#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ATAD3A	55210	broad.mit.edu	37	1	1464630	1464630	+	Silent	SNP	C	C	T	rs374773488	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:1464630C>T	ENST00000378755.5	+	15	1771	c.1677C>T	c.(1675-1677)taC>taT	p.Y559Y	ATAD3A_ENST00000378756.3_Silent_p.Y511Y|ATAD3A_ENST00000536055.1_Silent_p.Y432Y	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	559					cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		AGTTTGACTACGGGAGGAAGT	0.672													c|||	2	0.000399361	0.0	0.0	5008	,	,		17008	0.0		0.0	False		,,,				2504	0.002						uc001afz.1		NA																	0				skin(1)	1						c.(1675-1677)TAC>TAT		ATPase family, AAA domain containing 3A							26.0	29.0	28.0					1																	1464630		2197	4292	6489	SO:0001819	synonymous_variant	55210						ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr1:1464630C>T	AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.1677C>T	1.37:g.1464630C>T			Somatic				ATAD3A_uc001aga.1_Silent_p.Y511Y|ATAD3A_uc001agb.1_Silent_p.Y432Y|ATAD3A_uc001agc.1_5'Flank	p.Y559Y	NM_018188	NP_060658	WXS	Illumina HiSeq	Unspecified	Q9NVI7	ATD3A_HUMAN		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)	15	1771	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	559					B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Silent	SNP	ENST00000378755.5	37	c.1677C>T	CCDS31.1	.	.	.	.	.	.	.	.	.	.	c	5.026	0.190563	0.09547	.	.	ENSG00000197785	ENST00000339113	.	.	.	4.26	-1.49	0.08718	.	.	.	.	.	T	0.54078	0.1836	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49551	-0.8928	4	.	.	.	.	8.6498	0.34027	0.0:0.2956:0.0:0.7044	.	.	.	.	W	497	.	.	R	+	1	2	ATAD3A	1454493	0.011000	0.17503	0.976000	0.42696	0.514000	0.34195	-1.142000	0.03203	-0.134000	0.11516	0.407000	0.27541	CGG		0.672	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	NM_018188		4	10	0	0	0	0.004482	0	4	10				
MST1L	11223	broad.mit.edu	37	1	17085872	17085872	+	RNA	SNP	A	A	G	rs1806514		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:17085872A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.W307R(1)|p.W317R(1)									TCGAGGTTCCAGCAGAAGTTC	0.662																																							uc010ock.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(949-951)TGG>CGG		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085872A>G	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085872A>G			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.W317R	NR_002729		WXS	Illumina HiSeq	Unspecified					8	949	-								B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37	c.949T>C		.	.	.	.	.	.	.	.	.	.	.	0.008	-1.910101	0.00508	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.37857	N	0.001920	T	0.10809	0.0264	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.28073	-1.0055	6	0.02654	T	1	.	2.1243	0.03734	0.4998:2.0E-4:2.0E-4:0.4998	rs1806514;rs2021016;rs2761537;rs3982178;rs61595267	317	Q2TV78-2	.	R	307;317;317	.	ENSP00000439273:W317R	W	-	1	0	MST1P9	16958459	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.935000	0.40173	-0.000000	0.14550	0.000000	0.15137	TGG		0.662	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		3	18	0	0	0	0.00308	0	3	18				
AKR7A2	8574	broad.mit.edu	37	1	19632530	19632530	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:19632530G>C	ENST00000235835.3	-	6	921	c.900C>G	c.(898-900)taC>taG	p.Y300*	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	300					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTGAGTGGTGGTACATCCACC	0.617																																							uc001bbw.2		NA																	0				central_nervous_system(1)	1						c.(898-900)TAC>TAG		aldo-keto reductase family 7, member A2							68.0	67.0	67.0					1																	19632530		2203	4300	6503	SO:0001587	stop_gained	8574				carbohydrate metabolic process|cellular aldehyde metabolic process	Golgi apparatus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity	g.chr1:19632530G>C	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.900C>G	1.37:g.19632530G>C	ENSP00000235835:p.Tyr300*		Somatic				AKR7A2_uc001bbx.2_Nonsense_Mutation_p.Y265*	p.Y300*	NM_003689	NP_003680	WXS	Illumina HiSeq	Unspecified	O43488	ARK72_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	6	922	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	300					O75749|Q5TG63	Nonsense_Mutation	SNP	ENST00000235835.3	37	c.900C>G	CCDS194.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006380	0.93287	.	.	ENSG00000053371	ENST00000235835;ENST00000330072;ENST00000489286	.	.	.	3.84	3.84	0.44239	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6537	0.62325	0.0:0.0:1.0:0.0	.	.	.	.	X	300;255;162	.	ENSP00000235835:Y300X	Y	-	3	2	AKR7A2	19505117	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.851000	0.62896	2.142000	0.66516	0.561000	0.74099	TAC		0.617	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689		35	45	0	0	0	0.003271	0	35	45				
ARID1A	8289	broad.mit.edu	37	1	27092806	27092806	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:27092806C>A	ENST00000324856.7	+	9	3198	c.2827C>A	c.(2827-2829)Cct>Act	p.P943T	ARID1A_ENST00000457599.2_Missense_Mutation_p.P943T|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Missense_Mutation_p.P560T	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	943					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CATGATCAACCCTCAGGGACC	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		0				ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(2827-2829)CCT>ACT		AT rich interactive domain 1A isoform a							98.0	97.0	97.0					1																	27092806		2203	4300	6503	SO:0001583	missense	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27092806C>A	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2827C>A	1.37:g.27092806C>A	ENSP00000320485:p.Pro943Thr		Somatic				ARID1A_uc001bmt.1_Missense_Mutation_p.P943T|ARID1A_uc001bmu.1_Missense_Mutation_p.P943T|ARID1A_uc001bmw.1_Missense_Mutation_p.P560T	p.P943T	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	9	3200	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	943					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	c.2827C>A	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.782023	0.31502	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.02280	4.56;4.36;4.38	6.17	6.17	0.99709	.	0.228760	0.47093	D	0.000253	T	0.01320	0.0043	N	0.03016	-0.435	0.80722	D	1	B;B;B	0.20887	0.01;0.049;0.01	B;B;B	0.12837	0.002;0.008;0.002	T	0.61530	-0.7044	10	0.10111	T	0.7	-6.2191	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	943;943;597	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	T	943;943;560	ENSP00000320485:P943T;ENSP00000387636:P943T;ENSP00000363267:P560T	ENSP00000320485:P943T	P	+	1	0	ARID1A	26965393	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.599000	0.54045	2.941000	0.99782	0.655000	0.94253	CCT		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		29	68	1	0	1.12875e-08	0.00632	1.22511e-08	29	68				
LRRIQ3	127255	broad.mit.edu	37	1	74507000	74507000	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:74507000C>T	ENST00000395089.1	-	6	1614	c.1615G>A	c.(1615-1617)Gag>Aag	p.E539K	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.E539K			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	539										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TCATTCTTCTCCAGTCTGTCA	0.318																																							uc001dfy.3		NA																	0				ovary(2)	2						c.(1615-1617)GAG>AAG		leucine-rich repeats and IQ motif containing 3							88.0	85.0	86.0					1																	74507000		1808	4066	5874	SO:0001583	missense	127255							g.chr1:74507000C>T	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1615G>A	1.37:g.74507000C>T	ENSP00000378524:p.Glu539Lys		Somatic				LRRIQ3_uc001dfz.3_Intron	p.E539K	NM_001105659	NP_001099129	WXS	Illumina HiSeq	Unspecified	A6PVS8	LRIQ3_HUMAN			7	1807	-			539					A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	c.1615G>A	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	T	1.250	-0.618734	0.03663	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.06608	3.28;3.28	5.86	2.19	0.27852	.	.	.	.	.	T	0.00468	0.0015	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46442	-0.9191	9	0.02654	T	1	.	5.2547	0.15540	0.0:0.1504:0.2841:0.5655	.	539	A6PVS8	LRIQ3_HUMAN	K	539	ENSP00000378524:E539K;ENSP00000346414:E539K	ENSP00000346414:E539K	E	-	1	0	LRRIQ3	74279588	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.142000	0.31540	-0.044000	0.13491	-0.269000	0.10298	GAG		0.318	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		36	62	0	0	0	0.00623	0	36	62				
TTLL7	79739	broad.mit.edu	37	1	84417596	84417596	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:84417596C>A	ENST00000260505.8	-	3	466	c.89G>T	c.(88-90)aGg>aTg	p.R30M	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	30					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TCTGACTTTCCTTTTCATTGT	0.353																																							uc001djc.2		NA																	0				ovary(1)	1						c.(88-90)AGG>ATG		tubulin tyrosine ligase-like family, member 7							58.0	62.0	61.0					1																	84417596		2203	4300	6503	SO:0001583	missense	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84417596C>A	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.89G>T	1.37:g.84417596C>A	ENSP00000260505:p.Arg30Met		Somatic				TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	p.R30M	NM_024686	NP_078962	WXS	Illumina HiSeq	Unspecified	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	3	485	-			30					Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	c.89G>T	CCDS690.2	.	.	.	.	.	.	.	.	.	.	C	17.82	3.484091	0.63962	.	.	ENSG00000137941	ENST00000260505;ENST00000370703	T	0.04275	3.66	5.21	4.28	0.50868	.	0.190122	0.56097	D	0.000037	T	0.04452	0.0122	M	0.65975	2.015	0.54753	D	0.999989	B	0.31009	0.303	B	0.34385	0.181	T	0.07065	-1.0792	10	0.66056	D	0.02	.	13.5239	0.61584	0.0:0.9242:0.0:0.0758	.	30	Q6ZT98	TTLL7_HUMAN	M	30	ENSP00000260505:R30M	ENSP00000260505:R30M	R	-	2	0	TTLL7	84190184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.254000	0.51477	2.599000	0.87857	0.655000	0.94253	AGG		0.353	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		20	75	1	0	4.63292e-17	0.008871	5.91861e-17	20	75				
TCHH	7062	broad.mit.edu	37	1	152080436	152080436	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:152080436C>G	ENST00000368804.1	-	2	5256	c.5257G>C	c.(5257-5259)Gag>Cag	p.E1753Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1753	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGAGCTGCTCTTCCTCTAGG	0.582																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(5257-5259)GAG>CAG		trichohyalin							48.0	48.0	48.0					1																	152080436		1899	4115	6014	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152080436C>G	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5257G>C	1.37:g.152080436C>G	ENSP00000357794:p.Glu1753Gln		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.E1753Q	p.E1753Q	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	5257	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1753			23 X 26 AA approximate tandem repeats.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.5257G>C	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	6.830	0.522312	0.13066	.	.	ENSG00000159450	ENST00000368804	T	0.04809	3.55	3.11	-3.72	0.04411	.	.	.	.	.	T	0.01061	0.0035	L	0.49640	1.575	0.09310	N	1	B	0.26081	0.141	B	0.17722	0.019	T	0.47142	-0.9140	9	0.12103	T	0.63	.	6.1193	0.20144	0.0:0.3709:0.431:0.1981	.	1753	Q07283	TRHY_HUMAN	Q	1753	ENSP00000357794:E1753Q	ENSP00000357794:E1753Q	E	-	1	0	TCHH	150347060	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.384000	0.07389	-0.984000	0.03507	0.313000	0.20887	GAG		0.582	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		34	111	0	0	0	0.010818	0	34	111				
KCNJ10	3766	broad.mit.edu	37	1	160012237	160012237	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:160012237C>T	ENST00000368089.3	-	2	312	c.86G>A	c.(85-87)aGa>aAa	p.R29K	KCNJ10_ENST00000509700.1_5'Flank	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	29					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	TGTCAGGACTCTCCGCCGTCG	0.542																																					GBM(167;1368 2014 14817 36425 43215)	GBM(167;1368 2014 14817 36425 43215)	uc001fuw.1		NA																	0				ovary(1)	1						c.(85-87)AGA>AAA		potassium inwardly-rectifying channel, subfamily							133.0	113.0	120.0					1																	160012237		2203	4300	6503	SO:0001583	missense	3766					integral to plasma membrane	ATP binding|ATP-activated inward rectifier potassium channel activity	g.chr1:160012237C>T	U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.86G>A	1.37:g.160012237C>T	ENSP00000357068:p.Arg29Lys		Somatic					p.R29K	NM_002241	NP_002232	WXS	Illumina HiSeq	Unspecified	P78508	IRK10_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		2	236	-	all_hematologic(112;0.093)		29			Cytoplasmic (By similarity).		A3KME7|Q5VUT9|Q8N4I7|Q92808	Missense_Mutation	SNP	ENST00000368089.3	37	c.86G>A	CCDS1193.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919060	0.73098	.	.	ENSG00000177807	ENST00000368089	D	0.95788	-3.81	5.17	5.17	0.71159	.	0.060804	0.64402	D	0.000003	D	0.93497	0.7925	N	0.08118	0	0.54753	D	0.999983	D	0.71674	0.998	D	0.77557	0.99	D	0.95648	0.8704	10	0.87932	D	0	.	16.2022	0.82088	0.0:1.0:0.0:0.0	.	29	P78508	IRK10_HUMAN	K	29	ENSP00000357068:R29K	ENSP00000357068:R29K	R	-	2	0	KCNJ10	158278861	0.251000	0.23961	0.982000	0.44146	0.926000	0.56050	2.647000	0.46639	2.688000	0.91661	0.591000	0.81541	AGA		0.542	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060629.1	NM_002241		18	129	0	0	0	0.006122	0	18	129				
TNN	63923	broad.mit.edu	37	1	175116204	175116204	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:175116204C>T	ENST00000239462.4	+	19	4010	c.3897C>T	c.(3895-3897)ttC>ttT	p.F1299F		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1299					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGCGAACGTTCTGATGGCCCG	0.607											OREG0013992	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001gkl.1		NA																	0				large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(3895-3897)TTC>TTT		tenascin N precursor							49.0	46.0	47.0					1																	175116204		2203	4300	6503	SO:0001819	synonymous_variant	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175116204C>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3897C>T	1.37:g.175116204C>T			Somatic	OREG0013992	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1921		p.F1299F	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	19	4010	+		Breast(1374;0.000962)	1299					B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	c.3897C>T	CCDS30943.1																																																																																				0.607	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		13	42	0	0	0	0.00499	0	13	42				
PAPPA2	60676	broad.mit.edu	37	1	176762762	176762762	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:176762762C>G	ENST00000367662.3	+	20	6251	c.5087C>G	c.(5086-5088)aCt>aGt	p.T1696S		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1696	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAGAATATCACTGCTGACACT	0.493																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(5086-5088)ACT>AGT		pappalysin 2 isoform 1							160.0	158.0	159.0					1																	176762762		1999	4171	6170	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176762762C>G	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5087C>G	1.37:g.176762762C>G	ENSP00000356634:p.Thr1696Ser		Somatic				PAPPA2_uc009www.2_RNA	p.T1696S	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			20	6251	+			1696			Sushi 5.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.5087C>G	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699664	0.48307	.	.	ENSG00000116183	ENST00000367662	T	0.01981	4.52	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.03739	0.0106	L	0.51853	1.615	0.80722	D	1	B	0.33212	0.402	B	0.33799	0.17	T	0.53851	-0.8380	10	0.36615	T	0.2	-13.1379	15.5755	0.76380	0.0:1.0:0.0:0.0	.	1696	Q9BXP8	PAPP2_HUMAN	S	1696	ENSP00000356634:T1696S	ENSP00000356634:T1696S	T	+	2	0	PAPPA2	175029385	1.000000	0.71417	0.532000	0.27989	0.819000	0.46315	5.426000	0.66476	2.404000	0.81709	0.655000	0.94253	ACT		0.493	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			59	111	0	0	0	0.01441	0	59	111				
RGS13	6003	broad.mit.edu	37	1	192627430	192627430	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:192627430G>T	ENST00000391995.2	+	6	515	c.227G>T	c.(226-228)cGg>cTg	p.R76L	RGS13_ENST00000543215.1_Missense_Mutation_p.R76L|RGS13_ENST00000482095.1_3'UTR	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	76	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						ATTGCCTCACGGTGGAGCAGA	0.413																																							uc001gsj.2		NA																	0					0						c.(226-228)CGG>CTG		regulator of G-protein signalling 13							78.0	78.0	78.0					1																	192627430		2203	4300	6503	SO:0001583	missense	6003					plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192627430G>T	AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.227G>T	1.37:g.192627430G>T	ENSP00000375853:p.Arg76Leu		Somatic				RGS13_uc001gsk.2_Missense_Mutation_p.R76L	p.R76L	NM_002927	NP_002918	WXS	Illumina HiSeq	Unspecified	O14921	RGS13_HUMAN			6	508	+			76			RGS.		Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	ENST00000391995.2	37	c.227G>T	CCDS1376.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616539	0.28801	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.31510	1.49;1.49	5.78	2.73	0.32206	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.308918	0.34531	N	0.003900	T	0.19287	0.0463	N	0.21097	0.63	0.18873	N	0.999986	B	0.11235	0.004	B	0.20955	0.032	T	0.20075	-1.0286	10	0.27785	T	0.31	.	9.4808	0.38900	0.2469:0.0:0.7531:0.0	.	76	O14921	RGS13_HUMAN	L	76	ENSP00000375853:R76L;ENSP00000442837:R76L	ENSP00000375853:R76L	R	+	2	0	RGS13	190894053	0.000000	0.05858	0.321000	0.25320	0.746000	0.42486	-0.039000	0.12124	0.301000	0.22738	0.555000	0.69702	CGG		0.413	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927		27	69	1	0	8.24728e-16	0.004656	1.0101e-15	27	69				
PIK3C2B	5287	broad.mit.edu	37	1	204433650	204433650	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:204433650C>A	ENST00000367187.3	-	5	1673	c.1117G>T	c.(1117-1119)Ggg>Tgg	p.G373W	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.G373W	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	373					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			ACCTCATCCCCGAGGTGCTCT	0.522																																							uc001haw.2		NA																	0				lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.(1117-1119)GGG>TGG		phosphoinositide-3-kinase, class 2 beta							128.0	116.0	120.0					1																	204433650		2203	4300	6503	SO:0001583	missense	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204433650C>A	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1117G>T	1.37:g.204433650C>A	ENSP00000356155:p.Gly373Trp		Somatic				PIK3C2B_uc010pqv.1_Missense_Mutation_p.G373W|PIK3C2B_uc001hax.1_Missense_Mutation_p.G373W|PIK3C2B_uc009xbd.1_RNA	p.G373W	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		5	1596	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		373					O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	c.1117G>T	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414792	0.62511	.	.	ENSG00000133056	ENST00000367187;ENST00000424712;ENST00000438854;ENST00000367184	T;T	0.61859	0.07;0.09	5.24	5.24	0.73138	Phosphoinositide 3-kinase, ras-binding (2);	0.317119	0.34603	N	0.003823	T	0.73225	0.3560	L	0.59436	1.845	0.42774	D	0.993845	D;D	0.89917	1.0;1.0	D;D	0.97110	0.965;1.0	T	0.75536	-0.3283	10	0.87932	D	0	.	16.7749	0.85548	0.0:1.0:0.0:0.0	.	373;373	F5GWN5;O00750	.;P3C2B_HUMAN	W	373;373;151;151	ENSP00000356155:G373W;ENSP00000400561:G373W	ENSP00000356152:G151W	G	-	1	0	PIK3C2B	202700273	0.991000	0.36638	0.979000	0.43373	0.628000	0.37860	3.009000	0.49552	2.723000	0.93209	0.655000	0.94253	GGG		0.522	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		40	98	1	0	1.32136e-16	0.00874	1.64861e-16	40	98				
RAB3GAP2	25782	broad.mit.edu	37	1	220363423	220363423	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:220363423G>T	ENST00000358951.2	-	16	1813	c.1697C>A	c.(1696-1698)aCa>aAa	p.T566K		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	566					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GGGAGATTTTGTTTTCAGTAA	0.308																																							uc010puk.1		NA																	0				central_nervous_system(1)	1						c.(1696-1698)ACA>AAA		rab3 GTPase-activating protein, non-catalytic							115.0	116.0	116.0					1																	220363423		2203	4300	6503	SO:0001583	missense	25782				intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity	g.chr1:220363423G>T	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1697C>A	1.37:g.220363423G>T	ENSP00000351832:p.Thr566Lys		Somatic				RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.T146K	p.T566K	NM_012414	NP_036546	WXS	Illumina HiSeq	Unspecified	Q9H2M9	RBGPR_HUMAN		GBM - Glioblastoma multiforme(131;0.0443)	16	1861	-			566					A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	c.1697C>A	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281345	0.23392	.	.	ENSG00000118873	ENST00000358951	T	0.28454	1.61	5.63	1.46	0.22682	.	0.811393	0.11984	N	0.510475	T	0.13841	0.0335	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.32214	-0.9915	10	0.06365	T	0.9	.	7.3005	0.26418	0.2043:0.0:0.6732:0.1225	.	566	Q9H2M9	RBGPR_HUMAN	K	566	ENSP00000351832:T566K	ENSP00000351832:T566K	T	-	2	0	RAB3GAP2	218430046	0.203000	0.23435	0.004000	0.12327	0.953000	0.61014	1.437000	0.34991	0.847000	0.35167	0.655000	0.94253	ACA		0.308	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414		15	72	1	0	5.01169e-05	0.00499	5.10734e-05	15	72				
C1orf131	128061	broad.mit.edu	37	1	231362496	231362496	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:231362496C>T	ENST00000366649.2	-	5	707	c.682G>A	c.(682-684)Gaa>Aaa	p.E228K	C1orf131_ENST00000318906.2_Missense_Mutation_p.E228K|C1orf131_ENST00000366651.3_Missense_Mutation_p.E227K			Q8NDD1	CA131_HUMAN	chromosome 1 open reading frame 131	228	Lys-rich.						poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	8	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AGTCTCTTTTCTTCTTCCTTT	0.408																																							uc001hun.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(682-684)GAA>AAA		hypothetical protein LOC128061							169.0	163.0	165.0					1																	231362496		2203	4300	6503	SO:0001583	missense	128061							g.chr1:231362496C>T	BC062353	CCDS1591.2, CCDS73049.1	1q42.2	2012-06-27			ENSG00000143633	ENSG00000143633			25332	protein-coding gene	gene with protein product						12975309	Standard	XM_005273051		Approved	DKFZp547B1713	uc001hul.3	Q8NDD1	OTTHUMG00000038023	ENST00000366649.2:c.682G>A	1.37:g.231362496C>T	ENSP00000355609:p.Glu228Lys		Somatic				C1orf131_uc001hul.2_Missense_Mutation_p.E228K|C1orf131_uc001hum.2_Missense_Mutation_p.E227K|C1orf131_uc010pwd.1_Missense_Mutation_p.E227K	p.E228K	NM_152379	NP_689592	WXS	Illumina HiSeq	Unspecified	Q8NDD1	CA131_HUMAN			5	719	-	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)	228			Lys-rich.		Q5TBI0|Q5TBI1|Q6P6B4|Q7Z6H5|Q8N432|Q96NM6	Missense_Mutation	SNP	ENST00000366649.2	37	c.682G>A	CCDS1591.2	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262481	0.80358	.	.	ENSG00000143633	ENST00000366649;ENST00000318906;ENST00000366651;ENST00000366648;ENST00000451322	T;T;T;T	0.49432	0.8;0.8;0.8;0.78	4.64	4.64	0.57946	.	0.134283	0.49305	D	0.000157	T	0.69278	0.3093	M	0.79926	2.475	0.36350	D	0.860026	D;D;D;D	0.76494	0.986;0.999;0.998;0.998	P;D;D;D	0.80764	0.797;0.98;0.994;0.994	T	0.78679	-0.2110	10	0.72032	D	0.01	-21.3308	14.6117	0.68519	0.0:1.0:0.0:0.0	.	227;228;227;228	B4E0F7;Q8NDD1;Q8NDD1-3;Q8NDD1-2	.;CA131_HUMAN;.;.	K	228;228;227;198;191	ENSP00000355609:E228K;ENSP00000321341:E228K;ENSP00000355611:E227K;ENSP00000401677:E191K	ENSP00000321341:E228K	E	-	1	0	C1orf131	229429119	1.000000	0.71417	0.959000	0.39883	0.938000	0.57974	5.659000	0.68010	2.423000	0.82170	0.650000	0.86243	GAA		0.408	C1orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092864.1	NM_152379		23	167	0	0	0	0.00278	0	23	167				
RYR2	6262	broad.mit.edu	37	1	237620026	237620026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:237620026G>T	ENST00000366574.2	+	16	1920	c.1603G>T	c.(1603-1605)Gag>Tag	p.E535*	RYR2_ENST00000542537.1_Nonsense_Mutation_p.E519*|RYR2_ENST00000360064.6_Nonsense_Mutation_p.E533*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	535					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCTCTGTATGAGTTGCTGGG	0.443																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1603-1605)GAG>TAG		cardiac muscle ryanodine receptor							166.0	161.0	163.0					1																	237620026		1905	4130	6035	SO:0001587	stop_gained	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237620026G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1603G>T	1.37:g.237620026G>T	ENSP00000355533:p.Glu535*		Somatic					p.E535*	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		16	1723	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	535			Cytoplasmic (By similarity).		Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	37	c.1603G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	38	7.090270	0.98055	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	4.6	3.68	0.42216	.	0.094411	0.42172	U	0.000755	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	12.9766	0.58540	0.0791:0.0:0.9209:0.0	.	.	.	.	X	535;533;519	.	ENSP00000353174:E533X	E	+	1	0	RYR2	235686649	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.828000	0.55753	1.046000	0.40249	0.563000	0.77884	GAG		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		37	108	1	0	2.95478e-19	0.00874	3.88633e-19	37	108				
FMN2	56776	broad.mit.edu	37	1	240370778	240370778	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:240370778C>T	ENST00000319653.9	+	5	2896	c.2666C>T	c.(2665-2667)cCt>cTt	p.P889L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	889	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ATGACAGTGCCTACTCTGCCC	0.642																																							uc010pyd.1		NA																	0				ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(2665-2667)CCT>CTT		formin 2							68.0	67.0	68.0					1																	240370778		2203	4300	6503	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240370778C>T	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2666C>T	1.37:g.240370778C>T	ENSP00000318884:p.Pro889Leu		Somatic				FMN2_uc010pye.1_Missense_Mutation_p.P893L	p.P889L	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	2891	+	Ovarian(103;0.127)	all_cancers(173;0.013)	889			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.2666C>T	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	2.720	-0.266901	0.05754	.	.	ENSG00000155816	ENST00000319653	T	0.29142	1.58	3.79	1.9	0.25705	Actin-binding FH2/DRF autoregulatory (1);	0.139550	0.32719	N	0.005727	T	0.18341	0.0440	L	0.29908	0.895	0.46849	D	0.999221	B	0.12630	0.006	B	0.09377	0.004	T	0.07578	-1.0765	9	.	.	.	.	8.0206	0.30406	0.0:0.7919:0.0:0.2081	.	889	Q9NZ56	FMN2_HUMAN	L	889	ENSP00000318884:P889L	.	P	+	2	0	FMN2	238437401	0.059000	0.20769	0.003000	0.11579	0.016000	0.09150	0.599000	0.24089	0.388000	0.25054	-0.300000	0.09419	CCT		0.642	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		77	151	0	0	0	0.01441	0	77	151				
OR2M1P	388762	broad.mit.edu	37	1	248285994	248285994	+	IGR	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:248285994C>A								OR2L13 (21770 upstream) : OR2M5 (22455 downstream)																							TTCTATGGAGCAGGTTTGTTC	0.512																																							uc001idy.1		NA																	0					0						c.(556-558)GCA>GAA		RecName: Full=Olfactory receptor 2M5;																																				SO:0001628	intergenic_variant	388762							g.chr1:248285994C>A																													1.37:g.248285994C>A			Somatic					p.A186E	NR_002141		WXS	Illumina HiSeq	Unspecified					1	557	+									Missense_Mutation	SNP		37	c.557C>A																																																																																				0	0.512									77	232	1	0	3.83446e-41	0.01441	5.62527e-41	77	232				
OR2T4	127074	broad.mit.edu	37	1	248525358	248525358	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr1:248525358G>T	ENST00000366475.1	+	1	476	c.476G>T	c.(475-477)tGc>tTc	p.C159F		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGGCCATCTGCCATCCTCTC	0.532																																							uc001ieh.1		NA																	0				central_nervous_system(1)	1						c.(475-477)TGC>TTC		olfactory receptor, family 2, subfamily T,							241.0	215.0	224.0					1																	248525358		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525358G>T	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.476G>T	1.37:g.248525358G>T	ENSP00000355431:p.Cys159Phe		Somatic					p.C159F	NM_001004696	NP_001004696	WXS	Illumina HiSeq	Unspecified	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	476	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		159			Cytoplasmic (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.476G>T	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826603	0.50739	.	.	ENSG00000196944	ENST00000366475	T	0.02140	4.43	3.48	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000096	T	0.15998	0.0385	H	0.94620	3.56	0.40556	D	0.981168	D	0.89917	1.0	D	0.74348	0.983	T	0.01367	-1.1373	10	0.87932	D	0	.	10.3138	0.43725	0.1017:0.0:0.8983:0.0	.	159	Q8NH00	OR2T4_HUMAN	F	159	ENSP00000355431:C159F	ENSP00000355431:C159F	C	+	2	0	OR2T4	246591981	1.000000	0.71417	0.373000	0.26003	0.713000	0.41058	4.961000	0.63681	0.435000	0.26365	0.485000	0.47835	TGC		0.532	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		101	284	1	0	2.94851e-48	0.01441	4.34945e-48	101	284				
CUBN	8029	broad.mit.edu	37	10	17130243	17130243	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr10:17130243T>A	ENST00000377833.4	-	15	1932	c.1867A>T	c.(1867-1869)Agt>Tgt	p.S623C		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	623	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGTCAGGACTAGTTACAACA	0.438																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(1867-1869)AGT>TGT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						106.0	97.0	100.0					10																	17130243		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:17130243T>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1867A>T	10.37:g.17130243T>A	ENSP00000367064:p.Ser623Cys		Somatic					p.S623C	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			15	1919	-			623			CUB 2.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.1867A>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.378664	0.42207	.	.	ENSG00000107611	ENST00000377833	T	0.30182	1.54	5.14	2.75	0.32379	CUB (5);	0.390333	0.22021	N	0.065730	T	0.45975	0.1369	M	0.66939	2.045	0.09310	N	1	D	0.71674	0.998	D	0.65443	0.935	T	0.25916	-1.0118	10	0.59425	D	0.04	.	6.5773	0.22573	0.1379:0.0758:0.0:0.7863	.	623	O60494	CUBN_HUMAN	C	623	ENSP00000367064:S623C	ENSP00000367064:S623C	S	-	1	0	CUBN	17170249	0.005000	0.15991	0.037000	0.18230	0.673000	0.39480	0.440000	0.21592	0.396000	0.25283	0.533000	0.62120	AGT		0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		43	61	0	0	0	0.011902	0	43	61				
HIF1AN	55662	broad.mit.edu	37	10	102296366	102296366	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr10:102296366C>A	ENST00000299163.6	+	2	476	c.376C>A	c.(376-378)Cat>Aat	p.H126N	HIF1AN_ENST00000528044.1_3'UTR	NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	126					cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.H126Y(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		AATGAAATTTCATGAGTTCGT	0.423																																							uc001krj.3		NA																	1	Substitution - Missense(1)		NS(1)		0						c.(376-378)CAT>AAT		hypoxia-inducible factor 1, alpha subunit							81.0	85.0	84.0					10																	102296366		2203	4300	6503	SO:0001583	missense	55662				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding	g.chr10:102296366C>A	AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.376C>A	10.37:g.102296366C>A	ENSP00000299163:p.His126Asn		Somatic					p.H126N	NM_017902	NP_060372	WXS	Illumina HiSeq	Unspecified	Q9NWT6	HIF1N_HUMAN		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)	2	451	+		Colorectal(252;0.234)	126			Interaction with HIF1A.|Interaction with VHL.		D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	c.376C>A	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379464	0.24944	.	.	ENSG00000166135	ENST00000533589;ENST00000299163;ENST00000442724	T;T	0.70164	-0.46;-0.46	5.6	4.7	0.59300	.	2.476820	0.01665	N	0.025335	T	0.39759	0.1090	N	0.01352	-0.895	0.30536	N	0.766976	B	0.02656	0.0	B	0.01281	0.0	T	0.49113	-0.8973	10	0.15066	T	0.55	-16.7257	6.6932	0.23185	0.1244:0.6677:0.1348:0.0731	.	126	Q9NWT6	HIF1N_HUMAN	N	19;126;159	ENSP00000433360:H19N;ENSP00000299163:H126N	ENSP00000299163:H126N	H	+	1	0	HIF1AN	102286356	0.966000	0.33281	1.000000	0.80357	0.983000	0.72400	1.015000	0.29963	1.375000	0.46248	0.650000	0.86243	CAT		0.423	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902		19	72	1	0	1.67942e-08	0.006122	1.8154e-08	19	72				
PNLIPRP1	5407	broad.mit.edu	37	10	118357378	118357378	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr10:118357378G>A	ENST00000528052.1	+	7	684	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.E205K|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.E205K			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	205					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		GAGTACTCCTGAAGAGGTGCG	0.488																																							uc001lco.1		NA																	0				ovary(1)|breast(1)	2						c.(613-615)GAA>AAA		pancreatic lipase-related protein 1 precursor							178.0	156.0	164.0					10																	118357378		2203	4300	6503	SO:0001583	missense	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118357378G>A	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.613G>A	10.37:g.118357378G>A	ENSP00000433933:p.Glu205Lys		Somatic				PNLIPRP1_uc001lcp.2_Missense_Mutation_p.E205K|PNLIPRP1_uc009xys.1_RNA	p.E205K	NM_006229	NP_006220	WXS	Illumina HiSeq	Unspecified	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	7	631	+			205				Calcium; via carbonyl oxygen.	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	c.613G>A	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.950997	0.53186	.	.	ENSG00000187021	ENST00000358834;ENST00000528052;ENST00000530319;ENST00000527980;ENST00000534537	D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74	5.01	5.01	0.66863	Lipase, N-terminal (1);	0.215603	0.33327	N	0.005030	D	0.90696	0.7081	L	0.49256	1.55	0.80722	D	1	P	0.50943	0.94	P	0.56434	0.798	D	0.87157	0.2212	10	0.17369	T	0.5	-24.1279	11.0447	0.47852	0.0874:0.0:0.9126:0.0	.	205	P54315	LIPR1_HUMAN	K	205;205;160;132;205	ENSP00000351695:E205K;ENSP00000433933:E205K;ENSP00000437263:E160K;ENSP00000433785:E132K;ENSP00000434159:E205K	ENSP00000351695:E205K	E	+	1	0	PNLIPRP1	118347368	0.066000	0.20996	1.000000	0.80357	0.894000	0.52154	2.067000	0.41461	2.484000	0.83849	0.561000	0.74099	GAA		0.488	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		23	57	0	0	0	0.014323	0	23	57				
STIM1	6786	broad.mit.edu	37	11	3988901	3988901	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:3988901G>C	ENST00000300737.4	+	2	828	c.259G>C	c.(259-261)Gaa>Caa	p.E87Q	STIM1_ENST00000527651.1_Missense_Mutation_p.E87Q	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	87	EF-hand.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GGATGTGGAAGAAAGTGATGA	0.488																																							uc001lyv.2		NA																	0				pancreas(1)	1						c.(259-261)GAA>CAA		stromal interaction molecule 1 precursor							223.0	195.0	204.0					11																	3988901		2201	4298	6499	SO:0001583	missense	6786				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding	g.chr11:3988901G>C	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.259G>C	11.37:g.3988901G>C	ENSP00000300737:p.Glu87Gln		Somatic				STIM1_uc009yef.2_Missense_Mutation_p.E87Q	p.E87Q	NM_003156	NP_003147	WXS	Illumina HiSeq	Unspecified	Q13586	STIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)	2	827	+		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)	87	E->A,Q: Increases Ca(2+) influx through activation of CRAC channels, even when Ca(2+) stores are not depleted.		Potential.|EF-hand.|Extracellular (Potential).		E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	c.259G>C	CCDS7749.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752683	0.89753	.	.	ENSG00000167323	ENST00000525403;ENST00000300737;ENST00000527651;ENST00000532610;ENST00000532919;ENST00000530554;ENST00000524822;ENST00000525055;ENST00000528656;ENST00000532990	T;D	0.87809	-1.26;-2.3	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.93690	0.7984	M	0.79693	2.465	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79108	0.987;0.992	D	0.94057	0.7323	10	0.87932	D	0	-24.9044	17.4534	0.87599	0.0:0.0:1.0:0.0	.	87;87	E9PQJ4;Q13586	.;STIM1_HUMAN	Q	13;87;87;13;13;13;13;13;13;13	ENSP00000300737:E87Q;ENSP00000436208:E87Q	ENSP00000300737:E87Q	E	+	1	0	STIM1	3945477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.203000	0.95033	2.726000	0.93360	0.655000	0.94253	GAA		0.488	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156		16	67	0	0	0	0.00499	0	16	67				
OR51A4	401666	broad.mit.edu	37	11	4967852	4967852	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:4967852G>T	ENST00000380373.2	-	1	504	c.479C>A	c.(478-480)cCc>cAc	p.P160H	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAAGGGAAGGGAAGAACCAG	0.443																																							uc010qys.1		NA																	0				ovary(2)|skin(1)	3						c.(478-480)CCC>CAC		olfactory receptor, family 51, subfamily A,							190.0	182.0	185.0					11																	4967852		2189	4265	6454	SO:0001583	missense	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4967852G>T	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.479C>A	11.37:g.4967852G>T	ENSP00000369731:p.Pro160His		Somatic					p.P160H	NM_001005329	NP_001005329	WXS	Illumina HiSeq	Unspecified	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	479	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	160			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000380373.2	37	c.479C>A	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819333	0.50633	.	.	ENSG00000205497	ENST00000380373	T	0.51325	0.71	3.44	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.76941	0.4058	H	0.96720	3.87	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67684	-0.5607	9	0.87932	D	0	.	11.0746	0.48023	0.0:0.0:0.8131:0.1868	.	160	Q8NGJ6	O51A4_HUMAN	H	160	ENSP00000369731:P160H	ENSP00000369731:P160H	P	-	2	0	OR51A4	4924428	0.234000	0.23783	0.003000	0.11579	0.531000	0.34715	1.321000	0.33678	0.772000	0.33382	0.479000	0.44913	CCC		0.443	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		30	163	1	0	1.32136e-16	0.00874	1.64861e-16	30	163				
OR51A2	401667	broad.mit.edu	37	11	4976465	4976465	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:4976465G>T	ENST00000380371.1	-	1	478	c.479C>A	c.(478-480)cCc>cAc	p.P160H	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAAGGGAAGGGAAGAACCAG	0.443																																							uc010qyt.1		NA																	0					0						c.(478-480)CCC>CAC		olfactory receptor, family 51, subfamily A,							129.0	112.0	118.0					11																	4976465		2073	3915	5988	SO:0001583	missense	401667				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4976465G>T	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.479C>A	11.37:g.4976465G>T	ENSP00000369729:p.Pro160His		Somatic					p.P160H	NM_001004748	NP_001004748	WXS	Illumina HiSeq	Unspecified	Q8NGJ7	O51A2_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	479	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	160			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000380371.1	37	c.479C>A	CCDS31368.1	.	.	.	.	.	.	.	.	.	.	-	11.42	1.634926	0.29068	.	.	ENSG00000205496	ENST00000380371	T	0.51325	0.71	3.13	1.19	0.21007	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.74921	0.3780	H	0.97103	3.94	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.62562	-0.6828	9	0.87932	D	0	.	7.539	0.27727	0.2245:0.0:0.7755:0.0	.	160	Q8NGJ7	O51A2_HUMAN	H	160	ENSP00000369729:P160H	ENSP00000369729:P160H	P	-	2	0	OR51A2	4933041	0.732000	0.28121	0.000000	0.03702	0.014000	0.08584	2.200000	0.42724	0.181000	0.19994	0.395000	0.25975	CCC		0.443	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748		65	272	1	0	7.1157e-29	0.01441	9.94707e-29	65	272				
ZNF214	7761	broad.mit.edu	37	11	7022697	7022697	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:7022697C>A	ENST00000278314.4	-	3	532	c.217G>T	c.(217-219)Gct>Tct	p.A73S	ZNF214_ENST00000531083.1_5'UTR|ZNF214_ENST00000536068.1_Missense_Mutation_p.A73S	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	73	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGGGCGCCAGCATTCCACCAG	0.413																																					Ovarian(22;251 657 736 21522 46864)	Ovarian(22;251 657 736 21522 46864)	uc001mfa.2		NA																	0				skin(1)	1						c.(217-219)GCT>TCT		zinc finger protein 214							179.0	180.0	180.0					11																	7022697		2201	4295	6496	SO:0001583	missense	7761				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:7022697C>A	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.217G>T	11.37:g.7022697C>A	ENSP00000278314:p.Ala73Ser		Somatic				ZNF214_uc010ray.1_Missense_Mutation_p.A73S|ZNF214_uc009yfh.1_Missense_Mutation_p.A73S	p.A73S	NM_013249	NP_037381	WXS	Illumina HiSeq	Unspecified	Q9UL59	ZN214_HUMAN		Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)	3	520	-			73			KRAB.		B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	c.217G>T	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	C	1.021	-0.684810	0.03328	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.05925	3.37;3.37	4.14	4.14	0.48551	Krueppel-associated box (1);	0.361838	0.20236	N	0.096392	T	0.04137	0.0115	N	0.08118	0	0.09310	N	1	P	0.47762	0.9	B	0.43867	0.434	T	0.45425	-0.9262	10	0.11182	T	0.66	.	14.3083	0.66397	0.0:1.0:0.0:0.0	.	73	Q9UL59	ZN214_HUMAN	S	73	ENSP00000278314:A73S;ENSP00000445373:A73S	ENSP00000278314:A73S	A	-	1	0	ZNF214	6979273	0.004000	0.15560	0.146000	0.22360	0.037000	0.13140	0.469000	0.22067	2.308000	0.77769	0.655000	0.94253	GCT		0.413	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1			136	159	1	0	2.23784e-72	0.01441	3.3949e-72	136	159				
AMPD3	272	broad.mit.edu	37	11	10514898	10514898	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:10514898G>A	ENST00000396554.3	+	7	1310	c.969G>A	c.(967-969)gtG>gtA	p.V323V	AMPD3_ENST00000444303.2_Silent_p.V155V	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	314					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TGTTCCAGGTGGACACACACA	0.572																																							uc001mio.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(940-942)GTG>GTA		adenosine monophosphate deaminase 3 isoform 1B							108.0	111.0	110.0					11																	10514898		2201	4294	6495	SO:0001819	synonymous_variant	272				AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr11:10514898G>A	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.969G>A	11.37:g.10514898G>A			Somatic				AMPD3_uc010rbz.1_Silent_p.V155V|AMPD3_uc001min.1_Silent_p.V323V|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Silent_p.V321V|AMPD3_uc009yfy.2_Silent_p.V314V	p.V314V	NM_001025389	NP_001020560	WXS	Illumina HiSeq	Unspecified	Q01432	AMPD3_HUMAN		all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)	7	1277	+			314					A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	ENST00000396554.3	37	c.942G>A	CCDS7802.1																																																																																				0.572	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480		29	130	0	0	0	0.010818	0	29	130				
