST00000256544	.	.	.	4.49	0.737	0.18314	.	0.643571	0.16101	N	0.229547	T	0.22589	0.0545	N	0.24115	0.695	0.24081	N	0.995948	B	0.02656	0.0	B	0.01281	0.0	T	0.13522	-1.0506	9	0.28530	T	0.3	.	4.0108	0.09621	0.152:0.1705:0.0:0.6775	.	15	Q9H079	CO029_HUMAN	D	15	.	ENSP00000256544:N15D	N	-	1	0	C15orf29	32243127	0.994000	0.37717	0.988000	0.46212	0.903000	0.53119	0.758000	0.26447	0.020000	0.15106	-0.385000	0.06624	AAT		0.294	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251520.1	NM_024713		7	45	0	0	0	0.00308	0	7	45				
MAN2A2	4122	broad.mit.edu	37	15	91456505	91456505	+	Missense_Mutation	SNP	G	G	A	rs148275760		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr15:91456505G>A	ENST00000559717.1	+	18	3046	c.2587G>A	c.(2587-2589)Gtg>Atg	p.V863M	MAN2A2_ENST00000360468.3_Missense_Mutation_p.V863M|MAN2A2_ENST00000430376.2_Missense_Mutation_p.V53M|MAN2A2_ENST00000431652.2_Missense_Mutation_p.V371M			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	863					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GTACCCAGGGGTGGAGGGGCT	0.607																																							uc010bnz.2		NA																	0				large_intestine(2)|ovary(1)	3						c.(2587-2589)GTG>ATG		mannosidase, alpha, class 2A, member 2		G	MET/VAL	0,4396		0,0,2198	68.0	66.0	67.0		2587	3.1	1.0	15	dbSNP_134	67	1,8595	1.2+/-3.3	0,1,4297	no	missense	MAN2A2	NM_006122.2	21	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	benign	863/1151	91456505	1,12991	2198	4298	6496	SO:0001583	missense	4122				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding	g.chr15:91456505G>A	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2587G>A	15.37:g.91456505G>A	ENSP00000452948:p.Val863Met		Somatic				MAN2A2_uc002bqc.2_Missense_Mutation_p.V863M|MAN2A2_uc010uql.1_Missense_Mutation_p.V525M|MAN2A2_uc010uqm.1_Missense_Mutation_p.V442M|MAN2A2_uc010uqn.1_RNA	p.V863M	NM_006122	NP_006113	WXS	Illumina HiSeq	Unspecified	P49641	MA2A2_HUMAN	Lung(145;0.229)		18	2702	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		863					A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	c.2587G>A	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996701	0.54147	0.0	1.16E-4	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	T;D;D	0.93133	-1.19;-1.67;-3.17	4.97	3.1	0.35709	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.325875	0.33005	N	0.005393	D	0.91955	0.7452	L	0.50333	1.59	0.45733	D	0.998631	B;B;B	0.33777	0.425;0.254;0.032	P;B;B	0.45343	0.477;0.262;0.027	D	0.87617	0.2507	10	0.34782	T	0.22	-11.0945	8.3453	0.32270	0.2426:0.0:0.7574:0.0	.	371;491;863	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	M	863;371;53	ENSP00000353655:V863M;ENSP00000388221:V371M;ENSP00000394372:V53M	ENSP00000353655:V863M	V	+	1	0	MAN2A2	89257509	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.615000	0.67702	0.698000	0.31739	0.555000	0.69702	GTG		0.607	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122		7	67	0	0	0	0.001984	0	7	67				
CHD2	1106	broad.mit.edu	37	15	93567613	93567613	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr15:93567613A>T	ENST00000394196.4	+	39	6233	c.5165A>T	c.(5164-5166)gAc>gTc	p.D1722V		NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1722					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CACCATCATGACTCCAAGCGG	0.493																																							uc002bsp.2		NA																	0				ovary(1)|skin(1)	2						c.(5164-5166)GAC>GTC		chromodomain helicase DNA binding protein 2							52.0	51.0	52.0					15																	93567613		1910	4142	6052	SO:0001583	missense	1106				regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr15:93567613A>T	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.5165A>T	15.37:g.93567613A>T	ENSP00000377747:p.Asp1722Val		Somatic					p.D1722V	NM_001271	NP_001262	WXS	Illumina HiSeq	Unspecified	O14647	CHD2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)		39	5740	+	Lung NSC(78;0.00976)|all_lung(78;0.016)		1722					C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	c.5165A>T	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	18.96	3.734127	0.69189	.	.	ENSG00000173575	ENST00000394196	D	0.92249	-3.0	5.87	5.87	0.94306	.	.	.	.	.	D	0.92662	0.7668	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.93062	0.6475	9	0.44086	T	0.13	-2.7759	16.5764	0.84681	1.0:0.0:0.0:0.0	.	1722	O14647	CHD2_HUMAN	V	1722	ENSP00000377747:D1722V	ENSP00000377747:D1722V	D	+	2	0	CHD2	91368617	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.404000	0.90210	2.371000	0.80710	0.533000	0.62120	GAC		0.493	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271		7	52	0	0	0	0.00308	0	7	52				
RBFOX1	54715	broad.mit.edu	37	16	7637294	7637294	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr16:7637294G>A	ENST00000550418.1	+	7	1448	c.460G>A	c.(460-462)Ggc>Agc	p.G154S	RBFOX1_ENST00000311745.5_Missense_Mutation_p.G174S|RBFOX1_ENST00000547372.1_Missense_Mutation_p.G197S|RBFOX1_ENST00000436368.2_Missense_Mutation_p.G174S|RBFOX1_ENST00000553186.1_Missense_Mutation_p.G154S|RBFOX1_ENST00000552089.1_Intron|RBFOX1_ENST00000535565.2_Missense_Mutation_p.G142S|RBFOX1_ENST00000422070.4_Missense_Mutation_p.G197S|RBFOX1_ENST00000547338.1_Missense_Mutation_p.G154S|RBFOX1_ENST00000340209.4_Missense_Mutation_p.G159S|RBFOX1_ENST00000355637.4_Missense_Mutation_p.G174S	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	154	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TAATGAGCGAGGCTCAAAGGT	0.299																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	0					0						c.(460-462)GGC>AGC		ataxin 2-binding protein 1 isoform 4							67.0	72.0	70.0					16																	7637294		2197	4296	6493	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7637294G>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.460G>A	16.37:g.7637294G>A	ENSP00000450031:p.Gly154Ser		Somatic				A2BP1_uc010buf.1_Missense_Mutation_p.G154S|A2BP1_uc002cyr.1_Missense_Mutation_p.G153S|A2BP1_uc002cyt.2_Missense_Mutation_p.G154S|A2BP1_uc010uxz.1_Missense_Mutation_p.G197S|A2BP1_uc010uya.1_Missense_Mutation_p.G142S|A2BP1_uc002cyv.1_Missense_Mutation_p.G154S|A2BP1_uc010uyb.1_Missense_Mutation_p.G154S|A2BP1_uc002cyw.2_Missense_Mutation_p.G174S|A2BP1_uc002cyy.2_Missense_Mutation_p.G174S|A2BP1_uc002cyx.2_Missense_Mutation_p.G174S|A2BP1_uc010uyc.1_Missense_Mutation_p.G174S	p.G154S	NM_018723	NP_061193	WXS	Illumina HiSeq	Unspecified	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	7	1448	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	154			RRM.		Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.460G>A	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	31	5.093080	0.94149	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52	5.91	5.91	0.95273	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.33710	1.025	0.80722	D	1	D;D;P;D;P;D;D;D;D	0.89917	0.975;1.0;0.743;1.0;0.486;1.0;0.975;0.962;0.989	D;D;P;D;P;D;P;P;D	0.97110	0.958;1.0;0.876;1.0;0.631;0.998;0.732;0.885;0.931	T	0.01013	-1.1481	10	0.72032	D	0.01	-10.125	20.2985	0.98592	0.0:0.0:1.0:0.0	.	174;142;197;174;174;174;154;154;197	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	S	153;154;154;197;197;142;154;154;174;174;174;174;159	ENSP00000450402:G153S;ENSP00000450031:G154S;ENSP00000447753:G154S;ENSP00000446842:G197S;ENSP00000391269:G197S;ENSP00000447281:G154S;ENSP00000447717:G154S;ENSP00000402745:G174S;ENSP00000309117:G174S;ENSP00000347855:G174S;ENSP00000344196:G159S	ENSP00000309117:G174S	G	+	1	0	RBFOX1	7577295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.441000	0.97557	2.793000	0.96121	0.655000	0.94253	GGC		0.299	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		9	82	0	0	0	0.006214	0	9	82				
VWA3A	146177	broad.mit.edu	37	16	22155616	22155616	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr16:22155616T>A	ENST00000389398.5	+	26	2737	c.2641T>A	c.(2641-2643)Tgc>Agc	p.C881S	VWA3A_ENST00000563755.1_5'Flank|VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	881						extracellular region (GO:0005576)		p.C881S(1)|p.C77S(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GATTTCCAGATGCATGGGTCC	0.438																																							uc010vbq.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2641-2643)TGC>AGC		von Willebrand factor A domain containing 3A							69.0	70.0	70.0					16																	22155616		1964	4162	6126	SO:0001583	missense	146177					extracellular region		g.chr16:22155616T>A	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2641T>A	16.37:g.22155616T>A	ENSP00000374049:p.Cys881Ser		Somatic				VWA3A_uc010bxd.2_RNA|VWA3A_uc002dkg.3_5'UTR|VWA3A_uc010bxe.1_5'Flank	p.C881S	NM_173615	NP_775886	WXS	Illumina HiSeq	Unspecified	A6NCI4	VWA3A_HUMAN		GBM - Glioblastoma multiforme(48;0.0439)	26	2737	+			881					A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	c.2641T>A	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	T	9.406	1.079314	0.20227	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.11385	2.78	5.05	-1.77	0.07982	.	1.132580	0.06528	N	0.740809	T	0.10637	0.0260	L	0.36672	1.1	0.19300	N	0.999976	B	0.25312	0.123	B	0.23716	0.048	T	0.40831	-0.9542	10	0.42905	T	0.14	.	13.1192	0.59316	0.0:0.7307:0.0:0.2693	.	881	A6NCI4	VWA3A_HUMAN	S	881;504	ENSP00000374049:C881S	ENSP00000299840:C504S	C	+	1	0	VWA3A	22063117	0.038000	0.19896	0.023000	0.16930	0.792000	0.44763	-0.235000	0.09016	-0.245000	0.09625	0.460000	0.39030	TGC		0.438	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1			4	28	0	0	0	0.009096	0	4	28				
DRC7	84229	broad.mit.edu	37	16	57734101	57734101	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr16:57734101C>T	ENST00000360716.3	+	5	644	c.423C>T	c.(421-423)ccC>ccT	p.P141P	RP11-405F3.4_ENST00000563062.1_RNA|CCDC135_ENST00000336825.8_Silent_p.P141P|CCDC135_ENST00000394337.4_Silent_p.P141P			Q8IY82	CC135_HUMAN		141					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						TGCCCTACCCCGAGCTCTACA	0.577																																							uc002emi.2		NA																	0				central_nervous_system(1)	1						c.(421-423)CCC>CCT		coiled-coil domain containing 135							141.0	131.0	134.0					16																	57734101		2198	4300	6498	SO:0001819	synonymous_variant	84229					cytoplasm		g.chr16:57734101C>T																												ENST00000360716.3:c.423C>T	16.37:g.57734101C>T			Somatic				CCDC135_uc002emj.2_Silent_p.P141P|CCDC135_uc002emk.2_Silent_p.P141P	p.P141P	NM_032269	NP_115645	WXS	Illumina HiSeq	Unspecified	Q8IY82	CC135_HUMAN			4	512	+			141					A8K943|Q8NAA0|Q9H080	Silent	SNP	ENST00000360716.3	37	c.423C>T	CCDS10787.1																																																																																				0.577	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2			12	162	0	0	0	0.010729	0	12	162				
ALDOC	230	broad.mit.edu	37	17	26902474	26902474	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr17:26902474G>T	ENST00000226253.4	-	2	552	c.77C>A	c.(76-78)cCg>cAg	p.P26Q	ALDOC_ENST00000395319.3_Missense_Mutation_p.P26Q|ALDOC_ENST00000395321.2_Missense_Mutation_p.P26Q|RP11-192H23.5_ENST00000585189.1_RNA	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	26					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					GCCTTTGCCCGGGGCTACAAT	0.572											OREG0024278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002hbp.2		NA																	0				ovary(1)	1						c.(76-78)CCG>CAG		fructose-bisphosphate aldolase C							101.0	88.0	92.0					17																	26902474		2203	4300	6503	SO:0001583	missense	230				fructose 1,6-bisphosphate metabolic process|gluconeogenesis|glycolysis	cytosol	cytoskeletal protein binding|fructose-bisphosphate aldolase activity	g.chr17:26902474G>T	AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.77C>A	17.37:g.26902474G>T	ENSP00000226253:p.Pro26Gln		Somatic	OREG0024278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	790	ALDOC_uc010cro.2_Missense_Mutation_p.P26Q	p.P26Q	NM_005165	NP_005156	WXS	Illumina HiSeq	Unspecified	P09972	ALDOC_HUMAN			2	222	-	Lung NSC(42;0.00431)		26					B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	ENST00000226253.4	37	c.77C>A	CCDS11236.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483662	0.44147	.	.	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321;ENST00000435638	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	6.07	6.07	0.98685	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.91250	0.7242	M	0.87038	2.855	0.80722	D	1	P;B	0.36874	0.572;0.293	B;B	0.41723	0.365;0.252	D	0.91478	0.5202	10	0.87932	D	0	.	19.4154	0.94694	0.0:0.0:1.0:0.0	.	26;26	A8MVZ9;P09972	.;ALDOC_HUMAN	Q	26	ENSP00000378729:P26Q;ENSP00000226253:P26Q;ENSP00000378731:P26Q;ENSP00000398976:P26Q	ENSP00000226253:P26Q	P	-	2	0	ALDOC	23926601	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CCG		0.572	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255839.4			7	69	1	0	2.7689e-08	0.001984	3.30729e-08	7	69				
GPR179	440435	broad.mit.edu	37	17	36499178	36499178	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr17:36499178C>T	ENST00000342292.4	-	1	515	c.495G>A	c.(493-495)caG>caA	p.Q165Q		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	165					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TCCGGGTGGCCTGCAGGGCCA	0.647																																							uc002hpz.2		NA																	0				ovary(3)	3						c.(493-495)CAG>CAA		GPR158-like 1 precursor							50.0	54.0	53.0					17																	36499178		1952	4124	6076	SO:0001819	synonymous_variant	440435					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr17:36499178C>T		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.495G>A	17.37:g.36499178C>T			Somatic					p.Q165Q	NM_001004334	NP_001004334	WXS	Illumina HiSeq	Unspecified	Q6PRD1	GP179_HUMAN			1	516	-	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)	165			Extracellular (Potential).			Silent	SNP	ENST00000342292.4	37	c.495G>A	CCDS42308.1																																																																																				0.647	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2			8	65	0	0	0	0.004482	0	8	65				
SMG8	55181	broad.mit.edu	37	17	57290862	57290862	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr17:57290862C>T	ENST00000543872.2	+	4	2942	c.2678C>T	c.(2677-2679)tCa>tTa	p.S893L	SMG8_ENST00000300917.5_Missense_Mutation_p.S893L|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	893					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TATATTCTGTCATCCTCTCAA	0.423																																							uc002ixi.2		NA																	0					0						c.(2677-2679)TCA>TTA		SMG8 protein							115.0	121.0	119.0					17																	57290862		2203	4300	6503	SO:0001583	missense	55181				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding	g.chr17:57290862C>T	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2678C>T	17.37:g.57290862C>T	ENSP00000438748:p.Ser893Leu		Somatic					p.S893L	NM_018149	NP_060619	WXS	Illumina HiSeq	Unspecified	Q8ND04	SMG8_HUMAN			3	2720	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		893					Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	c.2678C>T	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762015	0.69763	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.51071	0.72;0.72	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.63022	0.2476	L	0.54323	1.7	0.58432	D	0.999999	D	0.63046	0.992	P	0.60068	0.868	T	0.60875	-0.7176	10	0.51188	T	0.08	-13.163	19.1378	0.93435	0.0:1.0:0.0:0.0	.	893	Q8ND04	SMG8_HUMAN	L	893	ENSP00000300917:S893L;ENSP00000438748:S893L	ENSP00000300917:S893L	S	+	2	0	SMG8	54645644	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.740000	0.84986	2.755000	0.94549	0.655000	0.94253	TCA		0.423	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		9	157	0	0	0	0.004482	0	9	157				
GRB2	2885	broad.mit.edu	37	17	73316622	73316622	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr17:73316622C>A	ENST00000392562.1	-	6	1263	c.481G>T	c.(481-483)Gtc>Ttc	p.V161F	GRB2_ENST00000578961.1_Silent_p.T104T|GRB2_ENST00000392564.1_Missense_Mutation_p.V161F|GRB2_ENST00000316804.5_Missense_Mutation_p.V161F|GRB2_ENST00000392563.1_Missense_Mutation_p.V120F|GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000316615.5_Missense_Mutation_p.V120F			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	161	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AGGGCCTGGACGTATGTCGGC	0.562																																							uc002jnx.3		NA																	0				ovary(3)	3						c.(481-483)GTC>TTC		growth factor receptor-bound protein 2 isoform	Pegademase bovine(DB00061)						51.0	56.0	54.0					17																	73316622		2203	4300	6503	SO:0001583	missense	2885				axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity	g.chr17:73316622C>A		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.481G>T	17.37:g.73316622C>A	ENSP00000376345:p.Val161Phe		Somatic				GRB2_uc002jny.3_Missense_Mutation_p.V120F	p.V161F	NM_002086	NP_002077	WXS	Illumina HiSeq	Unspecified	P62993	GRB2_HUMAN	all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		6	838	-	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		161			SH3 2.		P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	c.481G>T	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114798	0.94339	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564;ENST00000392563;ENST00000316615	T;T;T;T;T	0.52526	0.81;0.81;0.81;0.66;0.66	5.45	5.45	0.79879	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.68063	0.2960	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.60682	-0.7215	10	0.14656	T	0.56	-33.892	19.4688	0.94954	0.0:1.0:0.0:0.0	.	120;161	P62993-2;P62993	.;GRB2_HUMAN	F	161;161;161;120;120	ENSP00000339007:V161F;ENSP00000376345:V161F;ENSP00000376347:V161F;ENSP00000376346:V120F;ENSP00000317360:V120F	ENSP00000317360:V120F	V	-	1	0	GRB2	70828217	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.615000	0.83006	2.838000	0.97847	0.561000	0.74099	GTC		0.562	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1			7	50	1	0	7.48243e-07	0.006214	8.54189e-07	7	50				
TMX3	54495	broad.mit.edu	37	18	66344295	66344295	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr18:66344295T>C	ENST00000299608.2	-	16	1556	c.1240A>G	c.(1240-1242)Aaa>Gaa	p.K414E		NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	414					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						TTTTCACTTTTAGACACTTCA	0.463																																							uc002lkf.2		NA																	0				skin(1)	1						c.(1240-1242)AAA>GAA		thioredoxin domain containing 10 precursor							193.0	163.0	173.0					18																	66344295		2203	4300	6503	SO:0001583	missense	54495				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr18:66344295T>C	BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.1240A>G	18.37:g.66344295T>C	ENSP00000299608:p.Lys414Glu		Somatic				TMX3_uc010xez.1_Missense_Mutation_p.K273E	p.K414E	NM_019022	NP_061895	WXS	Illumina HiSeq	Unspecified	Q96JJ7	TMX3_HUMAN			16	1375	-			414			Cytoplasmic (Potential).		B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Missense_Mutation	SNP	ENST00000299608.2	37	c.1240A>G	CCDS32840.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.280028	0.40294	.	.	ENSG00000166479	ENST00000299608;ENST00000544714	T	0.10099	2.91	5.32	2.92	0.33932	.	0.517285	0.21951	N	0.066724	T	0.05090	0.0136	N	0.08118	0	0.23594	N	0.997334	B	0.21821	0.061	B	0.20577	0.03	T	0.37220	-0.9715	10	0.33141	T	0.24	.	7.0842	0.25247	0.0:0.0775:0.1497:0.7728	.	414	Q96JJ7	TMX3_HUMAN	E	414	ENSP00000299608:K414E	ENSP00000299608:K414E	K	-	1	0	TMX3	64495275	0.997000	0.39634	0.015000	0.15790	0.746000	0.42486	4.359000	0.59449	0.828000	0.34709	-0.323000	0.08544	AAA		0.463	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420155.1	NM_019022		16	141	0	0	0	0.006122	0	16	141				
ZNF236	7776	broad.mit.edu	37	18	74671705	74671705	+	Silent	SNP	A	A	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr18:74671705A>G	ENST00000253159.8	+	29	5367	c.5169A>G	c.(5167-5169)aaA>aaG	p.K1723K	ZNF236_ENST00000320610.9_Silent_p.K1725K	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1723					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GAGTGTTTAAATGTGACACTT	0.512																																							uc002lmi.2		NA																	0				ovary(4)	4						c.(5167-5169)AAA>AAG		zinc finger protein 236							64.0	68.0	66.0					18																	74671705		1980	4164	6144	SO:0001819	synonymous_variant	7776				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:74671705A>G	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.5169A>G	18.37:g.74671705A>G			Somatic				ZNF236_uc002lmj.2_RNA	p.K1723K	NM_007345	NP_031371	WXS	Illumina HiSeq	Unspecified	Q9UL36	ZN236_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)	29	5367	+		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)	1723			C2H2-type 28.		B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	37	c.5169A>G	CCDS42447.1																																																																																				0.512	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			7	49	0	0	0	0.00308	0	7	49				
KHSRP	8570	broad.mit.edu	37	19	6415180	6415180	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:6415180G>A	ENST00000398148.3	-	19	2191	c.2099C>T	c.(2098-2100)cCg>cTg	p.P700L	MIR3940_ENST00000579148.1_RNA|CTB-180A7.8_ENST00000398173.3_lincRNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	700					gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CGTGGGCGGCGGCTGGGGGCC	0.662																																					Colon(55;593 1006 2067 9135 22980)	Colon(55;593 1006 2067 9135 22980)	uc002mer.3		NA																	0				skin(1)	1						c.(2098-2100)CCG>CTG		KH-type splicing regulatory protein							15.0	20.0	19.0					19																	6415180		2001	4156	6157	SO:0001583	missense	8570				mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding	g.chr19:6415180G>A	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.2099C>T	19.37:g.6415180G>A	ENSP00000381216:p.Pro700Leu		Somatic					p.P700L	NM_003685	NP_003676	WXS	Illumina HiSeq	Unspecified	Q92945	FUBP2_HUMAN			19	2209	-			700					O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	c.2099C>T	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527734	0.27299	.	.	ENSG00000088247	ENST00000398148	T	0.44083	0.93	4.51	4.51	0.55191	.	1.380070	0.04945	N	0.459285	T	0.31358	0.0794	N	0.22421	0.69	0.51012	D	0.999907	P	0.40211	0.707	B	0.26517	0.07	T	0.28235	-1.0050	10	0.37606	T	0.19	.	16.3559	0.83235	0.0:0.0:1.0:0.0	.	700	Q92945	FUBP2_HUMAN	L	700	ENSP00000381216:P700L	ENSP00000381216:P700L	P	-	2	0	KHSRP	6366180	1.000000	0.71417	0.995000	0.50966	0.972000	0.66771	4.697000	0.61782	2.208000	0.71279	0.655000	0.94253	CCG		0.662	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1			7	26	0	0	0	0.001984	0	7	26				
ZNF844	284391	broad.mit.edu	37	19	12187210	12187210	+	Silent	SNP	A	A	G	rs6511764	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:12187210A>G	ENST00000439326.3	+	4	1450	c.1275A>G	c.(1273-1275)gtA>gtG	p.V425V	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						TAAGCAGTGTAGTAAAGCCTT	0.428													.|||	1455	0.290535	0.73	0.1455	5008	,	,		23733	0.0853		0.161	False		,,,				2504	0.1442						uc002mtb.2		NA																	0					0						c.(1273-1275)GTA>GTG		zinc finger protein 844		G		883,501		287,309,96	54.0	57.0	56.0		1275	0.5	0.0	19	dbSNP_116	56	413,2769		25,363,1203	no	coding-synonymous	ZNF844	NM_001136501.1		312,672,1299	GG,GA,AA		12.9793,36.1994,28.3837		425/667	12187210	1296,3270	692	1591	2283	SO:0001819	synonymous_variant	284391				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12187210A>G	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1275A>G	19.37:g.12187210A>G			Somatic				ZNF844_uc010dym.1_Silent_p.V268V	p.V425V	NM_001136501	NP_001129973	WXS	Illumina HiSeq	Unspecified	Q08AG5	ZN844_HUMAN			4	1418	+			425					Q5JPI8	Silent	SNP	ENST00000439326.3	37	c.1275A>G	CCDS45985.1																																																																																				0.428	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2			3	50	0	0	0	0.004672	0	3	50				
ZNF44	51710	broad.mit.edu	37	19	12384105	12384105	+	Missense_Mutation	SNP	C	C	T	rs144293271	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:12384105C>T	ENST00000356109.5	-	5	1227	c.1109G>A	c.(1108-1110)gGa>gAa	p.G370E	ZNF44_ENST00000355684.5_Missense_Mutation_p.G322E	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TTGAAAGCTTCCAAGATGACA	0.418													C|||	9	0.00179712	0.0	0.0029	5008	,	,		23664	0.0		0.003	False		,,,				2504	0.0041						uc010xmj.1		NA																	0				ovary(1)	1						c.(1108-1110)GGA>GAA		zinc finger protein 44 isoform 1		C	GLU/GLY,GLU/GLY	6,4400	11.4+/-27.6	0,6,2197	139.0	142.0	141.0		1109,965	-2.0	0.0	19	dbSNP_134	141	25,8575	16.6+/-54.9	0,25,4275	yes	missense,missense	ZNF44	NM_001164276.1,NM_016264.3	98,98	0,31,6472	TT,TC,CC		0.2907,0.1362,0.2384	probably-damaging,probably-damaging	370/664,322/616	12384105	31,12975	2203	4300	6503	SO:0001583	missense	51710				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:12384105C>T	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1109G>A	19.37:g.12384105C>T	ENSP00000348419:p.Gly370Glu		Somatic				ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.G322E	p.G370E	NM_001164276	NP_001157748	WXS	Illumina HiSeq	Unspecified	P15621	ZNF44_HUMAN		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)	5	1314	-		Renal(1328;0.157)	370			C2H2-type 7.		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	c.1109G>A	CCDS54223.1	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	12.96	2.094469	0.36952	0.001362	0.002907	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.15139	2.45;2.45;2.45	0.997	-1.95	0.07548	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18676	0.0448	N	0.20304	0.555	.	.	.	P;D	0.69078	0.773;0.997	P;D	0.69479	0.529;0.964	T	0.25950	-1.0117	8	0.62326	D	0.03	.	3.6019	0.08028	0.2092:0.2759:0.5149:0.0	.	370;322	P15621;F8W7T7	ZNF44_HUMAN;.	E	370;370;322;322	ENSP00000377008:G370E;ENSP00000348419:G370E;ENSP00000347910:G322E	ENSP00000347910:G322E	G	-	2	0	ZNF44	12245105	0.000000	0.05858	0.000000	0.03702	0.785000	0.44390	-1.976000	0.01497	-0.508000	0.06540	0.305000	0.20034	GGA		0.418	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264		5	175	0	0	0	0.001168	0	5	175				
TSHZ3	57616	broad.mit.edu	37	19	31768243	31768243	+	Missense_Mutation	SNP	G	G	A	rs150738892	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:31768243G>A	ENST00000240587.4	-	2	2783	c.2456C>T	c.(2455-2457)tCa>tTa	p.S819L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	819					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CACCGTGGATGAGGAGGTTGC	0.527																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2455-2457)TCA>TTA		zinc finger protein 537		G	LEU/SER	0,4406		0,0,2203	119.0	104.0	109.0		2456	5.4	1.0	19	dbSNP_134	109	3,8597	3.0+/-9.4	0,3,4297	yes	missense	TSHZ3	NM_020856.2	145	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	819/1082	31768243	3,13003	2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768243G>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2456C>T	19.37:g.31768243G>A	ENSP00000240587:p.Ser819Leu		Somatic					p.S819L	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2521	-	Esophageal squamous(110;0.226)		819					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2456C>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.770233	0.49680	0.0	3.49E-4	ENSG00000121297	ENST00000240587	T	0.13657	2.57	5.37	5.37	0.77165	.	0.062813	0.64402	D	0.000003	T	0.10252	0.0251	N	0.08118	0	0.58432	D	0.999998	P	0.37781	0.608	B	0.37943	0.261	T	0.23440	-1.0188	10	0.59425	D	0.04	-11.905	19.1085	0.93307	0.0:0.0:1.0:0.0	.	819	Q63HK5	TSH3_HUMAN	L	819	ENSP00000240587:S819L	ENSP00000240587:S819L	S	-	2	0	TSHZ3	36460083	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.429000	0.97481	2.501000	0.84356	0.655000	0.94253	TCA		0.527	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		6	72	0	0	0	0.001984	0	6	72				
TSHZ3	57616	broad.mit.edu	37	19	31769932	31769932	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:31769932T>G	ENST00000240587.4	-	2	1094	c.767A>C	c.(766-768)aAg>aCg	p.K256T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	256					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTTGCGAGGCTTGGACCAGCG	0.562																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(766-768)AAG>ACG		zinc finger protein 537							227.0	199.0	209.0					19																	31769932		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31769932T>G	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.767A>C	19.37:g.31769932T>G	ENSP00000240587:p.Lys256Thr		Somatic					p.K256T	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	832	-	Esophageal squamous(110;0.226)		256					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.767A>C	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	T	19.87	3.907486	0.72868	.	.	ENSG00000121297	ENST00000240587	T	0.14766	2.48	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	M	0.72479	2.2	0.80722	D	1	D	0.63046	0.992	D	0.85130	0.997	T	0.16364	-1.0405	10	0.72032	D	0.01	-28.6287	15.652	0.77104	0.0:0.0:0.0:1.0	.	256	Q63HK5	TSH3_HUMAN	T	256	ENSP00000240587:K256T	ENSP00000240587:K256T	K	-	2	0	TSHZ3	36461772	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.694000	0.84235	2.076000	0.62316	0.533000	0.62120	AAG		0.562	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		34	221	0	0	0	0.021022	0	34	221				
ZFP14	57677	broad.mit.edu	37	19	36832176	36832177	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:36832176_36832177GC>AA	ENST00000270001.7	-	5	666_667	c.551_552GC>TT	c.(550-552)cGC>cTT	p.R184L		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	184					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TAAGTGTTGAGCGACGAATAAA	0.411																																							uc002odx.1		NA																	0				ovary(1)	1						c.(550-552)CGC>CTT		zinc finger protein 14-like																																				SO:0001583	missense	57677				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36832176_36832177GC>AA	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.551_552delinsAA	19.37:g.36832176_36832177delinsAA	ENSP00000270001:p.Arg184Leu		Somatic				ZFP14_uc010xtd.1_Missense_Mutation_p.R185L|ZFP14_uc010eex.1_Missense_Mutation_p.R184L	p.R184L	NM_020917	NP_065968	WXS	Illumina HiSeq	Unspecified	Q9HCL3	ZFP14_HUMAN			4	644_645	-	Esophageal squamous(110;0.162)		184			C2H2-type 1.		A7MD23	Missense_Mutation	DNP	ENST00000270001.7	37	c.551_552GC>TT	CCDS33002.1																																																																																				0.411	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917		21	135	0	0	0	0.004672	0	21	135				
IZUMO1	284359	broad.mit.edu	37	19	49246723	49246723	+	Nonsense_Mutation	SNP	G	G	A	rs146399718		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr19:49246723G>A	ENST00000332955.2	-	6	1025	c.478C>T	c.(478-480)Cga>Tga	p.R160*	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	160					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		TAGGACTTTCGACAAGCGTGA	0.557																																							uc002pkj.2		NA																	0				ovary(1)	1						c.(478-480)CGA>TGA		izumo sperm-egg fusion 1 precursor		G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	87.0	97.0		478	3.9	0.4	19	dbSNP_134	97	0,8600		0,0,4300	no	stop-gained	IZUMO1	NM_182575.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		160/351	49246723	1,13005	2203	4300	6503	SO:0001587	stop_gained	284359				fusion of sperm to egg plasma membrane	integral to membrane		g.chr19:49246723G>A	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.478C>T	19.37:g.49246723G>A	ENSP00000327786:p.Arg160*		Somatic				RASIP1_uc002pki.2_5'Flank|IZUMO1_uc010eme.2_RNA|IZUMO1_uc010emf.2_RNA	p.R160*	NM_182575	NP_872381	WXS	Illumina HiSeq	Unspecified	Q8IYV9	IZUM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)	6	1026	-		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)	160			Extracellular (Potential).		Q6Q8P6|Q6Q8P7	Nonsense_Mutation	SNP	ENST00000332955.2	37	c.478C>T	CCDS12732.1	.	.	.	.	.	.	.	.	.	.	G	39	7.611065	0.98390	2.27E-4	0.0	ENSG00000182264	ENST00000332955	.	.	.	4.92	3.87	0.44632	.	0.594677	0.15272	N	0.271164	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6463	10.7049	0.45950	0.0:0.0:0.8094:0.1906	.	.	.	.	X	160	.	ENSP00000327786:R160X	R	-	1	2	IZUMO1	53938535	0.094000	0.21725	0.359000	0.25824	0.113000	0.19764	0.848000	0.27710	1.432000	0.47375	0.561000	0.74099	CGA		0.557	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	NM_182575		4	36	0	0	0	0.014758	0	4	36				
ATAD2B	54454	broad.mit.edu	37	2	24056803	24056803	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:24056803G>C	ENST00000238789.5	-	14	2057	c.1714C>G	c.(1714-1716)Ctg>Gtg	p.L572V	ATAD2B_ENST00000474583.1_5'Flank	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	572						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGATCAGGCAGGTTGAAGAGG	0.353																																							uc002rek.3		NA																	0				central_nervous_system(1)	1						c.(1714-1716)CTG>GTG		ATPase family, AAA domain containing 2B							59.0	56.0	57.0					2																	24056803		1854	4106	5960	SO:0001583	missense	54454						ATP binding|nucleoside-triphosphatase activity	g.chr2:24056803G>C	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1714C>G	2.37:g.24056803G>C	ENSP00000238789:p.Leu572Val		Somatic				ATAD2B_uc010yki.1_RNA|ATAD2B_uc002rej.3_5'Flank	p.L572V	NM_017552	NP_060022	WXS	Illumina HiSeq	Unspecified	Q9ULI0	ATD2B_HUMAN			14	2008	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		572					B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	c.1714C>G	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308238	0.60305	.	.	ENSG00000119778	ENST00000238789	D	0.95205	-3.64	4.97	2.04	0.26737	ATPase, AAA+ type, core (1);	.	.	.	.	D	0.95978	0.8690	M	0.79343	2.45	0.44702	D	0.99769	D	0.89917	1.0	D	0.97110	1.0	D	0.93683	0.7000	9	0.48119	T	0.1	.	6.1213	0.20154	0.556:0.0:0.444:0.0	.	572	Q9ULI0	ATD2B_HUMAN	V	572	ENSP00000238789:L572V	ENSP00000238789:L572V	L	-	1	2	ATAD2B	23910307	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	0.951000	0.29135	0.550000	0.28991	0.563000	0.77884	CTG		0.353	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552		5	36	0	0	0	0.001168	0	5	36				
CRIM1	51232	broad.mit.edu	37	2	36771546	36771546	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:36771546T>C	ENST00000280527.2	+	15	3018	c.2651T>C	c.(2650-2652)aTa>aCa	p.I884T	AC007401.2_ENST00000406220.1_Intron	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	884					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CCAACCAATATACCCATTGAG	0.438																																							uc002rpd.2		NA																	0				ovary(2)|skin(1)	3						c.(2650-2652)ATA>ACA		cysteine-rich motor neuron 1 precursor							131.0	130.0	130.0					2																	36771546		2203	4300	6503	SO:0001583	missense	51232				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity	g.chr2:36771546T>C	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2651T>C	2.37:g.36771546T>C	ENSP00000280527:p.Ile884Thr		Somatic					p.I884T	NM_016441	NP_057525	WXS	Illumina HiSeq	Unspecified	Q9NZV1	CRIM1_HUMAN			15	2690	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	884			Extracellular (Potential).		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	c.2651T>C	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.031489	0.54790	.	.	ENSG00000150938	ENST00000280527	T	0.05025	3.51	5.81	5.81	0.92471	.	0.182907	0.47455	D	0.000222	T	0.05227	0.0139	L	0.27053	0.805	0.34524	D	0.708437	B	0.27559	0.181	B	0.21708	0.036	T	0.26189	-1.0110	10	0.09084	T	0.74	-1.6567	15.3479	0.74355	0.0:0.0:0.0:1.0	.	884	Q9NZV1	CRIM1_HUMAN	T	884	ENSP00000280527:I884T	ENSP00000280527:I884T	I	+	2	0	CRIM1	36625050	0.987000	0.35691	0.461000	0.27105	0.990000	0.78478	6.371000	0.73119	2.210000	0.71456	0.533000	0.62120	ATA		0.438	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441		10	98	0	0	0	0.006214	0	10	98				
MAP4K3	8491	broad.mit.edu	37	2	39481642	39481642	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:39481642C>T	ENST00000263881.3	-	32	2814	c.2490G>A	c.(2488-2490)gtG>gtA	p.V830V	MAP4K3_ENST00000536018.1_Silent_p.V383V|MAP4K3_ENST00000341681.5_Silent_p.V809V|MAP4K3_ENST00000437545.1_Silent_p.V746V	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	830	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				AGAAAGCTAGCACACTGTCTT	0.358																																							uc002rro.2		NA																	0				ovary(3)|lung(3)|stomach(1)|pancreas(1)	8						c.(2488-2490)GTG>GTA		mitogen-activated protein kinase kinase kinase							186.0	166.0	173.0					2																	39481642		2203	4300	6503	SO:0001819	synonymous_variant	8491				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr2:39481642C>T	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.2490G>A	2.37:g.39481642C>T			Somatic				MAP4K3_uc002rrp.2_Silent_p.V809V|MAP4K3_uc010yns.1_Silent_p.V383V	p.V830V	NM_003618	NP_003609	WXS	Illumina HiSeq	Unspecified	Q8IVH8	M4K3_HUMAN			32	2581	-		all_hematologic(82;0.211)	830			CNH.		Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Silent	SNP	ENST00000263881.3	37	c.2490G>A	CCDS1803.1																																																																																				0.358	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		11	93	0	0	0	0.016723	0	11	93				