INSC	387755	broad.mit.edu	37	11	15134098	15134098	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:15134098G>T	ENST00000379554.3	+	1	129	c.83G>T	c.(82-84)aGg>aTg	p.R28M	INSC_ENST00000424273.1_5'Flank|INSC_ENST00000379556.3_5'Flank	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	28					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GAGTCCAGGAGGCTGTGCTGT	0.602																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(82-84)AGG>ATG		inscuteable isoform a							68.0	88.0	81.0					11																	15134098		2059	4193	6252	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15134098G>T	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.83G>T	11.37:g.15134098G>T	ENSP00000368872:p.Arg28Met		Somatic				INSC_uc001mlz.2_5'Flank	p.R28M	NM_001031853	NP_001027024	WXS	Illumina HiSeq	Unspecified	Q1MX18	INSC_HUMAN			1	129	+			28					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.83G>T	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741699	0.30865	.	.	ENSG00000188487	ENST00000379554	T	0.37058	1.22	3.54	2.56	0.30785	.	.	.	.	.	T	0.18425	0.0442	N	0.08118	0	0.80722	D	1	B	0.29085	0.232	B	0.32090	0.14	T	0.07195	-1.0785	9	0.72032	D	0.01	-3.9255	5.3605	0.16085	0.1743:0.0:0.8257:0.0	.	28	Q1MX18	INSC_HUMAN	M	28	ENSP00000368872:R28M	ENSP00000368872:R28M	R	+	2	0	INSC	15090674	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.628000	0.24522	0.969000	0.38237	0.561000	0.74099	AGG		0.602	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		12	16	1	0	6.31663e-08	0.003163	6.74616e-08	12	16				
INSC	387755	broad.mit.edu	37	11	15197423	15197423	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:15197423G>T	ENST00000379554.3	+	3	380	c.334G>T	c.(334-336)Gca>Tca	p.A112S	INSC_ENST00000530161.1_Missense_Mutation_p.A65S|INSC_ENST00000525218.1_Missense_Mutation_p.A65S|INSC_ENST00000528567.1_Missense_Mutation_p.A65S|INSC_ENST00000424273.1_Missense_Mutation_p.A65S|INSC_ENST00000379556.3_Missense_Mutation_p.A65S	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	112					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CCTCATCCTGGCAGGTGGCCC	0.617																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(334-336)GCA>TCA		inscuteable isoform a							43.0	47.0	46.0					11																	15197423		2041	4187	6228	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15197423G>T	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.334G>T	11.37:g.15197423G>T	ENSP00000368872:p.Ala112Ser		Somatic				INSC_uc001mlz.2_Missense_Mutation_p.A65S|INSC_uc001mma.2_Missense_Mutation_p.A65S|INSC_uc010rcs.1_Missense_Mutation_p.A65S|INSC_uc001mmb.2_Missense_Mutation_p.A65S|INSC_uc001mmc.2_Missense_Mutation_p.A65S	p.A112S	NM_001031853	NP_001027024	WXS	Illumina HiSeq	Unspecified	Q1MX18	INSC_HUMAN			3	380	+			112					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.334G>T	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	G	9.559	1.117983	0.20877	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.29917	1.55;1.59;1.56;1.57;1.59;1.56	5.32	2.18	0.27775	.	0.214451	0.40818	N	0.001006	T	0.06234	0.0161	N	0.00583	-1.355	0.36498	D	0.868833	B;B;B;B	0.16396	0.017;0.001;0.006;0.006	B;B;B;B	0.14023	0.01;0.002;0.005;0.005	T	0.32719	-0.9896	10	0.13108	T	0.6	-11.5049	3.1597	0.06516	0.0902:0.1188:0.415:0.376	.	65;65;65;112	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	S	112;65;65;65;65;65;65	ENSP00000368872:A112S;ENSP00000368874:A65S;ENSP00000389161:A65S;ENSP00000435022:A65S;ENSP00000436194:A65S;ENSP00000436113:A65S	ENSP00000368872:A112S	A	+	1	0	INSC	15153999	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	1.976000	0.40579	2.490000	0.84030	0.561000	0.74099	GCA		0.617	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		18	23	1	0	1.01871e-10	0.008871	1.15743e-10	18	23				
RAG2	5897	broad.mit.edu	37	11	36615240	36615240	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:36615240G>T	ENST00000311485.3	-	2	640	c.479C>A	c.(478-480)tCa>tAa	p.S160*	C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000347206.4_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	160					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				AGGCATGTATGAGCGTCCTCC	0.458									Familial Hemophagocytic Lymphohistiocytosis																														uc001mwv.3		NA																	0				skin(3)|ovary(1)|pancreas(1)	5	GRCh37	CM065432	RAG2	M		c.(478-480)TCA>TAA		recombination activating gene 2							129.0	121.0	123.0					11																	36615240		2202	4298	6500	SO:0001587	stop_gained	5897	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding	g.chr11:36615240G>T	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.479C>A	11.37:g.36615240G>T	ENSP00000308620:p.Ser160*		Somatic				C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	p.S160*	NM_000536	NP_000527	WXS	Illumina HiSeq	Unspecified	P55895	RAG2_HUMAN			2	667	-	all_lung(20;0.226)	all_hematologic(20;0.00756)	160					A8K9E9|Q8TBL4	Nonsense_Mutation	SNP	ENST00000311485.3	37	c.479C>A	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605780	0.87157	.	.	ENSG00000175097	ENST00000311485	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0046	19.4419	0.94824	0.0:0.0:1.0:0.0	.	.	.	.	X	160	.	ENSP00000308620:S160X	S	-	2	0	RAG2	36571816	1.000000	0.71417	0.249000	0.24280	0.903000	0.53119	9.476000	0.97823	2.593000	0.87608	0.650000	0.86243	TCA		0.458	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		87	86	1	0	2.5264e-35	0.01441	3.58803e-35	87	86				
MADD	8567	broad.mit.edu	37	11	47345827	47345827	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:47345827G>A	ENST00000311027.5	+	32	4719	c.4554G>A	c.(4552-4554)ctG>ctA	p.L1518L	MADD_ENST00000402192.2_Silent_p.L1458L|MADD_ENST00000349238.3_Silent_p.L1479L|MADD_ENST00000402799.1_Silent_p.L1416L|MADD_ENST00000406482.1_Silent_p.L1416L|MADD_ENST00000407859.3_Silent_p.L1436L|MADD_ENST00000395344.3_Silent_p.L1412L|MADD_ENST00000342922.4_Silent_p.L1459L|MADD_ENST00000395336.3_Silent_p.L1518L|MADD_ENST00000405573.2_Silent_p.L328L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GTCGGGAGCTGTACTACTGTG	0.577																																							uc001ner.1		NA																	0				ovary(5)|skin(4)|central_nervous_system(2)	11						c.(4552-4554)CTG>CTA		MAP-kinase activating death domain-containing							57.0	57.0	57.0					11																	47345827		2201	4298	6499	SO:0001819	synonymous_variant	8567				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr11:47345827G>A	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4554G>A	11.37:g.47345827G>A			Somatic				MADD_uc001neq.2_Silent_p.L1459L|MADD_uc001nev.1_Silent_p.L1416L|MADD_uc001nes.1_Silent_p.L1436L|MADD_uc001net.1_Silent_p.L1479L|MADD_uc009yln.1_Silent_p.L1412L|MADD_uc001neu.1_Silent_p.L1416L|MADD_uc001nex.2_Silent_p.L1518L|MADD_uc001nez.2_Silent_p.L1415L|MADD_uc001new.2_Silent_p.L1458L|MADD_uc009ylo.2_Silent_p.L432L	p.L1518L	NM_003682	NP_003673	WXS	Illumina HiSeq	Unspecified	Q8WXG6	MADD_HUMAN		Lung(87;0.182)	32	4745	+			1518						Silent	SNP	ENST00000311027.5	37	c.4554G>A	CCDS7930.1																																																																																				0.577	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			9	37	0	0	0	0.010729	0	9	37				
LOC440040	440040	broad.mit.edu	37	11	49598251	49598251	+	RNA	SNP	A	A	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:49598251A>T	ENST00000527477.1	+	0	855																											GCCTGGTTCCAGTTCTGTAGC	0.498																																							uc010rhy.1		NA																	0					0						c.(364-366)AGT>TGT		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49598251A>T																													11.37:g.49598251A>T			Somatic				LOC440040_uc009ymb.2_Missense_Mutation_p.S122C	p.S122C	NR_027044		WXS	Illumina HiSeq	Unspecified					2	842	+									Missense_Mutation	SNP	ENST00000527477.1	37	c.364A>T																																																																																					0.498	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			19	25	0	0	0	0.014323	0	19	25				
OR8H2	390151	broad.mit.edu	37	11	55872752	55872752	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:55872752C>T	ENST00000313503.1	+	1	234	c.234C>T	c.(232-234)gtC>gtT	p.V78V		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CAACTGTCGTCACACCTAAAA	0.428										HNSCC(53;0.14)																													uc010riy.1		NA																	0				ovary(1)|skin(1)	2						c.(232-234)GTC>GTT		olfactory receptor, family 8, subfamily H,							253.0	253.0	253.0					11																	55872752		2201	4294	6495	SO:0001819	synonymous_variant	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55872752C>T	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.234C>T	11.37:g.55872752C>T		HNSCC(53;0.14)	Somatic					p.V78V	NM_001005200	NP_001005200	WXS	Illumina HiSeq	Unspecified	Q8N162	OR8H2_HUMAN			1	234	+	Esophageal squamous(21;0.00693)		78			Extracellular (Potential).		Q6IFC1	Silent	SNP	ENST00000313503.1	37	c.234C>T	CCDS31518.1																																																																																				0.428	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		106	408	0	0	0	0.01441	0	106	408				
OR10W1	81341	broad.mit.edu	37	11	58035110	58035110	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:58035110G>T	ENST00000395079.2	-	1	622	c.221C>A	c.(220-222)gCc>gAc	p.A74D		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				TAGGGTGTTGGCCAGGATATG	0.517																																							uc001nmq.1		NA																	0				ovary(1)	1						c.(220-222)GCC>GAC		olfactory receptor, family 10, subfamily W,							95.0	85.0	88.0					11																	58035110		2201	4295	6496	SO:0001583	missense	81341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58035110G>T	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.221C>A	11.37:g.58035110G>T	ENSP00000378516:p.Ala74Asp		Somatic					p.A74D	NM_207374	NP_997257	WXS	Illumina HiSeq	Unspecified	Q8NGF6	O10W1_HUMAN			1	623	-		Breast(21;0.0589)	74			Extracellular (Potential).		A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	ENST00000395079.2	37	c.221C>A	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	G	14.50	2.553847	0.45487	.	.	ENSG00000172772	ENST00000395079	T	0.00382	7.61	5.76	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.749348	0.11831	N	0.525217	T	0.00271	0.0008	L	0.47016	1.485	0.18873	N	0.999981	B	0.31680	0.335	B	0.27500	0.08	T	0.35176	-0.9799	10	0.44086	T	0.13	.	5.8222	0.18534	0.2585:0.0:0.6126:0.1289	.	74	Q8NGF6	O10W1_HUMAN	D	74	ENSP00000378516:A74D	ENSP00000378516:A74D	A	-	2	0	OR10W1	57791686	0.000000	0.05858	0.725000	0.30721	0.927000	0.56198	-0.015000	0.12634	0.780000	0.33566	0.655000	0.94253	GCC		0.517	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		35	59	1	0	1.06647e-15	0.003755	1.30022e-15	35	59				
SLC22A10	387775	broad.mit.edu	37	11	63057558	63057558	+	5'Flank	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:63057558A>G	ENST00000332793.6	+	0	0				SLC22A10_ENST00000544661.1_Intron|SLC22A10_ENST00000526800.1_5'Flank|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10							integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TTGAATTAATAAAAGGAAATA	0.443																																							uc009yor.2		NA																	0				ovary(2)	2						c.(-81--77)ATAAA>ATGAA		solute carrier family 22, member 10																																				SO:0001631	upstream_gene_variant	387775					integral to membrane	transmembrane transporter activity	g.chr11:63057558A>G	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197		11.37:g.63057558A>G	Exception_encountered		Somatic				SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_Intron|SLC22A10_uc010rmp.1_5'Flank		NM_001039752	NP_001034841	WXS	Illumina HiSeq	Unspecified	Q63ZE4	S22AA_HUMAN			1	129	+								Q68CJ0	Translation_Start_Site	SNP	ENST00000332793.6	37	c.-79A>G	CCDS41661.1																																																																																				0.443	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752		9	5	0	0	0	0.004482	0	9	5				
MARK2	2011	broad.mit.edu	37	11	63668529	63668529	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:63668529C>G	ENST00000509502.2	+	11	1453	c.990C>G	c.(988-990)taC>taG	p.Y330*	MARK2_ENST00000315032.8_Nonsense_Mutation_p.Y363*|MARK2_ENST00000361128.5_Nonsense_Mutation_p.Y363*|MARK2_ENST00000377810.3_Nonsense_Mutation_p.Y330*|MARK2_ENST00000502399.3_Nonsense_Mutation_p.Y363*|MARK2_ENST00000377809.4_Nonsense_Mutation_p.Y363*|MARK2_ENST00000413835.2_Nonsense_Mutation_p.Y363*|MARK2_ENST00000350490.7_Nonsense_Mutation_p.Y363*|MARK2_ENST00000425897.2_Nonsense_Mutation_p.Y330*|MARK2_ENST00000408948.3_Nonsense_Mutation_p.Y330*|MARK2_ENST00000508192.1_Nonsense_Mutation_p.Y363*|MARK2_ENST00000402010.2_Nonsense_Mutation_p.Y363*|MARK2_ENST00000513765.2_Nonsense_Mutation_p.Y330*	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						TCCTGGGCTACAAGAGCTCCG	0.572																																							uc001nxw.2		NA																	0				stomach(1)|ovary(1)|lung(1)	3						c.(1087-1089)TAC>TAG		MAP/microtubule affinity-regulating kinase 2							97.0	83.0	87.0					11																	63668529		2201	4297	6498	SO:0001587	stop_gained	2011				cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:63668529C>G	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.990C>G	11.37:g.63668529C>G	ENSP00000423974:p.Tyr330*		Somatic				MARK2_uc001nxx.2_Nonsense_Mutation_p.Y363*|MARK2_uc001nxy.2_Nonsense_Mutation_p.Y363*|MARK2_uc001nxv.3_Nonsense_Mutation_p.Y363*|MARK2_uc001nxz.3_Nonsense_Mutation_p.Y330*|MARK2_uc009yoy.2_Nonsense_Mutation_p.Y330*	p.Y363*	NM_001039469	NP_001034558	WXS	Illumina HiSeq	Unspecified	Q7KZI7	MARK2_HUMAN			11	1668	+			363						Nonsense_Mutation	SNP	ENST00000509502.2	37	c.1089C>G	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	C	36	5.805843	0.96967	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	.	.	.	5.17	3.27	0.37495	.	0.066412	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	10.9787	0.47482	0.0:0.8425:0.0:0.1575	.	.	.	.	X	363;363;363;363;330;363;363;363;363;330;330;330;330	.	ENSP00000326632:Y363X	Y	+	3	2	MARK2	63425105	0.002000	0.14202	1.000000	0.80357	0.994000	0.84299	-0.283000	0.08433	1.414000	0.47017	0.557000	0.71058	TAC		0.572	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490		29	21	0	0	0	0.00632	0	29	21				
NUDT22	84304	broad.mit.edu	37	11	63996792	63996792	+	Missense_Mutation	SNP	G	G	A	rs147573630		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:63996792G>A	ENST00000279206.3	+	4	809	c.653G>A	c.(652-654)cGa>cAa	p.R218Q	DNAJC4_ENST00000355040.4_5'Flank|DNAJC4_ENST00000321460.5_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA|RP11-783K16.14_ENST00000534988.1_RNA|DNAJC4_ENST00000321685.3_5'Flank|NUDT22_ENST00000441250.2_Missense_Mutation_p.R185Q	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	218	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						AGTGCTGGCCGAGCCAGTGCC	0.647																																							uc001nyp.3		NA																	0					0						c.(652-654)CGA>CAA		nudix (nucleoside diphosphate linked moiety							50.0	48.0	49.0					11																	63996792		2199	4297	6496	SO:0001583	missense	84304						hydrolase activity	g.chr11:63996792G>A	BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.653G>A	11.37:g.63996792G>A	ENSP00000279206:p.Arg218Gln		Somatic				NUDT22_uc009ype.2_Missense_Mutation_p.R218Q|NUDT22_uc001nyq.3_Missense_Mutation_p.R185Q|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	p.R218Q	NM_032344	NP_115720	WXS	Illumina HiSeq	Unspecified	Q9BRQ3	NUD22_HUMAN			4	833	+			218			Nudix hydrolase.		C9JY06|Q71RD5	Missense_Mutation	SNP	ENST00000279206.3	37	c.653G>A	CCDS8061.1	.	.	.	.	.	.	.	.	.	.	G	32	5.141085	0.94560	.	.	ENSG00000149761	ENST00000279206;ENST00000441250;ENST00000428347	T;T;T	0.41065	1.67;1.46;1.01	4.13	4.13	0.48395	NUDIX hydrolase domain (1);	0.000000	0.85682	D	0.000000	T	0.65080	0.2657	M	0.79011	2.435	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.71371	-0.4613	10	0.87932	D	0	-0.1411	15.7082	0.77602	0.0:0.0:1.0:0.0	.	185;218	C9JY06;Q9BRQ3	.;NUD22_HUMAN	Q	218;185;249	ENSP00000279206:R218Q;ENSP00000407970:R185Q;ENSP00000401085:R249Q	ENSP00000279206:R218Q	R	+	2	0	NUDT22	63753368	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	7.250000	0.78287	2.298000	0.77334	0.462000	0.41574	CGA		0.647	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396304.2	NM_032344		3	8	0	0	0	0.004672	0	3	8				
CHORDC1	26973	broad.mit.edu	37	11	89935685	89935685	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:89935685G>C	ENST00000320585.6	-	11	1296	c.887C>G	c.(886-888)aCt>aGt	p.T296S	CHORDC1_ENST00000457199.2_Missense_Mutation_p.T277S|CHORDC1_ENST00000529987.1_Missense_Mutation_p.T108S|CHORDC1_ENST00000529726.1_Missense_Mutation_p.T108S	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	296	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.|Interaction with HSP90AA1 and HSP90AB1. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				CTTTGTTGCAGTCATAGTTAC	0.383																																							uc001pdg.2		NA																	0					0						c.(886-888)ACT>AGT		cysteine and histidine-rich domain-containing							80.0	69.0	73.0					11																	89935685		2200	4298	6498	SO:0001583	missense	26973				chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding	g.chr11:89935685G>C	AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.887C>G	11.37:g.89935685G>C	ENSP00000319255:p.Thr296Ser		Somatic				CHORDC1_uc009yvz.2_Missense_Mutation_p.T277S	p.T296S	NM_012124	NP_036256	WXS	Illumina HiSeq	Unspecified	Q9UHD1	CHRD1_HUMAN			11	1297	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)	296			Interaction with HSP90AA1 and HSP90AB1 (By similarity).|CS.		B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	ENST00000320585.6	37	c.887C>G	CCDS8289.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022281	0.35701	.	.	ENSG00000110172	ENST00000320585;ENST00000529987;ENST00000457199;ENST00000529726	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	5.43	5.43	0.79202	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.052222	0.85682	D	0.000000	T	0.14485	0.0350	L	0.45285	1.41	0.39131	D	0.961848	B;B	0.24651	0.108;0.061	B;B	0.22152	0.037;0.038	T	0.07616	-1.0763	9	.	.	.	0.6498	17.486	0.87688	0.0:0.0:1.0:0.0	.	277;296	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	S	296;108;277;108	ENSP00000319255:T296S;ENSP00000433719:T108S;ENSP00000401080:T277S;ENSP00000436632:T108S	.	T	-	2	0	CHORDC1	89575333	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.355000	0.73041	2.539000	0.85634	0.650000	0.86243	ACT		0.383	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394111.1	NM_012124		27	27	0	0	0	0.005443	0	27	27				
FAT3	120114	broad.mit.edu	37	11	92088256	92088256	+	Missense_Mutation	SNP	G	G	T	rs539020470	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:92088256G>T	ENST00000298047.6	+	1	2995	c.2978G>T	c.(2977-2979)cGc>cTc	p.R993L	FAT3_ENST00000541502.1_Missense_Mutation_p.R993L|FAT3_ENST00000525166.1_Missense_Mutation_p.R843L|FAT3_ENST00000409404.2_Missense_Mutation_p.R993L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	993	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGTGCCATCCGCTTGAGCAAA	0.458										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(2977-2979)CGC>CTC		FAT tumor suppressor homolog 3							71.0	70.0	70.0					11																	92088256		1924	4120	6044	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92088256G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2978G>T	11.37:g.92088256G>T	ENSP00000298047:p.Arg993Leu	TCGA Ovarian(4;0.039)	Somatic					p.R993L	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	2995	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	993			Cadherin 9.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.2978G>T		.	.	.	.	.	.	.	.	.	.	G	19.67	3.871430	0.72065	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.52754	4.68;4.68;0.65;4.68	5.82	5.82	0.92795	.	.	.	.	.	T	0.65312	0.2679	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56257	-0.8009	9	0.12430	T	0.62	.	19.0835	0.93192	0.0:0.0:1.0:0.0	.	993	Q8TDW7-3	.	L	993;993;993;843	ENSP00000298047:R993L;ENSP00000387040:R993L;ENSP00000443786:R993L;ENSP00000432586:R843L	ENSP00000298047:R993L	R	+	2	0	FAT3	91727904	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.635000	0.74295	2.767000	0.95098	0.655000	0.94253	CGC		0.458	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		16	27	1	0	2.23348e-06	0.004007	2.32039e-06	16	27				
FAT3	120114	broad.mit.edu	37	11	92534129	92534129	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:92534129C>T	ENST00000298047.6	+	9	7967	c.7950C>T	c.(7948-7950)ctC>ctT	p.L2650L	FAT3_ENST00000525166.1_Silent_p.L2500L|FAT3_ENST00000409404.2_Silent_p.L2650L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2650	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGCCGACCTCCTGGAAATCG	0.453										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(7948-7950)CTC>CTT		FAT tumor suppressor homolog 3							36.0	34.0	35.0					11																	92534129		1879	4105	5984	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534129C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7950C>T	11.37:g.92534129C>T		TCGA Ovarian(4;0.039)	Somatic					p.L2650L	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	7967	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2650			Cadherin 24.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.7950C>T																																																																																					0.453	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		12	15	0	0	0	0.010729	0	12	15				
CDON	50937	broad.mit.edu	37	11	125891389	125891389	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:125891389G>T	ENST00000392693.3	-	3	230	c.103C>A	c.(103-105)Ccg>Acg	p.P35T	CDON_ENST00000263577.7_Missense_Mutation_p.P35T	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	35	Ig-like C2-type 1.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		GCAGAGAGCGGCTCAGAAGTA	0.438																																							uc009zbw.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(103-105)CCG>ACG		surface glycoprotein, Ig superfamily member							67.0	64.0	65.0					11																	125891389		2201	4299	6500	SO:0001583	missense	50937				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding	g.chr11:125891389G>T	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.103C>A	11.37:g.125891389G>T	ENSP00000376458:p.Pro35Thr		Somatic				CDON_uc001qdc.3_Missense_Mutation_p.P35T|CDON_uc001qdd.3_RNA|CDON_uc009zbx.2_Missense_Mutation_p.P35T	p.P35T	NM_016952	NP_058648	WXS	Illumina HiSeq	Unspecified	Q4KMG0	CDON_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)	3	231	-	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	35			Extracellular (Potential).|Ig-like C2-type 1.		O14631	Missense_Mutation	SNP	ENST00000392693.3	37	c.103C>A	CCDS58192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.265258|4.265258	0.80358|0.80358	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000534661|ENST00000392693;ENST00000263577;ENST00000531586;ENST00000527967;ENST00000534818	.|T;T;T;T;T	.|0.50001	.|0.76;0.76;0.76;0.76;0.76	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.51477	.|D	.|0.000092	T|T	0.77130|0.77130	0.4085|0.4085	M|M	0.91663|0.91663	3.23|3.23	0.44966|0.44966	D|D	0.997981|0.997981	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.81947|0.81947	-0.0700|-0.0700	5|10	.|0.87932	.|D	.|0	-16.8168|-16.8168	19.7554|19.7554	0.96287|0.96287	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|35;35;35	.|E9PRD8;Q4KMG0;Q4KMG0-2	.|.;CDON_HUMAN;.	D|T	10|35	.|ENSP00000376458:P35T;ENSP00000263577:P35T;ENSP00000434212:P35T;ENSP00000436940:P35T;ENSP00000437176:P35T	.|ENSP00000263577:P35T	A|P	-|-	2|1	0|0	CDON|CDON	125396599|125396599	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.943000|0.943000	0.58893|0.58893	8.030000|8.030000	0.88816|0.88816	2.665000|2.665000	0.90641|0.90641	0.563000|0.563000	0.77884|0.77884	GCC|CCG		0.438	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952		27	33	1	0	6.12954e-19	0.004656	7.98335e-19	27	33				
NCAPD3	23310	broad.mit.edu	37	11	134079318	134079318	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr11:134079318C>A	ENST00000534548.2	-	5	685	c.621G>T	c.(619-621)cgG>cgT	p.R207R		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	207					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GAGAAAGGTCCCGGGCAGAAA	0.343																																							uc001qhd.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5						c.(619-621)CGG>CGT		non-SMC condensin II complex, subunit D3							44.0	47.0	46.0					11																	134079318		2200	4297	6497	SO:0001819	synonymous_variant	23310				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding	g.chr11:134079318C>A	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.621G>T	11.37:g.134079318C>A			Somatic				NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	p.R207R	NM_015261	NP_056076	WXS	Illumina HiSeq	Unspecified	P42695	CNDD3_HUMAN		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)	5	1227	-	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	207					A6NFS2|Q4KMQ9	Silent	SNP	ENST00000534548.2	37	c.621G>T	CCDS31723.1																																																																																				0.343	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		37	35	1	0	6.90743e-12	0.003755	8.01862e-12	37	35				
CLEC2B	9976	broad.mit.edu	37	12	10010225	10010225	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:10010225G>A	ENST00000228438.2	-	3	1018	c.85C>T	c.(85-87)Cga>Tga	p.R29*	CLEC2B_ENST00000538152.1_5'Flank	NM_005127.2	NP_005118.2	Q92478	CLC2B_HUMAN	C-type lectin domain family 2, member B	29						integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(3)|lung(1)	5						TGAGAATCTCGAGTTAGTTTA	0.318																																							uc001qwn.2		NA																	0					0						c.(85-87)CGA>TGA		C-type lectin, superfamily member 2							49.0	49.0	49.0					12																	10010225		2203	4298	6501	SO:0001587	stop_gained	9976					integral to plasma membrane	sugar binding	g.chr12:10010225G>A	X96719	CCDS8605.1	12p13-p12	2005-02-09	2005-02-09	2005-02-09		ENSG00000110852		"""C-type lectin domain containing"""	2053	protein-coding gene	gene with protein product		603242	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced)"""	CLECSF2		9038101	Standard	NM_005127		Approved	AICL, HP10085	uc001qwn.3	Q92478		ENST00000228438.2:c.85C>T	12.37:g.10010225G>A	ENSP00000228438:p.Arg29*		Somatic					p.R29*	NM_005127	NP_005118	WXS	Illumina HiSeq	Unspecified	Q92478	CLC2B_HUMAN			3	742	-			29			Extracellular (Potential).		B2R9U1|Q8IZE9|Q9BS74|Q9UQB4	Nonsense_Mutation	SNP	ENST00000228438.2	37	c.85C>T	CCDS8605.1	.	.	.	.	.	.	.	.	.	.	G	38	7.021708	0.98010	.	.	ENSG00000110852	ENST00000228438	.	.	.	2.16	-4.32	0.03688	.	11.903400	0.00166	N	0.000002	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	0.5879	0.00723	0.3237:0.1305:0.1523:0.3935	.	.	.	.	X	29	.	ENSP00000228438:R29X	R	-	1	2	CLEC2B	9901492	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.521000	0.00951	-2.673000	0.00413	-0.218000	0.12543	CGA		0.318	CLEC2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399881.1	NM_005127		9	25	0	0	0	0.006214	0	9	25				
KRAS	3845	broad.mit.edu	37	12	25398284	25398285	+	Missense_Mutation	DNP	CC	CC	AA	rs121913530|rs121913529		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:25398284_25398285CC>AA	ENST00000256078.4	-	2	97_98	c.34_35GG>TT	c.(34-36)GGt>TTt	p.G12F	KRAS_ENST00000556131.1_Missense_Mutation_p.G12F|KRAS_ENST00000311936.3_Missense_Mutation_p.G12F|KRAS_ENST00000557334.1_Missense_Mutation_p.G12F	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12C(3001)|p.G12A(1407)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAACT	0.347	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(CALU1_LUNG)|G12V(PATU8988S_PANCREAS)|G12C(NCIH1792_LUNG)|G12D(SU8686_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12D(LS513_LARGE_INTESTINE)|G12D(PANC0203_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12C(HCC44_LUNG)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEC50B_ENDOMETRIUM)|G12V(NCIH2444_LUNG)|G12D(MCAS_OVARY)|G12D(ASPC1_PANCREAS)|G12V(SHP77_LUNG)|G12R(CAL62_THYROID)|G12D(HPAFII_PANCREAS)|G12A(NCIH2009_LUNG)|G12D(PANC0403_PANCREAS)|G12C(NCIH2030_LUNG)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(PANC0327_PANCREAS)|G12D(PANC0813_PANCREAS)|G12V(COLO668_LUNG)|G12V(NCIH441_LUNG)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12V(CAPAN2_PANCREAS)|G12R(HUPT3_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12R(HS274T_BREAST)|G12V(SW480_LARGE_INTESTINE)|G12V(QGP1_PANCREAS)|G12S(LS123_LARGE_INTESTINE)|G12C(SW837_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(RKN_OVARY)|G12C(IALM_LUNG)|G12C(UMUC3_URINARY_TRACT)|G12V(RERFLCAD2_LUNG)|G12C(LU99_LUNG)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12V(SH10TC_STOMACH)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12D(COLO678_LARGE_INTESTINE)|G12S(A549_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(RERFLCAD1_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH1373_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12C(MIAPACA2_PANCREAS)|G12V(DANG_PANCREAS)|G12D(L33_PANCREAS)|G12C(OV56_OVARY)|G12V(PATU8902_PANCREAS)|G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12R(KP2_PANCREAS)|G12D(SUIT2_PANCREAS)|G12C(NCIH2122_LUNG)|G12D(KP4_PANCREAS)|G12C(NCIH358_LUNG)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12C(SW1463_LARGE_INTESTINE)|G12V(RCM1_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12D(PANC1_PANCREAS)|G12C(SW1573_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		20892	Substitution - Missense(20889)|Insertion - In frame(2)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(11786)|pancreas(3650)|lung(3132)|ovary(556)|biliary_tract(494)|endometrium(373)|haematopoietic_and_lymphoid_tissue(212)|stomach(145)|thyroid(97)|prostate(70)|small_intestine(56)|upper_aerodigestive_tract(47)|urinary_tract(47)|soft_tissue(42)|cervix(41)|skin(35)|liver(22)|breast(20)|testis(16)|oesophagus(11)|central_nervous_system(8)|peritoneum(6)|kidney(5)|eye(4)|NS(4)|autonomic_ganglia(3)|gastrointestinal_tract_(site_indeterminate)(3)|thymus(3)|penis(1)|adrenal_gland(1)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TTT		c-K-ras2 protein isoform a precursor																																				SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284_25398285CC>AA	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34_35delinsAA	12.37:g.25398284_25398285delinsAA	ENSP00000256078:p.Gly12Phe	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12F|KRAS_uc001rgr.2_RNA	p.G12F	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215_216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	DNP	ENST00000256078.4	37	c.34_35GG>TT	CCDS8703.1																																																																																				0.347	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	16	0	0	0	0.004672	0	8	16				
SMUG1	23583	broad.mit.edu	37	12	54576051	54576051	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:54576051C>A	ENST00000508394.2	-	3	704	c.642G>T	c.(640-642)ggG>ggT	p.G214G	SMUG1_ENST00000514685.1_Intron|SMUG1_ENST00000506595.1_Intron|SMUG1_ENST00000514196.1_Intron|SMUG1_ENST00000401977.2_Silent_p.G214G|SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000513838.1_Intron|SMUG1_ENST00000243112.5_Intron|SMUG1_ENST00000337581.3_Silent_p.G214G|SMUG1_ENST00000505662.1_5'UTR	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	214					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						CTGCCAGTCGCCCAACTCCCA	0.667								Base excision repair (BER), DNA glycosylases																															uc001sff.1		NA																	0					0						c.(640-642)GGG>GGT	BER_DNA_glycosylases	single-strand-selective monofunctional							38.0	43.0	42.0					12																	54576051		2203	4299	6502	SO:0001819	synonymous_variant	23583				depyrimidination	nucleolus|nucleoplasm	DNA binding|protein binding|single-strand selective uracil DNA N-glycosylase activity	g.chr12:54576051C>A	AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.642G>T	12.37:g.54576051C>A			Somatic				SMUG1_uc001sfa.1_RNA|SMUG1_uc001sfe.1_3'UTR|SMUG1_uc001sfg.1_Silent_p.G214G|SMUG1_uc009znf.1_Silent_p.G214G|SMUG1_uc001sfb.3_Intron|SMUG1_uc001sfc.3_Intron|SMUG1_uc001sfd.3_Intron	p.G214G	NM_014311	NP_055126	WXS	Illumina HiSeq	Unspecified	Q53HV7	SMUG1_HUMAN			4	771	-			214					A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Silent	SNP	ENST00000508394.2	37	c.642G>T	CCDS8874.1																																																																																				0.667	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359074.3	NM_014311		32	53	1	0	5.60225e-13	0.009535	6.58943e-13	32	53				
RPSAP52	204010	broad.mit.edu	37	12	66152274	66152274	+	RNA	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:66152274G>A	ENST00000489520.2	-	0	669					NR_026825.2				ribosomal protein SA pseudogene 52																		CTGACCCACTGAGGGAGCTCC	0.502																																							uc001sso.2		NA																	0					0						c.(247-249)CTC>CTT		SubName: Full=Putative uncharacterized protein RPSAP52;																																						204010							g.chr12:66152274G>A			12q14.3	2010-09-24			ENSG00000241749	ENSG00000241749			35752	pseudogene	pseudogene						19123937	Standard	NR_026825		Approved		uc001sso.4		OTTHUMG00000157608		12.37:g.66152274G>A			Somatic					p.L83L	NR_026825		WXS	Illumina HiSeq	Unspecified					2	670	-									Silent	SNP	ENST00000489520.2	37	c.249C>T																																																																																					0.502	RPSAP52-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000349256.2	NG_006174		9	31	0	0	0	0.006214	0	9	31				
ZFC3H1	196441	broad.mit.edu	37	12	72057061	72057061	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:72057061G>A	ENST00000378743.3	-	1	688	c.330C>T	c.(328-330)ttC>ttT	p.F110F	ZFC3H1_ENST00000552037.1_Silent_p.F110F|ZFC3H1_ENST00000549407.1_5'UTR|ZFC3H1_ENST00000548100.1_Silent_p.F110F|THAP2_ENST00000547843.1_5'Flank|THAP2_ENST00000308086.2_5'UTR	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	110	Ser-rich.				RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GATGAGACCGGAACGGTTCTT	0.632																																							uc001swo.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(328-330)TTC>TTT		proline/serine-rich coiled-coil 2							69.0	76.0	74.0					12																	72057061		1967	4140	6107	SO:0001819	synonymous_variant	196441				RNA processing	intracellular	metal ion binding	g.chr12:72057061G>A	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.330C>T	12.37:g.72057061G>A			Somatic				ZFC3H1_uc010sts.1_Silent_p.F110F|ZFC3H1_uc001swp.2_Silent_p.F110F|THAP2_uc001swq.2_5'Flank	p.F110F	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			1	689	-			110			Ser-rich.		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	c.330C>T	CCDS41813.1																																																																																				0.632	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		17	122	0	0	0	0.006122	0	17	122				
LUM	4060	broad.mit.edu	37	12	91502060	91502060	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:91502060A>T	ENST00000266718.4	-	2	1151	c.697T>A	c.(697-699)Tat>Aat	p.Y233N	LUM_ENST00000548071.1_5'UTR	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	233					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						AAACGCAGATACTGCAATGCA	0.423																																							uc001tbm.2		NA																	0				central_nervous_system(2)	2						c.(697-699)TAT>AAT		lumican precursor							169.0	158.0	162.0					12																	91502060		2203	4300	6503	SO:0001583	missense	4060				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	g.chr12:91502060A>T	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.697T>A	12.37:g.91502060A>T	ENSP00000266718:p.Tyr233Asn		Somatic				LUM_uc001tbn.2_RNA	p.Y233N	NM_002345	NP_002336	WXS	Illumina HiSeq	Unspecified	P51884	LUM_HUMAN			2	1086	-			233			LRR 8.		B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	37	c.697T>A	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.589797	0.66105	.	.	ENSG00000139329	ENST00000266718	T	0.58797	0.31	5.57	4.44	0.53790	.	0.059395	0.64402	D	0.000001	T	0.60090	0.2242	L	0.28014	0.82	0.58432	D	0.999998	D	0.60575	0.988	D	0.65323	0.934	T	0.62215	-0.6901	10	0.54805	T	0.06	-21.3804	10.9159	0.47135	0.927:0.0:0.073:0.0	.	233	P51884	LUM_HUMAN	N	233	ENSP00000266718:Y233N	ENSP00000266718:Y233N	Y	-	1	0	LUM	90026191	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.953000	0.70290	2.113000	0.64589	0.455000	0.32223	TAT		0.423	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345		64	55	0	0	0	0.01441	0	64	55				
ACACB	32	broad.mit.edu	37	12	109671560	109671560	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:109671560G>C	ENST00000338432.7	+	30	4266	c.4147G>C	c.(4147-4149)Gat>Cat	p.D1383H	ACACB_ENST00000543201.1_Missense_Mutation_p.D49H|ACACB_ENST00000377848.3_Missense_Mutation_p.D1383H|ACACB_ENST00000377854.5_Missense_Mutation_p.D1313H			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1383				D -> G (in Ref. 6; AAC50571). {ECO:0000305}.	acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CAGAAATTTTGATGAAGTCAT	0.597																																							uc001tob.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(4147-4149)GAT>CAT		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)						72.0	66.0	68.0					12																	109671560		2203	4300	6503	SO:0001583	missense	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109671560G>C	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4147G>C	12.37:g.109671560G>C	ENSP00000341044:p.Asp1383His		Somatic				ACACB_uc001toc.2_Missense_Mutation_p.D1383H|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.D49H	p.D1383H	NM_001093	NP_001084	WXS	Illumina HiSeq	Unspecified	O00763	ACACB_HUMAN			30	4266	+			1383	D -> G (in Ref. 6; AAC50571).				A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	c.4147G>C	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885547	0.91814	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.06	5.06	0.68205	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.69815	0.3153	M	0.79475	2.455	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.72404	-0.4304	10	0.52906	T	0.07	.	18.8388	0.92174	0.0:0.0:1.0:0.0	.	1383	O00763	ACACB_HUMAN	H	1383;1383;1313;614;49	ENSP00000341044:D1383H;ENSP00000367079:D1383H;ENSP00000367085:D1313H;ENSP00000444075:D49H	ENSP00000341044:D1383H	D	+	1	0	ACACB	108155943	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.558000	0.82253	2.525000	0.85131	0.655000	0.94253	GAT		0.597	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		28	46	0	0	0	0.004656	0	28	46				
TRPV4	59341	broad.mit.edu	37	12	110236638	110236638	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:110236638C>A	ENST00000418703.2	-	5	1027	c.933G>T	c.(931-933)aaG>aaT	p.K311N	TRPV4_ENST00000392719.2_Missense_Mutation_p.K264N|TRPV4_ENST00000261740.2_Missense_Mutation_p.K311N|TRPV4_ENST00000544971.1_Missense_Mutation_p.K264N|TRPV4_ENST00000537083.1_Missense_Mutation_p.K311N|TRPV4_ENST00000346520.2_Missense_Mutation_p.K311N|TRPV4_ENST00000541794.1_Missense_Mutation_p.K264N|TRPV4_ENST00000536838.1_Missense_Mutation_p.K277N	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	311					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GCATGTCCGCCTTCTTGTGGG	0.617																																							uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(931-933)AAG>AAT		transient receptor potential cation channel,							81.0	70.0	74.0					12																	110236638		2203	4300	6503	SO:0001583	missense	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110236638C>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.933G>T	12.37:g.110236638C>A	ENSP00000406191:p.Lys311Asn		Somatic				TRPV4_uc001tpg.1_Missense_Mutation_p.K277N|TRPV4_uc001tph.1_Missense_Mutation_p.K264N|TRPV4_uc001tpi.1_Missense_Mutation_p.K264N|TRPV4_uc001tpk.1_Missense_Mutation_p.K311N|TRPV4_uc001tpl.1_Missense_Mutation_p.K311N	p.K311N	NM_021625	NP_067638	WXS	Illumina HiSeq	Unspecified	Q9HBA0	TRPV4_HUMAN			5	1028	-			311			Cytoplasmic (Potential).|ANK 2.		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	c.933G>T	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093007	0.36952	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	4.37	0.432	0.16529	Ankyrin repeat-containing domain (3);	0.315307	0.37437	N	0.002081	T	0.69628	0.3132	L	0.28649	0.875	0.30599	N	0.760726	D;P;D;B;B	0.89917	1.0;0.921;1.0;0.249;0.409	D;P;D;B;B	0.76575	0.983;0.448;0.988;0.189;0.211	T	0.66089	-0.6010	10	0.27082	T	0.32	-23.0228	8.8814	0.35376	0.0:0.6563:0.0:0.3437	.	311;311;264;264;277	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	N	311;311;264;311;264;311;264;277	ENSP00000406191:K311N;ENSP00000261740:K311N;ENSP00000376480:K264N;ENSP00000319003:K311N;ENSP00000443611:K264N;ENSP00000442738:K311N;ENSP00000442167:K264N;ENSP00000444336:K277N	ENSP00000261740:K311N	K	-	3	2	TRPV4	108721021	0.989000	0.36119	0.993000	0.49108	0.793000	0.44817	0.328000	0.19681	0.201000	0.20466	0.655000	0.94253	AAG		0.617	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		13	60	1	0	1.49906e-05	0.00245	1.53352e-05	13	60				
IQCD	115811	broad.mit.edu	37	12	113633461	113633461	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:113633461C>G	ENST00000416617.2	-	5	1459	c.1269G>C	c.(1267-1269)aaG>aaC	p.K423N	IQCD_ENST00000299732.2_Missense_Mutation_p.K321N			Q96DY2	IQCD_HUMAN	IQ motif containing D	423	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.									endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						cccgcttcttctTGGATCTGA	0.602																																							uc001tuu.2		NA																	0				ovary(1)	1						c.(961-963)AAG>AAC		IQ motif containing D							157.0	137.0	144.0					12																	113633461		2203	4300	6503	SO:0001583	missense	115811							g.chr12:113633461C>G	BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.1269G>C	12.37:g.113633461C>G	ENSP00000400669:p.Lys423Asn		Somatic					p.K321N	NM_138451	NP_612460	WXS	Illumina HiSeq	Unspecified	Q96DY2	IQCD_HUMAN			3	1135	-			Error:Variant_position_missing_in_Q96DY2_after_alignment					Q6ZSU0	Missense_Mutation	SNP	ENST00000416617.2	37	c.963G>C		.	.	.	.	.	.	.	.	.	.	C	13.04	2.119016	0.37436	.	.	ENSG00000166578	ENST00000299732;ENST00000416617	T;T	0.54866	0.65;0.55	4.23	4.23	0.50019	.	.	.	.	.	T	0.53012	0.1770	.	.	.	0.80722	D	1	P	0.44429	0.835	B	0.43728	0.429	T	0.59445	-0.7453	8	0.52906	T	0.07	-6.2167	15.5256	0.75901	0.0:1.0:0.0:0.0	.	321	Q96DY2-2	.	N	321;423	ENSP00000299732:K321N;ENSP00000400669:K423N	ENSP00000299732:K321N	K	-	3	2	IQCD	112117844	0.997000	0.39634	0.217000	0.23759	0.743000	0.42351	2.618000	0.46393	2.183000	0.69458	0.561000	0.74099	AAG		0.602	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405327.1	NM_138451		35	77	0	0	0	0.004878	0	35	77				