WASH2P	375260	broad.mit.edu	37	2	114357557	114357557	+	RNA	SNP	A	A	G	rs377652994		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:114357557A>G	ENST00000538033.2	+	0	2800							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCCTACTTCTAGTGAAACTGG	0.567																																							uc010yxx.1		NA																	0					0						c.(382-384)TAG>CAG		SubName: Full=DEAD/H box polypeptide 11 like 2;																																						84771							g.chr2:114357557A>G			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114357557A>G			Somatic					p.*128Q			WXS	Illumina HiSeq	Unspecified					3	709	-									Nonstop_Mutation	SNP	ENST00000538033.2	37	c.382T>C																																																																																					0.567	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1	NM_198943		3	43	0	0	0	0.009096	0	3	43				
CFAP221	200373	broad.mit.edu	37	2	120395937	120395937	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:120395937G>C	ENST00000413369.3	+	20	2164	c.2077G>C	c.(2077-2079)Gag>Cag	p.E693Q	PCDP1_ENST00000602047.1_Missense_Mutation_p.E407Q	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					ATTCACCAAAGAGTCCCGCCA	0.502																																							uc002tmb.2		NA																	0					0						c.(1219-1221)GAG>CAG		primary ciliary dyskinesia protein 1							102.0	103.0	103.0					2																	120395937		2203	4300	6503	SO:0001583	missense	200373					cilium	calmodulin binding	g.chr2:120395937G>C																												ENST00000413369.3:c.2077G>C	2.37:g.120395937G>C	ENSP00000393222:p.Glu693Gln		Somatic					p.E407Q	NM_001029996	NP_001025167	WXS	Illumina HiSeq	Unspecified	Q4G0U5	PCDP1_HUMAN			21	2311	+	Colorectal(110;0.196)		693						Missense_Mutation	SNP	ENST00000413369.3	37	c.1219G>C	CCDS33282.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.47|14.47	2.545510|2.545510	0.45280|0.45280	.|.	.|.	ENSG00000163075|ENSG00000163075	ENST00000295220;ENST00000413369|ENST00000443972	T|T	0.32023|0.35048	1.47|1.33	5.4|5.4	4.5|4.5	0.54988|0.54988	.|.	0.233513|.	0.34110|.	N|.	0.004245|.	T|T	0.42017|0.42017	0.1184|0.1184	L|L	0.43923|0.43923	1.385|1.385	0.80722|0.80722	D|D	1|1	D|.	0.59767|.	0.986|.	P|.	0.51016|.	0.656|.	T|T	0.33189|0.33189	-0.9878|-0.9878	10|7	0.39692|0.56958	T|D	0.17|0.05	-18.4882|-18.4882	11.8024|11.8024	0.52135|0.52135	0.0:0.1763:0.8237:0.0|0.0:0.1763:0.8237:0.0	.|.	693|.	Q4G0U5|.	PCDP1_HUMAN|.	Q|N	407;693|251	ENSP00000393222:E693Q|ENSP00000413299:K251N	ENSP00000295220:E407Q|ENSP00000413299:K251N	E|K	+|+	1|3	0|2	AC069154.2|AC069154.2	120112407|120112407	1.000000|1.000000	0.71417|0.71417	0.880000|0.880000	0.34516|0.34516	0.477000|0.477000	0.33069|0.33069	2.793000|2.793000	0.47845|0.47845	1.469000|1.469000	0.48083|0.48083	0.655000|0.655000	0.94253|0.94253	GAG|AAG		0.502	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1			7	160	0	0	0	0.004482	0	7	160				
UBXN4	23190	broad.mit.edu	37	2	136537772	136537773	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:136537772_136537773CC>TT	ENST00000272638.9	+	12	1516_1517	c.1205_1206CC>TT	c.(1204-1206)tCC>tTT	p.S402F	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	402					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						CCAACTGCATCCATTGTACACT	0.396																																							uc002tur.2		NA																	0				skin(2)	2						c.(1204-1206)TCC>TTT		UBX domain containing 2																																				SO:0001583	missense	23190				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding	g.chr2:136537772_136537773CC>TT	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	Exception_encountered	2.37:g.136537772_136537773delinsTT	ENSP00000272638:p.Ser402Phe		Somatic				UBXN4_uc002tus.2_Missense_Mutation_p.S168F|UBXN4_uc002tut.2_Missense_Mutation_p.S38F	p.S402F	NM_014607	NP_055422	WXS	Illumina HiSeq	Unspecified	Q92575	UBXN4_HUMAN			12	1516_1517	+			402			Cytoplasmic (Potential).		A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	DNP	ENST00000272638.9	37	c.1205_1206CC>TT	CCDS42761.1																																																																																				0.396	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607		8	118	0	0	0	0.004672	0	8	118				
SSFA2	6744	broad.mit.edu	37	2	182774637	182774637	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:182774637G>A	ENST00000431877.2	+	9	1604	c.1425G>A	c.(1423-1425)acG>acA	p.T475T	SSFA2_ENST00000428267.2_Silent_p.T322T|SSFA2_ENST00000409001.1_Silent_p.T475T|SSFA2_ENST00000409136.1_5'Flank|SSFA2_ENST00000320370.7_Silent_p.T475T	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	475						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TTCAAAGTACGGAGGGAGAAG	0.373																																							uc002uoi.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1423-1425)ACG>ACA		sperm specific antigen 2 isoform 1							68.0	61.0	63.0					2																	182774637		2203	4300	6503	SO:0001819	synonymous_variant	6744					cytoplasm|plasma membrane	actin binding	g.chr2:182774637G>A	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1425G>A	2.37:g.182774637G>A			Somatic				SSFA2_uc002uoh.2_Silent_p.T475T|SSFA2_uc002uoj.2_Silent_p.T475T|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Silent_p.T322T|SSFA2_uc002uol.2_Silent_p.T322T	p.T475T	NM_001130445	NP_001123917	WXS	Illumina HiSeq	Unspecified	P28290	SSFA2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0856)		9	1747	+			475					A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Silent	SNP	ENST00000431877.2	37	c.1425G>A	CCDS46467.1																																																																																				0.373	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751		4	53	0	0	0	0.014758	0	4	53				
DNAH7	56171	broad.mit.edu	37	2	196729689	196729689	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:196729689G>C	ENST00000312428.6	-	41	6790	c.6690C>G	c.(6688-6690)atC>atG	p.I2230M		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2230					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAATGTAGTTGATGAGCCAGC	0.363																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(6688-6690)ATC>ATG		dynein, axonemal, heavy chain 7							87.0	82.0	84.0					2																	196729689		1837	4090	5927	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196729689G>C	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6690C>G	2.37:g.196729689G>C	ENSP00000311273:p.Ile2230Met		Somatic					p.I2230M	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			41	6791	-			2230					B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.6690C>G	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	1.015	-0.686702	0.03328	.	.	ENSG00000118997	ENST00000312428	T	0.41400	1.0	4.98	0.0116	0.14088	.	0.517604	0.18862	N	0.129092	T	0.25306	0.0615	L	0.33485	1.01	0.20764	N	0.999853	B	0.28933	0.228	B	0.33121	0.158	T	0.11372	-1.0590	10	0.34782	T	0.22	.	1.3447	0.02161	0.4609:0.1643:0.2279:0.1469	.	2230	Q8WXX0	DYH7_HUMAN	M	2230	ENSP00000311273:I2230M	ENSP00000311273:I2230M	I	-	3	3	DNAH7	196437934	0.174000	0.23070	0.001000	0.08648	0.005000	0.04900	0.467000	0.22035	0.103000	0.17682	-0.253000	0.11424	ATC		0.363	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		4	112	0	0	0	0.014758	0	4	112				
UGT1A5	54579	broad.mit.edu	37	2	234622444	234622444	+	Silent	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr2:234622444C>A	ENST00000373414.3	+	1	807	c.807C>A	c.(805-807)atC>atA	p.I269I	UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000608381.1_Silent_p.I269I|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	269						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		CCAGGCCGATCATGCCCAACA	0.512																																							uc002vuw.2		NA																	0				skin(1)	1						c.(805-807)ATC>ATA		UDP glycosyltransferase 1 family, polypeptide A5							91.0	106.0	101.0					2																	234622444		2202	4295	6497	SO:0001819	synonymous_variant	54579				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr2:234622444C>A	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.807C>A	2.37:g.234622444C>A			Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Silent_p.I269I	p.I269I	NM_019078	NP_061951	WXS	Illumina HiSeq	Unspecified	P35504	UD15_HUMAN		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)	1	807	+		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)	269					B8K294	Silent	SNP	ENST00000373414.3	37	c.807C>A	CCDS33404.1																																																																																				0.512	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078		41	182	1	0	3.76604e-16	0.010771	4.76293e-16	41	182				
CBLN4	140689	broad.mit.edu	37	20	54579155	54579155	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr20:54579155C>T	ENST00000064571.2	-	1	1373	c.73G>A	c.(73-75)Gtc>Atc	p.V25I		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	25					protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			TGTGCCCAGACGGGCAGCCCC	0.721																																							uc002xxa.2		NA																	0				ovary(3)|pancreas(1)	4						c.(73-75)GTC>ATC		cerebellin 4 precursor							27.0	24.0	25.0					20																	54579155		2201	4298	6499	SO:0001583	missense	140689					cell junction|extracellular region|synapse		g.chr20:54579155C>T	AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.73G>A	20.37:g.54579155C>T	ENSP00000064571:p.Val25Ile		Somatic					p.V25I	NM_080617	NP_542184	WXS	Illumina HiSeq	Unspecified	Q9NTU7	CBLN4_HUMAN	Colorectal(105;0.202)		1	858	-			25					A8K0S5	Missense_Mutation	SNP	ENST00000064571.2	37	c.73G>A	CCDS13448.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707777	0.48412	.	.	ENSG00000054803	ENST00000064571	D	0.85411	-1.98	4.49	3.55	0.40652	.	0.381500	0.29087	N	0.013181	T	0.79799	0.4508	L	0.47716	1.5	0.26292	N	0.978108	B	0.11235	0.004	B	0.01281	0.0	T	0.68454	-0.5404	10	0.37606	T	0.19	-16.2108	12.3663	0.55230	0.0:0.9159:0.0:0.0841	.	25	Q9NTU7	CBLN4_HUMAN	I	25	ENSP00000064571:V25I	ENSP00000064571:V25I	V	-	1	0	CBLN4	54012562	1.000000	0.71417	0.842000	0.33263	0.646000	0.38490	2.978000	0.49305	1.011000	0.39340	0.655000	0.94253	GTC		0.721	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079783.2	NM_080617		3	24	0	0	0	0.004672	0	3	24				
KRTAP21-1	337977	broad.mit.edu	37	21	32127654	32127654	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr21:32127654C>A	ENST00000335093.3	-	1	92	c.43G>T	c.(43-45)Ggc>Tgc	p.G15C		NM_181619.1	NP_853650.1	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	15			G -> S (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			intermediate filament (GO:0005882)		p.G15S(1)		breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7						cagccacagccggagccatag	0.537																																							uc011adi.1		NA																	1	Substitution - Missense(1)	p.G15S(1)	breast(1)	breast(1)	1						c.(43-45)GGC>TGC		keratin associated protein 21-1							126.0	117.0	120.0					21																	32127654		2203	4300	6503	SO:0001583	missense	337977					intermediate filament		g.chr21:32127654C>A	AP001709	CCDS13606.1	21q22.1	2006-03-13			ENSG00000187005	ENSG00000187005		"""Keratin associated proteins"""	18945	protein-coding gene	gene with protein product						12359730	Standard	NM_181619		Approved	KAP21.1	uc011adi.2	Q3LI58	OTTHUMG00000057777	ENST00000335093.3:c.43G>T	21.37:g.32127654C>A	ENSP00000335566:p.Gly15Cys		Somatic					p.G15C	NM_181619	NP_853650	WXS	Illumina HiSeq	Unspecified	Q3LI58	KR211_HUMAN			1	43	-			15		G -> S (in a breast cancer sample; somatic mutation).				Missense_Mutation	SNP	ENST00000335093.3	37	c.43G>T	CCDS13606.1	.	.	.	.	.	.	.	.	.	.	C	5.238	0.229481	0.09916	.	.	ENSG00000187005	ENST00000335093	.	.	.	4.17	3.26	0.37387	.	.	.	.	.	T	0.49541	0.1563	.	.	.	0.25351	N	0.988867	D	0.59767	0.986	P	0.53593	0.73	T	0.36578	-0.9742	7	0.66056	D	0.02	.	9.2597	0.37605	0.2151:0.7849:0.0:0.0	.	15	Q3LI58	KR211_HUMAN	C	15	.	ENSP00000335566:G15C	G	-	1	0	KRTAP21-1	31049525	0.000000	0.05858	0.906000	0.35671	0.230000	0.25150	-0.171000	0.09883	1.293000	0.44690	0.609000	0.83330	GGC		0.537	KRTAP21-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128229.2			37	157	1	0	3.33393e-15	0.021022	4.17551e-15	37	157				
SLC25A18	83733	broad.mit.edu	37	22	18070012	18070012	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr22:18070012C>T	ENST00000327451.6	+	8	1058	c.520C>T	c.(520-522)Ctc>Ttc	p.L174F	AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Missense_Mutation_p.L174F	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	174						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CTGGGAGCTGCTCCGCACTCA	0.662																																					Colon(118;1560 1625 18964 29606 50093)	Colon(118;1560 1625 18964 29606 50093)	uc002zmp.1		NA																	0					0						c.(520-522)CTC>TTC		solute carrier	L-Glutamic Acid(DB00142)						78.0	76.0	76.0					22																	18070012		2203	4300	6503	SO:0001583	missense	83733					integral to membrane|mitochondrial inner membrane	binding|symporter activity	g.chr22:18070012C>T	AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.520C>T	22.37:g.18070012C>T	ENSP00000329033:p.Leu174Phe		Somatic				SLC25A18_uc010gqx.2_Missense_Mutation_p.L174F|SLC25A18_uc002zmq.1_Missense_Mutation_p.L174F	p.L174F	NM_031481	NP_113669	WXS	Illumina HiSeq	Unspecified	Q9H1K4	GHC2_HUMAN		Lung(27;0.124)	8	1014	+			174			Solcar 2.			Missense_Mutation	SNP	ENST00000327451.6	37	c.520C>T	CCDS13744.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833528	0.50951	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	T;T	0.80123	-1.34;-1.34	4.95	3.91	0.45181	Mitochondrial carrier domain (2);	0.274663	0.35739	N	0.003005	T	0.77226	0.4099	L	0.46670	1.46	0.40455	D	0.980184	B	0.27700	0.186	B	0.35688	0.208	T	0.77512	-0.2560	10	0.48119	T	0.1	.	13.2266	0.59919	0.0:0.9153:0.0:0.0847	.	174	Q9H1K4	GHC2_HUMAN	F	174	ENSP00000329033:L174F;ENSP00000382710:L174F	ENSP00000329033:L174F	L	+	1	0	SLC25A18	16450012	1.000000	0.71417	0.992000	0.48379	0.852000	0.48524	2.787000	0.47798	2.475000	0.83589	0.485000	0.47835	CTC		0.662	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3	NM_031481		10	126	0	0	0	0.008291	0	10	126				
CRYBB1	1414	broad.mit.edu	37	22	27012230	27012230	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr22:27012230C>T	ENST00000215939.2	-	2	184	c.54G>A	c.(52-54)ggG>ggA	p.G18G		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	18	N-terminal arm.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						TGGTGTCAGGCCCTGGGTTCA	0.627																																							uc003acy.1		NA																	0				ovary(1)	1						c.(52-54)GGG>GGA		crystallin, beta B1							63.0	61.0	61.0					22																	27012230		2203	4300	6503	SO:0001819	synonymous_variant	1414				visual perception		structural constituent of eye lens	g.chr22:27012230C>T		CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.54G>A	22.37:g.27012230C>T			Somatic					p.G18G	NM_001887	NP_001878	WXS	Illumina HiSeq	Unspecified	P53674	CRBB1_HUMAN			2	124	-			18			N-terminal arm.			Silent	SNP	ENST00000215939.2	37	c.54G>A	CCDS13840.1																																																																																				0.627	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887		13	76	0	0	0	0.016723	0	13	76				
POLR3H	171568	broad.mit.edu	37	22	41926706	41926706	+	Silent	SNP	A	A	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr22:41926706A>C	ENST00000355209.4	-	5	889	c.546T>G	c.(544-546)gcT>gcG	p.A182A	POLR3H_ENST00000407461.1_Silent_p.A182A|POLR3H_ENST00000420561.1_5'Flank|POLR3H_ENST00000337566.5_Silent_p.A153A|POLR3H_ENST00000396504.2_Silent_p.A182A	NM_001018050.2	NP_001018060.1	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)	182					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|nucleobase-containing compound metabolic process (GO:0006139)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|lung(5)|skin(1)|urinary_tract(1)	8						GCGTGTACGGAGCCTCCTTCT	0.627																																							uc003baf.2		NA																	0				skin(1)	1						c.(544-546)GCT>GCG		polymerase (RNA) III (DNA directed) polypeptide							72.0	64.0	67.0					22																	41926706		2203	4300	6503	SO:0001819	synonymous_variant	171568				innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr22:41926706A>C	AB051452	CCDS14018.1, CCDS33651.1	22q13	2013-01-21			ENSG00000100413	ENSG00000100413		"""RNA polymerase subunits"""	30349	protein-coding gene	gene with protein product						11258795, 12391170	Standard	XR_244356		Approved	RPC8, KIAA1665	uc003baf.3	Q9Y535	OTTHUMG00000150971	ENST00000355209.4:c.546T>G	22.37:g.41926706A>C			Somatic				POLR3H_uc003bae.2_RNA|POLR3H_uc003bag.2_Silent_p.A182A|POLR3H_uc003bai.2_Silent_p.A153A	p.A182A	NM_138338	NP_612211	WXS	Illumina HiSeq	Unspecified	Q9Y535	RPC8_HUMAN			6	606	-			182					B0QYH9|Q5M7Y8|Q96AE3|Q9BY95	Silent	SNP	ENST00000355209.4	37	c.546T>G	CCDS14018.1																																																																																				0.627	POLR3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320701.1	NM_138338		4	28	0	0	0	0.009096	0	4	28				