TMEM132D	121256	broad.mit.edu	37	12	130184743	130184743	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr12:130184743C>A	ENST00000422113.2	-	2	906	c.580G>T	c.(580-582)Gcc>Tcc	p.A194S	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	194					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCCAGCTCGGCCACGCACAGC	0.706																																							uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(580-582)GCC>TCC		transmembrane protein 132D precursor							16.0	18.0	17.0					12																	130184743		2201	4298	6499	SO:0001583	missense	121256					integral to membrane		g.chr12:130184743C>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.580G>T	12.37:g.130184743C>A	ENSP00000408581:p.Ala194Ser		Somatic					p.A194S	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	908	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	194			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.580G>T	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	31	5.088388	0.94100	.	.	ENSG00000151952	ENST00000422113	T	0.17528	2.27	5.35	5.35	0.76521	.	0.098116	0.43110	D	0.000602	T	0.48978	0.1530	M	0.85041	2.73	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.53085	-0.8488	9	.	.	.	-44.746	19.0705	0.93134	0.0:1.0:0.0:0.0	.	194	Q14C87	T132D_HUMAN	S	194	ENSP00000408581:A194S	.	A	-	1	0	TMEM132D	128750696	1.000000	0.71417	0.997000	0.53966	0.826000	0.46750	7.541000	0.82084	2.482000	0.83794	0.650000	0.86243	GCC		0.706	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		12	20	1	0	1.08611e-07	0.010729	1.15076e-07	12	20				
BRCA2	675	broad.mit.edu	37	13	32912197	32912197	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:32912197A>G	ENST00000380152.3	+	11	3938	c.3705A>G	c.(3703-3705)caA>caG	p.Q1235Q	BRCA2_ENST00000544455.1_Silent_p.Q1235Q			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1235					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAGCTCTGCAAAAAGCTGTGA	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		0				ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64						c.(3703-3705)CAA>CAG	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							50.0	52.0	52.0					13																	32912197		2203	4299	6502	SO:0001819	synonymous_variant	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32912197A>G	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3705A>G	13.37:g.32912197A>G		TCGA Ovarian(8;0.087)	Somatic					p.Q1235Q	NM_000059	NP_000050	WXS	Illumina HiSeq	Unspecified	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	11	3932	+		Lung SC(185;0.0262)	1235			BRCA2 2.		O00183|O15008|Q13879|Q5TBJ7	Silent	SNP	ENST00000380152.3	37	c.3705A>G	CCDS9344.1																																																																																				0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		17	56	0	0	0	0.006122	0	17	56				
COG3	83548	broad.mit.edu	37	13	46054349	46054349	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:46054349T>C	ENST00000349995.5	+	4	585	c.473T>C	c.(472-474)tTg>tCg	p.L158S		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	158					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		CTGGAGTCTTTGCAGAAACAG	0.413																																					Ovarian(150;1048 1859 18083 21577 42700)	Ovarian(150;1048 1859 18083 21577 42700)	uc001vak.2		NA																	0				breast(1)|skin(1)	2						c.(472-474)TTG>TCG		component of golgi transport complex 3							139.0	139.0	139.0					13																	46054349		2203	4300	6503	SO:0001583	missense	83548				ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity	g.chr13:46054349T>C	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.473T>C	13.37:g.46054349T>C	ENSP00000258654:p.Leu158Ser		Somatic				COG3_uc010tfu.1_RNA|COG3_uc001vai.2_Missense_Mutation_p.L158S|COG3_uc001vaj.1_Missense_Mutation_p.L158S|COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	p.L158S	NM_031431	NP_113619	WXS	Illumina HiSeq	Unspecified	Q96JB2	COG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)	4	574	+		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	158					B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	37	c.473T>C	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.521673	0.85600	.	.	ENSG00000136152	ENST00000349995	T	0.58060	0.36	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000001	T	0.74764	0.3759	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	T	0.78001	-0.2375	10	0.59425	D	0.04	-8.3959	15.6508	0.77091	0.0:0.0:0.0:1.0	.	158;158	Q96JB2;Q96JB2-2	COG3_HUMAN;.	S	158	ENSP00000258654:L158S	ENSP00000258654:L158S	L	+	2	0	COG3	44952350	1.000000	0.71417	0.975000	0.42487	0.994000	0.84299	7.698000	0.84413	2.289000	0.77006	0.482000	0.46254	TTG		0.413	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2			19	56	0	0	0	0.007413	0	19	56				
SIAH3	283514	broad.mit.edu	37	13	46358015	46358015	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:46358015A>G	ENST00000400405.2	-	2	419	c.313T>C	c.(313-315)Tgc>Cgc	p.C105R		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	105					multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						ATGCACAGGCAGGGCGTCACC	0.687																																							uc001vap.2		NA																	0				ovary(1)|skin(1)	2						c.(313-315)TGC>CGC		seven in absentia homolog 3							52.0	59.0	56.0					13																	46358015		2145	4224	6369	SO:0001583	missense	283514				multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding	g.chr13:46358015A>G		CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.313T>C	13.37:g.46358015A>G	ENSP00000383256:p.Cys105Arg		Somatic					p.C105R	NM_198849	NP_942146	WXS	Illumina HiSeq	Unspecified	Q8IW03	SIAH3_HUMAN			2	395	-			105			SIAH-type; degenerate.		B7ZBP0|Q8N8M6	Missense_Mutation	SNP	ENST00000400405.2	37	c.313T>C	CCDS41883.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.833814	0.50951	.	.	ENSG00000215475	ENST00000400405	T	0.29655	1.56	5.4	4.24	0.50183	Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.642824	0.13739	U	0.366112	T	0.26011	0.0634	L	0.40543	1.245	0.58432	D	0.999997	B	0.14805	0.011	B	0.17433	0.018	T	0.11941	-1.0567	10	0.87932	D	0	-10.4097	8.6278	0.33899	0.9136:0.0:0.0864:0.0	.	105	Q8IW03	SIAH3_HUMAN	R	105	ENSP00000383256:C105R	ENSP00000383256:C105R	C	-	1	0	SIAH3	45256016	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.068000	0.76748	2.055000	0.61198	0.459000	0.35465	TGC		0.687	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044788.2	NM_198849		8	61	0	0	0	0.006214	0	8	61				
CDADC1	81602	broad.mit.edu	37	13	49842173	49842173	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:49842173C>T	ENST00000251108.6	+	5	1091	c.978C>T	c.(976-978)gcC>gcT	p.A326A	CDADC1_ENST00000444959.1_Silent_p.A128A	NM_001193478.1|NM_030911.3	NP_001180407.1|NP_112173.1	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	326							hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	16		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		TGGTTCAGGCCAGGTTATTGG	0.403																																							uc001vcu.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(976-978)GCC>GCT		cytidine and dCMP deaminase domain containing 1							67.0	65.0	66.0					13																	49842173		2203	4298	6501	SO:0001819	synonymous_variant	81602						hydrolase activity|zinc ion binding	g.chr13:49842173C>T	AY027525	CCDS9415.1	13q14.11	2008-02-05			ENSG00000102543	ENSG00000102543			20299	protein-coding gene	gene with protein product							Standard	NM_001193478		Approved	NYD-SP15	uc001vcu.3	Q9BWV3	OTTHUMG00000016913	ENST00000251108.6:c.978C>T	13.37:g.49842173C>T			Somatic				CDADC1_uc001vcs.1_RNA|CDADC1_uc001vct.1_Silent_p.A208A|CDADC1_uc010tgk.1_Silent_p.A128A|CDADC1_uc001vcv.2_RNA	p.A326A	NM_030911	NP_112173	WXS	Illumina HiSeq	Unspecified	Q9BWV3	CDAC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)	5	1054	+		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	326					Q49A08|Q4G119|Q5TAW9|Q7Z764|Q9NT36	Silent	SNP	ENST00000251108.6	37	c.978C>T	CCDS9415.1																																																																																				0.403	CDADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044902.2	NM_030911		34	88	0	0	0	0.003755	0	34	88				
WDFY2	115825	broad.mit.edu	37	13	52325503	52325503	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:52325503C>T	ENST00000298125.5	+	8	963	c.783C>T	c.(781-783)ggC>ggT	p.G261G	WDFY2_ENST00000460145.2_3'UTR	NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	261							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		TCTCCTGTGGCGGTGATGGTG	0.572																																							uc001vfp.2		NA																	0					0						c.(781-783)GGC>GGT		WD repeat and FYVE domain containing 2							124.0	98.0	107.0					13																	52325503		2203	4300	6503	SO:0001819	synonymous_variant	115825						metal ion binding	g.chr13:52325503C>T	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.783C>T	13.37:g.52325503C>T			Somatic				WDFY2_uc010ads.1_Silent_p.G261G|WDFY2_uc010adt.1_RNA	p.G261G	NM_052950	NP_443182	WXS	Illumina HiSeq	Unspecified	Q96P53	WDFY2_HUMAN		GBM - Glioblastoma multiforme(99;9e-08)	8	1123	+		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)	261			WD 6.		B1AL86|Q96CS1	Silent	SNP	ENST00000298125.5	37	c.783C>T	CCDS9429.1																																																																																				0.572	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045985.3	NM_052950		14	61	0	0	0	0.006122	0	14	61				
DIS3	22894	broad.mit.edu	37	13	73336106	73336106	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:73336106C>A	ENST00000377767.4	-	17	2397	c.2297G>T	c.(2296-2298)gGc>gTc	p.G766V	DIS3_ENST00000377780.4_Missense_Mutation_p.G736V|DIS3_ENST00000545453.1_Missense_Mutation_p.G604V	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	766					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		AGACGCTAAGCCATAGTGATG	0.328										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(2296-2298)GGC>GTC		DIS3 mitotic control isoform a							96.0	92.0	93.0					13																	73336106		2203	4300	6503	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73336106C>A	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2297G>T	13.37:g.73336106C>A	ENSP00000366997:p.Gly766Val	Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Missense_Mutation_p.G736V|DIS3_uc001viz.2_RNA	p.G766V	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	17	2671	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	766					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.2297G>T	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631753	0.87660	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.54866	0.55;0.55;0.55	5.68	5.68	0.88126	Ribonuclease II/R, conserved site (1);Ribonuclease II/R (2);	0.088217	0.85682	D	0.000000	D	0.86339	0.5909	H	0.99642	4.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92363	0.5899	10	0.87932	D	0	.	19.7894	0.96452	0.0:1.0:0.0:0.0	.	736;766	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	V	766;736;604	ENSP00000366997:G766V;ENSP00000367011:G736V;ENSP00000440058:G604V	ENSP00000366997:G766V	G	-	2	0	DIS3	72234107	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.734000	0.84928	2.672000	0.90937	0.555000	0.69702	GGC		0.328	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		68	35	1	0	9.4991e-31	0.01441	1.33487e-30	68	35				
RNF113B	140432	broad.mit.edu	37	13	98828921	98828921	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:98828921A>T	ENST00000267291.6	-	1	598	c.570T>A	c.(568-570)gaT>gaA	p.D190E	FARP1_ENST00000319562.6_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000376586.2_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	190							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CAGGCTGGTAATCCCAGCGCA	0.607																																							uc001vnk.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(568-570)GAT>GAA		ring finger protein 113B							81.0	73.0	76.0					13																	98828921		2203	4300	6503	SO:0001583	missense	140432						nucleic acid binding|zinc ion binding	g.chr13:98828921A>T	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.570T>A	13.37:g.98828921A>T	ENSP00000267291:p.Asp190Glu		Somatic				FARP1_uc001vnh.2_Intron|FARP1_uc001vni.2_Intron|FARP1_uc001vnj.2_Intron	p.D190E	NM_178861	NP_849192	WXS	Illumina HiSeq	Unspecified	Q8IZP6	R113B_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.13)		1	601	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		190			C3H1-type.		Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	c.570T>A	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.000832	0.54254	.	.	ENSG00000139797	ENST00000267291	T	0.49139	0.79	1.16	1.16	0.20824	Zinc finger, CCCH-type (2);	0.127637	0.49916	U	0.000139	T	0.68393	0.2996	M	0.92026	3.265	0.40058	D	0.975863	D	0.89917	1.0	D	0.81914	0.995	T	0.70103	-0.4964	10	0.87932	D	0	.	6.4193	0.21734	1.0:0.0:0.0:0.0	.	190	Q8IZP6	R113B_HUMAN	E	190	ENSP00000267291:D190E	ENSP00000267291:D190E	D	-	3	2	RNF113B	97626922	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	0.510000	0.22723	0.776000	0.33473	0.397000	0.26171	GAT		0.607	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3	NM_178861		76	33	0	0	0	0.01441	0	76	33				
DCUN1D2	55208	broad.mit.edu	37	13	114138335	114138335	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr13:114138335G>A	ENST00000478244.1	-	2	322	c.40C>T	c.(40-42)Cag>Tag	p.Q14*	DCUN1D2_ENST00000332592.3_Intron|DCUN1D2_ENST00000460318.1_5'Flank|DCUN1D2_ENST00000375399.2_Nonsense_Mutation_p.Q14*	NM_001014283.1	NP_001014305.1	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 2	14	UBA-like.									breast(1)|endometrium(1)|large_intestine(1)|lung(3)|stomach(1)	7	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			GCCATAAACTGGCGGACCTTG	0.502																																							uc001vtr.1		NA																	0					0						c.(40-42)CAG>TAG		DCN1, defective in cullin neddylation 1, domain							163.0	143.0	150.0					13																	114138335		2203	4300	6503	SO:0001587	stop_gained	55208							g.chr13:114138335G>A	AK001566	CCDS32013.1	13q34	2013-06-10	2013-06-10	2005-10-04	ENSG00000150401	ENSG00000150401			20328	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 17"", ""DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)"""	C13orf17		15988528	Standard	XM_005268320		Approved	FLJ10704, FLJ20092	uc001vtr.1	Q6PH85	OTTHUMG00000017390	ENST00000478244.1:c.40C>T	13.37:g.114138335G>A	ENSP00000417706:p.Gln14*		Somatic				DCUN1D2_uc001vts.1_RNA|DCUN1D2_uc010agw.1_Intron	p.Q14*	NM_001014283	NP_001014305	WXS	Illumina HiSeq	Unspecified	Q6PH85	DCNL2_HUMAN	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)		2	79	-	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	14			UBA-like.		Q5JSA5|Q5JSA6|Q5JSA7|Q9NVJ1|Q9NXR6	Nonsense_Mutation	SNP	ENST00000478244.1	37	c.40C>T	CCDS32013.1	.	.	.	.	.	.	.	.	.	.	G	38	7.156157	0.98099	.	.	ENSG00000150401	ENST00000478244;ENST00000375399	.	.	.	4.64	3.8	0.43715	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	12.7387	0.57239	0.08:0.0:0.92:0.0	.	.	.	.	X	14	.	ENSP00000364548:Q14X	Q	-	1	0	DCUN1D2	113186336	1.000000	0.71417	0.988000	0.46212	0.950000	0.60333	4.892000	0.63193	0.962000	0.38057	0.655000	0.94253	CAG		0.502	DCUN1D2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045938.4	NM_018185		41	121	0	0	0	0.00623	0	41	121				
CHD8	57680	broad.mit.edu	37	14	21862131	21862131	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:21862131C>A	ENST00000557364.1	-	32	6086	c.5823G>T	c.(5821-5823)ggG>ggT	p.G1941G	CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Silent_p.G1662G|SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000399982.2_Silent_p.G1941G			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1941					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTTGGCTCACCCCATGGCGGG	0.552																																							uc001was.1		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(4984-4986)GGG>GGT		chromodomain helicase DNA binding protein 8							61.0	61.0	61.0					14																	21862131		1953	4137	6090	SO:0001819	synonymous_variant	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21862131C>A	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5823G>T	14.37:g.21862131C>A			Somatic				CHD8_uc001war.1_Silent_p.G1558G|SNORD9_uc001wat.1_5'Flank	p.G1662G	NM_020920	NP_065971	WXS	Illumina HiSeq	Unspecified	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	32	5080	-	all_cancers(95;0.00121)		1941					Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	ENST00000557364.1	37	c.4986G>T	CCDS53885.1																																																																																				0.552	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		28	32	1	0	1.75199e-13	0.007291	2.07902e-13	28	32				
OR10G3	26533	broad.mit.edu	37	14	22038258	22038258	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:22038258C>T	ENST00000303532.1	-	1	617	c.618G>A	c.(616-618)gtG>gtA	p.V206V		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		TGGCAACCACCACCCCAATGT	0.527																																							uc010tmb.1		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(616-618)GTG>GTA		olfactory receptor, family 10, subfamily G,							188.0	181.0	183.0					14																	22038258		2203	4300	6503	SO:0001819	synonymous_variant	26533				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22038258C>T		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.618G>A	14.37:g.22038258C>T			Somatic					p.V206V	NM_001005465	NP_001005465	WXS	Illumina HiSeq	Unspecified	Q8NGC4	O10G3_HUMAN		GBM - Glioblastoma multiforme(265;0.0139)	1	618	-	all_cancers(95;0.000987)		206			Helical; Name=5; (Potential).		Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	c.618G>A	CCDS32046.1																																																																																				0.527	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1			69	96	0	0	0	0.01441	0	69	96				
COCH	1690	broad.mit.edu	37	14	31344261	31344261	+	Splice_Site	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:31344261G>C	ENST00000396618.3	+	3	90		c.e3-1		COCH_ENST00000475087.1_Splice_Site|COCH_ENST00000216361.4_Splice_Site|COCH_ENST00000460581.2_5'UTR|RP11-829H16.3_ENST00000555108.1_RNA	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin						defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TCTCTTCGCAGGTGTGTGTCT	0.741																																							uc001wqr.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.e3-1		cochlin precursor							17.0	19.0	18.0					14																	31344261		2196	4297	6493	SO:0001630	splice_region_variant	1690				sensory perception of sound	proteinaceous extracellular matrix		g.chr14:31344261G>C		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.35-1G>C	14.37:g.31344261G>C			Somatic				COCH_uc001wqp.2_Splice_Site_p.G12_splice|COCH_uc001wqq.3_Splice_Site_p.G12_splice	p.G12_splice	NM_004086	NP_004077	WXS	Illumina HiSeq	Unspecified	O43405	COCH_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)	3	115	+	Hepatocellular(127;0.0877)|Breast(36;0.148)							A8K9K9|D3DS84|Q96IU6	Splice_Site	SNP	ENST00000396618.3	37	c.35_splice	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331357	0.60853	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000555881	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5692	0.68200	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COCH	30414012	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	3.047000	0.49854	2.514000	0.84764	0.561000	0.74099	.		0.741	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	Intron	6	12	0	0	0	0.001168	0	6	12				
CFL2	1073	broad.mit.edu	37	14	35182111	35182111	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:35182111C>G	ENST00000341223.3	-	4	612	c.461G>C	c.(460-462)gGa>gCa	p.G154A	CFL2_ENST00000556161.1_Missense_Mutation_p.G137A|CFL2_ENST00000555765.1_Missense_Mutation_p.G137A|CFL2_ENST00000298159.6_Missense_Mutation_p.G154A	NM_001243645.1|NM_021914.7	NP_001230574.1|NP_068733.1	Q9Y281	COF2_HUMAN	cofilin 2 (muscle)	154					actin filament depolymerization (GO:0030042)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of actin filament depolymerization (GO:0030836)|regulation of dendritic spine morphogenesis (GO:0061001)|sarcomere organization (GO:0045214)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|nucleus (GO:0005634)				breast(3)|endometrium(2)|lung(3)	8	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		TACATTGCCTCCCAATTTCTC	0.378																																							uc001wsg.3		NA																	0				breast(2)	2						c.(460-462)GGA>GCA		cofilin 2							112.0	110.0	111.0					14																	35182111		2203	4300	6503	SO:0001583	missense	1073					cytoplasm|cytoskeleton|nuclear matrix	actin binding	g.chr14:35182111C>G	AF087867	CCDS9649.1, CCDS9650.1, CCDS58311.1	14q13.2	2014-09-17			ENSG00000165410	ENSG00000165410			1875	protein-coding gene	gene with protein product	"""nemaline myopathy type 7"""	601443				8800436	Standard	NM_138638		Approved	NEM7	uc001wsh.3	Q9Y281	OTTHUMG00000029536	ENST00000341223.3:c.461G>C	14.37:g.35182111C>G	ENSP00000340635:p.Gly154Ala		Somatic				CFL2_uc010tpn.1_Missense_Mutation_p.G137A|CFL2_uc001wsh.3_Missense_Mutation_p.G154A|CFL2_uc001wsi.3_RNA|CFL2_uc001wsj.3_RNA	p.G154A	NM_021914	NP_068733	WXS	Illumina HiSeq	Unspecified	Q9Y281	COF2_HUMAN	LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)	4	602	-	Breast(36;0.0361)|Hepatocellular(127;0.158)		154					G3V5P4	Missense_Mutation	SNP	ENST00000341223.3	37	c.461G>C	CCDS9650.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290996	0.59976	.	.	ENSG00000165410	ENST00000341223;ENST00000298159;ENST00000555765;ENST00000556161	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	6.02	6.02	0.97574	Actin-binding, cofilin/tropomyosin type (1);	0.000000	0.85682	D	0.000000	D	0.92573	0.7641	M	0.89478	3.035	0.80722	D	1	D	0.52996	0.957	D	0.64506	0.926	D	0.91884	0.5518	10	0.49607	T	0.09	-2.0544	20.5407	0.99260	0.0:1.0:0.0:0.0	.	154	Q9Y281	COF2_HUMAN	A	154;154;137;137	ENSP00000340635:G154A;ENSP00000298159:G154A;ENSP00000452451:G137A;ENSP00000452188:G137A	ENSP00000298159:G154A	G	-	2	0	CFL2	34251862	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.554000	0.82212	2.865000	0.98341	0.655000	0.94253	GGA		0.378	CFL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276639.1	NM_138638		26	81	0	0	0	0.00632	0	26	81				
CLEC14A	161198	broad.mit.edu	37	14	38724405	38724405	+	Missense_Mutation	SNP	T	T	C	rs140940981	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:38724405T>C	ENST00000342213.2	-	1	1169	c.823A>G	c.(823-825)Acg>Gcg	p.T275A		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	275	EGF-like.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCGAAGCCCGTAGCACATTCG	0.667													T|||	20	0.00399361	0.0151	0.0	5008	,	,		16233	0.0		0.0	False		,,,				2504	0.0						uc001wum.1		NA																	0				ovary(3)|skin(1)	4						c.(823-825)ACG>GCG		C-type lectin domain family 14, member A		T	ALA/THR	64,4340	53.6+/-89.4	1,62,2139	61.0	67.0	65.0		823	-3.8	0.0	14	dbSNP_134	65	0,8600		0,0,4300	yes	missense	CLEC14A	NM_175060.1	58	1,62,6439	CC,CT,TT		0.0,1.4532,0.4922	benign	275/491	38724405	64,12940	2202	4300	6502	SO:0001583	missense	161198					integral to membrane	sugar binding	g.chr14:38724405T>C		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.823A>G	14.37:g.38724405T>C	ENSP00000353013:p.Thr275Ala		Somatic					p.T275A	NM_175060	NP_778230	WXS	Illumina HiSeq	Unspecified	Q86T13	CLC14_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)	1	1170	-	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		275			Extracellular (Potential).|EGF-like.		Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	c.823A>G	CCDS9667.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	T	0.005	-2.179813	0.00308	0.014532	0.0	ENSG00000176435	ENST00000342213;ENST00000546356	D	0.95412	-3.7	3.91	-3.76	0.04359	Epidermal growth factor-like (1);	1.329510	0.05604	N	0.576877	T	0.80949	0.4722	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.76806	-0.2823	10	0.02654	T	1	0.623	11.4285	0.50025	0.0:0.2335:0.6759:0.0907	.	275	Q86T13	CLC14_HUMAN	A	275;40	ENSP00000353013:T275A	ENSP00000353013:T275A	T	-	1	0	CLEC14A	37794156	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.272000	0.08560	-0.650000	0.05423	-1.505000	0.00955	ACG		0.667	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		18	145	0	0	0	0.00499	0	18	145				
FSCB	84075	broad.mit.edu	37	14	44974569	44974569	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:44974569T>C	ENST00000340446.4	-	1	1913	c.1622A>G	c.(1621-1623)gAa>gGa	p.E541G	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	541	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AGACTGAGCTTCAGCAGGAGT	0.493																																							uc001wvn.2		NA																	0				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(1621-1623)GAA>GGA		fibrous sheath CABYR binding protein							31.0	32.0	32.0					14																	44974569		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44974569T>C	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1622A>G	14.37:g.44974569T>C	ENSP00000344579:p.Glu541Gly		Somatic					p.E541G	NM_032135	NP_115511	WXS	Illumina HiSeq	Unspecified	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	1931	-			541			Ala-rich.		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.1622A>G	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.302762	0.60195	.	.	ENSG00000189139	ENST00000340446	T	0.15718	2.4	5.55	3.2	0.36748	.	.	.	.	.	T	0.18551	0.0445	M	0.67397	2.05	0.09310	N	1	B	0.33940	0.433	B	0.33454	0.164	T	0.15925	-1.0420	9	0.52906	T	0.07	-1.4103	6.7666	0.23571	0.0:0.0802:0.1554:0.7644	.	541	Q5H9T9	FSCB_HUMAN	G	541	ENSP00000344579:E541G	ENSP00000344579:E541G	E	-	2	0	FSCB	44044319	0.014000	0.17966	0.001000	0.08648	0.009000	0.06853	0.903000	0.28475	1.057000	0.40506	-0.321000	0.08615	GAA		0.493	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		8	48	0	0	0	0.004482	0	8	48				
HSPA2	3306	broad.mit.edu	37	14	65008546	65008546	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:65008546G>T	ENST00000394709.1	+	2	1055	c.979G>T	c.(979-981)Gcc>Tcc	p.A327S	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.A327S			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	327					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GCTGCGCGACGCCAAGCTGGA	0.622																																					Pancreas(136;1211 1835 24894 31984 38227)	Pancreas(136;1211 1835 24894 31984 38227)	uc001xhj.2		NA																	0				skin(1)	1						c.(979-981)GCC>TCC		heat shock 70kDa protein 2							31.0	33.0	32.0					14																	65008546		2203	4300	6503	SO:0001583	missense	3306				response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding	g.chr14:65008546G>T	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.979G>T	14.37:g.65008546G>T	ENSP00000378199:p.Ala327Ser		Somatic				HSPA2_uc001xhk.3_Missense_Mutation_p.A327S	p.A327S	NM_021979	NP_068814	WXS	Illumina HiSeq	Unspecified	P54652	HSP72_HUMAN		all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)	2	1055	+			327					Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	c.979G>T	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105488	0.77096	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01369	4.97;4.97	4.96	4.96	0.65561	.	0.000000	0.53938	U	0.000049	T	0.05364	0.0142	L	0.41961	1.31	0.58432	D	0.999999	B	0.27559	0.181	P	0.48840	0.592	T	0.51694	-0.8673	10	0.66056	D	0.02	-9.0919	18.2708	0.90068	0.0:0.0:1.0:0.0	.	327	P54652	HSP72_HUMAN	S	327;327;101	ENSP00000378199:A327S;ENSP00000247207:A327S	ENSP00000247207:A327S	A	+	1	0	HSPA2	64078299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.865000	0.99609	2.318000	0.78349	0.558000	0.71614	GCC		0.622	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1			23	21	1	0	1.55795e-14	0.012319	1.87375e-14	23	21				
ZFP36L1	677	broad.mit.edu	37	14	69256498	69256498	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:69256498C>T	ENST00000439696.2	-	2	1070	c.769G>A	c.(769-771)Gag>Aag	p.E257K	ZFP36L1_ENST00000555997.1_3'UTR|ZFP36L1_ENST00000336440.3_Missense_Mutation_p.E257K	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	257					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E257*(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTTGCCAGCTCCTGGCTGGAG	0.632											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(769-771)GAG>AAG		butyrate response factor 1							56.0	68.0	64.0					14																	69256498		2199	4296	6495	SO:0001583	missense	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69256498C>T	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.769G>A	14.37:g.69256498C>T	ENSP00000388402:p.Glu257Lys		Somatic	OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1113	ZFP36L1_uc001xki.1_Missense_Mutation_p.E257K	p.E257K	NM_004926	NP_004917	WXS	Illumina HiSeq	Unspecified	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	2	899	-			257					Q13851	Missense_Mutation	SNP	ENST00000439696.2	37	c.769G>A	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189651	0.78789	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246	T;T	0.32272	1.46;1.46	4.65	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	L	0.47716	1.5	0.80722	D	1	P	0.37688	0.605	B	0.35039	0.194	T	0.03887	-1.0995	10	0.33940	T	0.23	-1.3057	12.481	0.55842	0.0:0.9196:0.0:0.0804	.	257	Q07352	TISB_HUMAN	K	257;257;240	ENSP00000388402:E257K;ENSP00000337386:E257K	ENSP00000337386:E257K	E	-	1	0	ZFP36L1	68326251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.312000	0.78968	1.178000	0.42870	0.585000	0.79938	GAG		0.632	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			18	102	0	0	0	0.006122	0	18	102				
UNC79	57578	broad.mit.edu	37	14	94083503	94083503	+	Silent	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:94083503T>C	ENST00000393151.2	+	28	4077	c.4077T>C	c.(4075-4077)ctT>ctC	p.L1359L	UNC79_ENST00000555664.1_Silent_p.L1359L|UNC79_ENST00000256339.4_Silent_p.L1182L|UNC79_ENST00000553484.1_Silent_p.L1381L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1359					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GAAAACACCTTCTCCCCTTAG	0.423																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(3610-3612)CTT>CTC		hypothetical protein LOC57578							110.0	108.0	109.0					14																	94083503		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94083503T>C	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4077T>C	14.37:g.94083503T>C			Somatic				KIAA1409_uc001ybs.1_Silent_p.L1182L	p.L1204L	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	26	3695	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1359					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.3612T>C																																																																																					0.423	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		36	101	0	0	0	0.005524	0	36	101				
ATG2B	55102	broad.mit.edu	37	14	96808029	96808029	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:96808029G>A	ENST00000359933.4	-	6	1647	c.754C>T	c.(754-756)Cca>Tca	p.P252S		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	252					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GAGAGCTTTGGCTCAGTTTCC	0.318																																							uc001yfi.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(754-756)CCA>TCA		ATG2 autophagy related 2 homolog B							111.0	98.0	102.0					14																	96808029		1816	4073	5889	SO:0001583	missense	55102							g.chr14:96808029G>A	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.754C>T	14.37:g.96808029G>A	ENSP00000353010:p.Pro252Ser		Somatic					p.P252S	NM_018036	NP_060506	WXS	Illumina HiSeq	Unspecified	Q96BY7	ATG2B_HUMAN		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)	6	1119	-		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)	252					Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	c.754C>T	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321199	0.60634	.	.	ENSG00000066739	ENST00000359933	T	0.09073	3.02	6.04	6.04	0.98038	.	0.000000	0.46145	U	0.000313	T	0.22244	0.0536	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.02450	-1.1157	10	0.05436	T	0.98	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	252	Q96BY7	ATG2B_HUMAN	S	252	ENSP00000353010:P252S	ENSP00000353010:P252S	P	-	1	0	ATG2B	95877782	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.540000	0.82074	2.873000	0.98535	0.563000	0.77884	CCA		0.318	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036		35	34	0	0	0	0.003755	0	35	34				
AHNAK2	113146	broad.mit.edu	37	14	105408595	105408595	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr14:105408595C>A	ENST00000333244.5	-	7	13312	c.13193G>T	c.(13192-13194)gGt>gTt	p.G4398V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4398						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TATCTGGGGACCCTTGAGGTC	0.602																																							uc010axc.1		NA																	0				ovary(1)	1						c.(13192-13194)GGT>GTT		AHNAK nucleoprotein 2							86.0	92.0	90.0					14																	105408595		1921	4121	6042	SO:0001583	missense	113146					nucleus		g.chr14:105408595C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13193G>T	14.37:g.105408595C>A	ENSP00000353114:p.Gly4398Val		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.G4298V	p.G4398V	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	13313	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	4398					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.13193G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	7.778	0.708839	0.15239	.	.	ENSG00000185567	ENST00000333244	T	0.02863	4.13	3.16	-0.473	0.12112	.	0.923299	0.08676	U	0.910177	T	0.15825	0.0381	M	0.81682	2.555	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.23655	-1.0182	10	0.42905	T	0.14	.	15.4194	0.75000	0.0:0.343:0.657:0.0	.	4398	Q8IVF2	AHNK2_HUMAN	V	4398	ENSP00000353114:G4398V	ENSP00000353114:G4398V	G	-	2	0	AHNAK2	104479640	0.000000	0.05858	0.007000	0.13788	0.016000	0.09150	-0.728000	0.04925	0.012000	0.14892	0.306000	0.20318	GGT		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		35	139	1	0	6.02846e-25	0.003271	8.25435e-25	35	139				
MKRN3	7681	broad.mit.edu	37	15	23811531	23811531	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:23811531C>A	ENST00000314520.3	+	1	1078	c.602C>A	c.(601-603)gCg>gAg	p.A201E	MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	201					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A201V(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GAAAGCTGGGCGGATGCCATT	0.592																																							uc001ywh.3		NA																	1	Substitution - Missense(1)		cervix(1)	lung(6)|large_intestine(2)|ovary(2)	10						c.(601-603)GCG>GAG		makorin ring finger protein 3							38.0	44.0	42.0					15																	23811531		2202	4300	6502	SO:0001583	missense	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811531C>A	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.602C>A	15.37:g.23811531C>A	ENSP00000313881:p.Ala201Glu		Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.A201E	p.A201E	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	1078	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	201						Missense_Mutation	SNP	ENST00000314520.3	37	c.602C>A	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	C	0.270	-0.993845	0.02145	.	.	ENSG00000179455	ENST00000314520	T	0.31247	1.5	4.07	-6.96	0.01622	.	0.299532	0.29707	N	0.011402	T	0.08088	0.0202	N	0.05124	-0.11	0.25742	N	0.985148	B	0.02656	0.0	B	0.06405	0.002	T	0.27123	-1.0083	10	0.10377	T	0.69	.	4.1067	0.10040	0.1667:0.5204:0.0891:0.2239	.	201	Q13064	MKRN3_HUMAN	E	201	ENSP00000313881:A201E	ENSP00000313881:A201E	A	+	2	0	MKRN3	21362624	0.877000	0.30153	0.002000	0.10522	0.273000	0.26683	0.487000	0.22356	-1.444000	0.01950	-1.475000	0.01000	GCG		0.592	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		12	24	1	0	2.80697e-09	0.010729	3.1098e-09	12	24				
GABRG3	2567	broad.mit.edu	37	15	27574019	27574019	+	Silent	SNP	G	G	C	rs554943323	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:27574019G>C	ENST00000333743.6	+	5	812	c.558G>C	c.(556-558)ccG>ccC	p.P186P	GABRG3_ENST00000555083.1_Silent_p.P186P	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	186					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACTCCTGCCCGCTGATTTTCT	0.547																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(556-558)CCG>CCC		gamma-aminobutyric acid (GABA) A receptor, gamma							78.0	80.0	79.0					15																	27574019		2124	4248	6372	SO:0001819	synonymous_variant	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27574019G>C		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.558G>C	15.37:g.27574019G>C			Somatic				GABRG3_uc001zbf.2_Silent_p.P186P	p.P186P	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	5	724	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	186			Extracellular (Probable).		G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	c.558G>C	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	8.517	0.867849	0.17250	.	.	ENSG00000182256	ENST00000557596	.	.	.	5.35	-7.3	0.01446	.	.	.	.	.	T	0.35770	0.0943	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42531	-0.9446	4	.	.	.	.	2.4329	0.04476	0.3332:0.0947:0.1009:0.4712	.	.	.	.	P	19	.	.	R	+	2	0	GABRG3	25156765	0.000000	0.05858	0.580000	0.28601	0.991000	0.79684	-3.481000	0.00456	-1.029000	0.03317	-0.251000	0.11542	CGC		0.547	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			32	19	0	0	0	0.003755	0	32	19				
RYR3	6263	broad.mit.edu	37	15	34137093	34137093	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:34137093G>A	ENST00000389232.4	+	93	13397	c.13327G>A	c.(13327-13329)Gag>Aag	p.E4443K	RYR3_ENST00000415757.3_Missense_Mutation_p.E4438K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4443					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGAAGAGACAGAGGATGTTGC	0.443																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(13327-13329)GAG>AAG		ryanodine receptor 3							107.0	99.0	101.0					15																	34137093		1908	4116	6024	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34137093G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.13327G>A	15.37:g.34137093G>A	ENSP00000373884:p.Glu4443Lys		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.E4438K	p.E4443K	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	93	13397	+		all_lung(180;7.18e-09)	4443					O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.13327G>A	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434923	0.43224	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.93953	-3.32	5.97	5.97	0.96955	Ryanodine Receptor TM 4-6 (1);	0.065519	0.64402	D	0.000016	D	0.90947	0.7154	L	0.52573	1.65	0.39908	D	0.973996	B;B	0.27625	0.152;0.183	B;B	0.25506	0.058;0.061	D	0.87649	0.2527	10	0.11794	T	0.64	.	20.428	0.99075	0.0:0.0:1.0:0.0	.	4438;4443	Q15413-2;Q15413	.;RYR3_HUMAN	K	4443;4439	ENSP00000373884:E4443K	ENSP00000354735:E4439K	E	+	1	0	RYR3	31924385	0.997000	0.39634	0.938000	0.37757	0.946000	0.59487	4.017000	0.57167	2.837000	0.97791	0.655000	0.94253	GAG		0.443	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			6	26	0	0	0	0.001984	0	6	26				
ACTC1	70	broad.mit.edu	37	15	35084379	35084379	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:35084379C>T	ENST00000290378.4	-	5	1375	c.720G>A	c.(718-720)aaG>aaA	p.K240K	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA|ACTC1_ENST00000557860.1_5'UTR	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	240					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GTTCATAGCTCTTCTCCAGGG	0.507																																							uc001ziu.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(718-720)AAG>AAA		cardiac muscle alpha actin 1 proprotein							87.0	82.0	84.0					15																	35084379		2201	4298	6499	SO:0001819	synonymous_variant	70				apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding	g.chr15:35084379C>T	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.720G>A	15.37:g.35084379C>T			Somatic				uc001zit.1_Intron	p.K240K	NM_005159	NP_005150	WXS	Illumina HiSeq	Unspecified	P68032	ACTC_HUMAN		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)	5	963	-		all_lung(180;2.3e-08)	240					P04270	Silent	SNP	ENST00000290378.4	37	c.720G>A	CCDS10041.1																																																																																				0.507	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159		35	20	0	0	0	0.003271	0	35	20				
AP4E1	23431	broad.mit.edu	37	15	51291271	51291271	+	Silent	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:51291271G>T	ENST00000261842.5	+	19	3013	c.2907G>T	c.(2905-2907)gtG>gtT	p.V969V	AP4E1_ENST00000560508.1_Silent_p.V894V|AP4E1_ENST00000561397.1_Intron	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	969					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ATTTGCAGGTGACTGAGCAAC	0.363																																							uc001zyx.1		NA																	0					0						c.(2905-2907)GTG>GTT		adaptor-related protein complex 4, epsilon 1							85.0	83.0	84.0					15																	51291271		2196	4294	6490	SO:0001819	synonymous_variant	23431				intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity	g.chr15:51291271G>T	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2907G>T	15.37:g.51291271G>T			Somatic				AP4E1_uc010bex.1_Intron	p.V969V	NM_007347	NP_031373	WXS	Illumina HiSeq	Unspecified	Q9UPM8	AP4E1_HUMAN		all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)	19	2937	+			969					A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	ENST00000261842.5	37	c.2907G>T	CCDS32240.1																																																																																				0.363	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1			28	16	1	0	7.01153e-11	0.007291	8.00034e-11	28	16				
MYO5C	55930	broad.mit.edu	37	15	52505478	52505478	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:52505478C>T	ENST00000261839.7	-	34	4209	c.4048G>A	c.(4048-4050)Gat>Aat	p.D1350N		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1350						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GAGTGCACATCATTGGCTGTA	0.473																																							uc010bff.2		NA																	0				ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14						c.(4048-4050)GAT>AAT		myosin VC							88.0	79.0	82.0					15																	52505478		1955	4141	6096	SO:0001583	missense	55930					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr15:52505478C>T	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4048G>A	15.37:g.52505478C>T	ENSP00000261839:p.Asp1350Asn		Somatic				MYO5C_uc010uga.1_Intron	p.D1350N	NM_018728	NP_061198	WXS	Illumina HiSeq	Unspecified	Q9NQX4	MYO5C_HUMAN		all cancers(107;0.0137)	34	4185	-			1350			Potential.		Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	c.4048G>A	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.743445	0.30865	.	.	ENSG00000128833	ENST00000261839	T	0.16597	2.33	5.38	3.5	0.40072	.	0.479179	0.23360	N	0.049032	T	0.07818	0.0196	N	0.04508	-0.205	0.80722	D	1	B	0.16802	0.019	B	0.20184	0.028	T	0.24440	-1.0160	10	0.19147	T	0.46	.	10.895	0.47017	0.0:0.7992:0.1309:0.0698	.	1350	Q9NQX4	MYO5C_HUMAN	N	1350	ENSP00000261839:D1350N	ENSP00000261839:D1350N	D	-	1	0	MYO5C	50292770	0.994000	0.37717	0.404000	0.26397	0.861000	0.49209	1.106000	0.31098	0.822000	0.34565	0.655000	0.94253	GAT		0.473	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728		12	32	0	0	0	0.010729	0	12	32				
ZNF280D	54816	broad.mit.edu	37	15	56974516	56974516	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:56974516C>A	ENST00000267807.7	-	10	1156	c.940G>T	c.(940-942)Gaa>Taa	p.E314*	ZNF280D_ENST00000559237.1_Nonsense_Mutation_p.E301*|ZNF280D_ENST00000559000.1_Nonsense_Mutation_p.E301*|ZNF280D_ENST00000396245.1_Nonsense_Mutation_p.E18*	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		GTCTTCTGTTCCTCCTGGACA	0.279																																							uc002adu.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(940-942)GAA>TAA		suppressor of hairy wing homolog 4 isoform 1							109.0	106.0	107.0					15																	56974516		2192	4289	6481	SO:0001587	stop_gained	54816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:56974516C>A	AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.940G>T	15.37:g.56974516C>A	ENSP00000267807:p.Glu314*		Somatic				ZNF280D_uc002adv.2_Nonsense_Mutation_p.E301*|ZNF280D_uc010bfq.2_Nonsense_Mutation_p.E314*|ZNF280D_uc002adw.1_Nonsense_Mutation_p.E342*|ZNF280D_uc010bfr.1_RNA|ZNF280D_uc010bfp.2_RNA	p.E314*	NM_017661	NP_060131	WXS	Illumina HiSeq	Unspecified	Q6N043	Z280D_HUMAN		all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)	10	1157	-			314					A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Nonsense_Mutation	SNP	ENST00000267807.7	37	c.940G>T	CCDS32245.1	.	.	.	.	.	.	.	.	.	.	C	38	6.690485	0.97764	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000260435;ENST00000396245	.	.	.	4.87	4.87	0.63330	.	0.800363	0.10545	N	0.662270	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-8.3117	17.3568	0.87338	0.0:1.0:0.0:0.0	.	.	.	.	X	314;301;150;18	.	ENSP00000260435:E150X	E	-	1	0	ZNF280D	54761808	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	4.026000	0.57232	2.396000	0.81511	0.484000	0.47621	GAA		0.279	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418891.2	XM_370867		10	28	1	0	2.80697e-09	0.010729	3.1098e-09	10	28				
BNIP2	663	broad.mit.edu	37	15	59964843	59964843	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:59964843G>C	ENST00000607373.1	-	6	770	c.568C>G	c.(568-570)Ctt>Gtt	p.L190V	BNIP2_ENST00000267859.3_Missense_Mutation_p.L311V|BNIP2_ENST00000415213.2_Missense_Mutation_p.L252V|AC092755.4_ENST00000441746.1_RNA	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2	190	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						TACTTAAAAAGATTGTCCATC	0.303																																					Ovarian(174;1936 1978 6671 8240 38212)	Ovarian(174;1936 1978 6671 8240 38212)	uc010uhc.1		NA																	0				ovary(1)	1						c.(931-933)CTT>GTT		BCL2/adenovirus E1B 19kD interacting protein 2							67.0	72.0	70.0					15																	59964843		2190	4290	6480	SO:0001583	missense	663				anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding	g.chr15:59964843G>C	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.568C>G	15.37:g.59964843G>C	ENSP00000475320:p.Leu190Val		Somatic				BNIP2_uc010uhb.1_Missense_Mutation_p.L252V	p.L311V	NM_004330	NP_004321	WXS	Illumina HiSeq	Unspecified	Q12982	BNIP2_HUMAN			6	934	-			190			CRAL-TRIO.		B4DS94	Missense_Mutation	SNP	ENST00000607373.1	37	c.931C>G		.	.	.	.	.	.	.	.	.	.	G	19.42	3.824856	0.71143	.	.	ENSG00000140299	ENST00000267859;ENST00000415213;ENST00000439052	T;T;T	0.69685	-0.42;-0.42;-0.42	5.79	5.79	0.91817	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81307	0.4795	M	0.81112	2.525	0.80722	D	1	D;P	0.56287	0.975;0.931	D;P	0.67382	0.951;0.833	T	0.81887	-0.0726	9	.	.	.	-11.6692	14.2229	0.65839	0.0711:0.0:0.9289:0.0	.	190;252	Q12982;Q12982-2	BNIP2_HUMAN;.	V	311;252;68	ENSP00000267859:L311V;ENSP00000412767:L252V;ENSP00000393644:L68V	.	L	-	1	0	BNIP2	57752135	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.128000	0.64733	2.727000	0.93392	0.591000	0.81541	CTT		0.303	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470740.1	NM_004330		16	44	0	0	0	0.004007	0	16	44				
ISLR2	57611	broad.mit.edu	37	15	74426032	74426032	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:74426032C>A	ENST00000361742.3	+	4	1706	c.937C>A	c.(937-939)Caa>Aaa	p.Q313K	ISLR2_ENST00000435464.1_Missense_Mutation_p.Q313K|ISLR2_ENST00000453268.2_Missense_Mutation_p.Q313K|ISLR2_ENST00000445793.1_Missense_Mutation_p.Q313K|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565159.1_Missense_Mutation_p.Q313K|ISLR2_ENST00000565540.1_Missense_Mutation_p.Q313K|ISLR2_ENST00000419208.1_Missense_Mutation_p.Q313K	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	313	Ig-like.				positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GACGCAGACCCAAGCCCAAAC	0.667																																							uc002axd.2		NA																	0					0						c.(937-939)CAA>AAA		immunoglobulin superfamily containing							35.0	26.0	29.0					15																	74426032		2198	4295	6493	SO:0001583	missense	57611				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane		g.chr15:74426032C>A		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.937C>A	15.37:g.74426032C>A	ENSP00000355402:p.Gln313Lys		Somatic				ISLR2_uc002axe.2_Missense_Mutation_p.Q313K|ISLR2_uc010bjg.2_Missense_Mutation_p.Q313K|ISLR2_uc010bjf.2_Missense_Mutation_p.Q313K	p.Q313K	NM_001130136	NP_001123608	WXS	Illumina HiSeq	Unspecified	Q6UXK2	ISLR2_HUMAN			4	1706	+			313			Ig-like.|Extracellular (Potential).		A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	c.937C>A	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.266666	0.00259	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000419208	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	3.24	0.0261	0.14148	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.774017	0.10860	N	0.626227	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45352	-0.9267	10	0.09590	T	0.72	.	5.2501	0.15517	0.1268:0.4236:0.4496:0.0	.	313	Q6UXK2	ISLR2_HUMAN	K	313	ENSP00000403244:Q313K;ENSP00000355402:Q313K;ENSP00000411443:Q313K;ENSP00000411834:Q313K;ENSP00000408872:Q313K	ENSP00000355402:Q313K	Q	+	1	0	ISLR2	72213085	0.578000	0.26717	0.001000	0.08648	0.231000	0.25187	1.763000	0.38461	0.028000	0.15324	0.205000	0.17691	CAA		0.667	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851		5	11	1	0	1.23904e-05	0.000602	1.2724e-05	5	11				
STARD5	80765	broad.mit.edu	37	15	81605687	81605687	+	Silent	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr15:81605687G>C	ENST00000302824.6	-	6	577	c.552C>G	c.(550-552)ctC>ctG	p.L184L		NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	184	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						CGTTCTGTGGGAGGTAACCGC	0.517																																							uc002bgm.2		NA																	0				ovary(1)	1						c.(550-552)CTC>CTG		StAR-related lipid transfer protein 5							198.0	167.0	177.0					15																	81605687		2203	4300	6503	SO:0001819	synonymous_variant	80765				C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding	g.chr15:81605687G>C	AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.552C>G	15.37:g.81605687G>C			Somatic				STARD5_uc002bgn.2_Silent_p.L77L	p.L184L	NM_181900	NP_871629	WXS	Illumina HiSeq	Unspecified	Q9NSY2	STAR5_HUMAN			6	636	-			184			START.		P59094	Silent	SNP	ENST00000302824.6	37	c.552C>G	CCDS10318.1																																																																																				0.517	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303950.2			28	72	0	0	0	0.010818	0	28	72				
RHBDL1	9028	broad.mit.edu	37	16	728016	728016	+	Silent	SNP	C	C	T	rs558802175	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:728016C>T	ENST00000219551.2	+	7	1308	c.1281C>T	c.(1279-1281)taC>taT	p.Y427Y	LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000565677.1_5'Flank|STUB1_ENST00000219548.4_5'Flank|LA16c-313D11.9_ENST00000567091.1_RNA|RHBDL1_ENST00000352681.3_Silent_p.Y362Y			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	427					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				TCTTCGCCTACGACCTGCTGG	0.701													C|||	2	0.000399361	0.0	0.0	5008	,	,		11330	0.0		0.0	False		,,,				2504	0.002						uc002cis.1		NA																	0					0						c.(1279-1281)TAC>TAT		rhomboid protease 1							47.0	41.0	43.0					16																	728016		2196	4297	6493	SO:0001819	synonymous_variant	9028				proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity	g.chr16:728016C>T	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.1281C>T	16.37:g.728016C>T			Somatic				RHBDL1_uc002cir.1_Silent_p.Y362Y|RHBDL1_uc010uun.1_3'UTR|STUB1_uc002cit.2_5'Flank|STUB1_uc002ciu.2_5'Flank|STUB1_uc010bqz.2_5'Flank|STUB1_uc002civ.2_5'Flank	p.Y427Y	NM_003961	NP_003952	WXS	Illumina HiSeq	Unspecified	O75783	RHBL1_HUMAN			7	1308	+		Hepatocellular(780;0.0218)	427					A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Silent	SNP	ENST00000219551.2	37	c.1281C>T	CCDS10418.1																																																																																				0.701	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961		4	14	0	0	0	0.009096	0	4	14				
PTX4	390667	broad.mit.edu	37	16	1536565	1536565	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:1536565G>C	ENST00000447419.2	-	3	837	c.812C>G	c.(811-813)cCc>cGc	p.P271R	PTX4_ENST00000293922.1_Missense_Mutation_p.P266R|PTX4_ENST00000440447.2_Missense_Mutation_p.P123A			Q96A99	PTX4_HUMAN	pentraxin 4, long	271	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						AACGAGGGTGGGGCCCACGCC	0.632																																							uc010uvf.1		NA																	0					0						c.(796-798)CCC>CGC		neuronal pentraxin II-like							38.0	38.0	38.0					16																	1536565		2199	4300	6499	SO:0001583	missense	390667					extracellular region	metal ion binding	g.chr16:1536565G>C		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.812C>G	16.37:g.1536565G>C	ENSP00000445277:p.Pro271Arg		Somatic					p.P266R	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			3	797	-			271			Pentaxin.			Missense_Mutation	SNP	ENST00000447419.2	37	c.797C>G		.	.	.	.	.	.	.	.	.	.	G	11.05	1.523795	0.27299	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.62941	-0.01;-0.01	5.58	1.4	0.22301	.	0.284712	0.34435	N	0.003975	T	0.68723	0.3032	M	0.70595	2.14	0.09310	N	1	D	0.69078	0.997	P	0.62382	0.901	T	0.57866	-0.7737	10	0.34782	T	0.22	.	5.9079	0.19010	0.2239:0.0:0.6424:0.1337	.	266	Q96A99-2	.	R	271;266	ENSP00000445277:P271R;ENSP00000293922:P266R	ENSP00000293922:P266R	P	-	2	0	PTX4	1476566	0.308000	0.24509	0.018000	0.16275	0.000000	0.00434	2.696000	0.47052	0.049000	0.15920	-0.895000	0.02911	CCC		0.632	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		17	12	0	0	0	0.004007	0	17	12				
C16orf89	146556	broad.mit.edu	37	16	5110370	5110370	+	Silent	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:5110370G>C	ENST00000315997.5	-	3	627	c.426C>G	c.(424-426)tcC>tcG	p.S142S	C16orf89_ENST00000472572.3_Silent_p.S142S|C16orf89_ENST00000474471.3_Silent_p.S142S|C16orf89_ENST00000350219.4_Silent_p.S180S|C16orf89_ENST00000422873.1_Silent_p.S180S|ALG1_ENST00000588623.1_Intron	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	142						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						GGTACACCAAGGAGGCATCAG	0.617																																							uc010bud.2		NA																	0				ovary(1)|skin(1)	2						c.(538-540)TCC>TCG		hypothetical protein LOC146556 isoform 1							47.0	54.0	52.0					16																	5110370		2003	4175	6178	SO:0001819	synonymous_variant	146556					extracellular region		g.chr16:5110370G>C		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.426C>G	16.37:g.5110370G>C			Somatic				ALG1_uc002cyj.2_Intron|C16orf89_uc002cyk.3_Silent_p.S180S	p.S180S	NM_152459	NP_689672	WXS	Illumina HiSeq	Unspecified	Q6UX73	CP089_HUMAN			3	628	-			142					B4DUM5|Q8N2I3|Q8N4T1	Silent	SNP	ENST00000315997.5	37	c.540C>G	CCDS42116.2																																																																																				0.617	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	NM_152459		10	35	0	0	0	0.006214	0	10	35				
XYLT1	64131	broad.mit.edu	37	16	17294451	17294451	+	Missense_Mutation	SNP	G	G	T	rs139070566		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:17294451G>T	ENST00000261381.6	-	4	1058	c.974C>A	c.(973-975)cCg>cAg	p.P325Q		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	325			P -> R (in dbSNP:rs28709752).		cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GATTCTGACCGGGTTGGCTGG	0.552																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(973-975)CCG>CAG		xylosyltransferase I							256.0	214.0	228.0					16																	17294451		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17294451G>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.974C>A	16.37:g.17294451G>T	ENSP00000261381:p.Pro325Gln		Somatic					p.P325Q	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			4	1059	-			325			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.974C>A	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637977	0.87760	.	.	ENSG00000103489	ENST00000261381	T	0.06218	3.33	5.33	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.26195	0.0639	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03148	-1.1067	10	0.87932	D	0	-21.2774	15.261	0.73621	0.0:0.1405:0.8595:0.0	.	325	Q86Y38	XYLT1_HUMAN	Q	325	ENSP00000261381:P325Q	ENSP00000261381:P325Q	P	-	2	0	XYLT1	17201952	1.000000	0.71417	0.942000	0.38095	0.966000	0.64601	7.725000	0.84808	1.242000	0.43836	0.655000	0.94253	CCG		0.552	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		31	81	1	0	1.61788e-16	0.012213	2.00918e-16	31	81				
GP2	2813	broad.mit.edu	37	16	20331704	20331704	+	Silent	SNP	C	C	T	rs368403835		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:20331704C>T	ENST00000381362.4	-	6	823	c.747G>A	c.(745-747)ggG>ggA	p.G249G	GP2_ENST00000381360.5_Silent_p.G102G|GP2_ENST00000573897.1_5'UTR|GP2_ENST00000302555.5_Silent_p.G246G|GP2_ENST00000341642.5_Silent_p.G99G	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	249	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGACCTCCTCCCCCAAACCCA	0.572																																							uc002dgv.2		NA																	0				ovary(3)|skin(1)	4						c.(745-747)GGG>GGA		zymogen granule membrane glycoprotein 2 isoform		C	,,,	0,4406		0,0,2203	103.0	87.0	92.0		747,306,297,738	2.3	0.0	16		92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GP2	NM_001007240.1,NM_001007241.1,NM_001007242.1,NM_001502.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	249/538,102/391,99/388,246/535	20331704	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20331704C>T	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.747G>A	16.37:g.20331704C>T			Somatic				GP2_uc002dgw.2_Silent_p.G246G|GP2_uc002dgx.2_Silent_p.G102G|GP2_uc002dgy.2_Silent_p.G99G	p.G249G	NM_001007240	NP_001007241	WXS	Illumina HiSeq	Unspecified	P55259	GP2_HUMAN			6	830	-			249			ZP.		A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	c.747G>A	CCDS42128.1																																																																																				0.572	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		31	23	0	0	0	0.010818	0	31	23				
APOBR	55911	broad.mit.edu	37	16	28507282	28507282	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:28507282G>T	ENST00000431282.1	+	2	930	c.920G>T	c.(919-921)gGg>gTg	p.G307V	APOBR_ENST00000328423.5_Missense_Mutation_p.G307V|CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.G307V|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	307	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)	p.G307V(1)|p.G307M(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						ATCTCAGGCGGGGAGGAGGCT	0.652																																							uc002dqb.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(919-921)GGG>GTG		apolipoprotein B48 receptor							23.0	24.0	24.0					16																	28507282		1926	4116	6042	SO:0001583	missense	55911				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle		g.chr16:28507282G>T	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.920G>T	16.37:g.28507282G>T	ENSP00000416094:p.Gly307Val		Somatic				uc010vct.1_Intron|APOB48R_uc010byg.1_5'UTR	p.G307V	NM_018690	NP_061160	WXS	Illumina HiSeq	Unspecified	Q0VD83	APOBR_HUMAN			2	930	+			307			Glu-rich.		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37	c.920G>T		.	.	.	.	.	.	.	.	.	.	G	5.730	0.319203	0.10845	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.58060	0.36;0.36	3.77	-3.26	0.05064	.	.	.	.	.	T	0.24890	0.0604	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.13045	-1.0524	9	0.32370	T	0.25	.	4.2346	0.10620	0.4694:0.0:0.3743:0.1563	.	298	Q9NS13	.	V	307	ENSP00000327669:G307V;ENSP00000416094:G307V	ENSP00000327669:G307V	G	+	2	0	APOBR	28414783	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.017000	0.03630	-0.405000	0.07599	-1.328000	0.01277	GGG		0.652	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804		7	7	1	0	3.09899e-07	0.004482	3.25759e-07	7	7				
ABCC11	85320	broad.mit.edu	37	16	48261771	48261771	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:48261771T>A	ENST00000394747.1	-	3	690	c.341A>T	c.(340-342)gAg>gTg	p.E114V	ABCC11_ENST00000394748.1_Missense_Mutation_p.E114V|ABCC11_ENST00000356608.2_Missense_Mutation_p.E114V|ABCC11_ENST00000537808.1_Missense_Mutation_p.E114V|ABCC11_ENST00000353782.5_Missense_Mutation_p.E114V	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	114					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GATGGTGTTCTCATCTAAGCG	0.537																																							uc002eff.1		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(340-342)GAG>GTG		ATP-binding cassette, sub-family C, member 11							152.0	137.0	142.0					16																	48261771		2200	4300	6500	SO:0001583	missense	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48261771T>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.341A>T	16.37:g.48261771T>A	ENSP00000378230:p.Glu114Val		Somatic				ABCC11_uc002efg.1_Missense_Mutation_p.E114V|ABCC11_uc002efh.1_Missense_Mutation_p.E114V|ABCC11_uc010vgl.1_Missense_Mutation_p.E114V	p.E114V	NM_033151	NP_149163	WXS	Illumina HiSeq	Unspecified	Q96J66	ABCCB_HUMAN			3	691	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	114			Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	c.341A>T	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	T	3.226	-0.158441	0.06544	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	5.53	1.87	0.25490	.	0.644973	0.14459	N	0.318297	D	0.87293	0.6141	L	0.49126	1.545	0.09310	N	0.999999	P;B	0.42518	0.782;0.431	B;B	0.43478	0.421;0.354	T	0.76383	-0.2979	10	0.29301	T	0.29	-21.3192	1.8756	0.03217	0.1698:0.0905:0.1645:0.5753	.	114;114	Q96J66-2;Q96J66	.;ABCCB_HUMAN	V	114	ENSP00000311326:E114V;ENSP00000349017:E114V;ENSP00000378231:E114V;ENSP00000378230:E114V;ENSP00000438530:E114V	ENSP00000311326:E114V	E	-	2	0	ABCC11	46819272	0.001000	0.12720	0.037000	0.18230	0.116000	0.19942	0.089000	0.15002	0.036000	0.15547	0.533000	0.62120	GAG		0.537	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		31	111	0	0	0	0.013726	0	31	111				
SALL1	6299	broad.mit.edu	37	16	51176048	51176048	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:51176048C>T	ENST00000251020.4	-	2	118	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000440970.1_5'UTR	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	29					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGACCCTTTTCTGTGTCTCCT	0.458																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(85-87)GAA>AAA		sal-like 1 isoform a							77.0	79.0	78.0					16																	51176048		2196	4296	6492	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51176048C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.85G>A	16.37:g.51176048C>T	ENSP00000251020:p.Glu29Lys		Somatic				SALL1_uc010vgr.1_5'UTR|SALL1_uc010cbv.2_Intron	p.E29K	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	116	-		all_cancers(37;0.0322)	29					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.85G>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449311	0.43531	.	.	ENSG00000103449	ENST00000251020;ENST00000457559	T	0.09255	3.0	5.6	5.6	0.85130	.	0.044914	0.85682	D	0.000000	T	0.12135	0.0295	L	0.58101	1.795	0.80722	D	1	B	0.31680	0.335	B	0.25140	0.058	T	0.09378	-1.0677	10	0.16896	T	0.51	.	15.9322	0.79672	0.0:0.865:0.135:0.0	.	29	Q9NSC2	SALL1_HUMAN	K	29	ENSP00000251020:E29K	ENSP00000251020:E29K	E	-	1	0	SALL1	49733549	1.000000	0.71417	0.953000	0.39169	0.577000	0.36160	6.032000	0.70918	2.615000	0.88500	0.650000	0.86243	GAA		0.458	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		37	95	0	0	0	0.00623	0	37	95				
CENPT	80152	broad.mit.edu	37	16	67863987	67863987	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:67863987A>G	ENST00000562787.1	-	12	1415	c.867T>C	c.(865-867)ccT>ccC	p.P289P	CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Silent_p.P289P|CENPT_ENST00000219172.3_Silent_p.P289P|CENPT_ENST00000440851.2_Silent_p.P289P	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	289	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CTGGTTTCCCAGGGCCTGAGT	0.582																																							uc002eun.3		NA																	0					0						c.(865-867)CCT>CCC		centromere protein T							41.0	42.0	42.0					16																	67863987		2024	4199	6223	SO:0001819	synonymous_variant	80152				mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus	DNA binding	g.chr16:67863987A>G	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.867T>C	16.37:g.67863987A>G			Somatic				CENPT_uc002eum.3_Silent_p.P289P|CENPT_uc010vkc.1_Silent_p.P47P|CENPT_uc010vkd.1_Silent_p.P42P|CENPT_uc010vke.1_3'UTR	p.P289P	NM_025082	NP_079358	WXS	Illumina HiSeq	Unspecified	Q96BT3	CENPT_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)	12	1416	-		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)	289					Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	37	c.867T>C	CCDS42182.1																																																																																				0.582	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082		3	41	0	0	0	0.004672	0	3	41				
HYDIN	54768	broad.mit.edu	37	16	70954947	70954947	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr16:70954947G>T	ENST00000393567.2	-	46	7482	c.7332C>A	c.(7330-7332)gaC>gaA	p.D2444E		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2444					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCTTTGAGTTGTCCCCTTCAC	0.498																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(7327-7329)GAC>GAA		hydrocephalus inducing isoform a							123.0	112.0	115.0					16																	70954947		1881	4110	5991	SO:0001583	missense	54768							g.chr16:70954947G>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7332C>A	16.37:g.70954947G>T	ENSP00000377197:p.Asp2444Glu		Somatic					p.D2443E	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			46	7457	-		Ovarian(137;0.0654)	2444					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.7329C>A	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	3.478	-0.106592	0.06924	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00873	5.59	5.89	-0.223	0.13118	.	0.460097	0.15558	U	0.256096	T	0.00666	0.0022	L	0.35854	1.095	0.30491	N	0.771394	B	0.19583	0.037	B	0.19148	0.024	T	0.42799	-0.9430	10	0.07325	T	0.83	.	0.9688	0.01411	0.1713:0.2476:0.2019:0.3793	.	2443	F8WD23	.	E	2444;2443	ENSP00000377197:D2444E	ENSP00000313052:D2443E	D	-	3	2	HYDIN	69512448	0.002000	0.14202	0.022000	0.16811	0.008000	0.06430	-0.210000	0.09345	0.096000	0.17463	-0.233000	0.12211	GAC		0.498	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			52	35	1	0	1.48005e-37	0.01441	2.14768e-37	52	35				
RPA1	6117	broad.mit.edu	37	17	1783839	1783839	+	Silent	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:1783839T>C	ENST00000254719.5	+	12	1205	c.1095T>C	c.(1093-1095)gcT>gcC	p.A365A		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	365					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						TTTTACAGGCTGATAAATTTG	0.428								Nucleotide excision repair (NER)																															uc002fto.2		NA																	0					0						c.(1093-1095)GCT>GCC	NER	replication protein A1							81.0	81.0	81.0					17																	1783839		2203	4300	6503	SO:0001819	synonymous_variant	6117				cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding	g.chr17:1783839T>C	M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1095T>C	17.37:g.1783839T>C			Somatic					p.A365A	NM_002945	NP_002936	WXS	Illumina HiSeq	Unspecified	P27694	RFA1_HUMAN			12	1210	+			365					A8K0Y9|Q59ES9	Silent	SNP	ENST00000254719.5	37	c.1095T>C	CCDS11014.1																																																																																				0.428	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945		3	68	0	0	0	0.009096	0	3	68				
PITPNM3	83394	broad.mit.edu	37	17	6380393	6380393	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:6380393G>A	ENST00000262483.8	-	9	1128	c.1041C>T	c.(1039-1041)acC>acT	p.T347T	PITPNM3_ENST00000421306.3_Silent_p.T311T	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	347					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CGCAGTCATAGGTGGAGGAGT	0.587																																							uc002gdd.3		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1039-1041)ACC>ACT		PITPNM family member 3 isoform 1							116.0	91.0	99.0					17																	6380393		2203	4300	6503	SO:0001819	synonymous_variant	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6380393G>A	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1041C>T	17.37:g.6380393G>A			Somatic				PITPNM3_uc010cln.2_Silent_p.T311T|PITPNM3_uc002gdc.3_5'UTR	p.T347T	NM_031220	NP_112497	WXS	Illumina HiSeq	Unspecified	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	9	1192	-			347					A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	c.1041C>T	CCDS11076.1																																																																																				0.587	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		26	23	0	0	0	0.00632	0	26	23				
C17orf74	201243	broad.mit.edu	37	17	7329009	7329009	+	Start_Codon_SNP	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:7329009T>C	ENST00000333870.3	+	1	76	c.2T>C	c.(1-3)aTg>aCg	p.M1T	RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_Start_Codon_SNP_p.M1T	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	1						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				CCCCCCTCCATGGAAAACCAG	0.602																																							uc002ggw.2		NA																	0					0						c.(1-3)ATG>ACG		hypothetical protein LOC201243							109.0	103.0	105.0					17																	7329009		1891	4096	5987	SO:0001582	initiator_codon_variant	201243					integral to membrane		g.chr17:7329009T>C	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.2T>C	17.37:g.7329009T>C	ENSP00000328061:p.Met1Thr		Somatic				FGF11_uc010vtw.1_Intron	p.M1T	NM_175734	NP_783861	WXS	Illumina HiSeq	Unspecified	Q0P670	CQ074_HUMAN			1	75	+		Prostate(122;0.157)	1						Missense_Mutation	SNP	ENST00000333870.3	37	c.2T>C	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.400214	0.42613	.	.	ENSG00000184560	ENST00000333870	T	0.50001	0.76	3.96	2.88	0.33553	.	0.000000	0.38897	U	0.001524	T	0.35278	0.0926	.	.	.	0.80722	D	1	B	0.27882	0.192	B	0.24269	0.052	T	0.22277	-1.0221	9	0.87932	D	0	-2.2882	6.1311	0.20204	0.0:0.1173:0.0:0.8827	.	1	Q0P670	CQ074_HUMAN	T	1	ENSP00000328061:M1T	ENSP00000328061:M1T	M	+	2	0	C17orf74	7269733	1.000000	0.71417	0.995000	0.50966	0.854000	0.48673	3.315000	0.51951	0.687000	0.31509	0.397000	0.26171	ATG		0.602	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734	Missense_Mutation	56	68	0	0	0	0.01441	0	56	68				
TOM1L2	146691	broad.mit.edu	37	17	17801988	17801988	+	Splice_Site	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:17801988C>T	ENST00000379504.3	-	3	221	c.138G>A	c.(136-138)ggG>ggA	p.G46G	TOM1L2_ENST00000581396.1_Splice_Site_p.G46G|TOM1L2_ENST00000535933.1_Splice_Site_p.G46G|TOM1L2_ENST00000542206.1_Splice_Site_p.G46G|TOM1L2_ENST00000395739.4_Splice_Site_p.G46G|TOM1L2_ENST00000318094.10_Splice_Site_p.G46G|TOM1L2_ENST00000540946.1_Splice_Site_p.G46G	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	46	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					CATCCTTTGGCCTGGaaaaaa	0.453																																					Melanoma(192;2505 2909 14455 25269)	Melanoma(192;2505 2909 14455 25269)	uc002grz.3		NA																	0					0						c.(136-138)GGG>GGA		target of myb1-like 2 isoform 3							104.0	85.0	91.0					17																	17801988		2203	4300	6503	SO:0001630	splice_region_variant	146691				intracellular protein transport	intracellular		g.chr17:17801988C>T	AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.138-1G>A	17.37:g.17801988C>T			Somatic				TOM1L2_uc002gry.3_Silent_p.G46G|TOM1L2_uc010vwy.1_Silent_p.G46G|TOM1L2_uc010cpr.2_Silent_p.G46G|TOM1L2_uc010vwz.1_Silent_p.G46G|TOM1L2_uc010vxa.1_Silent_p.G46G|TOM1L2_uc010vxb.1_Silent_p.G46G	p.G46G	NM_001082968	NP_001076437	WXS	Illumina HiSeq	Unspecified	Q6ZVM7	TM1L2_HUMAN			3	295	-	all_neural(463;0.228)		46			VHS.		B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Silent	SNP	ENST00000379504.3	37	c.138G>A	CCDS42270.1																																																																																				0.453	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131928.1		Silent	18	63	0	0	0	0.00499	0	18	63				
MFAP4	4239	broad.mit.edu	37	17	19287986	19287986	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:19287986G>A	ENST00000299610.4	-	6	641	c.557C>T	c.(556-558)tCt>tTt	p.S186F	MFAP4_ENST00000395592.2_Missense_Mutation_p.S210F|MFAP4_ENST00000497081.2_Missense_Mutation_p.S211F|MFAP4_ENST00000574313.2_5'Flank	NM_002404.2	NP_002395.1	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4	186	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cellular response to UV-B (GO:0071493)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|regulation of collagen metabolic process (GO:0010712)|UV protection (GO:0009650)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)				large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	10	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GTCGAAGGTAGAGAACTTCTG	0.617																																							uc002gvt.2		NA																	0					0						c.(556-558)TCT>TTT		microfibrillar-associated protein 4 precursor							78.0	85.0	82.0					17																	19287986		2203	4300	6503	SO:0001583	missense	4239				cell adhesion|signal transduction	microfibril	receptor binding	g.chr17:19287986G>A	L38486	CCDS11208.1, CCDS56023.1	17p11.2	2013-02-06			ENSG00000166482	ENSG00000166482		"""Fibrinogen C domain containing"""	7035	protein-coding gene	gene with protein product	"""microfibril-associated glycoprotein 4"""	600596				7633408	Standard	NM_001198695		Approved		uc002gvs.3	P55083	OTTHUMG00000059585	ENST00000299610.4:c.557C>T	17.37:g.19287986G>A	ENSP00000299610:p.Ser186Phe		Somatic				uc010vyt.1_5'Flank|MFAP4_uc002gvr.2_RNA|MFAP4_uc002gvs.2_Missense_Mutation_p.S210F	p.S186F	NM_002404	NP_002395	WXS	Illumina HiSeq	Unspecified	P55083	MFAP4_HUMAN			6	582	-	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)		186			Fibrinogen C-terminal.		A8KAJ1|A8MVM2|B4E317|Q6P680	Missense_Mutation	SNP	ENST00000299610.4	37	c.557C>T	CCDS11208.1	.	.	.	.	.	.	.	.	.	.	g	18.62	3.662370	0.67700	.	.	ENSG00000166482	ENST00000395592;ENST00000299610	D;D	0.82893	-1.66;-1.66	3.94	3.94	0.45596	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.56097	D	0.000030	D	0.92919	0.7747	H	0.94808	3.585	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.94623	0.7815	10	0.87932	D	0	.	13.8938	0.63757	0.0:0.0:1.0:0.0	.	186;210	P55083;A8MVM2	MFAP4_HUMAN;.	F	210;186	ENSP00000378957:S210F;ENSP00000299610:S186F	ENSP00000299610:S186F	S	-	2	0	MFAP4	19228579	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.040000	0.70980	2.202000	0.70862	0.550000	0.68814	TCT		0.617	MFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132493.2	NM_002404		25	123	0	0	0	0.005443	0	25	123				
KRT33B	3884	broad.mit.edu	37	17	39521111	39521111	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:39521111A>G	ENST00000251646.3	-	6	1066	c.1017T>C	c.(1015-1017)taT>taC	p.Y339Y		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	339	Coil 2.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				GCAGCACCTGATACTCCTGGT	0.637																																							uc002hwl.2		NA																	0					0						c.(1015-1017)TAT>TAC		type I hair keratin 3B							62.0	71.0	68.0					17																	39521111		2189	4298	6487	SO:0001819	synonymous_variant	3884					intermediate filament	protein binding|structural molecule activity	g.chr17:39521111A>G	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.1017T>C	17.37:g.39521111A>G			Somatic					p.Y339Y	NM_002279	NP_002270	WXS	Illumina HiSeq	Unspecified	Q14525	KT33B_HUMAN			6	1062	-		Breast(137;0.000496)	339			Coil 2.|Rod.		O76010	Silent	SNP	ENST00000251646.3	37	c.1017T>C	CCDS11389.1																																																																																				0.637	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279		54	71	0	0	0	0.01441	0	54	71				
HOXB1	3211	broad.mit.edu	37	17	46608140	46608140	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:46608140C>A	ENST00000239174.6	-	1	219	c.127G>T	c.(127-129)Gca>Tca	p.A43S	HOXB1_ENST00000577092.1_Missense_Mutation_p.A43S	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	43					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCCTCGCTTGCATAGCTGTCA	0.667																																							uc002ink.1		NA																	0				ovary(1)	1						c.(127-129)GCA>TCA		homeobox B1							45.0	53.0	50.0					17																	46608140		2203	4300	6503	SO:0001583	missense	3211					nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity	g.chr17:46608140C>A		CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.127G>T	17.37:g.46608140C>A	ENSP00000355140:p.Ala43Ser		Somatic					p.A43S	NM_002144	NP_002135	WXS	Illumina HiSeq	Unspecified	P14653	HXB1_HUMAN			1	133	-			43					Q4VB03	Missense_Mutation	SNP	ENST00000239174.6	37	c.127G>T	CCDS32675.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.623883	0.28889	.	.	ENSG00000120094	ENST00000239174	D	0.88664	-2.41	5.09	1.92	0.25849	.	0.318398	0.22713	N	0.056542	T	0.79969	0.4538	L	0.43923	1.385	0.22656	N	0.998883	B	0.24483	0.104	B	0.19148	0.024	T	0.61402	-0.7070	10	0.16420	T	0.52	.	5.4938	0.16791	0.0:0.415:0.3419:0.2431	.	43	P14653	HXB1_HUMAN	S	43	ENSP00000355140:A43S	ENSP00000355140:A43S	A	-	1	0	HOXB1	43963139	0.008000	0.16893	0.998000	0.56505	0.928000	0.56348	0.202000	0.17295	0.288000	0.22398	0.551000	0.68910	GCA		0.667	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358383.3			40	66	1	0	2.95478e-19	0.00874	3.88633e-19	40	66				
CUEDC1	404093	broad.mit.edu	37	17	55951069	55951069	+	Silent	SNP	C	C	T	rs200050222		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:55951069C>T	ENST00000577830.1	-	4	887	c.474G>A	c.(472-474)gcG>gcA	p.A158A	CUEDC1_ENST00000577840.1_Silent_p.A21A|CUEDC1_ENST00000360238.2_Silent_p.A158A|CUEDC1_ENST00000407144.2_Silent_p.A158A	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	158										endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						CAGAGCCCAGCGCGTCGATAC	0.617																																							uc002ivd.1		NA																	0				skin(2)	2						c.(472-474)GCG>GCA		CUE domain-containing 1							83.0	72.0	76.0					17																	55951069		2203	4300	6503	SO:0001819	synonymous_variant	404093							g.chr17:55951069C>T	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.474G>A	17.37:g.55951069C>T			Somatic				CUEDC1_uc002ive.1_Silent_p.A158A	p.A158A	NM_017949	NP_060419	WXS	Illumina HiSeq	Unspecified	Q9NWM3	CUED1_HUMAN			4	1193	-			158					D3DTZ2|Q9NWD0	Silent	SNP	ENST00000577830.1	37	c.474G>A	CCDS11599.1																																																																																				0.617	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949		26	39	0	0	0	0.004656	0	26	39				
BAHCC1	57597	broad.mit.edu	37	17	79428098	79428098	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:79428098G>T	ENST00000307745.7	+	30	6409	c.6409G>T	c.(6409-6411)Gcc>Tcc	p.A2137S	RP11-1055B8.8_ENST00000572590.1_RNA																							GGCCCGCGAGGCCCTGTTCCC	0.687																																							uc002kaf.2		NA																	0				ovary(1)	1						c.(6409-6411)GCC>TCC		BAH domain and coiled-coil containing 1							9.0	14.0	13.0					17																	79428098		2075	4196	6271	SO:0001583	missense	57597						DNA binding	g.chr17:79428098G>T																												ENST00000307745.7:c.6409G>T	17.37:g.79428098G>T	ENSP00000303486:p.Ala2137Ser		Somatic				BAHCC1_uc002kae.2_Missense_Mutation_p.A1367S	p.A2137S	NM_001080519	NP_001073988	WXS	Illumina HiSeq	Unspecified	Q9P281	BAHC1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)		24	6409	+	all_neural(118;0.0804)|Melanoma(429;0.242)		2137						Missense_Mutation	SNP	ENST00000307745.7	37	c.6409G>T		.	.	.	.	.	.	.	.	.	.	G	5.688	0.311539	0.10789	.	.	ENSG00000171282	ENST00000307745	T	0.11604	2.76	5.47	-0.519	0.11939	.	0.298608	0.23893	N	0.043523	T	0.06917	0.0176	L	0.41710	1.295	0.09310	N	1	B;B	0.24823	0.068;0.112	B;B	0.20955	0.014;0.032	T	0.31833	-0.9929	10	0.26408	T	0.33	.	5.4791	0.16713	0.3336:0.1378:0.5286:0.0	.	2137;2137	Q9P281;F8WBW8	BAHC1_HUMAN;.	S	2137	ENSP00000303486:A2137S	ENSP00000303486:A2137S	A	+	1	0	AC110285.1	77042693	0.381000	0.25140	0.151000	0.22473	0.005000	0.04900	0.909000	0.28558	0.310000	0.22990	0.555000	0.69702	GCC		0.687	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				7	11	1	0	0.00198382	0.001984	0.00199879	7	11				
LAMA1	284217	broad.mit.edu	37	18	7038880	7038880	+	Silent	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr18:7038880G>T	ENST00000389658.3	-	11	1585	c.1492C>A	c.(1492-1494)Cgg>Agg	p.R498R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	498	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAGCAGCCCCGGGGGTTTTTT	0.532																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(1492-1494)CGG>AGG		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						79.0	94.0	89.0					18																	7038880		2203	4300	6503	SO:0001819	synonymous_variant	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7038880G>T	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1492C>A	18.37:g.7038880G>T			Somatic				LAMA1_uc010wzj.1_5'UTR	p.R498R	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			11	1586	-		Colorectal(10;0.172)	498			Laminin EGF-like 4.			Silent	SNP	ENST00000389658.3	37	c.1492C>A	CCDS32787.1																																																																																				0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		43	91	1	0	7.53189e-24	0.007835	1.02603e-23	43	91				
ROCK1	6093	broad.mit.edu	37	18	18549153	18549153	+	Missense_Mutation	SNP	C	C	T	rs377651671		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr18:18549153C>T	ENST00000399799.2	-	24	3777	c.2837G>A	c.(2836-2838)aGc>aAc	p.S946N		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	946	Glu-rich.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GGTTAGCATGCTGTTTGCTTC	0.343																																							uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(2836-2838)AGC>AAC		Rho-associated, coiled-coil containing protein		C	ASN/SER	0,4406		0,0,2203	151.0	142.0	145.0		2837	3.6	1.0	18		145	2,8596	2.2+/-6.3	0,2,4297	no	missense	ROCK1	NM_005406.2	46	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	benign	946/1355	18549153	2,13002	2203	4299	6502	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18549153C>T		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.2837G>A	18.37:g.18549153C>T	ENSP00000382697:p.Ser946Asn		Somatic					p.S946N	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			24	3778	-	Melanoma(1;0.165)		946			Glu-rich.		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.2837G>A	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724881	0.30593	0.0	2.33E-4	ENSG00000067900	ENST00000399799	T	0.14266	2.52	5.45	3.57	0.40892	.	0.231552	0.51477	N	0.000093	T	0.08223	0.0205	L	0.27053	0.805	0.30046	N	0.812185	B	0.02656	0.0	B	0.04013	0.001	T	0.20940	-1.0260	10	0.14252	T	0.57	.	8.1591	0.31187	0.0:0.6905:0.1236:0.1859	.	946	Q13464	ROCK1_HUMAN	N	946	ENSP00000382697:S946N	ENSP00000382697:S946N	S	-	2	0	ROCK1	16803151	0.446000	0.25665	0.979000	0.43373	0.885000	0.51271	0.217000	0.17603	1.510000	0.48803	0.655000	0.94253	AGC		0.343	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		20	44	0	0	0	0.010504	0	20	44				
CCDC178	374864	broad.mit.edu	37	18	30926187	30926187	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr18:30926187C>A	ENST00000383096.3	-	9	828	c.646G>T	c.(646-648)Gct>Tct	p.A216S	CCDC178_ENST00000579947.1_Missense_Mutation_p.A216S|CCDC178_ENST00000300227.8_Missense_Mutation_p.A216S|CCDC178_ENST00000406524.2_Missense_Mutation_p.A216S|CCDC178_ENST00000402325.1_Missense_Mutation_p.A216S|CCDC178_ENST00000583930.1_Missense_Mutation_p.A216S|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.A216S			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	216																	TTCTGCACAGCCAATGGGAGT	0.328																																							uc002kxn.2		NA																	0				ovary(1)	1						c.(646-648)GCT>TCT		hypothetical protein LOC374864 isoform 1							103.0	103.0	103.0					18																	30926187		2203	4300	6503	SO:0001583	missense	374864							g.chr18:30926187C>A	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.646G>T	18.37:g.30926187C>A	ENSP00000372576:p.Ala216Ser		Somatic				C18orf34_uc010xbr.1_Missense_Mutation_p.A216S|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.A216S|C18orf34_uc002kxp.2_Missense_Mutation_p.A216S	p.A216S	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			8	788	-			216					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.646G>T	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553234	0.27739	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.54071	2.14;2.14;2.12;2.15;2.12;0.59	5.59	5.59	0.84812	.	.	.	.	.	T	0.67841	0.2936	L	0.55990	1.75	0.34096	D	0.66132	D;D;D;D	0.89917	1.0;0.998;0.998;0.998	D;D;D;D	0.87578	0.998;0.986;0.986;0.986	T	0.71537	-0.4563	9	0.31617	T	0.26	-14.1672	16.5129	0.84290	0.0:1.0:0.0:0.0	.	216;216;216;216	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	S	216	ENSP00000385591:A216S;ENSP00000372576:A216S;ENSP00000300227:A216S;ENSP00000385867:A216S;ENSP00000385234:A216S;ENSP00000382130:A216S	ENSP00000300227:A216S	A	-	1	0	C18orf34	29180185	0.997000	0.39634	0.965000	0.40720	0.605000	0.37080	4.659000	0.61504	2.636000	0.89361	0.557000	0.71058	GCT		0.328	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		36	51	1	0	9.8876e-21	0.004878	1.32663e-20	36	51				
MOCOS	55034	broad.mit.edu	37	18	33800036	33800036	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr18:33800036G>A	ENST00000261326.5	+	9	1837	c.1816G>A	c.(1816-1818)Gga>Aga	p.G606R		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GTGGCCTGTAGGAAACCAAGG	0.527																																							uc002kzq.3		NA																	0				skin(1)	1						c.(1816-1818)GGA>AGA		molybdenum cofactor sulfurase	Pyridoxal Phosphate(DB00114)						137.0	122.0	127.0					18																	33800036		2203	4300	6503	SO:0001583	missense	55034				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding	g.chr18:33800036G>A	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1816G>A	18.37:g.33800036G>A	ENSP00000261326:p.Gly606Arg		Somatic					p.G606R	NM_017947	NP_060417	WXS	Illumina HiSeq	Unspecified	Q96EN8	MOCOS_HUMAN			9	1839	+			606						Missense_Mutation	SNP	ENST00000261326.5	37	c.1816G>A	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341925	0.81911	.	.	ENSG00000075643	ENST00000261326	T	0.26957	1.7	5.92	5.92	0.95590	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	L	0.52823	1.66	0.37498	D	0.916636	D	0.89917	1.0	D	0.79784	0.993	T	0.25641	-1.0126	10	0.22706	T	0.39	-14.2339	11.1292	0.48336	0.083:0.0:0.917:0.0	.	606	Q96EN8	MOCOS_HUMAN	R	606	ENSP00000261326:G606R	ENSP00000261326:G606R	G	+	1	0	MOCOS	32054034	1.000000	0.71417	0.322000	0.25334	0.987000	0.75469	7.859000	0.86982	2.804000	0.96469	0.655000	0.94253	GGA		0.527	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			59	74	0	0	0	0.01441	0	59	74				