SUSD5	26032	broad.mit.edu	37	3	33195270	33195270	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:33195270C>G	ENST00000309558.3	-	5	1271	c.854G>C	c.(853-855)gGa>gCa	p.G285A		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	285					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CAGCCGTGATCCTGGTGAATC	0.527																																							uc003cfo.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(853-855)GGA>GCA		sushi domain containing 5 precursor							47.0	47.0	47.0					3																	33195270		1922	4135	6057	SO:0001583	missense	26032				cell adhesion	integral to membrane	hyaluronic acid binding	g.chr3:33195270C>G	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.854G>C	3.37:g.33195270C>G	ENSP00000308727:p.Gly285Ala		Somatic					p.G285A	NM_015551	NP_056366	WXS	Illumina HiSeq	Unspecified	O60279	SUSD5_HUMAN			5	1272	-			285			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000309558.3	37	c.854G>C	CCDS46787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.102|0.102	-1.151113|-1.151113	0.01700|0.01700	.|.	.|.	ENSG00000173705|ENSG00000173705	ENST00000412539|ENST00000309558	.|T	.|0.06142	.|3.34	6.02|6.02	-0.011|-0.011	0.13994|0.13994	.|.	.|0.466449	.|0.21210	.|N	.|0.078338	T|T	0.04679|0.04679	0.0127|0.0127	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	.|B	.|0.30741	.|0.293	.|B	.|0.22386	.|0.039	T|T	0.41556|0.41556	-0.9502|-0.9502	5|10	.|0.10111	.|T	.|0.7	-1.7143|-1.7143	4.4789|4.4789	0.11757|0.11757	0.1884:0.4625:0.0:0.3491|0.1884:0.4625:0.0:0.3491	.|.	.|285	.|O60279	.|SUSD5_HUMAN	H|A	221|285	.|ENSP00000308727:G285A	.|ENSP00000308727:G285A	D|G	-|-	1|2	0|0	SUSD5|SUSD5	33170274|33170274	0.638000|0.638000	0.27225|0.27225	0.001000|0.001000	0.08648|0.08648	0.023000|0.023000	0.10783|0.10783	1.075000|1.075000	0.30716|0.30716	0.263000|0.263000	0.21812|0.21812	-0.140000|-0.140000	0.14226|0.14226	GAT|GGA		0.527	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054		5	64	0	0	0	0.014758	0	5	64				
ULK4	54986	broad.mit.edu	37	3	41939949	41939949	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:41939949T>A	ENST00000301831.4	-	14	1785	c.1323A>T	c.(1321-1323)aaA>aaT	p.K441N	ULK4_ENST00000420927.1_Missense_Mutation_p.K441N|U8_ENST00000390843.2_RNA	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	441					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GATGCAATATTTTTGCATCAA	0.289																																							uc003ckv.3		NA																	0					0						c.(1321-1323)AAA>AAT		unc-51-like kinase 4							141.0	147.0	145.0					3																	41939949		2186	4293	6479	SO:0001583	missense	54986						ATP binding|protein serine/threonine kinase activity	g.chr3:41939949T>A	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1323A>T	3.37:g.41939949T>A	ENSP00000301831:p.Lys441Asn		Somatic				ULK4_uc003ckw.2_Missense_Mutation_p.K441N|ULK4_uc003ckx.1_Missense_Mutation_p.K441N	p.K441N	NM_017886	NP_060356	WXS	Illumina HiSeq	Unspecified	Q96C45	ULK4_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	14	1524	-			441					A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	c.1323A>T	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.853802	0.51270	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.70399	0.41;-0.48	4.85	2.46	0.29980	.	0.187865	0.56097	D	0.000032	T	0.72334	0.3447	M	0.62723	1.935	0.44966	D	0.99798	D;D	0.55800	0.973;0.973	P;P	0.51945	0.685;0.614	T	0.70880	-0.4752	10	0.72032	D	0.01	.	8.3032	0.32027	0.0:0.1677:0.0:0.8323	.	441;441	B4E2M4;Q96C45	.;ULK4_HUMAN	N	441	ENSP00000301831:K441N;ENSP00000412187:K441N	ENSP00000301831:K441N	K	-	3	2	ULK4	41914953	1.000000	0.71417	0.246000	0.24233	0.417000	0.31264	1.631000	0.37092	0.233000	0.21120	0.421000	0.28195	AAA		0.289	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		16	113	0	0	0	0.007413	0	16	113				
KLHL18	23276	broad.mit.edu	37	3	47385291	47385291	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:47385291G>T	ENST00000232766.5	+	10	1605	c.1585G>T	c.(1585-1587)Gtt>Ttt	p.V529F	KLHL18_ENST00000455924.2_Missense_Mutation_p.V417F	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	529										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CCTCTACGCTGTTGGGGGCTA	0.612																																							uc003crd.2		NA																	0					0						c.(1585-1587)GTT>TTT		kelch-like 18							78.0	81.0	80.0					3																	47385291		2203	4300	6503	SO:0001583	missense	23276							g.chr3:47385291G>T	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1585G>T	3.37:g.47385291G>T	ENSP00000232766:p.Val529Phe		Somatic				KLHL18_uc011bav.1_Missense_Mutation_p.V417F	p.V529F	NM_025010	NP_079286	WXS	Illumina HiSeq	Unspecified	O94889	KLH18_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)	10	1711	+		Acute lymphoblastic leukemia(5;0.164)	529			Kelch 6.		A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	c.1585G>T	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530609	0.85706	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	T;T	0.79247	-1.25;-1.25	5.15	5.15	0.70609	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.89044	0.6603	M	0.85630	2.765	0.80722	D	1	D	0.63880	0.993	D	0.68765	0.96	D	0.90523	0.4490	10	0.87932	D	0	.	17.8105	0.88614	0.0:0.0:1.0:0.0	.	529	O94889	KLH18_HUMAN	F	529;417	ENSP00000232766:V529F;ENSP00000405585:V417F	ENSP00000232766:V529F	V	+	1	0	KLHL18	47360295	1.000000	0.71417	0.782000	0.31804	0.785000	0.44390	6.320000	0.72876	2.683000	0.91414	0.561000	0.74099	GTT		0.612	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010		17	86	1	0	1.15088e-07	0.004007	1.33751e-07	17	86				
DAG1	1605	broad.mit.edu	37	3	49568391	49568391	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:49568391C>T	ENST00000539901.1	+	3	1005	c.447C>T	c.(445-447)tcC>tcT	p.S149S	DAG1_ENST00000541308.1_Silent_p.S149S|DAG1_ENST00000545947.1_Silent_p.S149S|DAG1_ENST00000538711.1_Silent_p.S149S|DAG1_ENST00000515359.2_Silent_p.S149S|DAG1_ENST00000308775.2_Silent_p.S149S	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	149	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCCAGACCTCCAGTGTGTTCT	0.602																																							uc003cxc.3		NA																	0				ovary(2)	2						c.(445-447)TCC>TCT		dystroglycan 1 preproprotein							63.0	54.0	57.0					3																	49568391		2203	4300	6503	SO:0001819	synonymous_variant	1605				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding	g.chr3:49568391C>T	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.447C>T	3.37:g.49568391C>T			Somatic					p.S149S	NM_004393	NP_004384	WXS	Illumina HiSeq	Unspecified	Q14118	DAG1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	3	865	+			149			Required for laminin recognition.		A8K6M7|Q969J9	Silent	SNP	ENST00000539901.1	37	c.447C>T	CCDS2799.1																																																																																				0.602	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			8	35	0	0	0	0.00308	0	8	35				
OR5K2	402135	broad.mit.edu	37	3	98217213	98217213	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:98217213C>A	ENST00000427338.1	+	1	766	c.689C>A	c.(688-690)tCc>tAc	p.S230Y	CLDND1_ENST00000502288.1_Intron	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGAATGAAATCCAAGGAGGGA	0.343																																							uc011bgx.1		NA																	0				ovary(2)	2						c.(688-690)TCC>TAC		olfactory receptor, family 5, subfamily K,							113.0	112.0	112.0					3																	98217213		2203	4300	6503	SO:0001583	missense	402135				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98217213C>A	AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.689C>A	3.37:g.98217213C>A	ENSP00000393889:p.Ser230Tyr		Somatic					p.S230Y	NM_001004737	NP_001004737	WXS	Illumina HiSeq	Unspecified	Q8NHB8	OR5K2_HUMAN			1	689	+			230			Cytoplasmic (Potential).		B2RN70|Q6IF47	Missense_Mutation	SNP	ENST00000427338.1	37	c.689C>A	CCDS33804.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312193	0.23908	.	.	ENSG00000231861	ENST00000427338	T	0.00337	8.05	2.82	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40554	N	0.001071	T	0.00637	0.0021	H	0.95645	3.7	0.80722	D	1	P	0.35944	0.529	B	0.44163	0.443	T	0.52823	-0.8524	10	0.72032	D	0.01	-14.6928	7.8877	0.29659	0.0:0.8675:0.0:0.1325	.	230	Q8NHB8	OR5K2_HUMAN	Y	230	ENSP00000393889:S230Y	ENSP00000393889:S230Y	S	+	2	0	OR5K2	99699903	0.000000	0.05858	0.998000	0.56505	0.496000	0.33645	0.529000	0.23019	0.728000	0.32382	0.313000	0.20887	TCC		0.343	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359020.2			9	100	1	0	0.000442599	0.006214	0.000467994	9	100				
KPNA1	3836	broad.mit.edu	37	3	122168504	122168504	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:122168504G>A	ENST00000344337.6	-	9	1010	c.834C>T	c.(832-834)ctC>ctT	p.L278L	KPNA1_ENST00000466923.1_5'UTR	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	278	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		ATAGATATGAGAGGGCCCAGC	0.438																																					Melanoma(12;340 801 11196 19797)	Melanoma(12;340 801 11196 19797)	uc003efd.1		NA																	0					0						c.(832-834)CTC>CTT		karyopherin alpha 1							79.0	75.0	76.0					3																	122168504		2203	4300	6503	SO:0001819	synonymous_variant	3836				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity	g.chr3:122168504G>A	S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.834C>T	3.37:g.122168504G>A			Somatic				KPNA1_uc003efb.1_Silent_p.L77L|KPNA1_uc003efc.1_Silent_p.L77L|KPNA1_uc011bjr.1_Silent_p.L77L|KPNA1_uc010hrh.2_Silent_p.L77L|KPNA1_uc003efe.2_Silent_p.L278L	p.L278L	NM_002264	NP_002255	WXS	Illumina HiSeq	Unspecified	P52294	IMA1_HUMAN		GBM - Glioblastoma multiforme(114;0.0898)	9	870	-			278			Binding to RAG1.|ARM 5.		D3DN93|Q6IBQ9|Q9BQ56	Silent	SNP	ENST00000344337.6	37	c.834C>T	CCDS3013.1																																																																																				0.438	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355740.1	NM_002264		4	60	0	0	0	0.009096	0	4	60				
KALRN	8997	broad.mit.edu	37	3	124281895	124281895	+	Missense_Mutation	SNP	G	G	C	rs369690103		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:124281895G>C	ENST00000393496.1	+	2	418	c.254G>C	c.(253-255)cGa>cCa	p.R85P	KALRN_ENST00000360013.3_Missense_Mutation_p.R1712P			O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1712	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TCACACTCCCGAAGCAGCGTG	0.647																																							uc003ehg.2		NA																	0				large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						c.(5134-5136)CGA>CCA		kalirin, RhoGEF kinase isoform 1							62.0	66.0	64.0					3																	124281895		2089	4223	6312	SO:0001583	missense	8997				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr3:124281895G>C	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000393496.1:c.254G>C	3.37:g.124281895G>C	ENSP00000377134:p.Arg85Pro		Somatic				KALRN_uc003ehi.2_Missense_Mutation_p.R85P	p.R1712P	NM_001024660	NP_001019831	WXS	Illumina HiSeq	Unspecified	O60229	KALRN_HUMAN			34	5262	+			1712					A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000393496.1	37	c.5135G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.696513|4.696513	0.88830|0.88830	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000393496	.|T;T	.|0.65549	.|-0.16;0.23	4.4|4.4	4.4|4.4	0.53042|0.53042	.|Src homology-3 domain (1);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.74366|0.74366	0.3707|0.3707	L|L	0.52573|0.52573	1.65|1.65	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.998	.|D;D	.|0.77004	.|0.974;0.989	T|T	0.75297|0.75297	-0.3367|-0.3367	5|10	.|0.48119	.|T	.|0.1	.|.	17.546|17.546	0.87861|0.87861	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|85;1712	.|O60229-5;O60229	.|.;KALRN_HUMAN	Q|P	1681|1712;85	.|ENSP00000353109:R1712P;ENSP00000377134:R85P	.|ENSP00000353109:R1712P	E|R	+|+	1|2	0|0	KALRN|KALRN	125764585|125764585	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.932000|0.932000	0.56968|0.56968	9.598000|9.598000	0.98277|0.98277	2.441000|2.441000	0.82636|0.82636	0.655000|0.655000	0.94253|0.94253	GAA|CGA		0.647	KALRN-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000258840.2	NM_003947		10	65	0	0	0	0.008291	0	10	65				
RUVBL1	8607	broad.mit.edu	37	3	127816180	127816180	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:127816180C>T	ENST00000322623.5	-	8	1078	c.979G>A	c.(979-981)Gtc>Atc	p.V327I	RUVBL1_ENST00000464873.1_Missense_Mutation_p.V267I|RUVBL1_ENST00000417360.1_Missense_Mutation_p.V327I	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	327					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		GCAAAGATGACGATGGGAGCG	0.542																																							uc003ekh.2		NA																	0				skin(1)	1						c.(979-981)GTC>ATC		RuvB-like 1							100.0	94.0	96.0					3																	127816180		2203	4300	6503	SO:0001583	missense	8607				cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding	g.chr3:127816180C>T	AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.979G>A	3.37:g.127816180C>T	ENSP00000318297:p.Val327Ile		Somatic				RUVBL1_uc003eke.2_Missense_Mutation_p.V68I|RUVBL1_uc003ekf.2_Missense_Mutation_p.V267I|RUVBL1_uc010hss.2_Missense_Mutation_p.V327I	p.V327I	NM_003707	NP_003698	WXS	Illumina HiSeq	Unspecified	Q9Y265	RUVB1_HUMAN		GBM - Glioblastoma multiforme(114;0.181)	8	1083	-			327					B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	ENST00000322623.5	37	c.979G>A	CCDS3047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.97|16.97	3.268054|3.268054	0.59540|0.59540	.|.	.|.	ENSG00000175792|ENSG00000175792	ENST00000472125|ENST00000464873;ENST00000322623;ENST00000417360;ENST00000478892	.|T;T;T	.|0.66815	.|-0.19;-0.23;0.19	5.32|5.32	4.45|4.45	0.53987|0.53987	.|TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	.|0.055847	.|0.64402	.|D	.|0.000001	T|T	0.79563|0.79563	0.4467|0.4467	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	.|B;B;B;D	.|0.56746	.|0.046;0.121;0.121;0.977	.|B;B;B;D	.|0.64687	.|0.076;0.362;0.328;0.928	T|T	0.81508|0.81508	-0.0901|-0.0901	5|10	.|0.59425	.|D	.|0.04	-14.7398|-14.7398	13.9229|13.9229	0.63942|0.63942	0.0:0.9267:0.0:0.0732|0.0:0.9267:0.0:0.0732	.|.	.|327;327;267;267	.|Q9Y265-2;Q9Y265;E7ETR0;B3KRS7	.|.;RUVB1_HUMAN;.;.	H|I	146|267;327;327;126	.|ENSP00000420738:V267I;ENSP00000318297:V327I;ENSP00000393755:V327I	.|ENSP00000318297:V327I	R|V	-|-	2|1	0|0	RUVBL1|RUVBL1	129298870|129298870	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.984000|0.984000	0.73092|0.73092	4.428000|4.428000	0.59894|0.59894	1.238000|1.238000	0.43771|0.43771	0.591000|0.591000	0.81541|0.81541	CGT|GTC		0.542	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2			8	26	0	0	0	0.00308	0	8	26				
MCCC1	56922	broad.mit.edu	37	3	182743552	182743552	+	Silent	SNP	A	A	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr3:182743552A>G	ENST00000265594.4	-	15	1868	c.1722T>C	c.(1720-1722)taT>taC	p.Y574Y	MCCC1_ENST00000492597.1_Silent_p.Y465Y|MCCC1_ENST00000489909.1_5'UTR|MCCC1_ENST00000539926.1_Intron	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	574					biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CCTGCATGCTATAAGACCCAT	0.368																																							uc003fle.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1720-1722)TAT>TAC		methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	Biotin(DB00121)						159.0	133.0	142.0					3																	182743552		2203	4300	6503	SO:0001819	synonymous_variant	56922				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity	g.chr3:182743552A>G	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1722T>C	3.37:g.182743552A>G			Somatic				MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Silent_p.Y457Y|MCCC1_uc003flg.2_Silent_p.Y465Y|MCCC1_uc011bqp.1_Silent_p.Y527Y	p.Y574Y	NM_020166	NP_064551	WXS	Illumina HiSeq	Unspecified	Q96RQ3	MCCA_HUMAN	all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		15	1859	-	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		574					Q59ES4|Q9H959|Q9NS97	Silent	SNP	ENST00000265594.4	37	c.1722T>C	CCDS3241.1																																																																																				0.368	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166		6	69	0	0	0	0.001984	0	6	69				
ADD1	118	broad.mit.edu	37	4	2886264	2886264	+	Silent	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:2886264G>C	ENST00000398129.1	+	3	401	c.381G>C	c.(379-381)gtG>gtC	p.V127V	ADD1_ENST00000503455.2_Silent_p.V127V|ADD1_ENST00000264758.7_Silent_p.V127V|ADD1_ENST00000513328.2_Silent_p.V127V|ADD1_ENST00000398123.2_Silent_p.V127V|ADD1_ENST00000398125.1_Silent_p.V127V|ADD1_ENST00000355842.3_Silent_p.V127V|ADD1_ENST00000446856.1_Silent_p.V127V			P35611	ADDA_HUMAN	adducin 1 (alpha)	127					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGACTCCTGTGAACGATCTTA	0.423																																					Esophageal Squamous(71;505 1201 20414 34538 37449)	Esophageal Squamous(71;505 1201 20414 34538 37449)	uc003gfr.2		NA																	0				ovary(1)	1						c.(379-381)GTG>GTC		adducin 1 (alpha) isoform a							205.0	203.0	203.0					4																	2886264		2203	4300	6503	SO:0001819	synonymous_variant	118				actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding	g.chr4:2886264G>C	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.381G>C	4.37:g.2886264G>C			Somatic				ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Silent_p.V127V|ADD1_uc003gfo.2_Silent_p.V127V|ADD1_uc003gfp.2_Silent_p.V127V|ADD1_uc003gfq.2_Silent_p.V127V|ADD1_uc003gfs.2_Silent_p.V127V|ADD1_uc003gft.3_Silent_p.V127V|ADD1_uc003gfu.2_5'Flank	p.V127V	NM_001119	NP_001110	WXS	Illumina HiSeq	Unspecified	P35611	ADDA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	4	569	+			127					A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	ENST00000398129.1	37	c.381G>C	CCDS43205.1																																																																																				0.423	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189		9	197	0	0	0	0.006214	0	9	197				
EPHA5	2044	broad.mit.edu	37	4	66270177	66270177	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:66270177G>T	ENST00000273854.3	-	8	2305	c.1705C>A	c.(1705-1707)Caa>Aaa	p.Q569K	EPHA5_ENST00000432638.2_Missense_Mutation_p.Q406K|EPHA5_ENST00000354839.4_Missense_Mutation_p.Q569K|EPHA5_ENST00000511294.1_Missense_Mutation_p.Q570K	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	569					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ATCTGGCTTTGATCGCTGGAT	0.438										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(1705-1707)CAA>AAA		ephrin receptor EphA5 isoform a precursor							121.0	101.0	108.0					4																	66270177		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66270177G>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1705C>A	4.37:g.66270177G>T	ENSP00000273854:p.Gln569Lys	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.Q501K|EPHA5_uc003hcz.2_Missense_Mutation_p.Q569K|EPHA5_uc011cah.1_Missense_Mutation_p.Q570K|EPHA5_uc011cai.1_Missense_Mutation_p.Q570K|EPHA5_uc003hda.2_Missense_Mutation_p.Q570K	p.Q569K	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			8	1898	-			569			Extracellular (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.1705C>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183544	0.38609	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.73047	-0.7;-0.71;-0.65;-0.67	5.05	4.19	0.49359	.	0.112714	0.39544	N	0.001323	T	0.53465	0.1798	N	0.08118	0	0.43088	D	0.994758	B;B;B;B	0.24675	0.036;0.07;0.061;0.109	B;B;B;B	0.28385	0.041;0.024;0.089;0.031	T	0.51601	-0.8685	10	0.38643	T	0.18	.	15.6839	0.77393	0.0:0.1376:0.8624:0.0	.	570;570;569;569	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	K	569;406;569;570	ENSP00000273854:Q569K;ENSP00000389208:Q406K;ENSP00000346899:Q569K;ENSP00000427638:Q570K	ENSP00000273854:Q569K	Q	-	1	0	EPHA5	65952772	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.089000	0.57685	1.239000	0.43787	0.650000	0.86243	CAA		0.438	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		10	48	1	0	6.40141e-05	0.010729	6.99815e-05	10	48				