NETO1	81832	broad.mit.edu	37	18	70526237	70526237	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr18:70526237A>C	ENST00000327305.6	-	4	950	c.293T>G	c.(292-294)tTt>tGt	p.F98C	NETO1_ENST00000397929.1_Missense_Mutation_p.F97C|NETO1_ENST00000580049.1_5'UTR|NETO1_ENST00000583169.1_Missense_Mutation_p.F98C|NETO1_ENST00000299430.2_Missense_Mutation_p.F97C	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	98	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AATATGATCAAATTTGCACTC	0.393																																							uc002lkw.2		NA																	0				ovary(2)|skin(2)	4						c.(292-294)TTT>TGT		neuropilin- and tolloid-like protein 1 isoform 3							84.0	83.0	84.0					18																	70526237		2203	4300	6503	SO:0001583	missense	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70526237A>C	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.293T>G	18.37:g.70526237A>C	ENSP00000313088:p.Phe98Cys		Somatic				NETO1_uc002lkx.1_Missense_Mutation_p.F97C|NETO1_uc002lky.1_Missense_Mutation_p.F98C|NETO1_uc002lkz.2_Missense_Mutation_p.F97C	p.F98C	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	4	577	-		Esophageal squamous(42;0.129)	98			CUB 1.|Extracellular (Potential).		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	c.293T>G	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.787744	0.90367	.	.	ENSG00000166342	ENST00000327305;ENST00000299430;ENST00000397929	T;T;T	0.17854	2.25;2.25;2.25	5.35	5.35	0.76521	CUB (5);	0.000000	0.64402	D	0.000007	T	0.44498	0.1296	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.997;0.995;0.998	T	0.46512	-0.9186	10	0.87932	D	0	-19.5178	15.6405	0.76997	1.0:0.0:0.0:0.0	.	97;97;98	Q8TDF5-1;Q8TDF5-2;Q8TDF5	.;.;NETO1_HUMAN	C	98;97;97	ENSP00000313088:F98C;ENSP00000299430:F97C;ENSP00000381024:F97C	ENSP00000299430:F97C	F	-	2	0	NETO1	68677217	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.223000	0.95203	2.159000	0.67721	0.533000	0.62120	TTT		0.393	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		23	80	0	0	0	0.012319	0	23	80				
LPPR3	79948	broad.mit.edu	37	19	813107	813107	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:813107G>A	ENST00000520876.3	-	8	1698	c.1620C>T	c.(1618-1620)atC>atT	p.I540I	LPPR3_ENST00000359894.2_Silent_p.I568I|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		540						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										TGGACATGGCGATGACCTGCA	0.731																																							uc002lpx.1		NA																	0					0						c.(1618-1620)ATC>ATT		plasticity-related protein 2							3.0	5.0	4.0					19																	813107		1659	3690	5349	SO:0001819	synonymous_variant	79948					integral to membrane	phosphatidate phosphatase activity	g.chr19:813107G>A																												ENST00000520876.3:c.1620C>T	19.37:g.813107G>A			Somatic				LPPR3_uc010dru.1_Silent_p.I452I|LPPR3_uc002lpw.1_Silent_p.I568I|LPPR3_uc002lpy.1_Silent_p.I321I|hsa-mir-3187|MI0014231_5'Flank	p.I540I	NM_024888	NP_079164	WXS	Illumina HiSeq	Unspecified	Q6T4P5	LPPR3_HUMAN			8	1684	-			540					Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	ENST00000520876.3	37	c.1620C>T	CCDS58636.1																																																																																				0.731	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3			5	4	0	0	0	0.001168	0	5	4				
FSD1	79187	broad.mit.edu	37	19	4312015	4312015	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:4312015G>T	ENST00000221856.6	+	7	814	c.667G>T	c.(667-669)Gag>Tag	p.E223*	FSD1_ENST00000598010.1_3'UTR|FSD1_ENST00000597590.1_Nonsense_Mutation_p.E223*	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	223	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGGTCATCGAGGGCATCCG	0.637																																							uc002lzy.2		NA																	0				skin(1)	1						c.(667-669)GAG>TAG		fibronectin type III and SPRY domain containing							58.0	40.0	46.0					19																	4312015		2203	4300	6503	SO:0001587	stop_gained	79187				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus		g.chr19:4312015G>T	AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.667G>T	19.37:g.4312015G>T	ENSP00000221856:p.Glu223*		Somatic				FSD1_uc002lzz.2_Nonsense_Mutation_p.E223*|FSD1_uc002maa.2_Nonsense_Mutation_p.E36*	p.E223*	NM_024333	NP_077309	WXS	Illumina HiSeq	Unspecified	Q9BTV5	FSD1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)	7	820	+			223			Fibronectin type-III.		B2RDT0|Q9BXN0|Q9HAG4	Nonsense_Mutation	SNP	ENST00000221856.6	37	c.667G>T	CCDS12127.1	.	.	.	.	.	.	.	.	.	.	G	39	7.729059	0.98456	.	.	ENSG00000105255	ENST00000221856	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	17.4334	0.87545	0.0:0.0:1.0:0.0	.	.	.	.	X	223	.	ENSP00000221856:E223X	E	+	1	0	FSD1	4263015	1.000000	0.71417	0.958000	0.39756	0.908000	0.53690	9.387000	0.97232	2.720000	0.93068	0.655000	0.94253	GAG		0.637	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333		10	2	1	0	9.70103e-10	0.008291	1.08831e-09	10	2				
CHAF1A	10036	broad.mit.edu	37	19	4428734	4428734	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:4428734G>A	ENST00000301280.5	+	8	1552	c.1451G>A	c.(1450-1452)cGg>cAg	p.R484Q	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	484					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCGGCGTCGGACCGCTTTC	0.597								Chromatin Structure																															uc002mal.2		NA																	0				ovary(1)|skin(1)	2						c.(1450-1452)CGG>CAG	Chromatin_Structure	chromatin assembly factor 1, subunit A (p150)							60.0	64.0	63.0					19																	4428734		2203	4300	6503	SO:0001583	missense	10036				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding	g.chr19:4428734G>A	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1451G>A	19.37:g.4428734G>A	ENSP00000301280:p.Arg484Gln		Somatic					p.R484Q	NM_005483	NP_005474	WXS	Illumina HiSeq	Unspecified	Q13111	CAF1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)	8	1551	+		Hepatocellular(1079;0.137)	484					Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	c.1451G>A	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281377	0.80692	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.20200	2.09	5.43	4.39	0.52855	.	.	.	.	.	T	0.43986	0.1272	M	0.68952	2.095	0.52099	D	0.999948	D	0.89917	1.0	D	0.91635	0.999	T	0.42344	-0.9457	9	0.87932	D	0	-36.2531	13.1241	0.59344	0.0778:0.0:0.9222:0.0	.	484	Q13111	CAF1A_HUMAN	Q	484	ENSP00000301280:R484Q	ENSP00000301280:R484Q	R	+	2	0	CHAF1A	4379734	1.000000	0.71417	0.090000	0.20809	0.172000	0.22775	9.404000	0.97306	1.273000	0.44346	0.555000	0.69702	CGG		0.597	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483		25	56	0	0	0	0.005443	0	25	56				
ACER1	125981	broad.mit.edu	37	19	6312431	6312431	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:6312431T>C	ENST00000301452.4	-	2	250	c.173A>G	c.(172-174)tAc>tGc	p.Y58C		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	58					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						AACGTAAATGTAGCGGGAGCG	0.557																																							uc002mel.2		NA																	0					0						c.(172-174)TAC>TGC		alkaline ceramidase 1							149.0	140.0	143.0					19																	6312431		2203	4300	6503	SO:0001583	missense	125981					endoplasmic reticulum membrane|integral to membrane	ceramidase activity	g.chr19:6312431T>C	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.173A>G	19.37:g.6312431T>C	ENSP00000301452:p.Tyr58Cys		Somatic					p.Y58C	NM_133492	NP_597999	WXS	Illumina HiSeq	Unspecified	Q8TDN7	ACER1_HUMAN			2	251	-			58			Helical; (Potential).			Missense_Mutation	SNP	ENST00000301452.4	37	c.173A>G	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309461	0.23821	.	.	ENSG00000167769	ENST00000301452	T	0.41758	0.99	5.18	-10.4	0.00318	.	1.815450	0.02587	N	0.099517	T	0.23249	0.0562	L	0.31294	0.92	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.10636	-1.0621	10	0.35671	T	0.21	-0.5761	2.4269	0.04461	0.2185:0.3568:0.2752:0.1495	.	58	Q8TDN7	ACER1_HUMAN	C	58	ENSP00000301452:Y58C	ENSP00000301452:Y58C	Y	-	2	0	ACER1	6263431	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.202000	0.03023	-2.954000	0.00292	-1.841000	0.00585	TAC		0.557	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1	NM_133492		81	15	0	0	0	0.01441	0	81	15				
MUC16	94025	broad.mit.edu	37	19	9002608	9002608	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:9002608C>A	ENST00000397910.4	-	51	40411	c.40208G>T	c.(40207-40209)aGc>aTc	p.S13403I	MUC16_ENST00000380951.5_Missense_Mutation_p.S44I	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13405	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTCCAGGGCTTTTGGGGTC	0.572																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(40207-40209)AGC>ATC		mucin 16							104.0	95.0	98.0					19																	9002608		2024	4182	6206	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9002608C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40208G>T	19.37:g.9002608C>A	ENSP00000381008:p.Ser13403Ile		Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.S220I|MUC16_uc010xki.1_RNA	p.S13403I	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			51	40412	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.40208G>T	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.01|11.01	1.512844|1.512844	0.27123|0.27123	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.29397	.|1.57;1.57	2.75|2.75	0.473|0.473	0.16763|0.16763	.|SEA (1);	.|.	.|.	.|.	.|.	T|T	0.26629|0.26629	0.0651|0.0651	N|N	0.08118|0.08118	0|0	.|.	.|.	.|.	.|B;D	.|0.56746	.|0.158;0.977	.|B;D	.|0.71656	.|0.068;0.974	T|T	0.27365|0.27365	-1.0076|-1.0076	4|8	.|0.46703	.|T	.|0.11	-3.8447|-3.8447	3.4016|3.4016	0.07325|0.07325	0.2494:0.6061:0.0:0.1445|0.2494:0.6061:0.0:0.1445	.|.	.|21048;13403	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	S|I	243|13403;44	.|ENSP00000381008:S13403I;ENSP00000370338:S44I	.|ENSP00000370338:S44I	A|S	-|-	1|2	0|0	MUC16|MUC16	8863608|8863608	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.069000|-0.069000	0.11542|0.11542	0.200000|0.200000	0.20447|0.20447	-0.657000|-0.657000	0.03884|0.03884	GCC|AGC		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		62	20	1	0	1.31171e-36	0.01441	1.89311e-36	62	20				
MUC16	94025	broad.mit.edu	37	19	9009651	9009652	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:9009651_9009652CC>AA	ENST00000397910.4	-	39	39277_39278	c.39074_39075GG>TT	c.(39073-39075)gGG>gTT	p.G13025V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13027	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCATGTCCTCCCCATACTGCAG	0.554																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(39073-39075)GGG>GTT		mucin 16																																				SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9009651_9009652CC>AA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39074_39075delinsAA	19.37:g.9009651_9009652delinsAA	ENSP00000381008:p.Gly13025Val		Somatic				MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	p.G13025V	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			39	39278_39279	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	DNP	ENST00000397910.4	37	c.39074_39075GG>TT	CCDS54212.1																																																																																				0.554	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		67	21	0	0	0	0.004672	0	67	21				
KEAP1	9817	broad.mit.edu	37	19	10600417	10600417	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:10600417C>A	ENST00000171111.5	-	4	1985	c.1438G>T	c.(1438-1440)Ggg>Tgg	p.G480W	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.G480W|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	480					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.G480W(2)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CGGTTTGTCCCGTCAAAGCCC	0.582																																							uc002moq.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1438-1440)GGG>TGG		kelch-like ECH-associated protein 1							90.0	72.0	78.0					19																	10600417		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600417C>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1438G>T	19.37:g.10600417C>A	ENSP00000171111:p.Gly480Trp		Somatic				KEAP1_uc002mop.1_Missense_Mutation_p.G198W|KEAP1_uc002mor.1_Missense_Mutation_p.G480W	p.G480W	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1594	-			480			Kelch 4.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1438G>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596251	0.66332	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.71579	-0.58;-0.58	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.90160	0.6925	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93107	0.6513	10	0.87932	D	0	.	17.5827	0.87973	0.0:1.0:0.0:0.0	.	480	Q14145	KEAP1_HUMAN	W	480	ENSP00000171111:G480W;ENSP00000377245:G480W	ENSP00000171111:G480W	G	-	1	0	KEAP1	10461417	1.000000	0.71417	0.816000	0.32577	0.173000	0.22820	7.509000	0.81698	2.752000	0.94435	0.558000	0.71614	GGG		0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		39	8	1	0	1.49673e-21	0.00623	2.01832e-21	39	8				
ZNF625	90589	broad.mit.edu	37	19	12256898	12256898	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:12256898G>A	ENST00000355738.1	-	4	484	c.135C>T	c.(133-135)tcC>tcT	p.S45S	ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF625_ENST00000439556.2_Silent_p.S111S|ZNF625_ENST00000542938.1_Silent_p.S45S|CTC-359D24.3_ENST00000472362.1_RNA|ZNF625_ENST00000455799.1_3'UTR			Q96I27	ZN625_HUMAN	zinc finger protein 625	45					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						GCCTATTAAGGGATGCATGAC	0.438																																							uc002mth.2		NA																	0					0						c.(133-135)TCC>TCT		zinc finger protein 625							91.0	84.0	86.0					19																	12256898		2203	4300	6503	SO:0001819	synonymous_variant	90589				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12256898G>A	BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.135C>T	19.37:g.12256898G>A			Somatic				ZNF20_uc002mtg.1_Intron|ZNF625_uc010dyn.1_RNA|ZNF625_uc010dyo.1_Silent_p.S79S	p.S45S	NM_145233	NP_660276	WXS	Illumina HiSeq	Unspecified	Q96I27	ZN625_HUMAN			4	485	-			45			C2H2-type 1; degenerate.		A4FU45|I3L0E9	Silent	SNP	ENST00000355738.1	37	c.135C>T																																																																																					0.438	ZNF625-201	KNOWN	basic	protein_coding	protein_coding		NM_145233		40	10	0	0	0	0.00623	0	40	10				
CD97	976	broad.mit.edu	37	19	14512314	14512314	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:14512314G>C	ENST00000242786.5	+	10	1094	c.1014G>C	c.(1012-1014)atG>atC	p.M338I	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.M289I|CD97_ENST00000358600.3_Missense_Mutation_p.M245I	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	338					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						AAGATATCATGAGGATCCTGG	0.597																																							uc002myl.2		NA																	0				ovary(3)|breast(1)	4						c.(1012-1014)ATG>ATC		CD97 antigen isoform 1 precursor							73.0	75.0	74.0					19																	14512314		2203	4300	6503	SO:0001583	missense	976				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr19:14512314G>C		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1014G>C	19.37:g.14512314G>C	ENSP00000242786:p.Met338Ile		Somatic				CD97_uc002mym.2_Missense_Mutation_p.M289I|CD97_uc002myn.2_Missense_Mutation_p.M245I	p.M338I	NM_078481	NP_510966	WXS	Illumina HiSeq	Unspecified	P48960	CD97_HUMAN			10	1137	+			338			Extracellular (Potential).		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	c.1014G>C	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.939465	0.34189	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70164	-0.46;-0.35;0.03	5.52	0.505	0.16953	.	0.349867	0.16407	N	0.215768	T	0.40815	0.1132	N	0.08118	0	0.09310	N	1	B;B;B	0.15930	0.015;0.015;0.001	B;B;B	0.15052	0.012;0.012;0.002	T	0.32534	-0.9903	10	0.54805	T	0.06	.	6.1267	0.20184	0.0931:0.0:0.3733:0.5336	.	245;289;338	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	I	338;289;245;288	ENSP00000242786:M338I;ENSP00000349918:M289I;ENSP00000351413:M245I	ENSP00000242786:M338I	M	+	3	0	CD97	14373314	0.933000	0.31639	0.446000	0.26920	0.014000	0.08584	0.745000	0.26259	0.636000	0.30508	0.561000	0.74099	ATG		0.597	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		16	19	0	0	0	0.004007	0	16	19				
ZNF536	9745	broad.mit.edu	37	19	31025821	31025821	+	Silent	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:31025821G>T	ENST00000355537.3	+	3	2385	c.2238G>T	c.(2236-2238)ctG>ctT	p.L746L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	746					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACAGAAGCCTGGGCTCGGCCA	0.567																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2236-2238)CTG>CTT		zinc finger protein 536							110.0	110.0	110.0					19																	31025821		2203	4300	6503	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31025821G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2238G>T	19.37:g.31025821G>T			Somatic				ZNF536_uc010edd.1_Silent_p.L746L	p.L746L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			3	2376	+	Esophageal squamous(110;0.0834)		746					A2RU18	Silent	SNP	ENST00000355537.3	37	c.2238G>T	CCDS32984.1																																																																																				0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		34	92	1	0	4.65686e-17	0.003755	5.92087e-17	34	92				
WDR62	284403	broad.mit.edu	37	19	36575577	36575577	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:36575577G>T	ENST00000270301.7	+	12	1573	c.1573G>T	c.(1573-1575)Gac>Tac	p.D525Y	WDR62_ENST00000401500.2_Missense_Mutation_p.D525Y			O43379	WDR62_HUMAN	WD repeat domain 62	525					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCACTTCATGGACGAGCTGGT	0.612																																							uc002odc.2		NA																	0					0						c.(1573-1575)GAC>TAC		WD repeat domain 62 isoform 2							100.0	84.0	89.0					19																	36575577		2203	4300	6503	SO:0001583	missense	284403				cerebral cortex development	nucleus		g.chr19:36575577G>T	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1573G>T	19.37:g.36575577G>T	ENSP00000270301:p.Asp525Tyr		Somatic				WDR62_uc002odd.2_Missense_Mutation_p.D525Y	p.D525Y	NM_173636	NP_775907	WXS	Illumina HiSeq	Unspecified	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		12	1664	+	Esophageal squamous(110;0.162)		525			WD 7.		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	c.1573G>T	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207619	0.79240	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.57595	0.96;0.39	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.113214	0.56097	D	0.000025	T	0.62502	0.2433	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.63554	-0.6611	10	0.62326	D	0.03	-19.5694	10.0138	0.42003	0.0929:0.0:0.9071:0.0	.	525;525	O43379-4;O43379	.;WDR62_HUMAN	Y	525	ENSP00000384792:D525Y;ENSP00000270301:D525Y	ENSP00000270301:D525Y	D	+	1	0	WDR62	41267417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.122000	0.41987	2.558000	0.86282	0.561000	0.74099	GAC		0.612	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		21	17	1	0	2.70639e-06	0.014323	2.8008e-06	21	17				
DPF1	8193	broad.mit.edu	37	19	38704372	38704372	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:38704372G>T	ENST00000420980.2	-	9	898	c.872C>A	c.(871-873)aCg>aAg	p.T291K	DPF1_ENST00000416611.1_Missense_Mutation_p.T309K|DPF1_ENST00000412732.1_Missense_Mutation_p.T253K|DPF1_ENST00000355526.4_Missense_Mutation_p.T335K|DPF1_ENST00000456296.1_Missense_Mutation_p.T309K|DPF1_ENST00000414789.1_Missense_Mutation_p.T253K	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	291					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CATGTTCACCGTGAATTGTAA	0.642																																							uc002ohl.2		NA																	0					0						c.(871-873)ACG>AAG		D4, zinc and double PHD fingers family 1 isoform							54.0	50.0	51.0					19																	38704372		2203	4300	6503	SO:0001583	missense	8193				induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding	g.chr19:38704372G>T	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.872C>A	19.37:g.38704372G>T	ENSP00000397354:p.Thr291Lys		Somatic				DPF1_uc002ohm.2_Missense_Mutation_p.T335K|DPF1_uc002ohn.2_Missense_Mutation_p.T253K|DPF1_uc010xtu.1_Missense_Mutation_p.T309K|DPF1_uc010xtv.1_Missense_Mutation_p.T309K	p.T291K	NM_004647	NP_004638	WXS	Illumina HiSeq	Unspecified	Q92782	DPF1_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		9	899	-	all_cancers(60;1.24e-06)		291			PHD-type 1.		B3KSY8|Q08AJ0	Missense_Mutation	SNP	ENST00000420980.2	37	c.872C>A	CCDS33008.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.732018|4.732018	0.89390|0.89390	.|.	.|.	ENSG00000011332|ENSG00000011332	ENST00000355526|ENST00000420980;ENST00000437720;ENST00000412732;ENST00000416611;ENST00000414789;ENST00000456296	.|D;D;D;D;D	.|0.87571	.|-2.27;-2.27;-2.27;-2.27;-2.27	4.04|4.04	4.04|4.04	0.47022|0.47022	.|Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);	.|0.000000	.|0.64402	.|U	.|0.000008	D|D	0.93933|0.93933	0.8058|0.8058	M|M	0.90483|0.90483	3.12|3.12	0.58432|0.58432	D|D	0.99999|0.99999	.|P;P;D;D;D	.|0.65815	.|0.912;0.928;0.978;0.972;0.995	.|P;P;P;P;D	.|0.66602	.|0.634;0.746;0.845;0.715;0.945	D|D	0.95302|0.95302	0.8404|0.8404	5|10	.|0.87932	.|D	.|0	-3.3385|-3.3385	15.1882|15.1882	0.73023|0.73023	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|309;308;335;335;291	.|E9PDV3;C8C3P2;Q6PJ73;Q92782-2;Q92782	.|.;.;.;.;DPF1_HUMAN	Q|K	327|291;335;253;309;253;309	.|ENSP00000397354:T291K;ENSP00000412098:T253K;ENSP00000390223:T309K;ENSP00000391884:T253K;ENSP00000411569:T309K	.|ENSP00000412098:T253K	H|T	-|-	3|2	2|0	DPF1|DPF1	43396212|43396212	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.229000|9.229000	0.95273|0.95273	2.070000|2.070000	0.61991|0.61991	0.449000|0.449000	0.29647|0.29647	CAC|ACG		0.642	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347721.1			29	30	1	0	7.38237e-10	0.00632	8.31684e-10	29	30				
RYR1	6261	broad.mit.edu	37	19	38951198	38951198	+	Silent	SNP	C	C	T	rs140374285	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:38951198C>T	ENST00000359596.3	+	20	2544	c.2544C>T	c.(2542-2544)acC>acT	p.T848T	RYR1_ENST00000355481.4_Silent_p.T848T|RYR1_ENST00000360985.3_Silent_p.T848T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	848	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TCTCACACACCGACTTCGTGC	0.642																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(2542-2544)ACC>ACT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)	C	,	5,4401	8.1+/-20.4	0,5,2198	44.0	47.0	46.0		2544,2544	-4.6	1.0	19	dbSNP_134	46	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RYR1	NM_000540.2,NM_001042723.1	,	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	,	848/5039,848/5034	38951198	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38951198C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2544C>T	19.37:g.38951198C>T			Somatic				RYR1_uc002oiu.2_Silent_p.T848T	p.T848T	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		20	2674	+	all_cancers(60;7.91e-06)		848			1.|Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.2544C>T	CCDS33011.1																																																																																				0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			20	46	0	0	0	0.00278	0	20	46				
GRIK5	2901	broad.mit.edu	37	19	42507532	42507532	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:42507532C>T	ENST00000262895.3	-	18	2465	c.2466G>A	c.(2464-2466)gcG>gcA	p.A822A	GRIK5_ENST00000593562.1_Silent_p.A822A|GRIK5_ENST00000301218.4_Silent_p.A822A	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	822					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ATTCCATGACCGCCACGAAGA	0.597																																							uc002osj.1		NA																	0					0						c.(2464-2466)GCG>GCA		glutamate receptor KA2 precursor	L-Glutamic Acid(DB00142)						89.0	76.0	81.0					19																	42507532		2203	4300	6503	SO:0001819	synonymous_variant	2901					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr19:42507532C>T		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2466G>A	19.37:g.42507532C>T			Somatic				GRIK5_uc002osi.1_Silent_p.A394A	p.A822A	NM_002088	NP_002079	WXS	Illumina HiSeq	Unspecified	Q16478	GRIK5_HUMAN			18	2501	-		Prostate(69;0.059)	822			Helical; (Potential).		Q8WWG8	Silent	SNP	ENST00000262895.3	37	c.2466G>A	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	C	9.566	1.119670	0.20877	.	.	ENSG00000105737	ENST00000454993	.	.	.	4.31	-8.61	0.00885	.	.	.	.	.	T	0.32041	0.0816	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41270	-0.9518	4	.	.	.	.	0.8052	0.01082	0.3823:0.142:0.2574:0.2184	.	.	.	.	S	199	.	.	G	-	1	0	GRIK5	47199372	0.001000	0.12720	0.880000	0.34516	0.966000	0.64601	-2.216000	0.01221	-1.387000	0.02095	-0.954000	0.02651	GGT		0.597	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1			31	19	0	0	0	0.010818	0	31	19				
PSG6	5675	broad.mit.edu	37	19	43411893	43411893	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:43411893G>C	ENST00000292125.2	-	4	864	c.820C>G	c.(820-822)Cta>Gta	p.L274V	PSG6_ENST00000402603.4_Intron|PSG6_ENST00000187910.2_Missense_Mutation_p.L274V	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	274	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TGACCATTTAGCCACCAAATG	0.483																																							uc002ovj.1		NA																	0				ovary(1)|skin(1)	2						c.(820-822)CTA>GTA		pregnancy specific beta-1-glycoprotein 6 isoform							295.0	280.0	285.0					19																	43411893		2201	4299	6500	SO:0001583	missense	5675				female pregnancy	extracellular region		g.chr19:43411893G>C		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.820C>G	19.37:g.43411893G>C	ENSP00000292125:p.Leu274Val		Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.L281V|PSG6_uc002ovi.2_Missense_Mutation_p.L275V|PSG6_uc010xwk.1_Missense_Mutation_p.L114V|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_Missense_Mutation_p.L64V|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Missense_Mutation_p.L274V	p.L274V	NM_002782	NP_002773	WXS	Illumina HiSeq	Unspecified	Q00889	PSG6_HUMAN			4	872	-		Prostate(69;0.00899)	274			Ig-like C2-type 2.		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	c.820C>G	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	1.130	-0.652700	0.03480	.	.	ENSG00000170848	ENST00000187910;ENST00000292125	T;T	0.14266	2.52;2.52	1.42	-2.58	0.06228	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03011	0.0089	N	0.00666	-1.275	0.09310	N	1	B;B	0.19073	0.033;0.009	B;B	0.26614	0.071;0.031	T	0.41395	-0.9511	9	0.19147	T	0.46	.	2.3527	0.04288	0.0:0.2257:0.3086:0.4657	.	274;274	Q00889;Q00889-2	PSG6_HUMAN;.	V	274	ENSP00000187910:L274V;ENSP00000292125:L274V	ENSP00000187910:L274V	L	-	1	2	PSG6	48103733	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	-1.903000	0.01594	-0.875000	0.04022	0.134000	0.15878	CTA		0.483	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		174	141	0	0	0	0.01441	0	174	141				
CA11	770	broad.mit.edu	37	19	49143455	49143455	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:49143455G>T	ENST00000084798.4	-	4	1047	c.368C>A	c.(367-369)cCc>cAc	p.P123H	DBP_ENST00000601104.1_5'Flank|DBP_ENST00000222122.5_5'Flank|SEC1P_ENST00000430145.2_RNA	NM_001217.3	NP_001208.2	O75493	CAH11_HUMAN	carbonic anhydrase XI	123						basolateral plasma membrane (GO:0016323)|extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	14		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	Zonisamide(DB00909)	GTAAAGGAGGGGACCTCCAGA	0.617																																							uc002pjz.1		NA																	0					0						c.(367-369)CCC>CAC		carbonic anhydrase XI precursor							79.0	76.0	77.0					19																	49143455		2203	4300	6503	SO:0001583	missense	770					extracellular region		g.chr19:49143455G>T	AF067662	CCDS12729.1	19q13.3	2012-07-02			ENSG00000063180	ENSG00000063180		"""Carbonic anhydrases"""	1370	protein-coding gene	gene with protein product	"""CA-RP XI"", ""carbonic anhydrase-related protein XI"", ""carbonic anhydrase-related protein 2"""	604644				9878252	Standard	XR_243956		Approved	CARP2, CARPX1	uc002pjz.1	O75493		ENST00000084798.4:c.368C>A	19.37:g.49143455G>T	ENSP00000084798:p.Pro123His		Somatic				SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	p.P123H	NM_001217	NP_001208	WXS	Illumina HiSeq	Unspecified	O75493	CAH11_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	4	930	-		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	123					O60596|Q6FHI1|Q9UEC4	Missense_Mutation	SNP	ENST00000084798.4	37	c.368C>A	CCDS12729.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434702	0.83885	.	.	ENSG00000063180	ENST00000084798	T	0.71934	-0.61	3.56	3.56	0.40772	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.86171	0.5869	M	0.93550	3.43	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.88702	0.3216	10	0.87932	D	0	.	10.8681	0.46866	0.0:0.0:1.0:0.0	.	123	O75493	CAH11_HUMAN	H	123	ENSP00000084798:P123H	ENSP00000084798:P123H	P	-	2	0	CA11	53835267	1.000000	0.71417	0.988000	0.46212	0.974000	0.67602	7.673000	0.83973	2.019000	0.59389	0.462000	0.41574	CCC		0.617	CA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466172.1	NM_001217		21	52	1	0	1.10513e-12	0.014323	1.29417e-12	21	52				
NUCB1	4924	broad.mit.edu	37	19	49404129	49404129	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:49404129G>C	ENST00000405315.4	+	2	410	c.76G>C	c.(76-78)Gct>Cct	p.A26P	NUCB1_ENST00000407032.1_Missense_Mutation_p.A26P|NUCB1_ENST00000263273.5_Missense_Mutation_p.A26P|TULP2_ENST00000221399.3_5'Flank|NUCB1_ENST00000485798.1_Intron	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	26						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		CGCCGTGCTGGCTGTCCCCCT	0.667																																							uc002plb.3		NA																	0					0						c.(76-78)GCT>CCT		nucleobindin 1 precursor							56.0	48.0	50.0					19																	49404129		2203	4300	6503	SO:0001583	missense	4924					ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding	g.chr19:49404129G>C	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.76G>C	19.37:g.49404129G>C	ENSP00000385923:p.Ala26Pro		Somatic				NUCB1_uc002pla.2_Missense_Mutation_p.A26P|NUCB1_uc002plc.2_Missense_Mutation_p.A26P|TULP2_uc002pkz.2_5'Flank	p.A26P	NM_006184	NP_006175	WXS	Illumina HiSeq	Unspecified	Q02818	NUCB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)	2	148	+		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)	26					B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	ENST00000405315.4	37	c.76G>C	CCDS12740.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.962|8.962	0.970842|0.970842	0.18659|0.18659	.|.	.|.	ENSG00000104805|ENSG00000104805	ENST00000405315;ENST00000407032;ENST00000452087;ENST00000411700;ENST00000451312;ENST00000263273|ENST00000424608	T;T;T|.	0.21361|.	2.01;2.01;2.01|.	4.08|4.08	-2.86|-2.86	0.05717|0.05717	.|.	0.421044|.	0.24287|.	N|.	0.039850|.	T|T	0.14098|0.14098	0.0341|0.0341	N|N	0.12502|0.12502	0.225|0.225	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.23976|0.23976	-1.0173|-1.0173	10|5	0.72032|.	D|.	0.01|.	.|.	0.9125|0.9125	0.01298|0.01298	0.3129:0.1547:0.3743:0.158|0.3129:0.1547:0.3743:0.158	.|.	26;26|.	Q02818;Q53GX6|.	NUCB1_HUMAN;.|.	P|C	26|25	ENSP00000385923:A26P;ENSP00000385211:A26P;ENSP00000263273:A26P|.	ENSP00000263273:A26P|.	A|W	+|+	1|3	0|0	NUCB1|NUCB1	54095941|54095941	0.182000|0.182000	0.23173|0.23173	0.008000|0.008000	0.14137|0.14137	0.044000|0.044000	0.14063|0.14063	0.079000|0.079000	0.14782|0.14782	-0.318000|-0.318000	0.08665|0.08665	-0.335000|-0.335000	0.08231|0.08231	GCT|TGG		0.667	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184		26	26	0	0	0	0.004656	0	26	26				
LILRB2	10288	broad.mit.edu	37	19	54782271	54782271	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:54782271A>G	ENST00000391749.4	-	7	1372	c.1101T>C	c.(1099-1101)cgT>cgC	p.R367R	LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391746.1_Silent_p.R367R|LILRB2_ENST00000391748.1_Silent_p.R367R|LILRB2_ENST00000314446.5_Silent_p.R367R|LILRB2_ENST00000434421.1_Silent_p.R251R	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	367	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTGATCTTAGACGGAGTGGGG	0.567																																							uc002qfb.2		NA																	0				skin(1)	1						c.(1099-1101)CGT>CGC		leukocyte immunoglobulin-like receptor,							157.0	156.0	156.0					19																	54782271		2203	4300	6503	SO:0001819	synonymous_variant	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54782271A>G	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1101T>C	19.37:g.54782271A>G			Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.R367R|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.R367R|LILRB2_uc010yet.1_Silent_p.R251R|LILRB2_uc010yeu.1_RNA	p.R367R	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	7	1367	-	Ovarian(34;0.19)		367			Extracellular (Potential).|Ig-like C2-type 4.		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	c.1101T>C	CCDS12886.1																																																																																				0.567	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			82	77	0	0	0	0.01441	0	82	77				
ZNF211	10520	broad.mit.edu	37	19	58153450	58153450	+	Silent	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:58153450G>T	ENST00000347302.3	+	3	1775	c.1596G>T	c.(1594-1596)acG>acT	p.T532T	ZNF211_ENST00000299871.5_Silent_p.T597T|ZNF211_ENST00000420680.1_Silent_p.T536T|ZNF211_ENST00000254182.7_Silent_p.T523T|ZNF211_ENST00000541801.1_Silent_p.T523T|ZNF211_ENST00000391703.3_Silent_p.T471T|ZNF211_ENST00000544273.1_Silent_p.T544T|ZNF211_ENST00000240731.4_Silent_p.T545T	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	532					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAGTTCACACGGGAAAAAGGC	0.463																																							uc002qpq.2		NA																	0				ovary(2)	2						c.(1594-1596)ACG>ACT		zinc finger protein 211 isoform 2							103.0	100.0	101.0					19																	58153450		2203	4300	6503	SO:0001819	synonymous_variant	10520					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58153450G>T	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.1596G>T	19.37:g.58153450G>T			Somatic				ZNF211_uc010yhb.1_Silent_p.T536T|ZNF211_uc002qpp.2_Silent_p.T545T|ZNF211_uc002qpr.2_Silent_p.T596T|ZNF211_uc002qps.2_Silent_p.T597T|ZNF211_uc002qpt.2_Silent_p.T544T|ZNF211_uc010yhc.1_Silent_p.T544T|ZNF211_uc010yhd.1_Silent_p.T471T|ZNF211_uc010yhe.1_Silent_p.T523T	p.T532T	NM_198855	NP_942152	WXS	Illumina HiSeq	Unspecified	Q13398	ZN211_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	1776	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	532					B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Silent	SNP	ENST00000347302.3	37	c.1596G>T	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	g	12.36	1.913285	0.33815	.	.	ENSG00000121417	ENST00000407202	.	.	.	3.23	-2.47	0.06442	.	.	.	.	.	T	0.49558	0.1564	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38972	-0.9636	4	.	.	.	.	5.7555	0.18170	0.3915:0.0:0.3991:0.2094	.	.	.	.	W	536	.	.	G	+	1	0	ZNF211	62845262	0.000000	0.05858	0.063000	0.19743	0.957000	0.61999	-1.476000	0.02333	-0.829000	0.04268	-0.357000	0.07601	GGG		0.463	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1			79	52	1	0	8.50452e-49	0.01441	1.2615e-48	79	52				
APOB	338	broad.mit.edu	37	2	21228441	21228441	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:21228441C>T	ENST00000233242.1	-	26	11426	c.11299G>A	c.(11299-11301)Gaa>Aaa	p.E3767K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3767					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTTGTATTTCTCTGAAGTCA	0.393																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(11299-11301)GAA>AAA		apolipoprotein B precursor	Atorvastatin(DB01076)						103.0	109.0	107.0					2																	21228441		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21228441C>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11299G>A	2.37:g.21228441C>T	ENSP00000233242:p.Glu3767Lys		Somatic					p.E3767K	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	11427	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3767					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.11299G>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476911	0.63849	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00705	5.81	4.62	2.72	0.32119	.	0.448386	0.20955	N	0.082665	T	0.01029	0.0034	M	0.63428	1.95	0.80722	D	1	P	0.46395	0.877	P	0.44732	0.459	T	0.68051	-0.5511	10	0.12430	T	0.62	.	4.0954	0.09988	0.0:0.3452:0.4567:0.1981	.	3767	P04114	APOB_HUMAN	K	3767	ENSP00000233242:E3767K	ENSP00000233242:E3767K	E	-	1	0	APOB	21081946	0.993000	0.37304	0.999000	0.59377	0.859000	0.49053	2.650000	0.46665	1.183000	0.42943	0.655000	0.94253	GAA		0.393	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			38	160	0	0	0	0.004878	0	38	160				
LTBP1	4052	broad.mit.edu	37	2	33623498	33623498	+	Silent	SNP	C	C	A	rs113896201	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:33623498C>A	ENST00000404816.2	+	34	5405	c.5052C>A	c.(5050-5052)acC>acA	p.T1684T	LTBP1_ENST00000390003.4_Silent_p.T1359T|LTBP1_ENST00000407925.1_Silent_p.T1358T|LTBP1_ENST00000354476.3_Silent_p.T1685T|LTBP1_ENST00000272273.5_Silent_p.T582T|LTBP1_ENST00000402934.1_Silent_p.T1303T|LTBP1_ENST00000418533.2_Silent_p.T1316T|LTBP1_ENST00000404525.1_Silent_p.T1305T			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1684	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GCATTAACACCGATGGTTCCT	0.448																																							uc002ros.2		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(5053-5055)ACC>ACA		latent transforming growth factor beta binding							165.0	121.0	136.0					2																	33623498		2203	4300	6503	SO:0001819	synonymous_variant	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33623498C>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.5052C>A	2.37:g.33623498C>A			Somatic				LTBP1_uc002rot.2_Silent_p.T1359T|LTBP1_uc002rou.2_Silent_p.T1358T|LTBP1_uc002rov.2_Silent_p.T1305T|LTBP1_uc010ymz.1_Silent_p.T1316T|LTBP1_uc010yna.1_Silent_p.T1263T|LTBP1_uc010ynb.1_Silent_p.T582T	p.T1685T	NM_206943	NP_996826	WXS	Illumina HiSeq	Unspecified	Q14766	LTBP1_HUMAN			34	5055	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	1684			EGF-like 18; calcium-binding (Potential).		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	c.5055C>A	CCDS33177.2																																																																																				0.448	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		30	50	1	0	1.08312e-15	0.009535	1.31451e-15	30	50				
CNTNAP5	129684	broad.mit.edu	37	2	125261950	125261950	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:125261950C>T	ENST00000431078.1	+	8	1505	c.1141C>T	c.(1141-1143)Ccc>Tcc	p.P381S		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	381	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTTGCTGCTGCCCGGCACCCC	0.517																																							uc002tno.2		NA																	0				ovary(10)	10						c.(1141-1143)CCC>TCC		contactin associated protein-like 5 precursor							78.0	73.0	75.0					2																	125261950		1867	4111	5978	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125261950C>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1141C>T	2.37:g.125261950C>T	ENSP00000399013:p.Pro381Ser		Somatic				CNTNAP5_uc010flu.2_Missense_Mutation_p.P382S	p.P381S	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	8	1505	+			381			Laminin G-like 2.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.1141C>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875157	0.72180	.	.	ENSG00000155052	ENST00000431078	T	0.81078	-1.45	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.47852	D	0.000207	D	0.85371	0.5681	M	0.86805	2.84	0.80722	D	1	D	0.53312	0.959	B	0.43867	0.434	D	0.88281	0.2936	10	0.66056	D	0.02	.	18.9038	0.92453	0.0:1.0:0.0:0.0	.	381	Q8WYK1	CNTP5_HUMAN	S	381	ENSP00000399013:P381S	ENSP00000399013:P381S	P	+	1	0	CNTNAP5	124978420	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.019000	0.64060	2.698000	0.92095	0.650000	0.86243	CCC		0.517	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			16	90	0	0	0	0.004007	0	16	90				
LRP1B	53353	broad.mit.edu	37	2	141093378	141093378	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:141093378A>G	ENST00000389484.3	-	78	12893	c.11922T>C	c.(11920-11922)atT>atC	p.I3974I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3974					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTCAACTGCAATGTCCCTGG	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(11920-11922)ATT>ATC		low density lipoprotein-related protein 1B							107.0	104.0	105.0					2																	141093378		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141093378A>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11922T>C	2.37:g.141093378A>G		TSP Lung(27;0.18)	Somatic					p.I3974I	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	78	12894	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3974			Extracellular (Potential).|LDL-receptor class B 33.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.11922T>C	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	10.10	1.256407	0.22965	.	.	ENSG00000168702	ENST00000437977	.	.	.	5.43	4.29	0.51040	.	.	.	.	.	T	0.60353	0.2262	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56932	-0.7897	4	.	.	.	.	9.9937	0.41887	0.8589:0.0:0.1411:0.0	.	.	.	.	S	206	.	.	L	-	2	0	LRP1B	140809848	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.592000	0.23984	1.007000	0.39238	0.528000	0.53228	TTG		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		21	130	0	0	0	0.012319	0	21	130				
NEB	4703	broad.mit.edu	37	2	152512792	152512792	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:152512792C>A	ENST00000172853.10	-	49	6517	c.6370G>T	c.(6370-6372)Gct>Tct	p.A2124S	NEB_ENST00000397345.3_Missense_Mutation_p.A2124S|NEB_ENST00000604864.1_Missense_Mutation_p.A2124S|NEB_ENST00000603639.1_Missense_Mutation_p.A2124S|NEB_ENST00000427231.2_Missense_Mutation_p.A2124S|NEB_ENST00000409198.1_Missense_Mutation_p.A2124S			P20929	NEBU_HUMAN	nebulin	2124					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCCTTTGCAGCCGTGACACTG	0.483																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(6370-6372)GCT>TCT		nebulin isoform 3							304.0	304.0	304.0					2																	152512792		2130	4247	6377	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152512792C>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6370G>T	2.37:g.152512792C>A	ENSP00000172853:p.Ala2124Ser		Somatic					p.A2124S	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	49	6561	-			2124			Nebulin 56.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.6370G>T		.	.	.	.	.	.	.	.	.	.	C	16.31	3.086897	0.55861	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.82	5.82	0.92795	.	0.368291	0.29544	N	0.011855	T	0.39489	0.1080	L	0.47716	1.5	0.80722	D	1	P	0.51351	0.944	P	0.49799	0.622	T	0.01951	-1.1241	10	0.21540	T	0.41	.	20.1008	0.97874	0.0:1.0:0.0:0.0	.	2124	P20929	NEBU_HUMAN	S	2124	ENSP00000386259:A2124S;ENSP00000380505:A2124S;ENSP00000416578:A2124S;ENSP00000172853:A2124S	ENSP00000172853:A2124S	A	-	1	0	NEB	152221038	1.000000	0.71417	0.908000	0.35775	0.954000	0.61252	4.325000	0.59234	2.756000	0.94617	0.563000	0.77884	GCT		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		129	195	1	0	6.92432e-61	0.01441	1.03285e-60	129	195				
XIRP2	129446	broad.mit.edu	37	2	168103772	168103773	+	Nonsense_Mutation	DNP	CG	CG	AA	rs373676460|rs566795295	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:168103772_168103773CG>AA	ENST00000409195.1	+	9	5959_5960	c.5870_5871CG>AA	c.(5869-5871)tCG>tAA	p.S1957*	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.S1735*|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.S1957*	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1782					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCAGGATCCTCGGGAGAGCAGA	0.431																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(5869-5871)TCG>TAA		xin actin-binding repeat containing 2 isoform 1																																				SO:0001587	stop_gained	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168103772_168103773CG>AA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	Exception_encountered	2.37:g.168103772_168103773delinsAA	ENSP00000386840:p.Ser1957*		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.S1782*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.S1735*|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.S1957*	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	5888_5889	+			1782					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	DNP	ENST00000409195.1	37	c.5870_5871CG>AA	CCDS42769.1																																																																																				0.431	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		30	57	0	0	0	0.004672	0	30	57				
LRP2	4036	broad.mit.edu	37	2	170134283	170134283	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:170134283C>G	ENST00000263816.3	-	13	2029	c.1744G>C	c.(1744-1746)Gaa>Caa	p.E582Q	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	582					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTTACAGTTTCAATGTAATCA	0.388																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(1744-1746)GAA>CAA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						107.0	106.0	106.0					2																	170134283		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170134283C>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1744G>C	2.37:g.170134283C>G	ENSP00000263816:p.Glu582Gln		Somatic				LRP2_uc010zdf.1_Intron	p.E582Q	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	13	1957	-			582			LDL-receptor class B 4.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.1744G>C	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	32	5.132600	0.94473	.	.	ENSG00000081479	ENST00000263816	D	0.91124	-2.79	5.7	5.7	0.88788	Six-bladed beta-propeller, TolB-like (1);	0.046730	0.85682	D	0.000000	D	0.94863	0.8340	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.93947	0.7228	10	0.45353	T	0.12	.	19.8176	0.96576	0.0:1.0:0.0:0.0	.	582	P98164	LRP2_HUMAN	Q	582	ENSP00000263816:E582Q	ENSP00000263816:E582Q	E	-	1	0	LRP2	169842529	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.723000	0.84788	2.680000	0.91292	0.555000	0.69702	GAA		0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		17	152	0	0	0	0.008871	0	17	152				
TTN	7273	broad.mit.edu	37	2	179465890	179465890	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:179465890C>G	ENST00000591111.1	-	238	51042	c.50818G>C	c.(50818-50820)Gat>Cat	p.D16940H	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D18581H|TTN_ENST00000342175.6_Missense_Mutation_p.D9708H|TTN_ENST00000460472.2_Missense_Mutation_p.D9516H|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D9641H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D16013H			Q8WZ42	TITIN_HUMAN	titin	16940					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGGAGGATCAGGAGGATCT	0.348																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(48037-48039)GAT>CAT		titin isoform N2-A							39.0	39.0	39.0					2																	179465890		1836	4088	5924	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179465890C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50818G>C	2.37:g.179465890C>G	ENSP00000465570:p.Asp16940His		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D9708H|TTN_uc010zfi.1_Missense_Mutation_p.D9641H|TTN_uc010zfj.1_Missense_Mutation_p.D9516H	p.D16013H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		237	48261	-			16940					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.48037G>C		.	.	.	.	.	.	.	.	.	.	C	13.43	2.235420	0.39498	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.38	5.38	0.77491	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77935	0.4205	M	0.89353	3.025	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.69824	0.966;0.966;0.966;0.966	T	0.82067	-0.0641	9	0.87932	D	0	.	19.4972	0.95079	0.0:1.0:0.0:0.0	.	9516;9641;9708;16940	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	16013;9516;9708;9641;9516	ENSP00000343764:D16013H;ENSP00000434586:D9516H;ENSP00000340554:D9708H;ENSP00000352154:D9641H	ENSP00000340554:D9708H	D	-	1	0	TTN	179174135	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.729000	0.84864	2.668000	0.90789	0.563000	0.77884	GAT		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		23	51	0	0	0	0.00278	0	23	51				
MYO1B	4430	broad.mit.edu	37	2	192257825	192257825	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:192257825G>T	ENST00000392318.3	+	20	2350	c.2103G>T	c.(2101-2103)aaG>aaT	p.K701N	MYO1B_ENST00000304164.4_Missense_Mutation_p.K701N|MYO1B_ENST00000339514.4_Missense_Mutation_p.K701N|MYO1B_ENST00000392316.1_Missense_Mutation_p.K701N|MYO1B_ENST00000439065.2_5'UTR	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	701	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ACCTGAGGAAGCAACGCCTGG	0.408																																							uc010fsg.2		NA																	0				central_nervous_system(5)|large_intestine(2)|ovary(1)	8						c.(2101-2103)AAG>AAT		myosin IB isoform 1							78.0	78.0	78.0					2																	192257825		2203	4300	6503	SO:0001583	missense	4430					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr2:192257825G>T	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.2103G>T	2.37:g.192257825G>T	ENSP00000376132:p.Lys701Asn		Somatic				MYO1B_uc002usq.2_Missense_Mutation_p.K701N|MYO1B_uc002usr.2_Missense_Mutation_p.K701N|MYO1B_uc002usu.2_5'UTR	p.K701N	NM_001130158	NP_001123630	WXS	Illumina HiSeq	Unspecified	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		20	2358	+			701					O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	c.2103G>T	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314815	0.40996	.	.	ENSG00000128641	ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.55	4.66	0.58398	Myosin head, motor domain (1);	0.048991	0.85682	D	0.000000	T	0.51907	0.1702	N	0.20574	0.59	0.80722	D	1	B;B	0.20368	0.026;0.044	B;B	0.19666	0.015;0.026	T	0.44651	-0.9314	10	0.18276	T	0.48	.	10.013	0.41997	0.2001:0.0:0.7999:0.0	.	701;701	O43795;O43795-2	MYO1B_HUMAN;.	N	701	ENSP00000341903:K701N;ENSP00000376132:K701N;ENSP00000306382:K701N;ENSP00000376130:K701N	ENSP00000306382:K701N	K	+	3	2	MYO1B	191966070	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	1.036000	0.30228	2.772000	0.95346	0.650000	0.86243	AAG		0.408	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		16	79	1	0	1.62849e-17	0.004007	2.09042e-17	16	79				
DNAH7	56171	broad.mit.edu	37	2	196822039	196822039	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:196822039T>A	ENST00000312428.6	-	19	3124	c.3024A>T	c.(3022-3024)agA>agT	p.R1008S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1008	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTGTAAATCGTCTGCCTTCCT	0.428																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(3022-3024)AGA>AGT		dynein, axonemal, heavy chain 7							111.0	101.0	104.0					2																	196822039		1878	4129	6007	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196822039T>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3024A>T	2.37:g.196822039T>A	ENSP00000311273:p.Arg1008Ser		Somatic					p.R1008S	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			19	3125	-			1008			Stem (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.3024A>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	11.81	1.748877	0.30955	.	.	ENSG00000118997	ENST00000312428	T	0.60548	0.18	5.57	-4.44	0.03557	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.73218	0.3559	M	0.82323	2.585	0.46437	D	0.999049	D	0.89917	1.0	D	0.83275	0.996	T	0.75895	-0.3156	10	0.62326	D	0.03	.	15.5206	0.75862	0.0:0.567:0.0:0.433	.	1008	Q8WXX0	DYH7_HUMAN	S	1008	ENSP00000311273:R1008S	ENSP00000311273:R1008S	R	-	3	2	DNAH7	196530284	0.001000	0.12720	0.445000	0.26908	0.169000	0.22640	-1.020000	0.03618	-1.006000	0.03412	-0.250000	0.11733	AGA		0.428	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		62	43	0	0	0	0.01441	0	62	43				
UNC80	285175	broad.mit.edu	37	2	210642218	210642218	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:210642218C>A	ENST00000439458.1	+	4	615	c.535C>A	c.(535-537)Cag>Aag	p.Q179K	UNC80_ENST00000272845.6_Missense_Mutation_p.Q179K|UNC80_ENST00000478701.1_3'UTR	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	179					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AAAGATCTTCCAGAACTCCAT	0.502																																							uc010zjc.1		NA																	0					0						c.(535-537)CAG>AAG		chromosome 2 open reading frame 21 isoform 1							120.0	123.0	122.0					2																	210642218		2203	4300	6503	SO:0001583	missense	285175					integral to membrane		g.chr2:210642218C>A	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.535C>A	2.37:g.210642218C>A	ENSP00000391088:p.Gln179Lys		Somatic				UNC80_uc002vdj.1_Missense_Mutation_p.Q179K	p.Q179K	NM_032504	NP_115893	WXS	Illumina HiSeq	Unspecified	Q8N2C7	UNC80_HUMAN			4	615	+			179					B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	c.535C>A	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669162	0.47677	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.29917	1.55;1.55	6.08	6.08	0.98989	.	0.173029	0.52532	D	0.000079	T	0.25606	0.0623	N	0.22421	0.69	0.80722	D	1	B;B	0.33883	0.038;0.43	B;B	0.30179	0.022;0.112	T	0.02683	-1.1124	10	0.49607	T	0.09	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	179;179	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	K	179	ENSP00000391088:Q179K;ENSP00000272845:Q179K	ENSP00000272845:Q179K	Q	+	1	0	UNC80	210350463	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.858000	0.69532	2.894000	0.99253	0.655000	0.94253	CAG		0.502	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587		68	112	1	0	4.90955e-16	0.01441	6.04079e-16	68	112				
ABCA12	26154	broad.mit.edu	37	2	215845334	215845334	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:215845334T>A	ENST00000272895.7	-	31	4832	c.4613A>T	c.(4612-4614)gAc>gTc	p.D1538V	ABCA12_ENST00000389661.4_Missense_Mutation_p.D1220V	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1538	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCAGCCTCGTCCAAGTGGTG	0.512																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(4612-4614)GAC>GTC		ATP-binding cassette, sub-family A, member 12							128.0	116.0	120.0					2																	215845334		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215845334T>A	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4613A>T	2.37:g.215845334T>A	ENSP00000272895:p.Asp1538Val		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.D1220V|ABCA12_uc010zjn.1_Missense_Mutation_p.D465V	p.D1538V	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	31	4833	-		Renal(323;0.127)	1538			ABC transporter 1.		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.4613A>T	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.774859	0.90108	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.90955	-2.76;-2.76	5.95	5.95	0.96441	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95866	0.8887	10	0.87932	D	0	.	16.4323	0.83853	0.0:0.0:0.0:1.0	.	1538;1220	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	V	1538;1220	ENSP00000272895:D1538V;ENSP00000374312:D1220V	ENSP00000272895:D1538V	D	-	2	0	ABCA12	215553579	1.000000	0.71417	0.954000	0.39281	0.903000	0.53119	8.040000	0.89188	2.281000	0.76405	0.528000	0.53228	GAC		0.512	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		60	42	0	0	0	0.01441	0	60	42				
BCS1L	617	broad.mit.edu	37	2	219528080	219528080	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr2:219528080A>G	ENST00000431802.1	+	8	1930	c.1231A>G	c.(1231-1233)Att>Gtt	p.I411V	BCS1L_ENST00000465706.1_3'UTR|BCS1L_ENST00000392110.2_Missense_Mutation_p.I411V|BCS1L_ENST00000392109.1_Missense_Mutation_p.I411V|BCS1L_ENST00000392111.2_Missense_Mutation_p.I411V|BCS1L_ENST00000439945.1_Missense_Mutation_p.I411V|BCS1L_ENST00000359273.3_Missense_Mutation_p.I411V|BCS1L_ENST00000412366.1_Missense_Mutation_p.I411V			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	411					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTAGGGGCAATTCACAATGC	0.498																																							uc002vio.2		NA																	0					0						c.(1231-1233)ATT>GTT		BCS1-like							60.0	64.0	62.0					2																	219528080		2203	4300	6503	SO:0001583	missense	617				mitochondrial respiratory chain complex I assembly|mitochondrial respiratory chain complex III assembly|mitochondrial respiratory chain complex IV assembly	integral to membrane|mitochondrial respiratory chain complex III	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr2:219528080A>G	AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.1231A>G	2.37:g.219528080A>G	ENSP00000413908:p.Ile411Val		Somatic				BCS1L_uc002vip.2_Missense_Mutation_p.I411V|BCS1L_uc002viq.2_Missense_Mutation_p.I411V|BCS1L_uc010fvu.2_Missense_Mutation_p.I411V|BCS1L_uc010fvv.2_Missense_Mutation_p.I411V|BCS1L_uc002vir.2_Missense_Mutation_p.I411V|BCS1L_uc002vis.2_Missense_Mutation_p.I411V	p.I411V	NM_004328	NP_004319	WXS	Illumina HiSeq	Unspecified	Q9Y276	BCS1_HUMAN		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	8	1649	+		Renal(207;0.0474)	411			Mitochondrial matrix (Potential).		B3KTW9|Q7Z2V7	Missense_Mutation	SNP	ENST00000431802.1	37	c.1231A>G	CCDS2419.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.71|15.71	2.913398|2.913398	0.52439|0.52439	.|.	.|.	ENSG00000074582|ENSG00000074582	ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802|ENST00000426649	D;D;D;D;D;D;D|.	0.87179|.	-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22|.	5.35|5.35	-7.77|-7.77	0.01227|0.01227	.|.	0.685270|.	0.14173|.	N|.	0.336567|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.16233|0.16233	0.39|0.39	0.09310|0.09310	N|N	0.999998|0.999998	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.25187|0.25187	-1.0139|-1.0139	10|5	0.06494|.	T|.	0.89|.	-13.3468|-13.3468	2.4989|2.4989	0.04629|0.04629	0.3821:0.2877:0.2368:0.0934|0.3821:0.2877:0.2368:0.0934	.|.	411|.	Q9Y276|.	BCS1_HUMAN|.	V|S	411|192	ENSP00000352219:I411V;ENSP00000375957:I411V;ENSP00000375958:I411V;ENSP00000375959:I411V;ENSP00000406494:I411V;ENSP00000404999:I411V;ENSP00000413908:I411V|.	ENSP00000352219:I411V|.	I|N	+|+	1|2	0|0	BCS1L|BCS1L	219236324|219236324	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.800000|0.800000	0.45204|0.45204	0.049000|0.049000	0.14099|0.14099	-0.832000|-0.832000	0.04251|0.04251	0.533000|0.533000	0.62120|0.62120	ATT|AAT		0.498	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336756.1	NM_004328		46	47	0	0	0	0.013114	0	46	47				
SIRPG	55423	broad.mit.edu	37	20	1638338	1638338	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:1638338G>T	ENST00000303415.3	-	1	87	c.23C>A	c.(22-24)cCc>cAc	p.P8H	SIRPG_ENST00000344103.4_Missense_Mutation_p.P8H|SIRPG_ENST00000216927.4_Missense_Mutation_p.P8H|SIRPG_ENST00000381583.2_Missense_Mutation_p.P8H	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	8					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AGGAGGATGGGGCCAGGAGGC	0.552																																							uc002wfm.1		NA																	0				ovary(1)	1						c.(22-24)CCC>CAC		signal-regulatory protein gamma isoform 1							129.0	117.0	121.0					20																	1638338		2203	4300	6503	SO:0001583	missense	55423				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding	g.chr20:1638338G>T	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.23C>A	20.37:g.1638338G>T	ENSP00000305529:p.Pro8His		Somatic				SIRPG_uc002wfn.1_Missense_Mutation_p.P8H|SIRPG_uc002wfo.1_Missense_Mutation_p.P8H	p.P8H	NM_018556	NP_061026	WXS	Illumina HiSeq	Unspecified	Q9P1W8	SIRPG_HUMAN			1	88	-			8					B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	c.23C>A	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	12.20	1.865689	0.32977	.	.	ENSG00000089012	ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T	0.11930	4.5;2.73;5.18;5.18	2.29	-0.96	0.10340	.	0.528567	0.15862	N	0.240967	T	0.18257	0.0438	M	0.69823	2.125	0.09310	N	1	P;P;P	0.51240	0.885;0.887;0.943	P;P;P	0.50896	0.653;0.58;0.479	T	0.11518	-1.0584	10	0.87932	D	0	.	2.0764	0.03625	0.3249:0.0:0.4184:0.2567	.	8;8;8	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	H	8	ENSP00000342759:P8H;ENSP00000305529:P8H;ENSP00000370995:P8H;ENSP00000216927:P8H	ENSP00000216927:P8H	P	-	2	0	SIRPG	1586338	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.146000	0.10250	-0.201000	0.10284	0.543000	0.68304	CCC		0.552	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556		35	42	1	0	1.67305e-13	0.00623	1.99421e-13	35	42				
KIF16B	55614	broad.mit.edu	37	20	16359627	16359627	+	Missense_Mutation	SNP	C	C	A	rs61754557	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:16359627C>A	ENST00000354981.2	-	19	3177	c.3020G>T	c.(3019-3021)cGg>cTg	p.R1007L	KIF16B_ENST00000378003.2_Missense_Mutation_p.R233L|KIF16B_ENST00000355755.3_Missense_Mutation_p.R1007L|KIF16B_ENST00000408042.1_Missense_Mutation_p.R1007L	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1007	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GGCCAGGGCCCGCTCCAGCGC	0.547																																							uc002wpg.1		NA																	0				skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						c.(3019-3021)CGG>CTG		kinesin-like motor protein C20orf23							83.0	88.0	86.0					20																	16359627		2203	4300	6503	SO:0001583	missense	55614				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity	g.chr20:16359627C>A	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3020G>T	20.37:g.16359627C>A	ENSP00000347076:p.Arg1007Leu		Somatic				KIF16B_uc002wpe.1_Missense_Mutation_p.R389L|KIF16B_uc002wpf.1_Missense_Mutation_p.R389L|KIF16B_uc010gch.1_Missense_Mutation_p.R1007L|KIF16B_uc010gci.1_Missense_Mutation_p.R1007L|KIF16B_uc010gcj.1_Missense_Mutation_p.R1018L	p.R1007L	NM_024704	NP_078980	WXS	Illumina HiSeq	Unspecified	Q96L93	KI16B_HUMAN			19	3178	-			1007			Glu-rich.|Potential.		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	c.3020G>T	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652896	0.47362	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.72942	-0.67;-0.7;2.48;-0.61	5.59	-0.719	0.11201	.	0.300009	0.35436	N	0.003216	T	0.56529	0.1991	L	0.36672	1.1	0.32875	D	0.50979	P;P;B;B	0.48640	0.553;0.913;0.332;0.418	B;B;B;B	0.41412	0.127;0.356;0.185;0.065	T	0.65269	-0.6209	10	0.59425	D	0.04	.	10.1051	0.42528	0.0:0.3024:0.0:0.6976	.	1007;1007;1007;1007	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	L	1007;1007;851;233;1007	ENSP00000347076:R1007L;ENSP00000347995:R1007L;ENSP00000367242:R233L;ENSP00000384164:R1007L	ENSP00000347076:R1007L	R	-	2	0	KIF16B	16307627	0.053000	0.20554	0.124000	0.21820	0.866000	0.49608	0.315000	0.19451	-0.026000	0.13895	-0.134000	0.14843	CGG		0.547	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683		66	83	1	0	5.08636e-23	0.01441	6.8937e-23	66	83				
CST9L	128821	broad.mit.edu	37	20	23545588	23545588	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:23545588G>T	ENST00000376979.3	-	3	739	c.441C>A	c.(439-441)caC>caA	p.H147Q		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	147						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GTTTCACTCAGTGGAATCCCT	0.537																																							uc002wtk.3		NA																	0					0						c.(439-441)CAC>CAA		cystatin 9-like precursor							138.0	119.0	125.0					20																	23545588		2203	4300	6503	SO:0001583	missense	128821					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23545588G>T		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.441C>A	20.37:g.23545588G>T	ENSP00000366178:p.His147Gln		Somatic					p.H147Q	NM_080610	NP_542177	WXS	Illumina HiSeq	Unspecified	Q9H4G1	CST9L_HUMAN			3	740	-	Colorectal(13;0.0431)|Lung NSC(19;0.235)		147					B2R5A1	Missense_Mutation	SNP	ENST00000376979.3	37	c.441C>A	CCDS13157.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752957	0.31046	.	.	ENSG00000101435	ENST00000376979	T	0.13657	2.57	1.74	-0.51	0.11973	.	1.458320	0.04638	N	0.404930	T	0.08582	0.0213	L	0.36672	1.1	0.09310	N	1	P	0.36647	0.563	B	0.17979	0.02	T	0.29912	-0.9996	10	0.87932	D	0	.	2.8515	0.05559	0.2022:0.3012:0.4966:0.0	.	147	Q9H4G1	CST9L_HUMAN	Q	147	ENSP00000366178:H147Q	ENSP00000366178:H147Q	H	-	3	2	CST9L	23493588	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-1.040000	0.03546	-0.115000	0.11915	0.305000	0.20034	CAC		0.537	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610		47	51	1	0	6.27289e-28	0.01441	8.72324e-28	47	51				
ZNF217	7764	broad.mit.edu	37	20	52198393	52198393	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:52198393C>A	ENST00000371471.2	-	2	1398	c.973G>T	c.(973-975)Gac>Tac	p.D325Y	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.D325Y			O75362	ZN217_HUMAN	zinc finger protein 217	325					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CTCGAATCGTCGTTGTCGGTG	0.532																																							uc002xwq.3		NA																	0				skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(973-975)GAC>TAC		zinc finger protein 217							139.0	133.0	135.0					20																	52198393		2203	4300	6503	SO:0001583	missense	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52198393C>A	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.973G>T	20.37:g.52198393C>A	ENSP00000360526:p.Asp325Tyr		Somatic				ZNF217_uc010gij.1_Missense_Mutation_p.D317Y	p.D325Y	NM_006526	NP_006517	WXS	Illumina HiSeq	Unspecified	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		1	1244	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		325					E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	c.973G>T	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438195	0.43326	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.10477	2.87;2.87	5.7	5.7	0.88788	.	0.279255	0.34676	N	0.003772	T	0.35913	0.0948	M	0.73598	2.24	0.48452	D	0.999651	D	0.89917	1.0	D	0.72075	0.976	T	0.02512	-1.1148	10	0.59425	D	0.04	-34.2783	19.4277	0.94751	0.0:1.0:0.0:0.0	.	325	O75362	ZN217_HUMAN	Y	325	ENSP00000360526:D325Y;ENSP00000304308:D325Y	ENSP00000304308:D325Y	D	-	1	0	ZNF217	51631800	1.000000	0.71417	0.082000	0.20525	0.044000	0.14063	5.639000	0.67868	2.686000	0.91538	0.591000	0.81541	GAC		0.532	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		70	91	1	0	9.12251e-31	0.01441	1.28874e-30	70	91				
GNAS	2778	broad.mit.edu	37	20	57415891	57415891	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:57415891C>T	ENST00000313949.7	+	1	1119	c.730C>T	c.(730-732)Cgt>Tgt	p.R244C	GNAS_ENST00000371098.2_Missense_Mutation_p.R244C|GNAS-AS1_ENST00000598163.1_RNA|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371075.3_Missense_Mutation_p.R244C|GNAS-AS1_ENST00000443966.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R244G(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CCCCATCCGGCGTCACTAATG	0.612			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzt.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		1	Substitution - Missense(1)		lung(1)	pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(730-732)CGT>TGT		GNAS complex locus NESP55							21.0	20.0	20.0					20																	57415891		2199	4287	6486	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57415891C>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.730C>T	20.37:g.57415891C>T	ENSP00000323571:p.Arg244Cys	TSP Lung(22;0.16)	Somatic				GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	p.R244C	NM_016592	NP_057676	WXS	Illumina HiSeq	Unspecified	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	1097	+	all_lung(29;0.0104)		Error:Variant_position_missing_in_P63092_after_alignment					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000313949.7	37	c.730C>T	CCDS13471.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927874	0.73327	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075;ENST00000453292	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	T	0.62865	0.2463	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67078	-0.5761	8	0.87932	D	0	.	13.3277	0.60469	0.0:1.0:0.0:0.0	.	244	O95467	GNAS3_HUMAN	C	244;244;244;165	.	ENSP00000323571:R244C	R	+	1	0	GNAS	56849286	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.685000	0.37659	2.404000	0.81709	0.585000	0.79938	CGT		0.612	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516		11	32	0	0	0	0.008291	0	11	32				
RTEL1	51750	broad.mit.edu	37	20	62317196	62317196	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr20:62317196C>T	ENST00000360203.5	+	16	1644	c.1319C>T	c.(1318-1320)gCc>gTc	p.A440V	RTEL1_ENST00000318100.4_Missense_Mutation_p.A440V|RTEL1_ENST00000508582.2_Missense_Mutation_p.A464V|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.A440V|RTEL1_ENST00000370018.3_Missense_Mutation_p.A440V					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CGGTCTGATGCCTGGAGCACC	0.682																																							uc002yfu.1		NA																	0					0						c.(1318-1320)GCC>GTC		regulator of telomere elongation helicase 1							74.0	62.0	66.0					20																	62317196		2201	4298	6499	SO:0001583	missense	51750				DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding	g.chr20:62317196C>T	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1319C>T	20.37:g.62317196C>T	ENSP00000353332:p.Ala440Val		Somatic				RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.A440V|RTEL1_uc011abd.1_Missense_Mutation_p.A464V|RTEL1_uc011abe.1_Missense_Mutation_p.A217V|RTEL1_uc002yfw.2_RNA	p.A440V	NM_016434	NP_057518	WXS	Illumina HiSeq	Unspecified	Q9NZ71	RTEL1_HUMAN	Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)		16	1662	+	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		440						Missense_Mutation	SNP	ENST00000360203.5	37	c.1319C>T		.	.	.	.	.	.	.	.	.	.	C	7.900	0.734287	0.15574	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203	T;T;T;T	0.81247	-1.45;-1.47;-1.41;-1.46	4.5	3.55	0.40652	.	0.905273	0.09558	N	0.785939	T	0.67477	0.2897	N	0.25485	0.75	0.23010	N	0.998436	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.17098	0.005;0.005;0.017	T	0.52335	-0.8589	10	0.19147	T	0.46	-7.0313	6.554	0.22450	0.0:0.709:0.0:0.291	.	464;440;440	Q9NZ71-7;Q9NZ71;Q9NZ71-6	.;RTEL1_HUMAN;.	V	440;440;464;440	ENSP00000359035:A440V;ENSP00000322287:A440V;ENSP00000424307:A464V;ENSP00000353332:A440V	ENSP00000353332:A440V	A	+	2	0	AL353715.1	61787640	0.000000	0.05858	0.104000	0.21259	0.432000	0.31715	-0.326000	0.07965	0.889000	0.36185	0.313000	0.20887	GCC		0.682	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957		6	24	0	0	0	0.00308	0	6	24				
MRPL39	54148	broad.mit.edu	37	21	26978821	26978821	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr21:26978821C>A	ENST00000352957.4	-	2	261	c.220G>T	c.(220-222)Gac>Tac	p.D74Y	MRPL39_ENST00000307301.7_Missense_Mutation_p.D74Y	NM_017446.3	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39	74						mitochondrial ribosome (GO:0005761)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	10						GTACCGGGGTCAGTTTTCCCA	0.408																																							uc002ylo.2		NA																	0					0						c.(220-222)GAC>TAC		mitochondrial ribosomal protein L39 isoform a							124.0	110.0	115.0					21																	26978821		2203	4300	6503	SO:0001583	missense	54148					mitochondrial ribosome	nucleotide binding	g.chr21:26978821C>A	AB051346	CCDS13573.1, CCDS33522.1	21q11.2-q21	2012-09-13			ENSG00000154719	ENSG00000154719		"""Mitochondrial ribosomal proteins / large subunits"""	14027	protein-coding gene	gene with protein product		611845				11543634	Standard	NM_080794		Approved	RPML5, MRP-L5, MGC104174, PRED66, PRED22, C21orf92, L39mt, MSTP003, MGC3400, FLJ20451	uc002yln.3	Q9NYK5	OTTHUMG00000078371	ENST00000352957.4:c.220G>T	21.37:g.26978821C>A	ENSP00000284967:p.Asp74Tyr		Somatic				MRPL39_uc002yln.2_Missense_Mutation_p.D74Y	p.D74Y	NM_017446	NP_059142	WXS	Illumina HiSeq	Unspecified	Q9NYK5	RM39_HUMAN			2	234	-			74					C9JYA5|Q32Q74|Q5QTR3|Q96Q65|Q9BSQ7|Q9BZV6|Q9NX44	Missense_Mutation	SNP	ENST00000352957.4	37	c.220G>T	CCDS13573.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490747	0.64074	.	.	ENSG00000154719	ENST00000352957;ENST00000307301;ENST00000419219	T;T;T	0.45276	0.9;0.9;0.9	5.46	4.58	0.56647	.	0.137266	0.50627	D	0.000107	T	0.46151	0.1378	M	0.72894	2.215	0.39940	D	0.974399	D;D	0.56521	0.976;0.976	P;P	0.46339	0.513;0.513	T	0.54853	-0.8231	10	0.66056	D	0.02	-12.7373	9.9563	0.41668	0.0:0.7455:0.1765:0.0781	.	74;74	Q9NYK5;Q9NYK5-2	RM39_HUMAN;.	Y	74	ENSP00000284967:D74Y;ENSP00000305682:D74Y;ENSP00000404426:D74Y	ENSP00000305682:D74Y	D	-	1	0	MRPL39	25900692	0.987000	0.35691	0.995000	0.50966	0.971000	0.66376	2.525000	0.45598	1.539000	0.49286	0.591000	0.81541	GAC		0.408	MRPL39-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000171194.1	NM_017446		31	12	1	0	3.1745e-13	0.008361	3.7504e-13	31	12				
TRPM2	7226	broad.mit.edu	37	21	45795821	45795821	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr21:45795821G>T	ENST00000397928.1	+	6	1322	c.877G>T	c.(877-879)Ggc>Tgc	p.G293C	TRPM2_ENST00000397932.2_Missense_Mutation_p.G293C|TRPM2_ENST00000300481.9_Missense_Mutation_p.G293C|TRPM2_ENST00000300482.5_Missense_Mutation_p.G293C|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	293					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CGGGACCCACGGCCAGTACGG	0.582																																							uc002zet.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(877-879)GGC>TGC		transient receptor potential cation channel,							128.0	116.0	120.0					21																	45795821		2203	4300	6503	SO:0001583	missense	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45795821G>T	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.877G>T	21.37:g.45795821G>T	ENSP00000381023:p.Gly293Cys		Somatic				TRPM2_uc002zeu.1_Missense_Mutation_p.G293C|TRPM2_uc002zew.1_Missense_Mutation_p.G293C|TRPM2_uc010gpt.1_Missense_Mutation_p.G293C|TRPM2_uc002zex.1_Missense_Mutation_p.G79C	p.G293C	NM_003307	NP_003298	WXS	Illumina HiSeq	Unspecified	O94759	TRPM2_HUMAN			7	1090	+			293			Cytoplasmic (Potential).		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	c.877G>T	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731470	0.69189	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.67393	-0.5682	10	0.87932	D	0	-33.5323	16.8938	0.86094	0.0:0.0:1.0:0.0	.	293;293	E9PGK7;O94759	.;TRPM2_HUMAN	C	293	ENSP00000300482:G293C;ENSP00000381023:G293C;ENSP00000300481:G293C;ENSP00000381026:G293C	ENSP00000300481:G293C	G	+	1	0	TRPM2	44620249	1.000000	0.71417	0.996000	0.52242	0.493000	0.33554	7.245000	0.78237	2.207000	0.71202	0.563000	0.77884	GGC		0.582	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		30	49	1	0	4.3181e-19	0.013726	5.65163e-19	30	49				
MYO18B	84700	broad.mit.edu	37	22	26422575	26422576	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr22:26422575_26422576CC>AT	ENST00000407587.2	+	43	6807_6808	c.6638_6639CC>AT	c.(6637-6639)gCC>gAT	p.A2213D	MYO18B_ENST00000335473.7_Missense_Mutation_p.A2212D|MYO18B_ENST00000536101.1_Missense_Mutation_p.A2212D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2212						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAAGTGCTTGCCGTCCAGAGAA	0.545																																							uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(6634-6636)GCC>GAT		myosin XVIIIB																																				SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26422575_26422576CC>AT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	Exception_encountered	22.37:g.26422575_26422576delinsAT	ENSP00000386096:p.Ala2213Asp		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.A2093D|MYO18B_uc010guy.1_Missense_Mutation_p.A2094D|MYO18B_uc010guz.1_Missense_Mutation_p.A2092D|MYO18B_uc011aka.1_Missense_Mutation_p.A1366D|MYO18B_uc011akb.1_Missense_Mutation_p.A1725D|MYO18B_uc010gva.1_Missense_Mutation_p.A195D|MYO18B_uc010gvb.1_RNA	p.A2212D	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			43	6885_6886	+			2212					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	DNP	ENST00000407587.2	37	c.6635_6636CC>AT																																																																																					0.545	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		25	10	0	0	0	0.004672	0	25	10				
CRYBB1	1414	broad.mit.edu	37	22	26995528	26995528	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr22:26995528G>T	ENST00000215939.2	-	6	815	c.685C>A	c.(685-687)Ctg>Atg	p.L229M	TPST2_ENST00000403880.1_5'Flank	NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	229	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						AGGCGACGCAGGGACTGCATC	0.617																																							uc003acy.1		NA																	0				ovary(1)	1						c.(685-687)CTG>ATG		crystallin, beta B1							69.0	59.0	62.0					22																	26995528		2203	4300	6503	SO:0001583	missense	1414				visual perception		structural constituent of eye lens	g.chr22:26995528G>T		CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.685C>A	22.37:g.26995528G>T	ENSP00000215939:p.Leu229Met		Somatic					p.L229M	NM_001887	NP_001878	WXS	Illumina HiSeq	Unspecified	P53674	CRBB1_HUMAN			6	755	-			229			Beta/gamma crystallin 'Greek key' 4.			Missense_Mutation	SNP	ENST00000215939.2	37	c.685C>A	CCDS13840.1	.	.	.	.	.	.	.	.	.	.	g	10.44	1.350102	0.24512	.	.	ENSG00000100122	ENST00000215939	T	0.79454	-1.27	4.22	-2.52	0.06346	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.419294	0.26450	N	0.024306	T	0.64886	0.2639	N	0.20530	0.585	0.09310	N	0.999999	B	0.28419	0.211	B	0.43331	0.416	T	0.59537	-0.7436	10	0.52906	T	0.07	.	4.1195	0.10099	0.1429:0.4873:0.2396:0.1302	.	229	P53674	CRBB1_HUMAN	M	229	ENSP00000215939:L229M	ENSP00000215939:L229M	L	-	1	2	CRYBB1	25325528	0.032000	0.19561	0.071000	0.20095	0.814000	0.46013	-0.107000	0.10873	-0.417000	0.07461	-2.436000	0.00213	CTG		0.617	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887		39	6	1	0	2.75727e-19	0.004878	3.66265e-19	39	6				
TBC1D5	9779	broad.mit.edu	37	3	17446369	17446369	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:17446369C>T	ENST00000253692.7	-	6	2025	c.361G>A	c.(361-363)Gaa>Aaa	p.E121K	TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000429924.2_Missense_Mutation_p.E73K|TBC1D5_ENST00000446818.2_Missense_Mutation_p.E121K|TBC1D5_ENST00000429383.4_Missense_Mutation_p.E121K	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	121	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						CTTACTATTTCTTTAATGTTG	0.303																																							uc003cbf.2		NA																	0				ovary(1)	1						c.(361-363)GAA>AAA		TBC1 domain family, member 5 isoform b							32.0	32.0	32.0					3																	17446369		2191	4281	6472	SO:0001583	missense	9779					intracellular	protein binding|Rab GTPase activator activity	g.chr3:17446369C>T	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.361G>A	3.37:g.17446369C>T	ENSP00000253692:p.Glu121Lys		Somatic				TBC1D5_uc010hev.2_Missense_Mutation_p.E121K|TBC1D5_uc003cbe.2_Missense_Mutation_p.E121K|TBC1D5_uc010hew.1_Missense_Mutation_p.E73K	p.E121K	NM_014744	NP_055559	WXS	Illumina HiSeq	Unspecified	Q92609	TBCD5_HUMAN			6	2026	-			121			Rab-GAP TBC.		A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	c.361G>A	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874598	0.72180	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924;ENST00000415814;ENST00000428355;ENST00000425944;ENST00000445294	T;T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.12	5.12	0.69794	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.29716	0.0742	L	0.33792	1.035	0.80722	D	1	B;B;P	0.42518	0.115;0.392;0.782	B;B;P	0.51055	0.262;0.374;0.657	T	0.01062	-1.1464	10	0.38643	T	0.18	-21.0103	18.9154	0.92503	0.0:1.0:0.0:0.0	.	73;121;121	C9J3F6;C9JP52;Q92609	.;.;TBCD5_HUMAN	K	121;121;121;73;121;121;121;121	ENSP00000253692:E121K;ENSP00000398127:E121K;ENSP00000402935:E121K;ENSP00000411925:E73K;ENSP00000396239:E121K;ENSP00000387395:E121K;ENSP00000399967:E121K;ENSP00000410596:E121K	ENSP00000253692:E121K	E	-	1	0	TBC1D5	17421373	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.911000	0.75746	2.552000	0.86080	0.460000	0.39030	GAA		0.303	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744		11	14	0	0	0	0.008291	0	11	14				
SATB1	6304	broad.mit.edu	37	3	18436096	18436096	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:18436096C>T	ENST00000338745.6	-	7	2798	c.1064G>A	c.(1063-1065)aGa>aAa	p.R355K	TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.R355K|SATB1_ENST00000475083.1_5'Flank|SATB1_ENST00000417717.2_Missense_Mutation_p.R355K	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	355					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						ATTCATAGATCTACTGACAGG	0.483																																							uc003cbh.2		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(1063-1065)AGA>AAA		special AT-rich sequence binding protein 1							190.0	187.0	188.0					3																	18436096		2203	4300	6503	SO:0001583	missense	6304				cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding	g.chr3:18436096C>T		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1064G>A	3.37:g.18436096C>T	ENSP00000341024:p.Arg355Lys		Somatic				SATB1_uc003cbi.2_Missense_Mutation_p.R355K|SATB1_uc003cbj.2_Missense_Mutation_p.R355K	p.R355K	NM_002971	NP_002962	WXS	Illumina HiSeq	Unspecified	Q01826	SATB1_HUMAN			7	2799	-			355					B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	c.1064G>A	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.002518	0.54254	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	T;T;T	0.44881	0.91;0.91;0.91	5.75	5.75	0.90469	Lambda repressor-like, DNA-binding (1);	0.163209	0.64402	D	0.000012	T	0.43986	0.1272	L	0.59436	1.845	0.44976	D	0.997994	B;B	0.27853	0.191;0.015	B;B	0.28849	0.095;0.028	T	0.25984	-1.0116	10	0.20046	T	0.44	-29.4639	19.9522	0.97203	0.0:1.0:0.0:0.0	.	355;355	Q01826-2;Q01826	.;SATB1_HUMAN	K	355	ENSP00000341024:R355K;ENSP00000399708:R355K;ENSP00000399518:R355K	ENSP00000341024:R355K	R	-	2	0	SATB1	18411100	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.507000	0.45442	2.725000	0.93324	0.655000	0.94253	AGA		0.483	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010		66	64	0	0	0	0.01441	0	66	64				
UBE2E2	7325	broad.mit.edu	37	3	23631271	23631271	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:23631271A>C	ENST00000396703.1	+	6	735	c.555A>C	c.(553-555)agA>agC	p.R185S	UBE2E2_ENST00000425792.1_Missense_Mutation_p.R185S	NM_152653.3	NP_689866.1	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2	185					ISG15-protein conjugation (GO:0032020)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)		ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(2)	10						TGACCAACAGAGCAGAGCATG	0.592																																					GBM(85;1941 2083 9456)	GBM(85;1941 2083 9456)	uc003ccg.2		NA																	0					0						c.(553-555)AGA>AGC		ubiquitin-conjugating enzyme E2E 2							106.0	90.0	95.0					3																	23631271		2203	4300	6503	SO:0001583	missense	7325				ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity	g.chr3:23631271A>C	AK057886	CCDS2637.1	3p24.2	2011-05-19	2011-05-19		ENSG00000182247	ENSG00000182247		"""Ubiquitin-conjugating enzymes E2"""	12478	protein-coding gene	gene with protein product		602163	"""ubiquitin-conjugating enzyme E2E 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast)"""			9371400	Standard	NM_152653		Approved	UbcH8, FLJ25157	uc003ccg.2	Q96LR5	OTTHUMG00000130482	ENST00000396703.1:c.555A>C	3.37:g.23631271A>C	ENSP00000379931:p.Arg185Ser		Somatic				UBE2E2_uc010hfc.2_RNA	p.R185S	NM_152653	NP_689866	WXS	Illumina HiSeq	Unspecified	Q96LR5	UB2E2_HUMAN			6	735	+			185						Missense_Mutation	SNP	ENST00000396703.1	37	c.555A>C	CCDS2637.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138071	0.77775	.	.	ENSG00000182247	ENST00000425792;ENST00000396703	T;T	0.37915	1.17;1.17	5.69	4.55	0.56014	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000001	T	0.63510	0.2517	M	0.90252	3.1	0.54753	D	0.999982	D	0.71674	0.998	D	0.68353	0.957	T	0.69206	-0.5206	10	0.87932	D	0	.	10.5767	0.45231	0.9227:0.0:0.0773:0.0	.	185	Q96LR5	UB2E2_HUMAN	S	185	ENSP00000401053:R185S;ENSP00000379931:R185S	ENSP00000379931:R185S	R	+	3	2	UBE2E2	23606275	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.571000	0.60879	1.001000	0.39076	0.533000	0.62120	AGA		0.592	UBE2E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252881.2	NM_152653		11	62	0	0	0	0.013537	0	11	62				
OSBPL10	114884	broad.mit.edu	37	3	31710172	31710172	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:31710172C>A	ENST00000396556.2	-	10	2180	c.2058G>T	c.(2056-2058)aaG>aaT	p.K686N	OSBPL10_ENST00000438237.2_Missense_Mutation_p.K622N	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	686					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GAGGTCTGATCTTCTTGGGAT	0.512																																							uc003cev.2		NA																	0				skin(1)	1						c.(2056-2058)AAG>AAT		oxysterol-binding protein-like protein 10							238.0	198.0	212.0					3																	31710172		2203	4300	6503	SO:0001583	missense	114884				lipid transport		lipid binding	g.chr3:31710172C>A	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.2058G>T	3.37:g.31710172C>A	ENSP00000379804:p.Lys686Asn		Somatic				OSBPL10_uc003ceu.1_Missense_Mutation_p.K443N|OSBPL10_uc011axf.1_Missense_Mutation_p.K622N	p.K686N	NM_017784	NP_060254	WXS	Illumina HiSeq	Unspecified	Q9BXB5	OSB10_HUMAN		STAD - Stomach adenocarcinoma(1;0.00406)	11	2439	-			686					B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	c.2058G>T	CCDS2651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.97|11.97	1.797280|1.797280	0.31777|0.31777	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000396556;ENST00000438237|ENST00000429492	T;T|.	0.32023|.	1.47;1.47|.	4.87|4.87	3.98|3.98	0.46160|0.46160	.|.	0.135922|.	0.64402|.	D|.	0.000004|.	T|T	0.60560|0.60560	0.2278|0.2278	L|L	0.55743|0.55743	1.74|1.74	0.47308|0.47308	D|D	0.999382|0.999382	D;P;B|.	0.56968|.	0.978;0.464;0.254|.	P;B;P|.	0.59643|.	0.861;0.288;0.456|.	T|T	0.58165|0.58165	-0.7684|-0.7684	10|5	0.41790|.	T|.	0.15|.	-21.9359|-21.9359	10.4806|10.4806	0.44691|0.44691	0.0:0.8455:0.0:0.1545|0.0:0.8455:0.0:0.1545	.|.	622;686;454|.	B4E212;Q9BXB5;Q59ED9|.	.;OSB10_HUMAN;.|.	N|I	686;622|455	ENSP00000379804:K686N;ENSP00000406124:K622N|.	ENSP00000379804:K686N|.	K|R	-|-	3|2	2|0	OSBPL10|OSBPL10	31685176|31685176	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.236000|0.236000	0.25371|0.25371	1.763000|1.763000	0.38461|0.38461	1.324000|1.324000	0.45282|0.45282	0.655000|0.655000	0.94253|0.94253	AAG|AGA		0.512	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2			22	58	1	0	1.96895e-08	0.00278	2.11979e-08	22	58				