FRAS1	80144	broad.mit.edu	37	4	79460483	79460483	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:79460483C>T	ENST00000264895.6	+	73	11774	c.11334C>T	c.(11332-11334)ttC>ttT	p.F3778F		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3774					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ATAAGTACTTCCATGATGTGC	0.423																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(11332-11334)TTC>TTT		Fraser syndrome 1							150.0	147.0	148.0					4																	79460483		1922	4133	6055	SO:0001819	synonymous_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79460483C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11334C>T	4.37:g.79460483C>T			Somatic					p.F3778F	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			73	11774	+			3773			Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	c.11334C>T	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	9.911	1.209414	0.22289	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.87	5.03	0.67393	.	.	.	.	.	T	0.69628	0.3132	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67106	-0.5754	4	.	.	.	.	14.4318	0.67257	0.0:0.9299:0.0:0.0701	.	.	.	.	S	2007	.	.	P	+	1	0	FRAS1	79679507	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.209000	0.51122	2.780000	0.95670	0.655000	0.94253	CCA		0.423	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	105	0	0	0	0.009096	0	4	105				
MMRN1	22915	broad.mit.edu	37	4	90856622	90856622	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:90856622C>T	ENST00000394980.1	+	7	2110	c.1791C>T	c.(1789-1791)tcC>tcT	p.S597S	MMRN1_ENST00000264790.2_Silent_p.S597S|MMRN1_ENST00000508372.1_Silent_p.S339S|MMRN1_ENST00000394981.1_Intron			Q13201	MMRN1_HUMAN	multimerin 1	597					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		ACATGTTATCCAAATGCAGAA	0.348																																							uc003hst.2		NA																	0				ovary(4)	4						c.(1789-1791)TCC>TCT		multimerin 1							52.0	54.0	53.0					4																	90856622		2203	4298	6501	SO:0001819	synonymous_variant	22915				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen		g.chr4:90856622C>T	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1791C>T	4.37:g.90856622C>T			Somatic				MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Silent_p.S339S	p.S597S	NM_007351	NP_031377	WXS	Illumina HiSeq	Unspecified	Q13201	MMRN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)	6	1862	+		Hepatocellular(203;0.114)	597			Potential.		Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	37	c.1791C>T	CCDS3635.1																																																																																				0.348	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351		7	76	0	0	0	0.001984	0	7	76				
TACR3	6870	broad.mit.edu	37	4	104512727	104512727	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:104512727G>A	ENST00000304883.2	-	4	1142	c.1002C>T	c.(1000-1002)atC>atT	p.I334I	RP11-297P16.3_ENST00000502936.1_RNA|RP11-297P16.3_ENST00000512401.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	334					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AGACCTGCTGGATGTATTTCC	0.393																																							uc003hxe.1		NA																	0				ovary(3)|lung(2)|breast(1)|skin(1)	7						c.(1000-1002)ATC>ATT		tachykinin receptor 3							144.0	138.0	140.0					4																	104512727		2203	4300	6503	SO:0001819	synonymous_variant	6870					integral to plasma membrane	tachykinin receptor activity	g.chr4:104512727G>A	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1002C>T	4.37:g.104512727G>A			Somatic					p.I334I	NM_001059	NP_001050	WXS	Illumina HiSeq	Unspecified	P29371	NK3R_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)	4	1145	-		Hepatocellular(203;0.217)	334			Extracellular (Potential).		Q0P510	Silent	SNP	ENST00000304883.2	37	c.1002C>T	CCDS3664.1																																																																																				0.393	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059		17	75	0	0	0	0.00499	0	17	75				
PDE5A	8654	broad.mit.edu	37	4	120446753	120446753	+	Missense_Mutation	SNP	C	C	T	rs569083571		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr4:120446753C>T	ENST00000354960.3	-	12	2049	c.1730G>A	c.(1729-1731)cGg>cAg	p.R577Q	PDE5A_ENST00000394439.1_Missense_Mutation_p.R525Q|PDE5A_ENST00000512739.1_5'UTR|PDE5A_ENST00000264805.5_Missense_Mutation_p.R535Q|RP11-33B1.1_ENST00000498873.1_RNA	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	577					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	AGTAAACATCCGAATTGTACA	0.443													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17623	0.0		0.0	False		,,,				2504	0.0						uc003idh.2		NA																	0					0						c.(1729-1731)CGG>CAG		phosphodiesterase 5A isoform 1	Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)						126.0	118.0	121.0					4																	120446753		2203	4300	6503	SO:0001583	missense	8654				platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding	g.chr4:120446753C>T	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1730G>A	4.37:g.120446753C>T	ENSP00000347046:p.Arg577Gln		Somatic				uc003ide.3_Intron|PDE5A_uc003idf.2_Missense_Mutation_p.R535Q|PDE5A_uc003idg.2_Missense_Mutation_p.R525Q|uc003idi.3_Intron	p.R577Q	NM_001083	NP_001074	WXS	Illumina HiSeq	Unspecified	O76074	PDE5A_HUMAN			12	1885	-			577					A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	c.1730G>A	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	C	35	5.484858	0.96323	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.48201	0.82;0.82;0.82	5.06	5.06	0.68205	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.115584	0.64402	D	0.000010	T	0.63224	0.2493	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	1.0;0.996	D;B	0.65010	0.931;0.441	T	0.61466	-0.7057	10	0.38643	T	0.18	.	18.4311	0.90625	0.0:1.0:0.0:0.0	.	577;535	O76074;O76074-2	PDE5A_HUMAN;.	Q	577;525;535	ENSP00000347046:R577Q;ENSP00000377957:R525Q;ENSP00000264805:R535Q	ENSP00000264805:R535Q	R	-	2	0	PDE5A	120666201	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.818000	0.86416	2.352000	0.79861	0.655000	0.94253	CGG		0.443	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083		17	73	0	0	0	0.007413	0	17	73				
BDP1	55814	broad.mit.edu	37	5	70818760	70818760	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:70818760C>T	ENST00000358731.4	+	24	5634	c.5371C>T	c.(5371-5373)Ctc>Ttc	p.L1791F	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1791					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGAGCAATATCTCAATAAACT	0.303																																							uc003kbp.1		NA																	0				skin(2)	2						c.(5371-5373)CTC>TTC		transcription factor-like nuclear regulator							74.0	70.0	71.0					5																	70818760		1818	4072	5890	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70818760C>T	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.5371C>T	5.37:g.70818760C>T	ENSP00000351575:p.Leu1791Phe		Somatic				BDP1_uc003kbo.2_Missense_Mutation_p.L1791F|BDP1_uc003kbq.1_RNA	p.L1791F	NM_018429	NP_060899	WXS	Illumina HiSeq	Unspecified	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	24	5634	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	1791					Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.5371C>T	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359007	0.24598	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.11169	2.8	5.77	0.96	0.19631	.	0.434509	0.19722	N	0.107579	T	0.08044	0.0201	L	0.50333	1.59	0.18873	N	0.999988	B;P	0.38597	0.019;0.639	B;B	0.32928	0.027;0.155	T	0.22487	-1.0215	10	0.48119	T	0.1	.	5.0283	0.14396	0.0:0.4162:0.3324:0.2514	.	1791;1791	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	F	1791;1371	ENSP00000351575:L1791F	ENSP00000351575:L1791F	L	+	1	0	BDP1	70854516	0.003000	0.15002	0.092000	0.20876	0.044000	0.14063	-0.708000	0.05035	0.085000	0.17107	0.650000	0.86243	CTC		0.303	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		3	47	0	0	0	0.004672	0	3	47				
CAST	831	broad.mit.edu	37	5	96011290	96011290	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:96011290G>C	ENST00000510756.1	+	2	123	c.123G>C	c.(121-123)aaG>aaC	p.K41N	CAST_ENST00000508830.1_Missense_Mutation_p.K41N|CAST_ENST00000359176.4_Missense_Mutation_p.K41N|CAST_ENST00000395813.1_Missense_Mutation_p.K41N|CAST_ENST00000508608.1_Missense_Mutation_p.K26N|CAST_ENST00000338252.3_5'UTR|CAST_ENST00000325674.7_Missense_Mutation_p.K41N|CAST_ENST00000395812.2_Missense_Mutation_p.K41N			P20810	ICAL_HUMAN	calpastatin	391					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CAGGAGAAAAGAAAGGATCAG	0.338																																							uc003klu.2		NA																	0				central_nervous_system(3)|ovary(1)|kidney(1)	5						c.(121-123)AAG>AAC		calpastatin isoform a							138.0	125.0	129.0					5																	96011290		1825	4068	5893	SO:0001583	missense	831						calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding	g.chr5:96011290G>C	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000510756.1:c.123G>C	5.37:g.96011290G>C	ENSP00000422176:p.Lys41Asn		Somatic				CAST_uc003klt.2_5'UTR|CAST_uc003klv.2_Missense_Mutation_p.K41N|CAST_uc003klw.2_Missense_Mutation_p.K41N|CAST_uc003klx.2_Missense_Mutation_p.K41N|CAST_uc003kly.2_Missense_Mutation_p.K41N|CAST_uc011cuo.1_Missense_Mutation_p.K26N	p.K41N	NM_001750	NP_001741	WXS	Illumina HiSeq	Unspecified	P20810	ICAL_HUMAN		all cancers(79;6.85e-15)	2	309	+		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000510756.1	37	c.123G>C	CCDS54882.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.88|13.88	2.368964|2.368964	0.42003|0.42003	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000505143;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000421689;ENST00000510756;ENST00000514845;ENST00000506811;ENST00000514055;ENST00000508608|ENST00000512620	T;T;T;T;T;T;T;T;T;T|.	0.62364|.	0.05;1.62;4.29;1.62;1.72;2.01;2.06;0.03;1.98;2.04|.	4.77|4.77	3.0|3.0	0.34707|0.34707	.|.	.|.	.|.	.|.	.|.	T|T	0.57344|0.57344	0.2047|0.2047	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	D;P;P;P;D;D|.	0.89917|.	1.0;0.728;0.557;0.557;1.0;0.977|.	D;B;B;B;D;P|.	0.87578|.	0.994;0.223;0.12;0.167;0.998;0.73|.	T|T	0.51529|0.51529	-0.8694|-0.8694	9|5	0.87932|.	D|.	0|.	-2.9946|-2.9946	7.6787|7.6787	0.28500|0.28500	0.1928:0.0:0.8072:0.0|0.1928:0.0:0.8072:0.0	.|.	26;41;41;41;41;41|.	B7Z468;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6|.	.;.;.;.;.;.|.	N|T	36;41;41;41;41;41;41;41;41;26;26;26;26|24	ENSP00000422957:K36N;ENSP00000425721:K41N;ENSP00000422951:K41N;ENSP00000379158:K41N;ENSP00000352098:K41N;ENSP00000320319:K41N;ENSP00000379157:K41N;ENSP00000396558:K41N;ENSP00000422176:K41N;ENSP00000422677:K26N|.	ENSP00000320319:K41N|.	K|R	+|+	3|2	2|0	CAST|CAST	96037046|96037046	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.875000|0.875000	0.50365|0.50365	1.183000|1.183000	0.32041|0.32041	0.738000|0.738000	0.32606|0.32606	-0.133000|-0.133000	0.14855|0.14855	AAG|AGA		0.338	CAST-010	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370546.1	NM_173062		5	74	0	0	0	0.001168	0	5	74				
RAPGEF6	51735	broad.mit.edu	37	5	130840380	130840380	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:130840380A>G	ENST00000509018.1	-	11	1398	c.1193T>C	c.(1192-1194)aTg>aCg	p.M398T	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.M398T|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.M398T|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.M398T|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.M398T|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.M448T|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.M398T|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.M113T	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	398					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CTCATGTACCATAACAATTTC	0.393																																					Melanoma(168;435 1955 13113 13877 23213)	Melanoma(168;435 1955 13113 13877 23213)	uc003kvn.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1192-1194)ATG>ACG		PDZ domain-containing guanine nucleotide							198.0	182.0	187.0					5																	130840380		2203	4300	6503	SO:0001583	missense	51735				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding	g.chr5:130840380A>G	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1193T>C	5.37:g.130840380A>G	ENSP00000421684:p.Met398Thr		Somatic				RAPGEF6_uc003kvp.1_Missense_Mutation_p.M448T|RAPGEF6_uc003kvo.1_Missense_Mutation_p.M398T|RAPGEF6_uc010jdi.1_Missense_Mutation_p.M398T|RAPGEF6_uc010jdj.1_Missense_Mutation_p.M398T|RAPGEF6_uc003kvq.2_Missense_Mutation_p.M115T|RAPGEF6_uc003kvr.2_Missense_Mutation_p.M398T|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Missense_Mutation_p.M398T	p.M398T	NM_016340	NP_057424	WXS	Illumina HiSeq	Unspecified	Q8TEU7	RPGF6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)	11	1399	-			398			cNMP.		A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	c.1193T>C	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.716973	0.68844	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	T;T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63	4.43	4.43	0.53597	Ras guanine nucleotide exchange factor, domain (1);Cyclic nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	L	0.60455	1.87	0.80722	D	1	D;P;D;D;D;D;B	0.89917	0.991;0.609;0.995;0.991;1.0;0.995;0.125	D;B;D;P;D;D;B	0.85130	0.914;0.341;0.92;0.833;0.997;0.98;0.253	T	0.55192	-0.8179	10	0.87932	D	0	.	13.9782	0.64285	1.0:0.0:0.0:0.0	.	398;398;398;113;448;398;398	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	T	398;398;398;398;398;113;398;398;448	ENSP00000421684:M398T;ENSP00000309298:M398T;ENSP00000426081:M398T;ENSP00000296859:M398T;ENSP00000426910:M113T;ENSP00000311419:M398T;ENSP00000425389:M398T;ENSP00000426948:M448T	ENSP00000426948:M448T	M	-	2	0	RAPGEF6;FNIP1	130868279	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.287000	0.95975	1.764000	0.52075	0.260000	0.18958	ATG		0.393	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		12	121	0	0	0	0.020292	0	12	121				
PCDHGA2	56113	broad.mit.edu	37	5	140720584	140720584	+	Silent	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:140720584C>A	ENST00000394576.2	+	1	2046	c.2046C>A	c.(2044-2046)gcC>gcA	p.A682A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	682	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCCTCCGCCATACCCAACG	0.682																																							uc003ljk.1		NA																	0				skin(2)|ovary(1)	3						c.(2044-2046)GCC>GCA		protocadherin gamma subfamily A, 2 isoform 1							101.0	108.0	106.0					5																	140720584		2203	4299	6502	SO:0001819	synonymous_variant	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140720584C>A	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2046C>A	5.37:g.140720584C>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Silent_p.A682A	p.A682A	NM_018915	NP_061738	WXS	Illumina HiSeq	Unspecified	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2231	+			682			Extracellular (Potential).|Cadherin 6.		Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	c.2046C>A	CCDS47289.1																																																																																				0.682	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		8	190	1	0	0.00621372	0.006214	0.00631157	8	190				
PCDHGB3	56102	broad.mit.edu	37	5	140778463	140778463	+	Intron	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:140778463C>A	ENST00000576222.1	+	1	2546				PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAACGTGCCACCAGGCACCAC	0.522																																							uc003lkf.1		NA																	0					0						c.(769-771)CCA>ACA		protocadherin gamma subfamily B, 5 isoform 1							77.0	85.0	83.0					5																	140778463		2082	4215	6297	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140778463C>A	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26087C>A	5.37:g.140778463C>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.P257T	p.P257T	NM_018925	NP_061748	WXS	Illumina HiSeq	Unspecified	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	769	+			257			Extracellular (Potential).|Cadherin 3.		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.769C>A	CCDS58980.1																																																																																				0.522	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		16	99	1	0	1.3612e-06	0.003163	1.54031e-06	16	99				
ADRA1B	147	broad.mit.edu	37	5	159344154	159344154	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr5:159344154A>G	ENST00000306675.3	+	1	365	c.242A>G	c.(241-243)aAc>aGc	p.N81S		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	81					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	ACGCCCACCAACTACTTCATT	0.622																																							uc003lxt.1		NA																	0				lung(1)	1						c.(241-243)AAC>AGC		alpha-1B-adrenergic receptor	Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Modafinil(DB00745)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Olanzapine(DB00334)|Phendimetrazine(DB01579)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Trazodone(DB00656)						107.0	101.0	103.0					5																	159344154		2203	4300	6503	SO:0001583	missense	147				cell proliferation|cell-cell signaling|G-protein signaling, coupled to cAMP nucleotide second messenger|intracellular protein kinase cascade	integral to plasma membrane	alpha1-adrenergic receptor activity	g.chr5:159344154A>G	L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.242A>G	5.37:g.159344154A>G	ENSP00000306662:p.Asn81Ser		Somatic					p.N81S	NM_000679	NP_000670	WXS	Illumina HiSeq	Unspecified	P35368	ADA1B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		1	415	+	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	81			Cytoplasmic (By similarity).		B0LPE1	Missense_Mutation	SNP	ENST00000306675.3	37	c.242A>G	CCDS4347.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.786034	0.70337	.	.	ENSG00000170214	ENST00000306675	T	0.19394	2.15	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	M	0.89534	3.04	0.51767	D	0.999934	D	0.64830	0.994	D	0.70935	0.971	T	0.63093	-0.6714	10	0.72032	D	0.01	.	13.9612	0.64180	1.0:0.0:0.0:0.0	.	81	P35368	ADA1B_HUMAN	S	81	ENSP00000306662:N81S	ENSP00000306662:N81S	N	+	2	0	ADRA1B	159276732	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.284000	0.95882	2.050000	0.60909	0.379000	0.24179	AAC		0.622	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252676.1			8	137	0	0	0	0.004482	0	8	137				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7988181	7988181	+	Intron	SNP	A	A	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:7988181A>C	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)									p.Y471S(1)									TGCATTACTTACCAGCCATTG	0.473																																							uc003mxx.3		NA																	1	Substitution - Missense(1)		prostate(1)		0						c.(1411-1413)TAC>TCC		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7988181A>C			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+38418T>G	6.37:g.7988181A>C			Somatic				TXNDC5_uc003mxw.2_Intron	p.Y471S	NR_027712		WXS	Illumina HiSeq	Unspecified					1	1847	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.1412A>C																																																																																					0.473	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		9	39	0	0	0	0.016723	0	9	39				
GPX6	257202	broad.mit.edu	37	6	28473575	28473575	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:28473575C>A	ENST00000361902.1	-	4	413	c.364G>T	c.(364-366)Gtg>Ttg	p.V122L	GPX6_ENST00000483058.1_5'Flank|GPX6_ENST00000474923.1_Intron	NM_182701.1	NP_874360.1	P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	122					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	CCTGGACACACATACCTGCAG	0.433																																							uc011dlj.1		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(364-366)GTG>TTG		glutathione peroxidase 6 precursor	Glutathione(DB00143)						73.0	76.0	75.0					6																	28473575		2095	4246	6341	SO:0001583	missense	257202				response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28473575C>A		CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000361902.1:c.364G>T	6.37:g.28473575C>A	ENSP00000354581:p.Val122Leu		Somatic				GPX6_uc010jrg.1_Intron	p.V122L	NM_182701	NP_874360	WXS	Illumina HiSeq	Unspecified	P59796	GPX6_HUMAN			5	414	-			122					Q4PJ17	Missense_Mutation	SNP	ENST00000361902.1	37	c.364G>T	CCDS43432.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186235	0.78789	.	.	ENSG00000198704	ENST00000361902	T	0.08807	3.05	4.2	4.2	0.49525	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.19366	0.0465	M	0.87547	2.89	0.80722	D	1	D	0.58268	0.982	P	0.56127	0.792	T	0.01500	-1.1339	10	0.66056	D	0.02	.	14.8506	0.70295	0.0:1.0:0.0:0.0	.	122	P59796	GPX6_HUMAN	L	122	ENSP00000354581:V122L	ENSP00000354581:V122L	V	-	1	0	GPX6	28581554	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	6.526000	0.73799	2.613000	0.88420	0.655000	0.94253	GTG		0.433	GPX6-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000104340.1			7	93	1	0	8.12818e-05	0.001984	8.7378e-05	7	93				
C6orf47	57827	broad.mit.edu	37	6	31626938	31626938	+	Missense_Mutation	SNP	G	G	A	rs114079572	byFrequency	TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:31626938G>A	ENST00000375911.1	-	1	1611	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	263						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						TTGGGCTCCCGGAGGCTGACA	0.632													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17661	0.0		0.0	False		,,,				2504	0.0						uc003nvm.1		NA																	0				ovary(1)	1						c.(787-789)CGG>TGG		G4 protein		G	TRP/ARG	10,3010		0,10,1500	73.0	78.0	76.0		787	3.7	1.0	6	dbSNP_132	76	0,5418		0,0,2709	yes	missense	C6orf47	NM_021184.3	101	0,10,4209	AA,AG,GG		0.0,0.3311,0.1185	probably-damaging	263/295	31626938	10,8428	1510	2709	4219	SO:0001583	missense	57827							g.chr6:31626938G>A	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.787C>T	6.37:g.31626938G>A	ENSP00000365076:p.Arg263Trp		Somatic					p.R263W	NM_021184	NP_067007	WXS	Illumina HiSeq	Unspecified	O95873	CF047_HUMAN			1	1612	-			263					B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	37	c.787C>T	CCDS34399.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	21.1|21.1	4.104583|4.104583	0.77096|0.77096	0.003311|0.003311	0.0|0.0	ENSG00000204439|ENSG00000204439	ENST00000538106|ENST00000375911	.|T	.|0.38887	.|1.11	5.58|5.58	3.67|3.67	0.42095|0.42095	.|.	.|0.214397	.|0.27302	.|N	.|0.019982	.|T	.|0.42404	.|0.1201	M|M	0.61703|0.61703	1.905|1.905	0.28671|0.28671	N|N	0.905629|0.905629	.|D	.|0.76494	.|0.999	.|P	.|0.61003	.|0.882	.|T	.|0.30031	.|-0.9992	.|10	.|0.87932	.|D	.|0	.|-7.2228	10.6258|10.6258	0.45506|0.45506	0.0:0.0:0.6527:0.3473|0.0:0.0:0.6527:0.3473	.|.	.|263	.|O95873	.|CF047_HUMAN	.|W	-1|263	.|ENSP00000365076:R263W	.|ENSP00000365076:R263W	.|R	-|-	.|1	.|2	C6orf47|C6orf47	31734917|31734917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	1.652000|1.652000	0.37313|0.37313	1.336000|1.336000	0.45506|0.45506	0.655000|0.655000	0.94253|0.94253	.|CGG		0.632	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184		8	156	0	0	0	0.004482	0	8	156				
COL11A2	1302	broad.mit.edu	37	6	33144245	33144245	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:33144245C>T	ENST00000374708.4	-	25	2134	c.1876G>A	c.(1876-1878)Gga>Aga	p.G626R	COL11A2_ENST00000374714.1_Missense_Mutation_p.G686R|COL11A2_ENST00000395197.1_Missense_Mutation_p.G652R|COL11A2_ENST00000341947.2_Missense_Mutation_p.G712R|COL11A2_ENST00000374713.1_Missense_Mutation_p.G665R|COL11A2_ENST00000374712.1_Missense_Mutation_p.G631R|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000361917.1_Missense_Mutation_p.G605R|COL11A2_ENST00000357486.1_Missense_Mutation_p.G691R	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	712	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CCTAGAGGTCCCTGAGGTCCA	0.557																																					Melanoma(1;90 116 3946 5341 17093)	Melanoma(1;90 116 3946 5341 17093)	uc003ocx.1		NA																	0				ovary(3)|skin(2)	5						c.(2134-2136)GGA>AGA		collagen, type XI, alpha 2 isoform 1							36.0	38.0	38.0					6																	33144245		1511	2708	4219	SO:0001583	missense	1302				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging	g.chr6:33144245C>T	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1876G>A	6.37:g.33144245C>T	ENSP00000363840:p.Gly626Arg		Somatic				COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.G626R|COL11A2_uc003ocz.1_Missense_Mutation_p.G605R	p.G712R	NM_080680	NP_542411	WXS	Illumina HiSeq	Unspecified	P13942	COBA2_HUMAN			27	2362	-			712			Triple-helical region.		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	37	c.2134G>A	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666036	0.88251	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29;-6.29;-6.29;-6.29	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	H	0.99090	4.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.993	D	0.96551	0.9408	10	0.87932	D	0	.	15.5774	0.76404	0.0:1.0:0.0:0.0	.	605;626;712	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	R	626;712;691;686;665;652;631;605	ENSP00000363840:G626R;ENSP00000339915:G712R;ENSP00000350079:G691R;ENSP00000363846:G686R;ENSP00000363845:G665R;ENSP00000378623:G652R;ENSP00000363844:G631R;ENSP00000355123:G605R	ENSP00000339915:G712R	G	-	1	0	COL11A2	33252223	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.193000	0.77780	2.561000	0.86390	0.549000	0.68633	GGA		0.557	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2			4	38	0	0	0	0.009096	0	4	38				
GLTSCR1L	23506	broad.mit.edu	37	6	42832802	42832802	+	Missense_Mutation	SNP	G	G	A	rs375000480		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:42832802G>A	ENST00000314073.5	+	13	3034	c.2858G>A	c.(2857-2859)aGc>aAc	p.S953N	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.S953N			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	953																	GGTACTGAGAGCAAACTGTCA	0.512																																							uc003osn.1		NA																	0				ovary(1)	1						c.(2857-2859)AGC>AAC		hypothetical protein LOC23506		G	ASN/SER	0,4406		0,0,2203	79.0	79.0	79.0		2858	4.3	0.9	6		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIAA0240	NM_015349.1	46	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	953/1080	42832802	1,13005	2203	4300	6503	SO:0001583	missense	23506							g.chr6:42832802G>A	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.2858G>A	6.37:g.42832802G>A	ENSP00000313933:p.Ser953Asn		Somatic				KIAA0240_uc011duw.1_Missense_Mutation_p.S953N|KIAA0240_uc003osp.1_Missense_Mutation_p.S953N	p.S953N	NM_015349	NP_056164	WXS	Illumina HiSeq	Unspecified	Q6AI39	K0240_HUMAN	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)		13	3009	+	Colorectal(47;0.196)		953					A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	c.2858G>A	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	G	7.727	0.698476	0.15106	0.0	1.16E-4	ENSG00000112624	ENST00000394167;ENST00000314073;ENST00000394168	T;T	0.42900	0.96;0.96	5.15	4.26	0.50523	.	0.241238	0.39407	N	0.001367	T	0.05731	0.0150	N	0.08118	0	0.26755	N	0.970115	B	0.02656	0.0	B	0.04013	0.001	T	0.37731	-0.9693	10	0.06365	T	0.9	-4.0377	5.1191	0.14851	0.291:0.0:0.709:0.0	.	953	Q6AI39	K0240_HUMAN	N	953	ENSP00000313933:S953N;ENSP00000377723:S953N	ENSP00000313933:S953N	S	+	2	0	KIAA0240	42940780	1.000000	0.71417	0.932000	0.37286	0.935000	0.57460	3.409000	0.52657	2.544000	0.85801	0.650000	0.86243	AGC		0.512	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349		5	69	0	0	0	0.001984	0	5	69				
CUL9	23113	broad.mit.edu	37	6	43191089	43191089	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:43191089G>T	ENST00000252050.4	+	39	7322	c.7238G>T	c.(7237-7239)cGg>cTg	p.R2413L	CUL9_ENST00000372647.2_Missense_Mutation_p.R2385L|CUL9_ENST00000354495.3_Missense_Mutation_p.R2303L|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2413					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GAGCTGCTCCGGCGGATCCAG	0.677																																							uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(7237-7239)CGG>CTG		p53-associated parkin-like cytoplasmic protein							21.0	20.0	20.0					6																	43191089		2203	4299	6502	SO:0001583	missense	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43191089G>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.7238G>T	6.37:g.43191089G>T	ENSP00000252050:p.Arg2413Leu		Somatic				CUL9_uc003oul.2_Missense_Mutation_p.R2385L|CUL9_uc010jyk.2_Missense_Mutation_p.R1565L|CUL9_uc003oun.2_Missense_Mutation_p.R208L	p.R2413L	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			39	7313	+			2413					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	c.7238G>T	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371649	0.82573	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.18960	2.18;2.18;2.18	5.16	5.16	0.70880	.	0.362018	0.28600	N	0.014761	T	0.19446	0.0467	L	0.27053	0.805	0.53005	D	0.999964	D;D;D	0.65815	0.959;0.995;0.995	P;P;P	0.58454	0.673;0.839;0.839	T	0.01776	-1.1276	10	0.87932	D	0	-26.3071	13.9982	0.64416	0.0751:0.0:0.9249:0.0	.	2303;2385;2413	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	L	2413;2303;2385	ENSP00000252050:R2413L;ENSP00000346490:R2303L;ENSP00000361730:R2385L	ENSP00000252050:R2413L	R	+	2	0	CUL9	43299067	1.000000	0.71417	0.939000	0.37840	0.559000	0.35586	4.570000	0.60872	2.410000	0.81850	0.561000	0.74099	CGG		0.677	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		3	6	1	0	0.004672	0.004672	0.00478324	3	6				
EFHC1	114327	broad.mit.edu	37	6	52288786	52288786	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:52288786G>T	ENST00000371068.5	+	2	209	c.106G>T	c.(106-108)Ggc>Tgc	p.G36C	EFHC1_ENST00000433625.2_5'UTR|EFHC1_ENST00000491749.1_3'UTR|EFHC1_ENST00000538167.1_Missense_Mutation_p.G17C	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	36						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.G36C(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					CTACAGGAACGGCTATGCAAT	0.463																																							uc003pap.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(106-108)GGC>TGC		EF-hand domain (C-terminal) containing 1							93.0	88.0	90.0					6																	52288786		2203	4300	6503	SO:0001583	missense	114327					axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding	g.chr6:52288786G>T	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.106G>T	6.37:g.52288786G>T	ENSP00000360107:p.Gly36Cys		Somatic				EFHC1_uc011dwv.1_5'UTR|EFHC1_uc011dww.1_Missense_Mutation_p.G17C	p.G36C	NM_018100	NP_060570	WXS	Illumina HiSeq	Unspecified	Q5JVL4	EFHC1_HUMAN			2	321	+	Lung NSC(77;0.109)		36					B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	37	c.106G>T	CCDS4942.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765121	0.90020	.	.	ENSG00000096093	ENST00000371068;ENST00000538167	T;T	0.70749	-0.36;-0.51	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.86339	0.5909	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87401	0.2369	10	0.87932	D	0	-10.2652	20.4581	0.99154	0.0:0.0:1.0:0.0	.	17;36	F5GZD8;Q5JVL4	.;EFHC1_HUMAN	C	36;17	ENSP00000360107:G36C;ENSP00000444521:G17C	ENSP00000360107:G36C	G	+	1	0	EFHC1	52396745	1.000000	0.71417	0.985000	0.45067	0.975000	0.68041	8.642000	0.91036	2.835000	0.97688	0.650000	0.86243	GGC		0.463	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100		37	93	1	0	6.19805e-25	0.005524	7.99549e-25	37	93				
AHI1	54806	broad.mit.edu	37	6	135784313	135784313	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr6:135784313T>C	ENST00000367800.4	-	6	1097	c.881A>G	c.(880-882)cAa>cGa	p.Q294R	AHI1_ENST00000457866.2_Missense_Mutation_p.Q294R|AHI1_ENST00000327035.6_Missense_Mutation_p.Q294R	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	294	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)		p.Q294R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TGTATCATCTTGCATGCTGTC	0.313																																							uc003qgi.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(880-882)CAA>CGA		Abelson helper integration site 1 isoform a							129.0	114.0	119.0					6																	135784313		1852	4103	5955	SO:0001583	missense	54806					adherens junction|cilium|microtubule basal body		g.chr6:135784313T>C	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.881A>G	6.37:g.135784313T>C	ENSP00000356774:p.Gln294Arg		Somatic				AHI1_uc003qgh.2_Missense_Mutation_p.Q294R|AHI1_uc003qgj.2_Missense_Mutation_p.Q294R|AHI1_uc003qgk.3_RNA|AHI1_uc003qgl.3_Missense_Mutation_p.Q294R	p.Q294R	NM_001134831	NP_001128303	WXS	Illumina HiSeq	Unspecified	Q8N157	AHI1_HUMAN		GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)	8	1265	-	Breast(56;0.239)|Colorectal(23;0.24)		294					E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	c.881A>G	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	T	3.317	-0.139492	0.06669	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	T;T;T;T;T	0.57107	0.42;0.42;0.42;1.63;0.93	4.34	2.06	0.26882	.	0.686507	0.13895	N	0.355342	T	0.26376	0.0644	L	0.51422	1.61	0.58432	D	0.999999	B;B	0.31125	0.145;0.309	B;B	0.21708	0.036;0.026	T	0.16512	-1.0400	10	0.66056	D	0.02	-4.9798	8.9169	0.35587	0.0:0.0:0.507:0.493	.	294;294	Q8N157-2;Q8N157	.;AHI1_HUMAN	R	294;294;294;294;294;276	ENSP00000356774:Q294R;ENSP00000388650:Q294R;ENSP00000265602:Q294R;ENSP00000322478:Q294R;ENSP00000433063:Q276R	ENSP00000265602:Q294R	Q	-	2	0	AHI1	135826006	0.083000	0.21467	0.245000	0.24217	0.019000	0.09904	1.142000	0.31540	0.484000	0.27630	0.383000	0.25322	CAA		0.313	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651		3	45	0	0	0	0.014758	0	3	45				
BMPER	168667	broad.mit.edu	37	7	34085929	34085929	+	Silent	SNP	A	A	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:34085929A>T	ENST00000297161.2	+	8	962	c.588A>T	c.(586-588)acA>acT	p.T196T	BMPER_ENST00000494786.1_3'UTR|BMPER_ENST00000426693.1_Silent_p.T196T	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	196	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GAGGCAGGACACAATGTGTGA	0.438																																							uc011kap.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(586-588)ACA>ACT		BMP-binding endothelial regulator precursor							140.0	126.0	131.0					7																	34085929		2203	4300	6503	SO:0001819	synonymous_variant	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34085929A>T		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.588A>T	7.37:g.34085929A>T			Somatic					p.T196T	NM_133468	NP_597725	WXS	Illumina HiSeq	Unspecified	Q8N8U9	BMPER_HUMAN			7	702	+			196			VWFC 3.		A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	c.588A>T	CCDS5442.1																																																																																				0.438	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		17	128	0	0	0	0.00499	0	17	128				
Unknown	0	broad.mit.edu	37	7	63680605	63680605	+	IGR	SNP	G	G	A	rs575560193		TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:63680605G>A								GUSBP6 (69506 upstream) : ZNF679 (8246 downstream)																							CTTTTAAGTGGCATTCAAGTC	0.373																																							uc011kdn.1		NA																	0					0						c.(1174-1176)TGG>TGA		zinc finger protein 735							42.0	46.0	45.0					7																	63680605		692	1591	2283	SO:0001628	intergenic_variant	730291				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63680605G>A																													7.37:g.63680605G>A			Somatic					p.W392*	NM_001159524	NP_001152996	WXS	Illumina HiSeq	Unspecified	P0CB33	ZN735_HUMAN			4	1176	+			392			C2H2-type 9.			Nonsense_Mutation	SNP		37	c.1176G>A																																																																																				0	0.373									3	17	0	0	0	0.004672	0	3	17				