NKTR	4820	broad.mit.edu	37	3	42680794	42680794	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:42680794A>T	ENST00000232978.8	+	13	3786	c.3598A>T	c.(3598-3600)Agc>Tgc	p.S1200C	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	1200					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CAGCTCTGCTAGCTTGGCTAG	0.512																																							uc003clo.2		NA																	0				ovary(2)|skin(1)	3						c.(3598-3600)AGC>TGC		natural killer-tumor recognition sequence							101.0	96.0	98.0					3																	42680794		2203	4300	6503	SO:0001583	missense	4820				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr3:42680794A>T		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.3598A>T	3.37:g.42680794A>T	ENSP00000232978:p.Ser1200Cys		Somatic				NKTR_uc003clm.1_Missense_Mutation_p.S947C|NKTR_uc003clp.2_Missense_Mutation_p.S947C|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Missense_Mutation_p.S1090C|NKTR_uc003clr.1_Missense_Mutation_p.S947C|NKTR_uc003cls.2_Missense_Mutation_p.S900C	p.S1200C	NM_005385	NP_005376	WXS	Illumina HiSeq	Unspecified	P30414	NKTR_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.24)	13	3745	+			1200						Missense_Mutation	SNP	ENST00000232978.8	37	c.3598A>T	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.407196	0.42715	.	.	ENSG00000114857	ENST00000232978	D	0.82081	-1.57	5.22	-1.98	0.07480	.	1.141800	0.06350	N	0.709623	D	0.86443	0.5934	L	0.59436	1.845	0.09310	N	0.999999	D;P	0.76494	0.999;0.871	P;B	0.61722	0.893;0.237	T	0.75988	-0.3123	10	0.87932	D	0	-0.0104	8.2973	0.31993	0.2706:0.225:0.5044:0.0	.	900;1200	Q6M1B8;P30414	.;NKTR_HUMAN	C	1200	ENSP00000232978:S1200C	ENSP00000232978:S1200C	S	+	1	0	NKTR	42655798	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	0.062000	0.14389	0.030000	0.15379	0.460000	0.39030	AGC		0.512	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		16	46	0	0	0	0.00499	0	16	46				
WDR6	11180	broad.mit.edu	37	3	49049802	49049802	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:49049802G>A	ENST00000608424.1	+	2	874	c.835G>A	c.(835-837)Gtc>Atc	p.V279I	WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000448293.1_Missense_Mutation_p.V228I|WDR6_ENST00000395474.3_Missense_Mutation_p.V309I|WDR6_ENST00000415265.2_Intron			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	279					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		AGAGGATTGTGTCTGCTTGGT	0.587																																							uc003cvj.2		NA																	0				central_nervous_system(1)	1						c.(925-927)GTC>ATC		WD repeat domain 6 protein							71.0	76.0	74.0					3																	49049802		2203	4300	6503	SO:0001583	missense	11180				cell cycle arrest|negative regulation of cell proliferation	cytoplasm		g.chr3:49049802G>A	AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.835G>A	3.37:g.49049802G>A	ENSP00000477389:p.Val279Ile		Somatic				WDR6_uc011bbx.1_Missense_Mutation_p.V180I|WDR6_uc011bby.1_Intron|WDR6_uc010hkn.2_Missense_Mutation_p.V253I|WDR6_uc011bbz.1_Missense_Mutation_p.V228I	p.V309I	NM_018031	NP_060501	WXS	Illumina HiSeq	Unspecified	Q9NNW5	WDR6_HUMAN		Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)	2	1063	+			279			WD 4.		B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37	c.925G>A		.	.	.	.	.	.	.	.	.	.	G	21.4	4.139345	0.77775	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;D	0.90133	-0.18;-2.62	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056374	0.64402	D	0.000002	D	0.88220	0.6378	N	0.14661	0.345	0.43360	D	0.995438	P;P;P	0.52170	0.951;0.951;0.897	P;P;P	0.51615	0.675;0.675;0.579	D	0.89199	0.3556	10	0.46703	T	0.11	-30.0426	18.1959	0.89822	0.0:0.0:1.0:0.0	.	150;279;228	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	I	309;228	ENSP00000378857:V309I;ENSP00000413432:V228I	ENSP00000378857:V309I	V	+	1	0	WDR6	49024806	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	4.885000	0.63142	2.594000	0.87642	0.561000	0.74099	GTC		0.587	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1			18	44	0	0	0	0.00499	0	18	44				
OR5H1	26341	broad.mit.edu	37	3	97851965	97851965	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:97851965A>T	ENST00000354565.2	+	1	424	c.424A>T	c.(424-426)Atc>Ttc	p.I142F	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TGGACTGTGCATCCGGCTATT	0.388																																							uc011bgt.1		NA																	0				ovary(1)|breast(1)	2						c.(424-426)ATC>TTC		olfactory receptor, family 5, subfamily H,							65.0	74.0	71.0					3																	97851965		2182	4276	6458	SO:0001583	missense	26341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97851965A>T	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.424A>T	3.37:g.97851965A>T	ENSP00000346575:p.Ile142Phe		Somatic					p.I142F	NM_001005338	NP_001005338	WXS	Illumina HiSeq	Unspecified	A6NKK0	OR5H1_HUMAN			1	424	+			142			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000354565.2	37	c.424A>T	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	1.771	-0.484431	0.04352	.	.	ENSG00000231192	ENST00000354565	T	0.38077	1.16	3.57	-7.14	0.01527	GPCR, rhodopsin-like superfamily (1);	1.444560	0.04728	N	0.420625	T	0.25121	0.0610	L	0.52573	1.65	0.09310	N	1	B	0.02656	0.0	B	0.12837	0.008	T	0.14448	-1.0472	10	0.27785	T	0.31	.	2.5987	0.04861	0.1934:0.276:0.3946:0.136	.	142	A6NKK0	OR5H1_HUMAN	F	142	ENSP00000346575:I142F	ENSP00000346575:I142F	I	+	1	0	OR5H1	99334655	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.693000	0.00829	-1.990000	0.00978	-1.322000	0.01289	ATC		0.388	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338		44	80	0	0	0	0.01441	0	44	80				
OR5H14	403273	broad.mit.edu	37	3	97868653	97868653	+	Missense_Mutation	SNP	A	A	T	rs201359365	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:97868653A>T	ENST00000437310.1	+	1	484	c.424A>T	c.(424-426)Atc>Ttc	p.I142F	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGGACTGTGCATCCGGCTATT	0.388																																							uc003dsg.1		NA																	0				skin(1)	1						c.(424-426)ATC>TTC		olfactory receptor, family 5, subfamily H,							116.0	120.0	119.0					3																	97868653		2202	4299	6501	SO:0001583	missense	403273				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97868653A>T		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.424A>T	3.37:g.97868653A>T	ENSP00000401706:p.Ile142Phe		Somatic					p.I142F	NM_001005514	NP_001005514	WXS	Illumina HiSeq	Unspecified	A6NHG9	O5H14_HUMAN			1	424	+			142			Cytoplasmic (Potential).		B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	c.424A>T	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	A	7.853	0.724418	0.15439	.	.	ENSG00000236032	ENST00000437310	T	0.38077	1.16	2.49	-1.88	0.07713	GPCR, rhodopsin-like superfamily (1);	1.468830	0.04625	N	0.402561	T	0.29223	0.0727	L	0.49778	1.585	0.09310	N	1	B	0.10296	0.003	B	0.18561	0.022	T	0.16217	-1.0410	10	0.22706	T	0.39	.	4.2643	0.10756	0.3055:0.2237:0.4708:0.0	.	142	A6NHG9	O5H14_HUMAN	F	142	ENSP00000401706:I142F	ENSP00000401706:I142F	I	+	1	0	OR5H14	99351343	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.874000	0.01636	-0.570000	0.06022	0.164000	0.16699	ATC		0.388	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1			7	167	0	0	0	0.008291	0	7	167				
PDIA5	10954	broad.mit.edu	37	3	122865026	122865026	+	Silent	SNP	G	G	A	rs372369512	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:122865026G>A	ENST00000316218.7	+	13	1157	c.1062G>A	c.(1060-1062)acG>acA	p.T354T	PDIA5_ENST00000467157.1_3'UTR	NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	354	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		AGTTTCCTACGTTGAAGTATT	0.478													G|||	2	0.000399361	0.0	0.0	5008	,	,		21270	0.001		0.0	False		,,,				2504	0.001						uc003egc.1		NA																	0				ovary(1)	1						c.(1060-1062)ACG>ACA		protein disulfide isomerase A5 precursor		G		0,4406		0,0,2203	141.0	148.0	145.0		1062	-5.8	0.6	3		145	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PDIA5	NM_006810.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		354/520	122865026	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10954				cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr3:122865026G>A	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.1062G>A	3.37:g.122865026G>A			Somatic				PDIA5_uc003egd.1_RNA	p.T354T	NM_006810	NP_006801	WXS	Illumina HiSeq	Unspecified	Q14554	PDIA5_HUMAN		GBM - Glioblastoma multiforme(114;0.0427)	13	1118	+			354			Thioredoxin 2.		D3DN95|Q9BV43	Silent	SNP	ENST00000316218.7	37	c.1062G>A	CCDS3020.1																																																																																				0.478	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810		46	117	0	0	0	0.010771	0	46	117				
PTPLB	201562	broad.mit.edu	37	3	123247306	123247306	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:123247306G>C	ENST00000383657.5	-	4	465	c.308C>G	c.(307-309)tCt>tGt	p.S103C		NM_198402.3	NP_940684.1	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b	103					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			kidney(2)	2				GBM - Glioblastoma multiforme(114;0.1)		CAGGACAACAGAAGATGGAAC	0.308																																							uc003egj.2		NA																	0				kidney(1)	1						c.(307-309)TCT>TGT		protein tyrosine phosphatase-like (proline							135.0	122.0	126.0					3																	123247306		1823	4090	5913	SO:0001583	missense	201562				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein binding	g.chr3:123247306G>C	AK074605	CCDS46895.1	3q21.1	2010-04-30			ENSG00000206527	ENSG00000206527			9640	protein-coding gene	gene with protein product		615939				15024066	Standard	NM_198402		Approved		uc003egj.2	Q6Y1H2	OTTHUMG00000159529	ENST00000383657.5:c.308C>G	3.37:g.123247306G>C	ENSP00000373153:p.Ser103Cys		Somatic					p.S103C	NM_198402	NP_940684	WXS	Illumina HiSeq	Unspecified	Q6Y1H2	HACD2_HUMAN		GBM - Glioblastoma multiforme(114;0.1)	4	358	-			103			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000383657.5	37	c.308C>G	CCDS46895.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941746	0.73557	.	.	ENSG00000206527	ENST00000383657	T	0.32753	1.44	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.59155	0.2173	M	0.82323	2.585	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.64419	-0.6412	10	0.62326	D	0.03	-12.6103	15.5733	0.76356	0.0:0.0:1.0:0.0	.	103	Q6Y1H2	HACD2_HUMAN	C	103	ENSP00000373153:S103C	ENSP00000373153:S103C	S	-	2	0	PTPLB	124729996	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.465000	0.80898	2.475000	0.83589	0.655000	0.94253	TCT		0.308	PTPLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356021.3	NM_198402		14	40	0	0	0	0.004007	0	14	40				
KALRN	8997	broad.mit.edu	37	3	123813710	123813710	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:123813710G>C	ENST00000240874.3	+	1	183	c.26G>C	c.(25-27)tGg>tCg	p.W9S	KALRN_ENST00000477496.1_3'UTR|KALRN_ENST00000460856.1_Missense_Mutation_p.W9S|KALRN_ENST00000360013.3_Missense_Mutation_p.W9S	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	9					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGGGACCAGTGGTATCTCTGG	0.557																																							uc003ehg.2		NA																	0				large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						c.(25-27)TGG>TCG		kalirin, RhoGEF kinase isoform 1							187.0	134.0	152.0					3																	123813710		2203	4300	6503	SO:0001583	missense	8997				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr3:123813710G>C	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.26G>C	3.37:g.123813710G>C	ENSP00000240874:p.Trp9Ser		Somatic				KALRN_uc003ehd.2_Intron|KALRN_uc003ehe.2_RNA|KALRN_uc010hru.1_RNA|KALRN_uc010hrv.1_Missense_Mutation_p.W9S|KALRN_uc010hrw.1_RNA|KALRN_uc003ehf.1_Missense_Mutation_p.W9S|KALRN_uc011bjy.1_Missense_Mutation_p.W9S	p.W9S	NM_001024660	NP_001019831	WXS	Illumina HiSeq	Unspecified	O60229	KALRN_HUMAN			1	153	+			9					A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	c.26G>C	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	g	13.70	2.314434	0.40996	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.59224	0.82;0.75;0.28	3.7	3.7	0.42460	.	0.318222	0.22047	U	0.065365	T	0.42832	0.1220	N	0.14661	0.345	0.80722	D	1	P;P;P	0.47106	0.824;0.824;0.89	B;B;P	0.49332	0.403;0.403;0.607	T	0.20538	-1.0272	10	0.07482	T	0.82	.	11.2459	0.48996	0.0:0.0:1.0:0.0	.	9;9;9	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	S	9	ENSP00000418611:W9S;ENSP00000240874:W9S;ENSP00000353109:W9S	ENSP00000240874:W9S	W	+	2	0	KALRN	125296400	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.749000	0.55150	2.361000	0.80049	0.486000	0.48141	TGG		0.557	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947		24	12	0	0	0	0.00632	0	24	12				
RUVBL1	8607	broad.mit.edu	37	3	127842496	127842496	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:127842496C>T	ENST00000322623.5	-	1	171	c.72G>A	c.(70-72)ctG>ctA	p.L24L	RUVBL1_ENST00000464873.1_Intron|RUVBL1_ENST00000417360.1_Silent_p.L24L	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	24					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		CGTCCAGCCCCAGCCCTTTCA	0.637																																							uc003ekh.2		NA																	0				skin(1)	1						c.(70-72)CTG>CTA		RuvB-like 1							45.0	45.0	45.0					3																	127842496		2203	4300	6503	SO:0001819	synonymous_variant	8607				cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding	g.chr3:127842496C>T	AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.72G>A	3.37:g.127842496C>T			Somatic				RUVBL1_uc003ekf.2_Intron|RUVBL1_uc010hss.2_Silent_p.L24L	p.L24L	NM_003707	NP_003698	WXS	Illumina HiSeq	Unspecified	Q9Y265	RUVB1_HUMAN		GBM - Glioblastoma multiforme(114;0.181)	1	176	-			24					B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Silent	SNP	ENST00000322623.5	37	c.72G>A	CCDS3047.1																																																																																				0.637	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2			14	29	0	0	0	0.003163	0	14	29				
XRN1	54464	broad.mit.edu	37	3	142037437	142037437	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:142037437T>A	ENST00000264951.4	-	39	4732	c.4615A>T	c.(4615-4617)Act>Tct	p.T1539S	XRN1_ENST00000392981.2_Missense_Mutation_p.T1540S	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1539					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATCTTACCAGTAGGTGGGGGA	0.368																																							uc003eus.2		NA																	0				ovary(3)	3						c.(4615-4617)ACT>TCT		5'-3' exoribonuclease 1 isoform a							51.0	56.0	54.0					3																	142037437		2203	4300	6503	SO:0001583	missense	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142037437T>A	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4615A>T	3.37:g.142037437T>A	ENSP00000264951:p.Thr1539Ser		Somatic				XRN1_uc010huu.2_Missense_Mutation_p.T1006S|XRN1_uc003eut.2_Missense_Mutation_p.T1539S|XRN1_uc003euu.2_Missense_Mutation_p.T1540S	p.T1539S	NM_019001	NP_061874	WXS	Illumina HiSeq	Unspecified	Q8IZH2	XRN1_HUMAN			39	4682	-			1539					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	c.4615A>T	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	T	0.240	-1.014187	0.02095	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.32272	1.46;1.53	5.07	2.47	0.30058	.	0.313605	0.32884	N	0.005526	T	0.17916	0.0430	N	0.24115	0.695	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.06427	-1.0827	10	0.12766	T	0.61	.	11.3592	0.49633	0.0:0.0:0.4161:0.5839	.	1540;1539	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	S	1539;1540	ENSP00000264951:T1539S;ENSP00000376707:T1540S	ENSP00000264951:T1539S	T	-	1	0	XRN1	143520127	0.922000	0.31269	0.999000	0.59377	0.289000	0.27227	-0.234000	0.09028	0.744000	0.32741	-0.461000	0.05368	ACT		0.368	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		3	5	0	0	0	0.004672	0	3	5				
SIAH2	6478	broad.mit.edu	37	3	150459956	150459956	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:150459956T>C	ENST00000312960.3	-	2	1474	c.947A>G	c.(946-948)aAt>aGt	p.N316S		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	316	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AATAGTAACATTGATTCCAAG	0.388																																							uc003eyi.2		NA																	0				ovary(1)|lung(1)	2						c.(946-948)AAT>AGT		seven in absentia homolog 2							84.0	80.0	81.0					3																	150459956		2203	4300	6503	SO:0001583	missense	6478				apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:150459956T>C	U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.947A>G	3.37:g.150459956T>C	ENSP00000322457:p.Asn316Ser		Somatic					p.N316S	NM_005067	NP_005058	WXS	Illumina HiSeq	Unspecified	O43255	SIAH2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		2	1574	-			316			SBD.		O43270	Missense_Mutation	SNP	ENST00000312960.3	37	c.947A>G	CCDS3152.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.295560	0.81025	.	.	ENSG00000181788	ENST00000312960	T	0.25414	1.8	5.81	4.64	0.57946	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	M	0.88979	2.995	0.52099	D	0.99994	P	0.49696	0.927	P	0.45037	0.467	T	0.49725	-0.8909	10	0.56958	D	0.05	.	12.2266	0.54463	0.1277:0.0:0.0:0.8722	.	316	O43255	SIAH2_HUMAN	S	316	ENSP00000322457:N316S	ENSP00000322457:N316S	N	-	2	0	SIAH2	151942646	1.000000	0.71417	0.991000	0.47740	0.984000	0.73092	8.024000	0.88770	0.992000	0.38840	0.482000	0.46254	AAT		0.388	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	NM_005067		18	54	0	0	0	0.008871	0	18	54				
KLHL24	54800	broad.mit.edu	37	3	183368462	183368463	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:183368462_183368463GG>TT	ENST00000454652.2	+	4	704_705	c.318_319GG>TT	c.(316-321)ttGGtt>ttTTtt	p.106_107LV>FF	KLHL24_ENST00000242810.6_Missense_Mutation_p.106_107LV>FF|KLHL24_ENST00000476808.1_Missense_Mutation_p.106_107LV>FF	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	106	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GAGAAATGTTGGTTGAGATCAA	0.396																																							uc003flv.2		NA																	0				ovary(1)	1						c.(316-321)TTGGTT>TTTTTT		DRE1 protein																																				SO:0001583	missense	54800					axon|cytoplasm|perikaryon		g.chr3:183368462_183368463GG>TT		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	Exception_encountered	3.37:g.183368462_183368463delinsTT	ENSP00000395012:p.L106_V107delinsFF		Somatic				KLHL24_uc003flw.2_Missense_Mutation_p.106_107LV>FF|KLHL24_uc003flx.2_Missense_Mutation_p.106_107LV>FF	p.106_107LV>FF	NM_017644	NP_060114	WXS	Illumina HiSeq	Unspecified	Q6TFL4	KLH24_HUMAN	all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)		3	613_614	+	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		106_107			BTB.		A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	DNP	ENST00000454652.2	37	c.318_319GG>TT	CCDS3246.1																																																																																				0.396	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		92	67	0	0	0	0.004672	0	92	67				
FGF12	2257	broad.mit.edu	37	3	191888341	191888341	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:191888341C>T	ENST00000454309.2	-	4	1344	c.519G>A	c.(517-519)tgG>tgA	p.W173*	FGF12_ENST00000264730.3_Nonsense_Mutation_p.W111*|FGF12_ENST00000445105.2_Nonsense_Mutation_p.W111*|FGF12_ENST00000450716.1_Nonsense_Mutation_p.W111*|FGF12_ENST00000430714.1_Nonsense_Mutation_p.W74*	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	173					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		GTCCCAGAAACCAAGCTCGGC	0.408																																							uc003fsx.2		NA																	0				ovary(1)|skin(1)|lung(1)|pancreas(1)	4						c.(517-519)TGG>TGA		fibroblast growth factor 12 isoform 1							215.0	219.0	217.0					3																	191888341		2203	4300	6503	SO:0001587	stop_gained	2257				cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding	g.chr3:191888341C>T	U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.519G>A	3.37:g.191888341C>T	ENSP00000413496:p.Trp173*		Somatic				FGF12_uc003fsy.2_Nonsense_Mutation_p.W111*	p.W173*	NM_021032	NP_066360	WXS	Illumina HiSeq	Unspecified	P61328	FGF12_HUMAN	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)	4	1345	-	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	173					B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Nonsense_Mutation	SNP	ENST00000454309.2	37	c.519G>A	CCDS3301.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.980151	0.92982	.	.	ENSG00000114279	ENST00000264730;ENST00000392454;ENST00000445105;ENST00000454309;ENST00000440901;ENST00000450716;ENST00000430714;ENST00000448795	.	.	.	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9912	0.80206	0.1354:0.8646:0.0:0.0	.	.	.	.	X	111;111;111;173;68;111;74;87	.	ENSP00000264730:W111X	W	-	3	0	FGF12	193371035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.437000	0.80417	1.566000	0.49654	0.655000	0.94253	TGG		0.408	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032		35	152	0	0	0	0.003755	0	35	152				
HTT	3064	broad.mit.edu	37	4	3176766	3176766	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:3176766C>T	ENST00000355072.5	+	33	4484	c.4339C>T	c.(4339-4341)Cag>Tag	p.Q1447*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1447					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GTTACAGAAGCAGGTTTTAGA	0.368																																							uc011bvq.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(4345-4347)CAG>TAG		huntingtin							151.0	134.0	139.0					4																	3176766		1848	4106	5954	SO:0001587	stop_gained	3064				establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding	g.chr4:3176766C>T	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4339C>T	4.37:g.3176766C>T	ENSP00000347184:p.Gln1447*		Somatic					p.Q1449*	NM_002111	NP_002102	WXS	Illumina HiSeq	Unspecified	P42858	HD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)	34	4490	+		all_epithelial(65;0.18)	1447					Q9UQB7	Nonsense_Mutation	SNP	ENST00000355072.5	37	c.4345C>T	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	46	12.392292	0.99663	.	.	ENSG00000197386	ENST00000355072	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.6214	0.95658	0.0:1.0:0.0:0.0	.	.	.	.	X	1447	.	ENSP00000347184:Q1447X	Q	+	1	0	HTT	3146564	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.706000	0.92434	0.650000	0.86243	CAG		0.368	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		28	36	0	0	0	0.005443	0	28	36				
EVC2	132884	broad.mit.edu	37	4	5624431	5624431	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:5624431C>T	ENST00000344408.5	-	14	2387	c.2334G>A	c.(2332-2334)gaG>gaA	p.E778E	EVC2_ENST00000344938.1_Silent_p.E778E|EVC2_ENST00000310917.2_Silent_p.E698E	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	778					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TGCCGTGCTCCTCCAGGATCT	0.657																																							uc003gij.2		NA																	0				large_intestine(3)|ovary(2)	5						c.(2332-2334)GAG>GAA		limbin							56.0	48.0	51.0					4																	5624431		2203	4300	6503	SO:0001819	synonymous_variant	132884					integral to membrane		g.chr4:5624431C>T	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2334G>A	4.37:g.5624431C>T			Somatic				EVC2_uc011bwb.1_Silent_p.E218E|EVC2_uc003gik.2_Silent_p.E698E	p.E778E	NM_147127	NP_667338	WXS	Illumina HiSeq	Unspecified	Q86UK5	LBN_HUMAN			14	2388	-			778			Potential.		Q86YT3|Q86YT4|Q8NG49	Silent	SNP	ENST00000344408.5	37	c.2334G>A	CCDS3382.2																																																																																				0.657	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		15	57	0	0	0	0.003163	0	15	57				
WDR1	9948	broad.mit.edu	37	4	10083005	10083005	+	Silent	SNP	G	G	A	rs368099158		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:10083005G>A	ENST00000499869.2	-	11	1453	c.1260C>T	c.(1258-1260)taC>taT	p.Y420Y	WDR1_ENST00000382451.2_Silent_p.Y280Y|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000382452.2_Silent_p.Y420Y|MIR3138_ENST00000585238.1_RNA|WDR1_ENST00000502702.1_Silent_p.Y280Y			O75083	WDR1_HUMAN	WD repeat domain 1	420					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CGACCACGGCGTATCCCCCGG	0.557																																							uc003gmf.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1258-1260)TAC>TAT		WD repeat-containing protein 1 isoform 1							79.0	90.0	87.0					4																	10083005		2045	4186	6231	SO:0001819	synonymous_variant	9948				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding	g.chr4:10083005G>A	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1260C>T	4.37:g.10083005G>A			Somatic				WDR1_uc003gmg.2_Silent_p.Y280Y|WDR1_uc010idm.2_RNA|hsa-mir-3138|MI0014161_5'Flank	p.Y420Y	NM_017491	NP_059830	WXS	Illumina HiSeq	Unspecified	O75083	WDR1_HUMAN		STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)	11	1543	-			420					A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Silent	SNP	ENST00000499869.2	37	c.1260C>T	CCDS54740.1																																																																																				0.557	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1			8	41	0	0	0	0.006214	0	8	41				
GPR125	166647	broad.mit.edu	37	4	22390127	22390127	+	Missense_Mutation	SNP	G	G	A	rs200161840		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:22390127G>A	ENST00000334304.5	-	19	3436	c.3167C>T	c.(3166-3168)gCg>gTg	p.A1056V	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1056					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CATGATCCACGCAAGTCTAAC	0.498																																							uc003gqm.1		NA																	0				skin(1)	1						c.(3166-3168)GCG>GTG		G protein-coupled receptor 125 precursor		G	VAL/ALA	0,4406		0,0,2203	97.0	82.0	87.0		3167	5.9	0.2	4		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR125	NM_145290.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1056/1322	22390127	1,13005	2203	4300	6503	SO:0001583	missense	166647				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity	g.chr4:22390127G>A	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3167C>T	4.37:g.22390127G>A	ENSP00000334952:p.Ala1056Val		Somatic				GPR125_uc010ieo.1_Missense_Mutation_p.A912V|GPR125_uc003gql.1_Missense_Mutation_p.A183V	p.A1056V	NM_145290	NP_660333	WXS	Illumina HiSeq	Unspecified	Q8IWK6	GP125_HUMAN			19	3432	-		Breast(46;0.198)	1056			Cytoplasmic (Potential).		Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	c.3167C>T	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520394	0.27211	0.0	1.16E-4	ENSG00000152990	ENST00000334304	T	0.43294	0.95	5.94	5.94	0.96194	.	0.340853	0.35151	N	0.003403	T	0.44871	0.1314	L	0.57536	1.79	0.80722	D	1	B;B	0.26672	0.156;0.103	B;B	0.22601	0.04;0.017	T	0.27938	-1.0059	10	0.46703	T	0.11	-22.1272	20.3501	0.98811	0.0:0.0:1.0:0.0	.	913;1056	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	V	1056	ENSP00000334952:A1056V	ENSP00000334952:A1056V	A	-	2	0	GPR125	21999225	0.893000	0.30496	0.151000	0.22473	0.502000	0.33828	3.657000	0.54474	2.807000	0.96579	0.650000	0.86243	GCG		0.498	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			26	55	0	0	0	0.004656	0	26	55				
GABRA4	2557	broad.mit.edu	37	4	46979530	46979530	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:46979530C>A	ENST00000264318.3	-	4	1373	c.391G>T	c.(391-393)Gat>Tat	p.D131Y		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	131					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	AAGAAAGTATCAGGGGTCCAC	0.343																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(391-393)GAT>TAT		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						97.0	96.0	97.0					4																	46979530		2202	4300	6502	SO:0001583	missense	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46979530C>A		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.391G>T	4.37:g.46979530C>A	ENSP00000264318:p.Asp131Tyr		Somatic					p.D131Y	NM_000809	NP_000800	WXS	Illumina HiSeq	Unspecified	P48169	GBRA4_HUMAN			4	530	-			131			Extracellular (Probable).		Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	c.391G>T	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689649	0.88735	.	.	ENSG00000109158	ENST00000264318	D	0.84944	-1.92	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel ligand-binding (3);	0.102108	0.64402	D	0.000003	D	0.95623	0.8577	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96990	0.9721	10	0.87932	D	0	.	18.2112	0.89871	0.0:1.0:0.0:0.0	.	131	P48169	GBRA4_HUMAN	Y	131	ENSP00000264318:D131Y	ENSP00000264318:D131Y	D	-	1	0	GABRA4	46674287	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.647000	0.83462	2.776000	0.95493	0.650000	0.86243	GAT		0.343	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			31	50	1	0	3.57733e-08	0.009535	3.83593e-08	31	50				
SRD5A3	79644	broad.mit.edu	37	4	56230251	56230251	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:56230251G>A	ENST00000264228.4	+	3	603	c.375G>A	c.(373-375)ctG>ctA	p.L125L	SRD5A3-AS1_ENST00000609573.1_RNA|SRD5A3-AS1_ENST00000596312.1_RNA|SRD5A3-AS1_ENST00000595103.1_RNA|SRD5A3-AS1_ENST00000608265.1_RNA|SRD5A3-AS1_ENST00000608086.1_RNA|SRD5A3-AS1_ENST00000609700.1_RNA|SRD5A3-AS1_ENST00000608558.1_RNA|SRD5A3-AS1_ENST00000598906.1_RNA|SRD5A3-AS1_ENST00000609487.1_RNA|SRD5A3-AS1_ENST00000595734.1_RNA|SRD5A3-AS1_ENST00000609580.1_RNA|SRD5A3-AS1_ENST00000609051.1_RNA|SRD5A3-AS1_ENST00000510637.1_RNA|SRD5A3-AS1_ENST00000596289.1_RNA|SRD5A3-AS1_ENST00000433175.2_RNA|SRD5A3-AS1_ENST00000609500.1_RNA|SRD5A3_ENST00000514398.1_3'UTR	NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	125					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	GAGGGGAGCTGGCACTGTCTG	0.428																																							uc003hau.2		NA																	0					0						c.(373-375)CTG>CTA		steroid 5 alpha-reductase 3							228.0	207.0	214.0					4																	56230251		2203	4300	6503	SO:0001819	synonymous_variant	79644				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	g.chr4:56230251G>A	AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.375G>A	4.37:g.56230251G>A			Somatic				uc003hav.1_RNA	p.L125L	NM_024592	NP_078868	WXS	Illumina HiSeq	Unspecified	Q9H8P0	PORED_HUMAN	Epithelial(7;0.0179)		3	470	+	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		125			Helical; (Potential).		Q4W5Q6	Silent	SNP	ENST00000264228.4	37	c.375G>A	CCDS3498.1																																																																																				0.428	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250644.2	NM_024592		32	95	0	0	0	0.004289	0	32	95				
STAP1	26228	broad.mit.edu	37	4	68472042	68472042	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:68472042T>A	ENST00000265404.2	+	9	937	c.855T>A	c.(853-855)agT>agA	p.S285R	STAP1_ENST00000396225.1_Missense_Mutation_p.S285R	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	285					intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						AAGGGAGAAGTGAAAAGTTGA	0.323																																							uc003hde.3		NA																	0					0						c.(853-855)AGT>AGA		signal transducing adaptor family member 1							101.0	107.0	105.0					4																	68472042		2203	4300	6503	SO:0001583	missense	26228				cellular membrane fusion|intracellular protein transport	cytoplasm		g.chr4:68472042T>A	AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.855T>A	4.37:g.68472042T>A	ENSP00000265404:p.Ser285Arg		Somatic				STAP1_uc003hdf.2_Missense_Mutation_p.S285R	p.S285R	NM_012108	NP_036240	WXS	Illumina HiSeq	Unspecified	Q9ULZ2	STAP1_HUMAN			9	937	+			285					B2R980	Missense_Mutation	SNP	ENST00000265404.2	37	c.855T>A	CCDS3515.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.283727	0.23392	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.49720	0.77;0.77	3.99	-3.74	0.04385	.	1.562520	0.03685	N	0.246124	T	0.24890	0.0604	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08554	-1.0716	10	0.44086	T	0.13	1.3443	1.2792	0.02037	0.253:0.3762:0.1228:0.248	.	285	Q9ULZ2	STAP1_HUMAN	R	285	ENSP00000265404:S285R;ENSP00000379527:S285R	ENSP00000265404:S285R	S	+	3	2	STAP1	68154637	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-0.285000	0.08410	-0.746000	0.04766	0.459000	0.35465	AGT		0.323	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251434.1	NM_012108		13	32	0	0	0	0.00499	0	13	32				
TMPRSS11F	389208	broad.mit.edu	37	4	68956241	68956241	+	Splice_Site	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:68956241C>A	ENST00000356291.2	-	3	341	c.282G>T	c.(280-282)atG>atT	p.M94I		NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	94	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TTGAGCTTACCATTCTTTCAA	0.299																																							uc003hdt.1		NA																	0				ovary(1)	1						c.(280-282)ATG>ATT		transmembrane protease, serine 11F							68.0	70.0	70.0					4																	68956241		2202	4296	6498	SO:0001630	splice_region_variant	389208				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:68956241C>A	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.282+1G>T	4.37:g.68956241C>A			Somatic					p.M94I	NM_207407	NP_997290	WXS	Illumina HiSeq	Unspecified	Q6ZWK6	TM11F_HUMAN			3	331	-			94			SEA.|Extracellular (Potential).		A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	c.282G>T	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296930	0.40594	.	.	ENSG00000198092	ENST00000356291	T	0.38887	1.11	5.56	5.56	0.83823	SEA (3);	0.159584	0.45126	D	0.000388	T	0.59770	0.2218	L	0.58810	1.83	0.39570	D	0.969263	P	0.49559	0.925	D	0.67900	0.954	T	0.56751	-0.7927	9	.	.	.	.	15.3829	0.74673	0.0:1.0:0.0:0.0	.	94	Q6ZWK6	TM11F_HUMAN	I	94	ENSP00000348639:M94I	.	M	-	3	0	TMPRSS11F	68638836	1.000000	0.71417	1.000000	0.80357	0.271000	0.26615	3.666000	0.54540	2.787000	0.95880	0.650000	0.86243	ATG		0.299	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	Missense_Mutation	27	17	1	0	2.12542e-12	0.00632	2.4781e-12	27	17				
SLC6A18	348932	broad.mit.edu	37	5	1235661	1235661	+	Missense_Mutation	SNP	A	A	G	rs139414850	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:1235661A>G	ENST00000324642.3	+	4	628	c.505A>G	c.(505-507)Atc>Gtc	p.I169V	SLC6A18_ENST00000296821.4_Missense_Mutation_p.I169V	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	169					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GACACTGAACATCACAGCCGA	0.597																																							uc003jby.1		NA																	0				ovary(1)	1						c.(505-507)ATC>GTC		solute carrier family 6, member 18							116.0	107.0	110.0					5																	1235661		2203	4300	6503	SO:0001583	missense	348932				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr5:1235661A>G	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.505A>G	5.37:g.1235661A>G	ENSP00000323549:p.Ile169Val		Somatic					p.I169V	NM_182632	NP_872438	WXS	Illumina HiSeq	Unspecified	Q96N87	S6A18_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		4	628	+	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		169			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000324642.3	37	c.505A>G	CCDS3860.1	.	.	.	.	.	.	.	.	.	.	A	9.910	1.209152	0.22205	.	.	ENSG00000164363	ENST00000324642;ENST00000296821	T;T	0.76186	-1.0;-1.0	5.18	1.5	0.22942	.	0.260770	0.35151	N	0.003403	T	0.60327	0.2260	L	0.28400	0.85	0.32438	N	0.547104	P	0.34826	0.471	B	0.35770	0.21	T	0.63501	-0.6623	10	0.66056	D	0.02	.	8.5413	0.33395	0.7744:0.0:0.2256:0.0	.	169	Q96N87	S6A18_HUMAN	V	169	ENSP00000323549:I169V;ENSP00000296821:I169V	ENSP00000296821:I169V	I	+	1	0	SLC6A18	1288661	0.997000	0.39634	0.766000	0.31476	0.605000	0.37080	1.127000	0.31357	0.024000	0.15214	0.533000	0.62120	ATC		0.597	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632		38	57	0	0	0	0.007835	0	38	57				
CDH12	1010	broad.mit.edu	37	5	21854823	21854823	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:21854823G>A	ENST00000382254.1	-	7	1689	c.603C>T	c.(601-603)agC>agT	p.S201S	CDH12_ENST00000522262.1_Intron|CDH12_ENST00000504376.2_Silent_p.S201S|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	201	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCTGAAGAATGCTGTAAACGA	0.398										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(601-603)AGC>AGT		cadherin 12, type 2 preproprotein							123.0	119.0	120.0					5																	21854823		2203	4300	6503	SO:0001819	synonymous_variant	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21854823G>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.603C>T	5.37:g.21854823G>A		HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Silent_p.S201S	p.S201S	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			4	1061	-			201			Extracellular (Potential).|Cadherin 2.		B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	c.603C>T	CCDS3890.1																																																																																				0.398	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		33	36	0	0	0	0.003755	0	33	36				
HCN1	348980	broad.mit.edu	37	5	45645442	45645442	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:45645442C>A	ENST00000303230.4	-	2	751	c.694G>T	c.(694-696)Gtg>Ttg	p.V232L		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	232					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						ATATAATCCACTGGGATGGAT	0.378																																							uc003jok.2		NA																	0				ovary(1)	1						c.(694-696)GTG>TTG		hyperpolarization activated cyclic							70.0	65.0	67.0					5																	45645442		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45645442C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.694G>T	5.37:g.45645442C>A	ENSP00000307342:p.Val232Leu		Somatic					p.V232L	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			2	719	-			232			Helical; Name=Segment S3; (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.694G>T	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030944	0.54790	.	.	ENSG00000164588	ENST00000303230	D	0.98296	-4.85	5.37	5.37	0.77165	Ion transport (1);	0.000000	0.52532	D	0.000070	D	0.95252	0.8460	N	0.17474	0.49	0.80722	D	1	B	0.18741	0.03	B	0.23716	0.048	D	0.92304	0.5852	10	0.22706	T	0.39	.	19.1028	0.93281	0.0:1.0:0.0:0.0	.	232	O60741	HCN1_HUMAN	L	232	ENSP00000307342:V232L	ENSP00000307342:V232L	V	-	1	0	HCN1	45681199	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.520000	0.84964	0.555000	0.69702	GTG		0.378	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		26	36	1	0	3.01185e-09	0.003954	3.32299e-09	26	36				
ARHGEF28	64283	broad.mit.edu	37	5	73181890	73181890	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:73181890G>T	ENST00000426542.2	+	24	3291	c.3271G>T	c.(3271-3273)Ggc>Tgc	p.G1091C	ARHGEF28_ENST00000513042.2_Missense_Mutation_p.G1091C|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.G1091C|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.G1091C|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.G1091C|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.G778C|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.G1091C|ARHGEF28_ENST00000512883.1_Missense_Mutation_p.G55C			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1091	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GTTATATGATGGCCTTGTTTA	0.393																																							uc011csq.1		NA																	0					0						c.(3271-3273)GGC>TGC		Rho-guanine nucleotide exchange factor							97.0	100.0	99.0					5																	73181890		1916	4132	6048	SO:0001583	missense	64283				cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding	g.chr5:73181890G>T		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.3271G>T	5.37:g.73181890G>T	ENSP00000412175:p.Gly1091Cys		Somatic				RGNEF_uc003kcx.2_Missense_Mutation_p.G1091C|RGNEF_uc010izf.2_Missense_Mutation_p.G1091C|RGNEF_uc011csr.1_Missense_Mutation_p.G778C|RGNEF_uc003kcz.3_Missense_Mutation_p.G55C|RGNEF_uc003kda.3_Missense_Mutation_p.G55C	p.G1091C	NM_001080479	NP_001073948	WXS	Illumina HiSeq	Unspecified	Q8N1W1	RGNEF_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)	24	3282	+		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)	1091			PH.		B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	c.3271G>T	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745200	0.89663	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	D;D;D;D;D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84	5.92	5.92	0.95590	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.33712	U	0.004634	D	0.96522	0.8865	M	0.90369	3.11	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96551	0.9408	10	0.87932	D	0	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	778;1091;1091;55;1091	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	C	1091;1091;1091;1091;1091;1091;778;55	ENSP00000296794:G1091C;ENSP00000441913:G1091C;ENSP00000441436:G1091C;ENSP00000287898:G1091C;ENSP00000411459:G1091C;ENSP00000412175:G1091C;ENSP00000296799:G778C;ENSP00000421081:G55C	ENSP00000287898:G1091C	G	+	1	0	RP11-428C6.1	73217646	1.000000	0.71417	0.989000	0.46669	0.887000	0.51463	9.400000	0.97290	2.804000	0.96469	0.655000	0.94253	GGC		0.393	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1			30	24	1	0	2.61193e-14	0.009535	3.12729e-14	30	24				
HOMER1	9456	broad.mit.edu	37	5	78697723	78697723	+	Splice_Site	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:78697723C>T	ENST00000334082.6	-	6	2125	c.683G>A	c.(682-684)cGg>cAg	p.R228Q	HOMER1_ENST00000508576.1_Intron|HOMER1_ENST00000282260.6_Intron|HOMER1_ENST00000535690.1_Splice_Site_p.R54Q	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	228					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		TGAAATTACCCGCTTGTGCAG	0.458																																							uc003kfy.2		NA																	0					0						c.(682-684)CGG>CAG		homer 1							184.0	173.0	177.0					5																	78697723		1893	4128	6021	SO:0001630	splice_region_variant	9456				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane		g.chr5:78697723C>T	BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.684+1G>A	5.37:g.78697723C>T			Somatic				HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Missense_Mutation_p.R54Q	p.R228Q	NM_004272	NP_004263	WXS	Illumina HiSeq	Unspecified	Q86YM7	HOME1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)	6	1786	-		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)	228			Potential.		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	ENST00000334082.6	37	c.683G>A	CCDS43335.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294943	0.60086	.	.	ENSG00000152413	ENST00000334082;ENST00000535690	T;T	0.78003	-1.14;-1.14	5.45	4.58	0.56647	.	0.052881	0.85682	N	0.000000	T	0.67458	0.2895	L	0.39397	1.21	0.80722	D	1	B;B	0.27450	0.179;0.107	B;B	0.19148	0.024;0.014	T	0.62817	-0.6774	10	0.18276	T	0.48	-8.2671	14.5422	0.68002	0.0:0.929:0.0:0.071	.	54;228	Q86YM6;Q86YM7	.;HOME1_HUMAN	Q	228;54	ENSP00000334382:R228Q;ENSP00000441587:R54Q	ENSP00000334382:R228Q	R	-	2	0	HOMER1	78733479	1.000000	0.71417	0.999000	0.59377	0.941000	0.58515	7.235000	0.78143	1.436000	0.47453	-0.140000	0.14226	CGG		0.458	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258856.1	NM_004272	Missense_Mutation	35	127	0	0	0	0.00623	0	35	127				