PCLO	27445	broad.mit.edu	37	7	82585054	82585054	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:82585054C>T	ENST00000333891.9	-	5	5552	c.5215G>A	c.(5215-5217)Gag>Aag	p.E1739K	PCLO_ENST00000423517.2_Missense_Mutation_p.E1739K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCACTGTCCTCATCAAGTGAT	0.498																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(5215-5217)GAG>AAG		piccolo isoform 1							145.0	135.0	138.0					7																	82585054		2002	4198	6200	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82585054C>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5215G>A	7.37:g.82585054C>T	ENSP00000334319:p.Glu1739Lys		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.E1739K	p.E1739K	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	5504	-			1670						Missense_Mutation	SNP	ENST00000333891.9	37	c.5215G>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772615	0.49680	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.32753	1.44;1.45	5.56	5.56	0.83823	.	.	.	.	.	T	0.43986	0.1272	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.47446	-0.9117	9	0.87932	D	0	.	19.5248	0.95199	0.0:1.0:0.0:0.0	.	1739;1739	Q9Y6V0-5;Q9Y6V0-6	.;.	K	1670;1739;1739	ENSP00000334319:E1739K;ENSP00000388393:E1739K	ENSP00000334319:E1739K	E	-	1	0	PCLO	82422990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.624000	0.88883	0.650000	0.86243	GAG		0.498	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		12	157	0	0	0	0.010729	0	12	157				
STEAP1	26872	broad.mit.edu	37	7	89790341	89790341	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:89790341C>G	ENST00000297205.2	+	3	507	c.307C>G	c.(307-309)Caa>Gaa	p.Q103E	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	103					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					AACTTCCCATCAACAATATTT	0.393																																							uc003ujx.2		NA																	0					0						c.(307-309)CAA>GAA		six transmembrane epithelial antigen of the							64.0	66.0	65.0					7																	89790341		2203	4297	6500	SO:0001583	missense	26872				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity	g.chr7:89790341C>G	AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.307C>G	7.37:g.89790341C>G	ENSP00000297205:p.Gln103Glu		Somatic				STEAP1_uc010lem.2_Missense_Mutation_p.Q103E	p.Q103E	NM_012449	NP_036581	WXS	Illumina HiSeq	Unspecified	Q9UHE8	STEA1_HUMAN			3	507	+	all_hematologic(106;0.112)		103					A4D1E0|O95034	Missense_Mutation	SNP	ENST00000297205.2	37	c.307C>G	CCDS5614.1	.	.	.	.	.	.	.	.	.	.	C	1.200	-0.632825	0.03584	.	.	ENSG00000164647	ENST00000297205	T	0.05996	3.36	5.02	-0.851	0.10716	.	0.558871	0.17976	N	0.155705	T	0.05410	0.0143	L	0.51853	1.615	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.43750	-0.9372	10	0.15952	T	0.53	-3.961	7.7995	0.29166	0.4115:0.2211:0.3675:0.0	.	103;103	B4E221;Q9UHE8	.;STEA1_HUMAN	E	103	ENSP00000297205:Q103E	ENSP00000297205:Q103E	Q	+	1	0	STEAP1	89628277	0.035000	0.19736	0.119000	0.21687	0.390000	0.30446	0.210000	0.17455	-0.031000	0.13781	-0.169000	0.13324	CAA		0.393	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059327.3	NM_012449		8	85	0	0	0	0.00308	0	8	85				
STAG3	10734	broad.mit.edu	37	7	99798718	99798718	+	Silent	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:99798718C>A	ENST00000426455.1	+	20	2474	c.2067C>A	c.(2065-2067)tcC>tcA	p.S689S	GATS_ENST00000436886.2_3'UTR|STAG3_ENST00000440830.1_3'UTR|GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_Silent_p.S631S|STAG3_ENST00000317296.5_Silent_p.S689S	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	689					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCAGTCGTCCTTCCTAGATG	0.517																																							uc003utx.1		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(2065-2067)TCC>TCA		stromal antigen 3							104.0	90.0	95.0					7																	99798718		2203	4300	6503	SO:0001819	synonymous_variant	10734				chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding	g.chr7:99798718C>A	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2067C>A	7.37:g.99798718C>A			Somatic				STAG3_uc010lgs.1_Silent_p.S477S|STAG3_uc011kjk.1_Silent_p.S631S|GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc003uua.3_3'UTR|GATS_uc010lgt.2_RNA|STAG3_uc003uub.1_5'UTR	p.S689S	NM_012447	NP_036579	WXS	Illumina HiSeq	Unspecified	Q9UJ98	STAG3_HUMAN			20	2222	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		689					A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Silent	SNP	ENST00000426455.1	37	c.2067C>A	CCDS34703.1																																																																																				0.517	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		10	48	1	0	6.40141e-05	0.010729	6.99815e-05	10	48				
CUX1	1523	broad.mit.edu	37	7	101833099	101833099	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:101833099G>T	ENST00000292535.7	+	12	1062	c.1024G>T	c.(1024-1026)Gaa>Taa	p.E342*	CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000393824.3_Nonsense_Mutation_p.E314*|CUX1_ENST00000547394.2_Nonsense_Mutation_p.E337*|CUX1_ENST00000360264.3_Nonsense_Mutation_p.E353*|CUX1_ENST00000556210.1_Nonsense_Mutation_p.E342*|CUX1_ENST00000437600.4_Nonsense_Mutation_p.E351*|CUX1_ENST00000425244.2_Nonsense_Mutation_p.E307*|CUX1_ENST00000546411.2_Nonsense_Mutation_p.E342*|CUX1_ENST00000550008.2_Nonsense_Mutation_p.E342*|CUX1_ENST00000292538.4_Nonsense_Mutation_p.E353*|CUX1_ENST00000549414.2_Nonsense_Mutation_p.E342*	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	342					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TCAGCAACTGGAAGAAAAACT	0.537																																							uc003uyx.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(1024-1026)GAA>TAA		cut-like homeobox 1 isoform a							101.0	99.0	100.0					7																	101833099		2203	4300	6503	SO:0001587	stop_gained	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101833099G>T	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1024G>T	7.37:g.101833099G>T	ENSP00000292535:p.Glu342*		Somatic				CUX1_uc003uys.3_Nonsense_Mutation_p.E353*|CUX1_uc003uyt.2_Nonsense_Mutation_p.E353*|CUX1_uc011kkn.1_Nonsense_Mutation_p.E314*|CUX1_uc003uyw.2_Nonsense_Mutation_p.E307*|CUX1_uc003uyv.2_Nonsense_Mutation_p.E337*|CUX1_uc003uyu.2_Nonsense_Mutation_p.E351*	p.E342*	NM_181552	NP_853530	WXS	Illumina HiSeq	Unspecified	P39880	CUX1_HUMAN			12	1062	+			342			Potential.		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Nonsense_Mutation	SNP	ENST00000292535.7	37	c.1024G>T	CCDS5721.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.514120|10.514120	0.99419|0.99419	.|.	.|.	ENSG00000257923|ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210|ENST00000393824	.|.	.|.	.|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.72020	.|0.3409	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73802	.|-0.3868	.|4	0.23302|0.38643	T|T	0.38|0.18	-26.5172|-26.5172	16.7159|16.7159	0.85397|0.85397	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|V	353;337;353;307;351;342;342;342;342;342|148	.|.	ENSP00000292535:E342X|ENSP00000377410:G148V	E|G	+|+	1|2	0|0	CUX1|CUX1	101619819|101619819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.297000|9.297000	0.96120|0.96120	2.429000|2.429000	0.82318|0.82318	0.561000|0.561000	0.74099|0.74099	GAA|GGA		0.537	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		10	35	1	0	3.07112e-06	0.010729	3.44499e-06	10	35				
TRPV5	56302	broad.mit.edu	37	7	142625896	142625896	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:142625896G>T	ENST00000265310.1	-	6	1000	c.652C>A	c.(652-654)Ctg>Atg	p.L218M	TRPV5_ENST00000442623.1_Missense_Mutation_p.L218M	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	218					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GACAGCAGCAGGTTGTACATC	0.582																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(652-654)CTG>ATG		transient receptor potential cation channel,							217.0	204.0	208.0					7																	142625896		2203	4300	6503	SO:0001583	missense	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142625896G>T	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.652C>A	7.37:g.142625896G>T	ENSP00000265310:p.Leu218Met		Somatic				TRPV5_uc003wbz.2_Missense_Mutation_p.L218M	p.L218M	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			6	916	-	Melanoma(164;0.059)		218			Cytoplasmic (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	c.652C>A	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602184	0.46423	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	T;T;T	0.58506	0.33;0.33;0.33	4.01	2.09	0.27110	Ankyrin repeat-containing domain (3);	0.152578	0.45126	D	0.000389	T	0.59266	0.2181	L	0.41415	1.275	0.48135	D	0.999596	P;D	0.54601	0.874;0.967	P;P	0.59643	0.696;0.861	T	0.55598	-0.8116	10	0.36615	T	0.2	-5.766	9.7417	0.40422	0.0906:0.1538:0.7556:0.0	.	218;218	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	M	218;212;218	ENSP00000265310:L218M;ENSP00000406361:L212M;ENSP00000406572:L218M	ENSP00000265310:L218M	L	-	1	2	TRPV5	142336018	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.579000	0.36536	0.918000	0.36919	-0.368000	0.07277	CTG		0.582	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		13	74	1	0	4.36969e-10	0.016723	5.36848e-10	13	74				
KMT2C	58508	broad.mit.edu	37	7	151944996	151944996	+	Silent	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:151944996C>G	ENST00000262189.6	-	14	2741	c.2523G>C	c.(2521-2523)cgG>cgC	p.R841R	KMT2C_ENST00000355193.2_Silent_p.R841R	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	841					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTGTTTGGACCGAGGTCTAC	0.378																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2521-2523)CGG>CGC		myeloid/lymphoid or mixed-lineage leukemia 3							117.0	106.0	110.0					7																	151944996		2203	4297	6500	SO:0001819	synonymous_variant	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151944996C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2523G>C	7.37:g.151944996C>G			Somatic					p.R841R	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	14	2742	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	841					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	c.2523G>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	9.026	0.986168	0.18889	.	.	ENSG00000055609	ENST00000418673	.	.	.	5.67	-3.03	0.05429	.	.	.	.	.	T	0.38746	0.1052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27739	-1.0065	4	.	.	.	.	1.6898	0.02849	0.2012:0.2969:0.0992:0.4027	.	.	.	.	L	37	.	.	V	-	1	0	MLL3	151575929	0.269000	0.24143	0.884000	0.34674	0.998000	0.95712	-0.478000	0.06575	-1.084000	0.03092	0.650000	0.86243	GTC		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			7	290	0	0	0	0.001984	0	7	290				
CSMD1	64478	broad.mit.edu	37	8	2944663	2944663	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr8:2944663G>C	ENST00000520002.1	-	50	7988	c.7433C>G	c.(7432-7434)cCa>cGa	p.P2478R	CSMD1_ENST00000602723.1_Missense_Mutation_p.P2478R|CSMD1_ENST00000400186.3_Missense_Mutation_p.P2478R|CSMD1_ENST00000542608.1_Missense_Mutation_p.P2477R|CSMD1_ENST00000602557.1_Missense_Mutation_p.P2478R|CSMD1_ENST00000537824.1_Missense_Mutation_p.P2477R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2478	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CATGCCAAGTGGGTTTCGTCT	0.498																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(7432-7434)CCA>CGA		CUB and Sushi multiple domains 1 precursor							104.0	104.0	104.0					8																	2944663		2037	4184	6221	SO:0001583	missense	64478					integral to membrane		g.chr8:2944663G>C			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7433C>G	8.37:g.2944663G>C	ENSP00000430733:p.Pro2478Arg		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.P1807R|CSMD1_uc010lrg.2_Missense_Mutation_p.P546R	p.P2478R	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	49	7823	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2478			Sushi 14.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.7433C>G		.	.	.	.	.	.	.	.	.	.	G	13.57	2.278078	0.40294	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.81	4.88	0.63580	Complement control module (2);Sushi/SCR/CCP (3);	0.226724	0.36972	N	0.002309	T	0.29158	0.0725	L	0.28274	0.84	0.80722	D	1	P;B;B	0.34562	0.457;0.391;0.438	B;P;B	0.45794	0.255;0.493;0.36	T	0.11251	-1.0595	10	0.87932	D	0	.	15.0132	0.71565	0.0:0.0:0.783:0.217	.	2478;2478;2477	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	R	2478;2478;2339;2477;2477	ENSP00000383047:P2478R;ENSP00000430733:P2478R;ENSP00000441462:P2477R;ENSP00000446243:P2477R	ENSP00000320445:P2339R	P	-	2	0	CSMD1	2932070	0.967000	0.33354	0.117000	0.21633	0.004000	0.04260	3.131000	0.50515	2.749000	0.94314	0.561000	0.74099	CCA		0.498	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		7	60	0	0	0	0.001984	0	7	60				
CSMD3	114788	broad.mit.edu	37	8	113314076	113314076	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr8:113314076C>G	ENST00000297405.5	-	53	8630	c.8386G>C	c.(8386-8388)Gta>Cta	p.V2796L	CSMD3_ENST00000343508.3_Missense_Mutation_p.V2756L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V2726L|CSMD3_ENST00000455883.2_Missense_Mutation_p.V2627L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2796	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATTCCCTTACAGCAGAGCCC	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8386-8388)GTA>CTA		CUB and Sushi multiple domains 3 isoform 1							127.0	128.0	128.0					8																	113314076		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113314076C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8386G>C	8.37:g.113314076C>G	ENSP00000297405:p.Val2796Leu	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.V1998L|CSMD3_uc003ynt.2_Missense_Mutation_p.V2756L|CSMD3_uc011lhx.1_Missense_Mutation_p.V2627L	p.V2796L	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			53	8545	-			2796			Extracellular (Potential).|Sushi 17.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.8386G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946495	0.92593	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000008	T	0.80276	0.4593	M	0.72118	2.19	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.996;1.0	D;D;D	0.87578	0.994;0.996;0.998	T	0.73113	-0.4085	10	0.10902	T	0.67	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	2627;2796;2756	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	2756;2796;2066;2627;2726	ENSP00000345799:V2756L;ENSP00000297405:V2796L;ENSP00000341558:V2066L;ENSP00000412263:V2627L;ENSP00000343124:V2726L	ENSP00000297405:V2796L	V	-	1	0	CSMD3	113383252	1.000000	0.71417	0.863000	0.33907	0.925000	0.55904	7.666000	0.83877	2.809000	0.96659	0.655000	0.94253	GTA		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		12	79	0	0	0	0.016723	0	12	79				
EFR3A	23167	broad.mit.edu	37	8	132998476	132998476	+	Silent	SNP	T	T	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr8:132998476T>C	ENST00000254624.5	+	17	2130	c.1905T>C	c.(1903-1905)ttT>ttC	p.F635F	EFR3A_ENST00000519656.1_Silent_p.F599F|EFR3A_ENST00000334503.4_Silent_p.F635F	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	635						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CCCCTTATTTTCTACCAGAGC	0.313																																							uc003yte.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)	5						c.(1903-1905)TTT>TTC		EFR3 homolog A							86.0	85.0	85.0					8																	132998476		2203	4294	6497	SO:0001819	synonymous_variant	23167					plasma membrane	binding	g.chr8:132998476T>C	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.1905T>C	8.37:g.132998476T>C			Somatic					p.F635F	NM_015137	NP_055952	WXS	Illumina HiSeq	Unspecified	Q14156	EFR3A_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)		17	2106	+	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		635					A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	ENST00000254624.5	37	c.1905T>C	CCDS34942.2																																																																																				0.313	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137		4	27	0	0	0	0.001168	0	4	27				
KANK1	23189	broad.mit.edu	37	9	730172	730172	+	Silent	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr9:730172G>A	ENST00000382303.1	+	8	3472	c.2820G>A	c.(2818-2820)ctG>ctA	p.L940L	KANK1_ENST00000382297.2_Silent_p.L940L|KANK1_ENST00000382293.3_Silent_p.L782L|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	940					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TCAGCAGCCTGGATGCCTTCC	0.552																																							uc003zgl.1		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2818-2820)CTG>CTA		KN motif and ankyrin repeat domains 1 isoform a							80.0	67.0	72.0					9																	730172		2203	4300	6503	SO:0001819	synonymous_variant	23189				negative regulation of actin filament polymerization	cytoplasm		g.chr9:730172G>A	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2820G>A	9.37:g.730172G>A			Somatic				KANK1_uc003zgm.2_Silent_p.L940L|KANK1_uc003zgn.1_Silent_p.L940L|KANK1_uc003zgs.1_Silent_p.L782L|KANK1_uc010mgx.1_5'Flank|KANK1_uc010mgy.1_5'Flank	p.L940L	NM_015158	NP_055973	WXS	Illumina HiSeq	Unspecified	Q14678	KANK1_HUMAN		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)	8	3469	+		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)	940					A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	c.2820G>A	CCDS34976.1																																																																																				0.552	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158		4	47	0	0	0	0.009096	0	4	47				
PLAA	9373	broad.mit.edu	37	9	26926558	26926558	+	Splice_Site	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr9:26926558C>A	ENST00000397292.3	-	5	983	c.566G>T	c.(565-567)gGg>gTg	p.G189V	PLAA_ENST00000520884.1_Splice_Site_p.G189V	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	189					inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GTCTTCATGCCCTGCATTAAA	0.338																																					Melanoma(175;2670 2735 14091 35526)	Melanoma(175;2670 2735 14091 35526)	uc003zqd.2		NA																	0					0						c.(565-567)GGG>GTG		phospholipase A2-activating protein							68.0	70.0	69.0					9																	26926558		2203	4300	6503	SO:0001630	splice_region_variant	9373				phospholipid metabolic process|signal transduction		phospholipase A2 activator activity	g.chr9:26926558C>A	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.566-1G>T	9.37:g.26926558C>A			Somatic				PLAA_uc003zqe.2_Missense_Mutation_p.G189V	p.G189V	NM_001031689	NP_001026859	WXS	Illumina HiSeq	Unspecified	Q9Y263	PLAP_HUMAN		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)	5	991	-		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)	189					Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	ENST00000397292.3	37	c.566G>T	CCDS35000.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.111952|4.111952	0.77210|0.77210	.|.	.|.	ENSG00000137055|ENSG00000137055	ENST00000397292;ENST00000520884|ENST00000523212	T;T|.	0.70516|.	-0.49;-0.49|.	5.07|5.07	5.07|5.07	0.68467|0.68467	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.048895|.	0.85682|.	D|.	0.000000|.	D|D	0.88040|0.88040	0.6330|0.6330	H|H	0.96333|0.96333	3.805|3.805	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.997;0.993|.	D|D	0.92073|0.92073	0.5666|0.5666	10|5	0.87932|.	D|.	0|.	.|.	18.444|18.444	0.90677|0.90677	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	189;189|.	E5RIM3;Q9Y263|.	.;PLAP_HUMAN|.	V|S	189|165	ENSP00000380460:G189V;ENSP00000429372:G189V|.	ENSP00000380460:G189V|.	G|R	-|-	2|3	0|2	PLAA|PLAA	26916558|26916558	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.929000|0.929000	0.56500|0.56500	7.063000|7.063000	0.76714|0.76714	2.343000|2.343000	0.79666|0.79666	0.467000|0.467000	0.42956|0.42956	GGG|AGG		0.338	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	Missense_Mutation	8	50	1	0	1.06961e-07	0.00308	1.25436e-07	8	50				
KIF27	55582	broad.mit.edu	37	9	86504081	86504081	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr9:86504081C>G	ENST00000297814.2	-	7	2040	c.1897G>C	c.(1897-1899)Gaa>Caa	p.E633Q	KIF27_ENST00000376347.1_Missense_Mutation_p.E24Q|KIF27_ENST00000413982.1_Missense_Mutation_p.E633Q|KIF27_ENST00000334204.2_Missense_Mutation_p.E633Q	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	633					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TTATCTTGTTCTTCTATGTGA	0.413																																							uc004ana.2		NA																	0				lung(4)|skin(1)	5						c.(1897-1899)GAA>CAA		kinesin family member 27							153.0	151.0	152.0					9																	86504081		2203	4300	6503	SO:0001583	missense	55582				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:86504081C>G	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1897G>C	9.37:g.86504081C>G	ENSP00000297814:p.Glu633Gln		Somatic				KIF27_uc010mpw.2_Missense_Mutation_p.E633Q|KIF27_uc010mpx.2_Missense_Mutation_p.E633Q	p.E633Q	NM_017576	NP_060046	WXS	Illumina HiSeq	Unspecified	Q86VH2	KIF27_HUMAN			7	2041	-			633					B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	c.1897G>C	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510971	0.85389	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	4.85	4.85	0.62838	.	0.255496	0.26058	U	0.026599	T	0.66076	0.2753	L	0.56769	1.78	0.33701	D	0.6145	P;D;D	0.62365	0.928;0.991;0.981	P;P;P	0.58970	0.603;0.849;0.522	T	0.73908	-0.3834	10	0.42905	T	0.14	.	18.3352	0.90285	0.0:1.0:0.0:0.0	.	633;633;633	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	Q	633;633;633;24	ENSP00000297814:E633Q;ENSP00000401688:E633Q;ENSP00000333928:E633Q;ENSP00000365525:E24Q	ENSP00000297814:E633Q	E	-	1	0	KIF27	85693901	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.937000	0.70162	2.407000	0.81776	0.557000	0.71058	GAA		0.413	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576		10	161	0	0	0	0.006214	0	10	161				
ATP6V1G1	9550	broad.mit.edu	37	9	117359867	117359867	+	Silent	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr9:117359867C>T	ENST00000374050.3	+	3	294	c.201C>T	c.(199-201)ggC>ggT	p.G67G		NM_004888.3	NP_004879.1	O75348	VATG1_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1	67					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase binding (GO:0051117)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5						GATCCCGTGGCAGTTGCAGCA	0.512																																							uc004bjc.2		NA																	0					0						c.(199-201)GGC>GGT		vacuolar H+ ATPase G1							98.0	86.0	90.0					9																	117359867		2203	4300	6503	SO:0001819	synonymous_variant	9550				cellular iron ion homeostasis|insulin receptor signaling pathway|proton transport|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances	g.chr9:117359867C>T	AF038954	CCDS6807.1	9q33.1	2010-04-21	2006-01-13	2002-05-10	ENSG00000136888	ENSG00000136888		"""ATPases / V-type"""	864	protein-coding gene	gene with protein product		607296	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member J"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1"""	ATP6J, ATP6G1		9653160	Standard	NM_004888		Approved	ATP6GL, Vma10, ATP6G, DKFZp547P234	uc004bjc.3	O75348	OTTHUMG00000021023	ENST00000374050.3:c.201C>T	9.37:g.117359867C>T			Somatic					p.G67G	NM_004888	NP_004879	WXS	Illumina HiSeq	Unspecified	O75348	VATG1_HUMAN			3	326	+			67					Q6IB33	Silent	SNP	ENST00000374050.3	37	c.201C>T	CCDS6807.1																																																																																				0.512	ATP6V1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055454.1	NM_004888		7	65	0	0	0	0.001984	0	7	65				
ZFX	7543	broad.mit.edu	37	X	24228777	24228777	+	Nonsense_Mutation	SNP	A	A	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chrX:24228777A>T	ENST00000379177.1	+	11	2129	c.1702A>T	c.(1702-1704)Aga>Tga	p.R568*	ZFX_ENST00000540034.1_Nonsense_Mutation_p.R607*|ZFX_ENST00000338565.3_Nonsense_Mutation_p.R518*|ZFX_ENST00000379188.3_Nonsense_Mutation_p.R568*|ZFX_ENST00000304543.5_Nonsense_Mutation_p.R568*|ZFX_ENST00000539115.1_Nonsense_Mutation_p.R339*	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	568					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						AAAGCACATGAGAATCCATAC	0.458																																					Esophageal Squamous(20;306 562 7346 32868 37983)	Esophageal Squamous(20;306 562 7346 32868 37983)	uc004dbf.2		NA																	0				ovary(2)	2						c.(1702-1704)AGA>TGA		zinc finger protein, X-linked							102.0	94.0	97.0					X																	24228777		2203	4300	6503	SO:0001587	stop_gained	7543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chrX:24228777A>T		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1702A>T	X.37:g.24228777A>T	ENSP00000368475:p.Arg568*		Somatic				ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Nonsense_Mutation_p.R607*|ZFX_uc010nfz.2_Nonsense_Mutation_p.R224*	p.R568*	NM_003410	NP_003401	WXS	Illumina HiSeq	Unspecified	P17010	ZFX_HUMAN			9	1960	+			568			C2H2-type 5.		B9EG97|O43668|Q8WYJ8	Nonsense_Mutation	SNP	ENST00000379177.1	37	c.1702A>T	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	A	37	6.378112	0.97520	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	.	.	.	5.61	2.76	0.32466	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	5.745	13.8219	0.63325	0.548:0.452:0.0:0.0	.	.	.	.	X	339;568;290;568;568;607;518	.	ENSP00000304985:R568X	R	+	1	2	ZFX	24138698	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.441000	0.35035	0.130000	0.18549	-0.269000	0.10298	AGA		0.458	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410		15	63	0	0	0	0.00499	0	15	63				
ITIH6	347365	broad.mit.edu	37	X	54785155	54785155	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chrX:54785155C>A	ENST00000218436.6	-	8	1381	c.1352G>T	c.(1351-1353)cGc>cTc	p.R451L		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	451	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CTCATATATGCGCCGGGCTAT	0.577																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(1351-1353)CGC>CTC		inter-alpha (globulin) inhibitor H5-like							46.0	42.0	43.0					X																	54785155		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54785155C>A	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1352G>T	X.37:g.54785155C>A	ENSP00000218436:p.Arg451Leu		Somatic					p.R451L	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			8	1382	-			451			VWFA.		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.1352G>T	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271329	0.23221	.	.	ENSG00000102313	ENST00000218436	T	0.12672	2.66	3.66	0.68	0.17980	von Willebrand factor, type A (3);	0.148173	0.39759	U	0.001262	T	0.17238	0.0414	M	0.85099	2.735	0.09310	N	1	B	0.13145	0.007	B	0.15870	0.014	T	0.20009	-1.0288	10	0.54805	T	0.06	.	5.9555	0.19271	0.0:0.6487:0.1515:0.1998	.	451	Q6UXX5	ITH5L_HUMAN	L	451	ENSP00000218436:R451L	ENSP00000218436:R451L	R	-	2	0	ITIH5L	54801880	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.763000	0.04740	-0.009000	0.14296	0.597000	0.82753	CGC		0.577	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		4	11	1	0	0.00909568	0.009096	0.00916674	4	11				
MORC4	79710	broad.mit.edu	37	X	106198242	106198242	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chrX:106198242C>T	ENST00000355610.4	-	14	1860	c.1586G>A	c.(1585-1587)gGa>gAa	p.G529E	MORC4_ENST00000535534.1_Missense_Mutation_p.G277E|MORC4_ENST00000255495.7_Missense_Mutation_p.G529E	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	529						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						GCTATGAATTCCCTCATATCC	0.393																																							uc004emu.3		NA																	0				ovary(1)	1						c.(1585-1587)GGA>GAA		zinc finger, CW type with coiled-coil domain 2							168.0	140.0	149.0					X																	106198242		2203	4300	6503	SO:0001583	missense	79710						ATP binding|zinc ion binding	g.chrX:106198242C>T	AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.1586G>A	X.37:g.106198242C>T	ENSP00000347821:p.Gly529Glu		Somatic				MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Missense_Mutation_p.G529E|MORC4_uc004emw.3_Missense_Mutation_p.G277E	p.G529E	NM_024657	NP_078933	WXS	Illumina HiSeq	Unspecified	Q8TE76	MORC4_HUMAN			14	1829	-			529					A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	ENST00000355610.4	37	c.1586G>A	CCDS14525.2	.	.	.	.	.	.	.	.	.	.	C	0.001	-2.881874	0.00061	.	.	ENSG00000133131	ENST00000355610;ENST00000535534;ENST00000255495	T;T;T	0.28069	2.86;1.63;2.85	5.36	-1.41	0.08941	.	1.908520	0.02659	N	0.107307	T	0.17746	0.0426	N	0.24115	0.695	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.13764	-1.0497	10	0.07644	T	0.81	5.943	5.0739	0.14620	0.1359:0.4196:0.0:0.4444	.	277;529;529	A1YR24;A1YR23;Q8TE76	.;.;MORC4_HUMAN	E	529;277;529	ENSP00000347821:G529E;ENSP00000440359:G277E;ENSP00000255495:G529E	ENSP00000255495:G529E	G	-	2	0	MORC4	106084898	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.009000	0.12765	-0.947000	0.03673	-0.928000	0.02712	GGA		0.393	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057816.3	NM_024657		26	63	0	0	0	0.01892	0	26	63				
DOCK11	139818	broad.mit.edu	37	X	117712548	117712548	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chrX:117712548G>A	ENST00000276202.7	+	13	1513	c.1450G>A	c.(1450-1452)Gta>Ata	p.V484I	DOCK11_ENST00000276204.6_Missense_Mutation_p.V484I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	484					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						AATTGAAAAGGTACTACAGGG	0.348																																							uc004eqp.2		NA																	0				ovary(3)	3						c.(1450-1452)GTA>ATA		dedicator of cytokinesis 11							78.0	72.0	74.0					X																	117712548		2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117712548G>A	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1450G>A	X.37:g.117712548G>A	ENSP00000276202:p.Val484Ile		Somatic				DOCK11_uc004eqq.2_Missense_Mutation_p.V250I	p.V484I	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			13	1513	+			484					A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.1450G>A	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186039	0.57909	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.36878	1.23;1.23	6.16	6.16	0.99307	.	0.055536	0.64402	D	0.000001	T	0.61476	0.2350	M	0.75085	2.285	0.54753	D	0.999989	D;D	0.76494	0.986;0.999	P;D	0.70016	0.781;0.967	T	0.59402	-0.7461	10	0.44086	T	0.13	-15.0968	18.1498	0.89671	0.0:0.0:1.0:0.0	.	484;484	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	484	ENSP00000276204:V484I;ENSP00000276202:V484I	ENSP00000276202:V484I	V	+	1	0	DOCK11	117596576	1.000000	0.71417	0.958000	0.39756	0.110000	0.19582	6.325000	0.72901	2.614000	0.88457	0.594000	0.82650	GTA		0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		4	53	0	0	0	0.009096	0	4	53				
ARNT	405	broad.mit.edu	37	1	150789322	150789326	+	Frame_Shift_Del	DEL	GTTGG	GTTGG	-			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	GTTGG	GTTGG	-	-	GTTGG	GTTGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr1:150789322_150789326delGTTGG	ENST00000358595.5	-	18	1940_1944	c.1740_1744delCCAAC	c.(1738-1746)acccaacagfs	p.QQ581fs	ARNT_ENST00000505755.1_Frame_Shift_Del_p.QQ566fs|ARNT_ENST00000354396.2_Frame_Shift_Del_p.QQ581fs|ARNT_ENST00000515192.1_Frame_Shift_Del_p.QQ567fs	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	581					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAGAATAGCTGTTGGGTGGCAGGGA	0.556			T	ETV6	AML																																		uc001evr.1		NA		Dom	yes		1	1q21	405	T	aryl hydrocarbon receptor nuclear translocator			L	ETV6		AML		0				skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9						c.(1738-1746)ACCCAACAGfs		aryl hydrocarbon receptor nuclear translocator																																				SO:0001589	frameshift_variant	405				positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity	g.chr1:150789322_150789326delGTTGG	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.1740_1744delCCAAC	1.37:g.150789322_150789326delGTTGG	ENSP00000351407:p.Gln581fs		Somatic				ARNT_uc010pck.1_Frame_Shift_Del_p.T69fs|ARNT_uc001evs.1_Frame_Shift_Del_p.T565fs|ARNT_uc009wmb.1_Frame_Shift_Del_p.T566fs|ARNT_uc009wmc.1_Frame_Shift_Del_p.T580fs|ARNT_uc009wmd.1_Frame_Shift_Del_p.T565fs	p.T580fs	NM_001668	NP_001659	WXS	Illumina HiSeq	Unspecified	P27540	ARNT_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)		18	1883_1887	-	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		580_582					B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Frame_Shift_Del	DEL	ENST00000358595.5	37	c.1740_1744delCCAAC	CCDS970.1																																																																																				0.556	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2			18	87	NA	NA	NA	NA	NA	18	87	---	---	---	---
STK31	56164	broad.mit.edu	37	7	23775275	23775275	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:23775275delA	ENST00000355870.3	+	7	721	c.602delA	c.(601-603)gaafs	p.E202fs	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Frame_Shift_Del_p.E179fs|STK31_ENST00000433467.2_Frame_Shift_Del_p.E202fs|STK31_ENST00000428484.1_Frame_Shift_Del_p.E179fs	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	202						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GATATAGGGGAAGAGGTGCTT	0.398																																							uc003sws.3		NA																	0				skin(3)|lung(2)|ovary(2)|stomach(2)	9						c.(601-603)GAAfs		serine/threonine kinase 31 isoform a							135.0	126.0	129.0					7																	23775275		2203	4300	6503	SO:0001589	frameshift_variant	56164						ATP binding|nucleic acid binding|protein serine/threonine kinase activity	g.chr7:23775275delA	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.602delA	7.37:g.23775275delA	ENSP00000348132:p.Glu202fs		Somatic				STK31_uc003swt.3_Frame_Shift_Del_p.E178fs|STK31_uc011jze.1_Frame_Shift_Del_p.E201fs|STK31_uc010kuq.2_Frame_Shift_Del_p.E178fs	p.E201fs	NM_031414	NP_113602	WXS	Illumina HiSeq	Unspecified	Q9BXU1	STK31_HUMAN			7	669	+			201					B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Frame_Shift_Del	DEL	ENST00000355870.3	37	c.602delA	CCDS5386.1																																																																																				0.398	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414		23	116	NA	NA	NA	NA	NA	23	116	---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50737429	50737430	+	Frame_Shift_Ins	INS	-	-	C			TCGA-78-7162-01A-21D-2063-08	TCGA-78-7162-11A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	ac2c5bb2-ead3-4bd7-b0e5-d9eae2dc0577	d600b5f9-7e31-43c9-99f6-4909c035211c	g.chr7:50737429_50737430insC	ENST00000401949.1	-	7	962_963	c.493_494insG	c.(493-495)gccfs	p.A165fs	GRB10_ENST00000439599.1_Frame_Shift_Ins_p.A159fs|GRB10_ENST00000403097.1_Frame_Shift_Ins_p.A159fs|GRB10_ENST00000398810.2_Frame_Shift_Ins_p.A107fs|GRB10_ENST00000402578.1_Frame_Shift_Ins_p.A107fs|GRB10_ENST00000398812.2_Frame_Shift_Ins_p.A165fs|GRB10_ENST00000406641.1_Frame_Shift_Ins_p.A107fs|GRB10_ENST00000335866.3_Frame_Shift_Ins_p.A107fs|GRB10_ENST00000402497.1_Frame_Shift_Ins_p.A107fs|GRB10_ENST00000357271.5_Frame_Shift_Ins_p.A165fs|GRB10_ENST00000407526.1_Frame_Shift_Ins_p.A107fs			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	165					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					CTGCTTTGCGGCGGCCTGGCTC	0.584									Russell-Silver syndrome																														uc003tpi.2		NA																	0				lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(493-495)GCCfs		growth factor receptor-bound protein 10 isoform																																				SO:0001589	frameshift_variant	2887	Russell-Silver_syndrome	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity	g.chr7:50737429_50737430insC		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.494dupG	7.37:g.50737430_50737430dupC	ENSP00000385770:p.Ala165fs		Somatic				GRB10_uc003tph.3_Frame_Shift_Ins_p.A107fs|GRB10_uc003tpj.2_Frame_Shift_Ins_p.A165fs|GRB10_uc003tpk.2_Frame_Shift_Ins_p.A165fs|GRB10_uc010kzb.2_Frame_Shift_Ins_p.A107fs|GRB10_uc003tpl.2_Frame_Shift_Ins_p.A159fs|GRB10_uc003tpm.2_Frame_Shift_Ins_p.A107fs|GRB10_uc003tpn.2_Frame_Shift_Ins_p.A107fs	p.A165fs	NM_005311	NP_005302	WXS	Illumina HiSeq	Unspecified	Q13322	GRB10_HUMAN			4	524_525	-	Glioma(55;0.08)|all_neural(89;0.245)		165					A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Frame_Shift_Ins	INS	ENST00000401949.1	37	c.493_494insG	CCDS43582.1																																																																																				0.584	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1			7	30	NA	NA	NA	NA	NA	7	30	---	---	---	---