CMYA5	202333	broad.mit.edu	37	5	79034466	79034466	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:79034466A>C	ENST00000446378.2	+	2	9909	c.9878A>C	c.(9877-9879)aAg>aCg	p.K3293T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3293					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGCAGGGAGAAGAGTCTGGAA	0.458																																							uc003kgc.2		NA																	0				ovary(6)|pancreas(2)|lung(1)	9						c.(9877-9879)AAG>ACG		cardiomyopathy associated 5							123.0	120.0	121.0					5																	79034466		1920	4138	6058	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79034466A>C	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9878A>C	5.37:g.79034466A>C	ENSP00000394770:p.Lys3293Thr		Somatic					p.K3293T	NM_153610	NP_705838	WXS	Illumina HiSeq	Unspecified	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	9950	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	3293					A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.9878A>C	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	5.551	0.286533	0.10513	.	.	ENSG00000164309	ENST00000446378	T	0.26067	1.76	5.52	-5.47	0.02600	.	1.353880	0.04633	N	0.403983	T	0.13157	0.0319	L	0.27053	0.805	0.09310	N	1	B	0.21381	0.055	B	0.17433	0.018	T	0.24476	-1.0159	10	0.39692	T	0.17	.	0.3131	0.00291	0.3518:0.2166:0.2215:0.2102	.	3293	Q8N3K9	CMYA5_HUMAN	T	3293	ENSP00000394770:K3293T	ENSP00000394770:K3293T	K	+	2	0	CMYA5	79070222	0.019000	0.18553	0.214000	0.23707	0.528000	0.34623	0.054000	0.14205	-0.517000	0.06461	0.459000	0.35465	AAG		0.458	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		43	40	0	0	0	0.010771	0	43	40				
VCAN	1462	broad.mit.edu	37	5	82815621	82815621	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:82815621T>A	ENST00000265077.3	+	7	2061	c.1496T>A	c.(1495-1497)gTa>gAa	p.V499E	VCAN_ENST00000343200.5_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.V499E|VCAN_ENST00000512590.2_Missense_Mutation_p.V451E|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	499	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GGTCCTTTGGTAACATCTATG	0.398																																							uc003kii.3		NA																	0				ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(1495-1497)GTA>GAA		versican isoform 1 precursor							114.0	113.0	113.0					5																	82815621		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82815621T>A	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1496T>A	5.37:g.82815621T>A	ENSP00000265077:p.Val499Glu		Somatic				VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.V499E|VCAN_uc003kik.3_Intron	p.V499E	NM_004385	NP_004376	WXS	Illumina HiSeq	Unspecified	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	7	1852	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	499			GAG-alpha (glucosaminoglycan attachment domain).		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.1496T>A	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	15.73	2.918486	0.52546	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.90133	-2.54;-2.58;-2.62	5.92	4.77	0.60923	.	0.231682	0.30252	N	0.010047	D	0.93203	0.7835	M	0.69823	2.125	0.33415	D	0.579098	D;D	0.89917	0.999;1.0	D;D	0.85130	0.988;0.997	D	0.92411	0.5937	10	0.23891	T	0.37	.	7.7225	0.28740	0.0:0.0723:0.208:0.7197	.	499;499	P13611-3;P13611	.;CSPG2_HUMAN	E	499;499;451	ENSP00000265077:V499E;ENSP00000342768:V499E;ENSP00000425959:V451E	ENSP00000265077:V499E	V	+	2	0	VCAN	82851377	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	0.863000	0.27913	1.074000	0.40909	-0.250000	0.11733	GTA		0.398	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		71	55	0	0	0	0.01441	0	71	55				
POU5F2	134187	broad.mit.edu	37	5	93076921	93076921	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:93076921C>A	ENST00000510627.4	-	1	422	c.349G>T	c.(349-351)Gag>Tag	p.E117*	RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'Flank	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	117					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GAGATGTCCTCTGGCGGCGGC	0.627																																							uc003kkl.1		NA																	0					0						c.(349-351)GAG>TAG		POU domain class 5, transcription factor 2							83.0	81.0	82.0					5																	93076921		1980	4157	6137	SO:0001587	stop_gained	134187					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:93076921C>A		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.349G>T	5.37:g.93076921C>A	ENSP00000464890:p.Glu117*		Somatic				FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	p.E117*	NM_153216	NP_694948	WXS	Illumina HiSeq	Unspecified	Q8N7G0	PO5F2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)	1	389	-		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)	117					Q15169|Q6MZL7|Q8N748	Nonsense_Mutation	SNP	ENST00000510627.4	37	c.349G>T	CCDS59489.1																																																																																				0.627	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216		21	40	1	0	6.21321e-17	0.00278	7.82513e-17	21	40				
FTMT	94033	broad.mit.edu	37	5	121188081	121188081	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:121188081C>A	ENST00000321339.1	+	1	432	c.423C>A	c.(421-423)cgC>cgA	p.R141R		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	141	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCCGGATCCGCCTGCAGGACA	0.577																																							uc003kss.2		NA																	0				ovary(1)	1						c.(421-423)CGC>CGA		ferritin mitochondrial precursor							70.0	72.0	71.0					5																	121188081		2203	4300	6503	SO:0001819	synonymous_variant	94033				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity	g.chr5:121188081C>A	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.423C>A	5.37:g.121188081C>A			Somatic					p.R141R	NM_177478	NP_803431	WXS	Illumina HiSeq	Unspecified	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)	1	432	+		all_cancers(142;0.0124)|Prostate(80;0.0322)	141			Ferritin-like diiron.			Silent	SNP	ENST00000321339.1	37	c.423C>A	CCDS4128.1																																																																																				0.577	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478		20	54	1	0	8.34094e-07	0.008871	8.69934e-07	20	54				
PCDHA1	56147	broad.mit.edu	37	5	140167837	140167837	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:140167837C>T	ENST00000504120.2	+	1	1962	c.1962C>T	c.(1960-1962)caC>caT	p.H654H	PCDHA1_ENST00000378133.3_Silent_p.H654H|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	654	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGGATCACGGTGAGCCGG	0.662																																							uc003lhb.2		NA																	0				skin(1)	1						c.(1960-1962)CAC>CAT		protocadherin alpha 1 isoform 1 precursor							49.0	54.0	53.0					5																	140167837		2203	4300	6503	SO:0001819	synonymous_variant	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140167837C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1962C>T	5.37:g.140167837C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.H654H	p.H654H	NM_018900	NP_061723	WXS	Illumina HiSeq	Unspecified	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1962	+			654			Cadherin 6.|Extracellular (Potential).		O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	37	c.1962C>T	CCDS54913.1																																																																																				0.662	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		18	46	0	0	0	0.00499	0	18	46				
PCDHA6	56142	broad.mit.edu	37	5	140209241	140209241	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:140209241C>A	ENST00000529310.1	+	1	1679	c.1565C>A	c.(1564-1566)cCg>cAg	p.P522Q	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.P522Q|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCTGCAGCCGCTGGACCAC	0.682																																							uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(1564-1566)CCG>CAG		protocadherin alpha 6 isoform 1 precursor							68.0	80.0	76.0					5																	140209241		2203	4292	6495	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140209241C>A	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1565C>A	5.37:g.140209241C>A	ENSP00000433378:p.Pro522Gln		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.P522Q|PCDHA6_uc011dab.1_Missense_Mutation_p.P522Q	p.P522Q	NM_018909	NP_061732	WXS	Illumina HiSeq	Unspecified	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1592	+			522			Cadherin 5.|Extracellular (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.1565C>A	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730971	0.48939	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.54866	0.55;0.55	3.68	3.68	0.42216	Cadherin (5);Cadherin-like (1);	0.000000	0.36555	U	0.002522	T	0.63319	0.2501	L	0.35723	1.085	0.22918	N	0.99856	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.993	T	0.58674	-0.7595	10	0.87932	D	0	.	15.9906	0.80202	0.0:1.0:0.0:0.0	.	522;522;522	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	Q	522	ENSP00000433378:P522Q;ENSP00000434113:P522Q	ENSP00000434113:P522Q	P	+	2	0	PCDHA6	140189425	0.016000	0.18221	1.000000	0.80357	0.808000	0.45660	2.384000	0.44362	2.056000	0.61249	0.306000	0.20318	CCG		0.682	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		33	118	1	0	3.62531e-18	0.004289	4.67612e-18	33	118				
PCDHB7	56129	broad.mit.edu	37	5	140553928	140553928	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:140553928C>A	ENST00000231137.3	+	1	1686	c.1512C>A	c.(1510-1512)gtC>gtA	p.V504V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	504	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCCCTGGTCTCCATCAACG	0.677																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1510-1512)GTC>GTA		protocadherin beta 7 precursor							87.0	91.0	90.0					5																	140553928		2203	4297	6500	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553928C>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1512C>A	5.37:g.140553928C>A			Somatic					p.V504V	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1686	+			504			Extracellular (Potential).|Cadherin 5.		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.1512C>A	CCDS4249.1																																																																																				0.677	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		46	116	1	0	5.78141e-17	0.013114	7.31582e-17	46	116				
PCDHGA1	56114	broad.mit.edu	37	5	140711266	140711266	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:140711266G>T	ENST00000517417.1	+	1	1015	c.1015G>T	c.(1015-1017)Gat>Tat	p.D339Y	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D339Y|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	339	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D339N(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAGTTTTGGATGTAAATGA	0.433																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(1015-1017)GAT>TAT		protocadherin gamma subfamily A, 1 isoform 1							69.0	68.0	68.0					5																	140711266		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711266G>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1015G>T	5.37:g.140711266G>T	ENSP00000431083:p.Asp339Tyr		Somatic				PCDHGA1_uc011dan.1_Missense_Mutation_p.D339Y	p.D339Y	NM_018912	NP_061735	WXS	Illumina HiSeq	Unspecified	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1015	+			339			Cadherin 3.|Extracellular (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.1015G>T	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.728986	0.48833	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.74632	-0.86;-0.86	3.99	3.99	0.46301	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.46442	U	0.000294	D	0.92776	0.7703	H	0.99777	4.77	0.43564	D	0.995882	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.96248	0.9181	10	0.87932	D	0	.	16.2627	0.82553	0.0:0.0:1.0:0.0	.	339;339	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	Y	339	ENSP00000431083:D339Y;ENSP00000367345:D339Y	ENSP00000367345:D339Y	D	+	1	0	PCDHGA1	140691450	1.000000	0.71417	0.996000	0.52242	0.375000	0.29983	9.601000	0.98297	2.237000	0.73441	0.650000	0.86243	GAT		0.433	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		20	52	1	0	4.35082e-09	0.010504	4.78053e-09	20	52				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7988108	7988108	+	Intron	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:7988108C>A	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)																		GAAGCCTTCTCCTTCCAAAAA	0.507																																							uc003mxx.3		NA																	0					0						c.(1339-1341)CCT>ACT		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7988108C>A			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+38491G>T	6.37:g.7988108C>A			Somatic				TXNDC5_uc003mxw.2_Intron	p.P447T	NR_027712		WXS	Illumina HiSeq	Unspecified					1	1774	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.1339C>A																																																																																					0.507	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		23	71	1	0	7.41877e-09	0.012319	8.08569e-09	23	71				
SYNGAP1	8831	broad.mit.edu	37	6	33405711	33405711	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:33405711C>T	ENST00000418600.2	+	8	1130	c.1029C>T	c.(1027-1029)gtC>gtT	p.V343V	SYNGAP1_ENST00000293748.5_Silent_p.V343V|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Silent_p.V284V	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	343	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CAGGCTATGTCGGCCTGGTGA	0.607																																							uc011dri.1		NA																	0				ovary(4)	4						c.(1027-1029)GTC>GTT		synaptic Ras GTPase activating protein 1							65.0	61.0	63.0					6																	33405711		2203	4300	6503	SO:0001819	synonymous_variant	8831				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding	g.chr6:33405711C>T	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1029C>T	6.37:g.33405711C>T			Somatic				SYNGAP1_uc003oeo.1_Silent_p.V328V|SYNGAP1_uc010juy.2_Silent_p.V328V|SYNGAP1_uc010juz.2_Silent_p.V55V	p.V343V	NM_006772	NP_006763	WXS	Illumina HiSeq	Unspecified	Q96PV0	SYGP1_HUMAN			8	1224	+			343			C2.		A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	37	c.1029C>T	CCDS34434.2																																																																																				0.607	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		37	62	0	0	0	0.007835	0	37	62				
COL21A1	81578	broad.mit.edu	37	6	55926451	55926451	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:55926451C>A	ENST00000244728.5	-	25	2598	c.2201G>T	c.(2200-2202)gGa>gTa	p.G734V	COL21A1_ENST00000370808.2_Missense_Mutation_p.G134V|COL21A1_ENST00000535941.1_Missense_Mutation_p.G734V|COL21A1_ENST00000370819.1_Missense_Mutation_p.G731V|COL21A1_ENST00000467045.1_5'UTR	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	734	Collagen-like 5.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACATACCTCTCCTTTTGCACC	0.338																																							uc003pcs.2		NA																	0				ovary(2)	2						c.(2200-2202)GGA>GTA		collagen, type XXI, alpha 1 precursor							59.0	58.0	58.0					6																	55926451		1814	4075	5889	SO:0001583	missense	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:55926451C>A	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2201G>T	6.37:g.55926451C>A	ENSP00000244728:p.Gly734Val		Somatic				COL21A1_uc010jzz.2_Missense_Mutation_p.G119V|COL21A1_uc011dxg.1_Missense_Mutation_p.G107V|COL21A1_uc011dxh.1_Missense_Mutation_p.G119V|COL21A1_uc003pcr.2_Nonsense_Mutation_p.E92*	p.G734V	NM_030820	NP_110447	WXS	Illumina HiSeq	Unspecified	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		25	2433	-	Lung NSC(77;0.0483)		734			Collagen-like 5.		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	c.2201G>T	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.403053	0.42613	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.99488	-6.0;-6.0;-6.0;-6.0	5.46	5.46	0.80206	.	0.000000	0.56097	D	0.000037	D	0.99684	0.9881	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	0.989;0.992;1.0	P;D;D	0.97110	0.892;0.935;1.0	D	0.97649	1.0153	10	0.87932	D	0	.	16.0328	0.80593	0.0:1.0:0.0:0.0	.	134;734;734	Q96P44-2;B7ZLK3;Q96P44	.;.;COLA1_HUMAN	V	734;731;734;731;134	ENSP00000244728:G734V;ENSP00000359855:G731V;ENSP00000444384:G734V;ENSP00000359844:G134V	ENSP00000244728:G734V	G	-	2	0	COL21A1	56034410	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	3.807000	0.55591	2.568000	0.86640	0.579000	0.79373	GGA		0.338	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			3	15	1	0	0.000602214	0.000602	0.000609058	3	15				
DST	667	broad.mit.edu	37	6	56391233	56391233	+	Missense_Mutation	SNP	G	G	A	rs533800541		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:56391233G>A	ENST00000361203.3	-	64	17102	c.17095C>T	c.(17095-17097)Cgc>Tgc	p.R5699C	DST_ENST00000370754.5_Missense_Mutation_p.R5988C|DST_ENST00000370788.2_Missense_Mutation_p.R3613C|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Missense_Mutation_p.R5484C|DST_ENST00000421834.2_Missense_Mutation_p.R3722C|DST_ENST00000244364.6_Missense_Mutation_p.R3396C|DST_ENST00000340834.4_5'UTR|DST_ENST00000370769.4_Missense_Mutation_p.R5810C			Q03001	DYST_HUMAN	dystonin	5699					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATCGGTAGCGCTCATTGTCC	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19388	0.0		0.0	False		,,,				2504	0.0						uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(11698-11700)CGC>TGC		dystonin isoform 2							245.0	231.0	235.0					6																	56391233		2024	4199	6223	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56391233G>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17095C>T	6.37:g.56391233G>A	ENSP00000354508:p.Arg5699Cys		Somatic				DST_uc003pcz.3_Missense_Mutation_p.R3722C|DST_uc011dxj.1_Missense_Mutation_p.R3751C|DST_uc011dxk.1_Missense_Mutation_p.R3762C|DST_uc003pcy.3_Missense_Mutation_p.R3396C	p.R3900C	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		63	11726	-	Lung NSC(77;0.103)		5808					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.11698C>T		.	.	.	.	.	.	.	.	.	.	G	23.6	4.435326	0.83885	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.41758	1.03;0.99;0.99;1.03;1.03;1.03;1.03	5.73	5.73	0.89815	.	0.000000	0.52532	D	0.000063	T	0.59500	0.2198	M	0.64997	1.995	0.35464	D	0.796756	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.953;0.953;0.997;0.921	T	0.59963	-0.7355	9	0.87932	D	0	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	3722;5810;5988;5808;3396	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	C	3396;5988;5810;3722;5484;3613;5699	ENSP00000244364:R3396C;ENSP00000359790:R5988C;ENSP00000359805:R5810C;ENSP00000400883:R3722C;ENSP00000393645:R5484C;ENSP00000359824:R3613C;ENSP00000354508:R5699C	ENSP00000244364:R3396C	R	-	1	0	DST	56499192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.541000	0.73865	2.854000	0.98071	0.655000	0.94253	CGC		0.488	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		23	132	0	0	0	0.014323	0	23	132				
EYS	346007	broad.mit.edu	37	6	66063424	66063424	+	Silent	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:66063424T>A	ENST00000370621.3	-	9	1912	c.1386A>T	c.(1384-1386)ggA>ggT	p.G462G	EYS_ENST00000370618.3_Silent_p.G462G|EYS_ENST00000370616.2_Silent_p.G462G|EYS_ENST00000503581.1_Silent_p.G462G|EYS_ENST00000342421.5_Silent_p.G462G|EYS_ENST00000393380.2_Silent_p.G462G			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	462					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GGAAGGTGACTCCACAGTAGC	0.363																																							uc011dxu.1		NA																	0				lung(4)|ovary(1)|skin(1)	6						c.(1384-1386)GGA>GGT		eyes shut homolog isoform 1							118.0	108.0	111.0					6																	66063424		2203	4300	6503	SO:0001819	synonymous_variant	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66063424T>A		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1386A>T	6.37:g.66063424T>A			Somatic				EYS_uc003peq.2_Silent_p.G462G|EYS_uc003per.1_Silent_p.G462G	p.G462G	NM_001142800	NP_001136272	WXS	Illumina HiSeq	Unspecified	Q5T1H1	EYS_HUMAN			9	1924	-			462					A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37	c.1386A>T																																																																																					0.363	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		17	68	0	0	0	0.00499	0	17	68				
PRDM1	639	broad.mit.edu	37	6	106547325	106547325	+	Missense_Mutation	SNP	A	A	C	rs151324489	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:106547325A>C	ENST00000369096.4	+	4	796	c.562A>C	c.(562-564)Aag>Cag	p.K188Q	PRDM1_ENST00000369089.3_Missense_Mutation_p.K54Q|PRDM1_ENST00000369091.2_Missense_Mutation_p.K152Q|RP1-134E15.3_ENST00000602426.1_RNA	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	188	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CTACACCATTAAGCCCATCCC	0.502			"""D, N, Mis, F, S"""		DLBCL																																		uc003prd.2		NA		Rec	yes		6	6q21	639	D|N|Mis|F|S	"""PR domain containing 1, with ZNF domain"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56						c.(562-564)AAG>CAG		PR domain containing 1, with ZNF domain isoform							111.0	96.0	101.0					6																	106547325		2203	4300	6503	SO:0001583	missense	639				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:106547325A>C		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.562A>C	6.37:g.106547325A>C	ENSP00000358092:p.Lys188Gln		Somatic				PRDM1_uc003pre.2_Missense_Mutation_p.K54Q	p.K188Q	NM_001198	NP_001189	WXS	Illumina HiSeq	Unspecified	O75626	PRDM1_HUMAN		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)	4	796	+	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)	188			SET.		B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	c.562A>C	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128090	0.77549	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000450060;ENST00000369089	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.75	5.75	0.90469	SET domain (3);	0.208186	0.49916	D	0.000131	D	0.89897	0.6848	M	0.81497	2.545	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.77557	0.985;0.99	D	0.91485	0.5207	10	0.87932	D	0	-30.3966	16.0549	0.80794	1.0:0.0:0.0:0.0	.	54;188	Q86WM7;O75626	.;PRDM1_HUMAN	Q	152;188;152;67;54	ENSP00000358087:K152Q;ENSP00000358092:K188Q;ENSP00000399772:K67Q;ENSP00000358085:K54Q	ENSP00000358085:K54Q	K	+	1	0	PRDM1	106654018	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.975000	0.70475	2.193000	0.70182	0.477000	0.44152	AAG		0.502	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3			22	38	0	0	0	0.012319	0	22	38				
KIAA1244	57221	broad.mit.edu	37	6	138584148	138584148	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:138584148G>A	ENST00000251691.4	+	12	1694	c.1528G>A	c.(1528-1530)Gac>Aac	p.D510N		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGTCACCACAGACACAGGCCA	0.592																																							uc003qhu.2		NA																	0				ovary(1)|skin(1)	2						c.(1528-1530)GAC>AAC		brefeldin A-inhibited guanine							39.0	33.0	35.0					6																	138584148		2203	4300	6503	SO:0001583	missense	57221				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr6:138584148G>A	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1528G>A	6.37:g.138584148G>A	ENSP00000251691:p.Asp510Asn		Somatic					p.D510N	NM_020340	NP_065073	WXS	Illumina HiSeq	Unspecified	Q5TH69	BIG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)	12	1528	+	Breast(32;0.135)		510						Missense_Mutation	SNP	ENST00000251691.4	37	c.1528G>A	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717745	0.89205	.	.	ENSG00000112379	ENST00000251691	T	0.21031	2.03	5.37	5.37	0.77165	.	0.848965	0.10553	N	0.661250	T	0.14830	0.0358	L	0.27053	0.805	0.53005	D	0.99996	P	0.46395	0.877	P	0.45829	0.494	T	0.16600	-1.0397	10	0.46703	T	0.11	-15.4269	19.1101	0.93313	0.0:0.0:1.0:0.0	.	510	Q5TH69	BIG3_HUMAN	N	510	ENSP00000251691:D510N	ENSP00000251691:D510N	D	+	1	0	KIAA1244	138625841	1.000000	0.71417	0.973000	0.42090	0.984000	0.73092	9.496000	0.97967	2.501000	0.84356	0.655000	0.94253	GAC		0.592	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		5	3	0	0	0	0.000602	0	5	3				
STXBP5	134957	broad.mit.edu	37	6	147680300	147680300	+	Missense_Mutation	SNP	G	G	A	rs551024360		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:147680300G>A	ENST00000321680.6	+	23	2386	c.2386G>A	c.(2386-2388)Gct>Act	p.A796T	STXBP5_ENST00000367481.3_Missense_Mutation_p.A760T|STXBP5_ENST00000179882.6_Missense_Mutation_p.A451T|STXBP5_ENST00000367480.3_Missense_Mutation_p.A743T	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	796					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		AGCGATCTCCGCTCTTCATTT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		16839	0.001		0.0	False		,,,				2504	0.0						uc003qlz.2		NA																	0					0						c.(2386-2388)GCT>ACT		syntaxin binding protein 5 (tomosyn) isoform b							101.0	98.0	99.0					6																	147680300		2203	4300	6503	SO:0001583	missense	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147680300G>A	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2386G>A	6.37:g.147680300G>A	ENSP00000321826:p.Ala796Thr		Somatic				STXBP5_uc010khz.1_Missense_Mutation_p.A760T|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.A451T	p.A796T	NM_001127715	NP_001121187	WXS	Illumina HiSeq	Unspecified	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	23	2547	+		Ovarian(120;0.0164)	796			WD 11.		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	c.2386G>A	CCDS47499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.804|9.804	1.181363|1.181363	0.21787|0.21787	.|.	.|.	ENSG00000164506|ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882;ENST00000392291|ENST00000367475	T;T;T;T;T|.	0.32023|.	1.82;1.82;1.47;1.82;1.82|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.231953|.	0.44902|.	D|.	0.000411|.	T|T	0.22589|0.22589	0.0545|0.0545	N|N	0.04880|0.04880	-0.145|-0.145	0.40774|0.40774	D|D	0.983114|0.983114	P;P;P|.	0.43607|.	0.697;0.812;0.64|.	B;B;B|.	0.31869|.	0.137;0.096;0.072|.	T|T	0.16778|0.16778	-1.0391|-1.0391	10|5	0.07813|.	T|.	0.8|.	.|.	14.2071|14.2071	0.65741|0.65741	0.0:0.0:0.8506:0.1494|0.0:0.0:0.8506:0.1494	.|.	760;796;451|.	Q5T5C0-2;Q5T5C0;B3KXX0|.	.;STXB5_HUMAN;.|.	T|H	135;760;796;743;451;120|121	ENSP00000356451:A760T;ENSP00000321826:A796T;ENSP00000356450:A743T;ENSP00000179882:A451T;ENSP00000376112:A120T|.	ENSP00000179882:A451T|.	A|R	+|+	1|2	0|0	STXBP5|STXBP5	147721993|147721993	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.737000|0.737000	0.42083|0.42083	3.984000|3.984000	0.56923|0.56923	2.570000|2.570000	0.86706|0.86706	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.443	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1			14	22	0	0	0	0.003163	0	14	22				
SCAF8	22828	broad.mit.edu	37	6	155131230	155131230	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:155131230A>G	ENST00000367178.3	+	12	1884	c.1308A>G	c.(1306-1308)agA>agG	p.R436R	SCAF8_ENST00000417268.1_Silent_p.R436R|SCAF8_ENST00000367186.4_Silent_p.R502R	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	436	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						CCCGCTCAAGAGAAAGAAAGA	0.423																																							uc003qqa.2		NA																	0					0						c.(1306-1308)AGA>AGG		RNA-binding motif protein 16							147.0	146.0	147.0					6																	155131230		2203	4300	6503	SO:0001819	synonymous_variant	22828				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding	g.chr6:155131230A>G	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1308A>G	6.37:g.155131230A>G			Somatic				RBM16_uc011efj.1_Silent_p.R502R|RBM16_uc011efk.1_Silent_p.R481R|RBM16_uc003qpz.2_Silent_p.R436R|RBM16_uc010kji.2_Silent_p.R457R	p.R436R	NM_014892	NP_055707	WXS	Illumina HiSeq	Unspecified	Q9UPN6	SCAF8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)	13	1540	+		Ovarian(120;0.196)	436			Arg-rich.		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	c.1308A>G	CCDS5247.1																																																																																				0.423	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892		63	23	0	0	0	0.01441	0	63	23				
SCAF8	22828	broad.mit.edu	37	6	155153764	155153764	+	Silent	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:155153764G>T	ENST00000367178.3	+	20	3627	c.3051G>T	c.(3049-3051)cgG>cgT	p.R1017R	SCAF8_ENST00000417268.1_Silent_p.R1017R|TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000367186.4_Silent_p.R1083R	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1017	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						GAGATTACCGGTTTCCTCCTA	0.458																																							uc003qqa.2		NA																	0					0						c.(3049-3051)CGG>CGT		RNA-binding motif protein 16							66.0	68.0	68.0					6																	155153764		2203	4300	6503	SO:0001819	synonymous_variant	22828				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding	g.chr6:155153764G>T	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3051G>T	6.37:g.155153764G>T			Somatic				TIAM2_uc003qqb.2_5'Flank|RBM16_uc011efj.1_Silent_p.R1083R|RBM16_uc011efk.1_Silent_p.R1062R|RBM16_uc003qpz.2_Silent_p.R1017R|RBM16_uc010kji.2_Intron	p.R1017R	NM_014892	NP_055707	WXS	Illumina HiSeq	Unspecified	Q9UPN6	SCAF8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)	21	3283	+		Ovarian(120;0.196)	1017			Pro-rich.		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	c.3051G>T	CCDS5247.1																																																																																				0.458	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892		45	7	1	0	9.84934e-19	0.010771	1.27659e-18	45	7				
C6orf118	168090	broad.mit.edu	37	6	165713903	165713903	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:165713903C>A	ENST00000230301.8	-	3	846	c.826G>T	c.(826-828)Gat>Tat	p.D276Y	C6orf118_ENST00000543069.1_Missense_Mutation_p.D172Y	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	276										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TTACAAATATCTTCAAAGACT	0.403																																							uc003qum.3		NA																	0					0						c.(826-828)GAT>TAT		hypothetical protein LOC168090							120.0	140.0	133.0					6																	165713903		2203	4300	6503	SO:0001583	missense	168090							g.chr6:165713903C>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.826G>T	6.37:g.165713903C>A	ENSP00000230301:p.Asp276Tyr		Somatic				C6orf118_uc011egi.1_RNA	p.D276Y	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	3	862	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	276					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.826G>T	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258002	0.59321	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.14766	2.48;2.48	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000004	T	0.26412	0.0645	M	0.61703	1.905	0.42077	D	0.991239	D	0.89917	1.0	D	0.74348	0.983	T	0.01305	-1.1390	10	0.87932	D	0	.	15.771	0.78167	0.0:1.0:0.0:0.0	.	276	Q5T5N4	CF118_HUMAN	Y	276;172	ENSP00000230301:D276Y;ENSP00000439288:D172Y	ENSP00000230301:D276Y	D	-	1	0	C6orf118	165633893	0.988000	0.35896	0.986000	0.45419	0.542000	0.35054	3.958000	0.56737	2.427000	0.82271	0.655000	0.94253	GAT		0.403	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		52	20	1	0	7.05377e-20	0.01441	9.41678e-20	52	20				
CCR6	1235	broad.mit.edu	37	6	167550348	167550348	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr6:167550348G>A	ENST00000341935.5	+	3	1182	c.630G>A	c.(628-630)tgG>tgA	p.W210*	RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Nonsense_Mutation_p.W210*|CCR6_ENST00000349984.4_Nonsense_Mutation_p.W210*	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	210					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		CCATCAGGTGGAAGCTGCTGA	0.448																																							uc003qvl.2		NA																	0				ovary(1)	1						c.(628-630)TGG>TGA		chemokine (C-C motif) receptor 6							132.0	114.0	120.0					6																	167550348		2203	4300	6503	SO:0001587	stop_gained	1235				cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity	g.chr6:167550348G>A	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.630G>A	6.37:g.167550348G>A	ENSP00000343952:p.Trp210*		Somatic				CCR6_uc010kkm.2_Nonsense_Mutation_p.W210*|CCR6_uc003qvn.3_Nonsense_Mutation_p.W210*|CCR6_uc003qvm.3_Nonsense_Mutation_p.W210*	p.W210*	NM_031409	NP_113597	WXS	Illumina HiSeq	Unspecified	P51684	CCR6_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)	13	3106	+		Breast(66;1.53e-05)|Ovarian(120;0.0606)	210			Extracellular (Potential).		E1P5C6|P78553|Q92846	Nonsense_Mutation	SNP	ENST00000341935.5	37	c.630G>A	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	G	38	7.063241	0.98036	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	.	.	.	5.09	5.09	0.68999	.	1.033030	0.07664	U	0.934220	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4755	0.87658	0.0:0.0:1.0:0.0	.	.	.	.	X	210	.	ENSP00000343952:W210X	W	+	3	0	CCR6	167470338	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	3.418000	0.52721	2.345000	0.79718	0.655000	0.94253	TGG		0.448	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1			25	47	0	0	0	0.005443	0	25	47				
SDK1	221935	broad.mit.edu	37	7	4247749	4247749	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:4247749G>C	ENST00000404826.2	+	37	5372	c.5233G>C	c.(5233-5235)Gac>Cac	p.D1745H	SDK1_ENST00000389531.3_Missense_Mutation_p.D1725H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1745	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTGGGAGGCAGACAGCCAGAA	0.557																																							uc003smx.2		NA																	0				large_intestine(3)|ovary(2)|skin(1)	6						c.(5233-5235)GAC>CAC		sidekick 1 precursor							76.0	77.0	77.0					7																	4247749		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4247749G>C	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5233G>C	7.37:g.4247749G>C	ENSP00000385899:p.Asp1745His		Somatic				SDK1_uc010kso.2_Missense_Mutation_p.D1001H|SDK1_uc003smy.2_Missense_Mutation_p.D232H	p.D1745H	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	37	5372	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1745			Fibronectin type-III 11.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.5233G>C	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	8.692	0.907604	0.17833	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59364	0.27;0.27	4.77	4.77	0.60923	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.156699	0.39985	N	0.001207	T	0.71178	0.3309	M	0.71871	2.18	0.28468	N	0.915557	P;B;D	0.62365	0.831;0.152;0.991	P;B;P	0.61800	0.694;0.141;0.894	T	0.67715	-0.5599	10	0.56958	D	0.05	.	13.8603	0.63557	0.0:0.1529:0.8471:0.0	.	1725;232;1745	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	H	1745;1725	ENSP00000385899:D1745H;ENSP00000374182:D1725H	ENSP00000374182:D1725H	D	+	1	0	SDK1	4214275	0.456000	0.25744	0.912000	0.35992	0.943000	0.58893	3.516000	0.53436	2.359000	0.80004	0.655000	0.94253	GAC		0.557	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		9	64	0	0	0	0.010729	0	9	64				
TBX20	57057	broad.mit.edu	37	7	35280533	35280533	+	Silent	SNP	T	T	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:35280533T>A	ENST00000408931.3	-	5	1297	c.771A>T	c.(769-771)ccA>ccT	p.P257P		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	257					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						AAACTGTTTCTGGAAAGATGA	0.413																																							uc011kas.1		NA																	0				central_nervous_system(1)	1						c.(769-771)CCA>CCT		T-box transcription factor TBX20							96.0	88.0	91.0					7																	35280533		2203	4300	6503	SO:0001819	synonymous_variant	57057					nucleus	DNA binding	g.chr7:35280533T>A	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.771A>T	7.37:g.35280533T>A			Somatic					p.P257P	NM_001077653	NP_001071121	WXS	Illumina HiSeq	Unspecified	Q9UMR3	TBX20_HUMAN			5	782	-			257			T-box.		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Silent	SNP	ENST00000408931.3	37	c.771A>T	CCDS43568.1																																																																																				0.413	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		25	22	0	0	0	0.004656	0	25	22				
SEPT14	346288	broad.mit.edu	37	7	55910638	55910638	+	Silent	SNP	A	A	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:55910638A>G	ENST00000388975.3	-	5	671	c.555T>C	c.(553-555)agT>agC	p.S185S	SEPT14_ENST00000477628.1_5'Flank	NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	185	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AACATACCTTACTGTCAAGGT	0.458																																							uc003tqz.2		NA																	0					0						c.(553-555)AGT>AGC		septin 14							69.0	62.0	64.0					7																	55910638		1861	4081	5942	SO:0001819	synonymous_variant	346288				cell cycle|cell division	septin complex	GTP binding|protein binding	g.chr7:55910638A>G	AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.555T>C	7.37:g.55910638A>G			Somatic					p.S185S	NM_207366	NP_997249	WXS	Illumina HiSeq	Unspecified	Q6ZU15	SEP14_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		5	672	-	Breast(14;0.214)		185					A6NCC2|B4DXD6	Silent	SNP	ENST00000388975.3	37	c.555T>C	CCDS5519.2																																																																																				0.458	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251489.2	NM_207366		2	2	0	0	0	0.004672	0	2	2				
Unknown	0	broad.mit.edu	37	7	75126022	75126022	+	IGR	SNP	G	G	A	rs199940698		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:75126022G>A								POM121C (10474 upstream) : PMS2P3 (11052 downstream)																							CCAGCCCCCCGCATAGGTCCT	0.567																																							uc011kfy.1		NA																	0					0						c.(283-285)CCG>CCA		speedy homolog E5							13.0	13.0	13.0					7																	75126022		1327	2255	3582	SO:0001628	intergenic_variant	442590							g.chr7:75126022G>A																													7.37:g.75126022G>A			Somatic					p.P95P	NM_001099435	NP_001092905	WXS	Illumina HiSeq	Unspecified	A6NIY4	SPDE5_HUMAN			2	421	+			95						Silent	SNP		37	c.285G>A																																																																																				0	0.567									10	22	0	0	0	0.008291	0	10	22				
ZNF804B	219578	broad.mit.edu	37	7	88964545	88964545	+	Missense_Mutation	SNP	T	T	C	rs143293437		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:88964545T>C	ENST00000333190.4	+	4	2858	c.2249T>C	c.(2248-2250)gTt>gCt	p.V750A		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	750							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CACCACTCAGTTGAAAGGCAC	0.408										HNSCC(36;0.09)																													uc011khi.1		NA																	0				ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(2248-2250)GTT>GCT		zinc finger protein 804B		T	ALA/VAL	0,4406		0,0,2203	82.0	75.0	77.0		2249	-2.0	0.0	7	dbSNP_134	77	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF804B	NM_181646.2	64	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	benign	750/1350	88964545	2,13004	2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88964545T>C	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2249T>C	7.37:g.88964545T>C	ENSP00000329638:p.Val750Ala	HNSCC(36;0.09)	Somatic					p.V750A	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	2787	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		750					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.2249T>C	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	T	0.727	-0.781210	0.02929	0.0	2.33E-4	ENSG00000182348	ENST00000333190	T	0.04809	3.55	5.35	-2.04	0.07343	.	1.056820	0.07357	N	0.883368	T	0.02230	0.0069	N	0.19112	0.55	0.09310	N	1	B	0.22346	0.068	B	0.13407	0.009	T	0.46190	-0.9209	10	0.07175	T	0.84	1.2697	0.4548	0.00507	0.1916:0.2172:0.1863:0.4049	.	750	A4D1E1	Z804B_HUMAN	A	750	ENSP00000329638:V750A	ENSP00000329638:V750A	V	+	2	0	ZNF804B	88802481	0.000000	0.05858	0.025000	0.17156	0.197000	0.23852	-0.806000	0.04525	-0.106000	0.12110	-0.451000	0.05528	GTT		0.408	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		15	62	0	0	0	0.00245	0	15	62				
AKAP9	10142	broad.mit.edu	37	7	91709239	91709239	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:91709239G>T	ENST00000359028.2	+	32	8053	c.7828G>T	c.(7828-7830)Ggg>Tgg	p.G2610W	AKAP9_ENST00000358100.2_Missense_Mutation_p.G2610W|AKAP9_ENST00000356239.3_Missense_Mutation_p.G2598W			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2610	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGATGAGTTGGGGTCAGATAT	0.303			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		0				breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(7792-7794)GGG>TGG		A-kinase anchor protein 9 isoform 2							68.0	74.0	72.0					7																	91709239		2203	4299	6502	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91709239G>T	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7828G>T	7.37:g.91709239G>T	ENSP00000351922:p.Gly2610Trp		Somatic				AKAP9_uc003ulf.2_Missense_Mutation_p.G2590W|AKAP9_uc003uli.2_Missense_Mutation_p.G2221W|AKAP9_uc003ulj.2_Missense_Mutation_p.G368W	p.G2598W	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		31	8017	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		2610			Potential.|Glu-rich.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.7792G>T		.	.	.	.	.	.	.	.	.	.	G	4.374	0.068912	0.08436	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03801	3.9;3.9;3.89;3.8	4.16	4.16	0.48862	.	0.208574	0.24141	N	0.041172	T	0.05090	0.0136	N	0.14661	0.345	0.28531	N	0.912604	P;P;P;P	0.42908	0.599;0.464;0.793;0.599	B;B;B;B	0.42386	0.298;0.156;0.386;0.298	T	0.17992	-1.0351	10	0.72032	D	0.01	.	17.0382	0.86482	0.0:0.0:1.0:0.0	.	2602;2610;2598;2590	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	W	2598;2610;2610;2602;444	ENSP00000348573:G2598W;ENSP00000351922:G2610W;ENSP00000350813:G2610W;ENSP00000378042:G444W	ENSP00000348573:G2598W	G	+	1	0	AKAP9	91547175	0.893000	0.30496	0.514000	0.27761	0.004000	0.04260	4.229000	0.58625	2.331000	0.79229	0.591000	0.81541	GGG		0.303	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		44	44	1	0	3.76604e-16	0.010771	4.65524e-16	44	44				
LRCH4	4034	broad.mit.edu	37	7	100174326	100174326	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:100174326T>C	ENST00000310300.6	-	14	1595	c.1543A>G	c.(1543-1545)Agt>Ggt	p.S515G	LRCH4_ENST00000497245.1_Missense_Mutation_p.S63G	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	515					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCTGAGCCACTCTGAGAGGAG	0.632																																							uc003uvj.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1543-1545)AGT>GGT		leucine-rich repeats and calponin homology (CH)							106.0	68.0	81.0					7																	100174326		2202	4299	6501	SO:0001583	missense	4034				nervous system development	PML body	protein binding	g.chr7:100174326T>C	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.1543A>G	7.37:g.100174326T>C	ENSP00000309689:p.Ser515Gly		Somatic				uc003uvh.2_5'Flank|LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjw.1_Missense_Mutation_p.S42G	p.S515G	NM_002319	NP_002310	WXS	Illumina HiSeq	Unspecified	O75427	LRCH4_HUMAN			14	1596	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		515					A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	ENST00000310300.6	37	c.1543A>G	CCDS34706.1	.	.	.	.	.	.	.	.	.	.	T	11.85	1.763146	0.31228	.	.	ENSG00000077454	ENST00000310300;ENST00000497245	T;T	0.50277	1.37;0.75	4.68	2.27	0.28462	.	0.053463	0.64402	D	0.000001	T	0.29652	0.0740	L	0.34521	1.04	0.34931	D	0.749365	B;B	0.12013	0.002;0.005	B;B	0.08055	0.003;0.003	T	0.18871	-1.0323	10	0.22109	T	0.4	-5.1124	5.4291	0.16444	0.0:0.2428:0.0:0.7572	.	63;515	C9JYK0;O75427	.;LRCH4_HUMAN	G	515;63	ENSP00000309689:S515G;ENSP00000419870:S63G	ENSP00000309689:S515G	S	-	1	0	LRCH4	100012262	0.983000	0.35010	1.000000	0.80357	0.987000	0.75469	0.824000	0.27379	0.749000	0.32854	0.449000	0.29647	AGT		0.632	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356110.1	NM_002319		4	4	0	0	0	0.000602	0	4	4				
LRRN3	54674	broad.mit.edu	37	7	110762783	110762783	+	5'UTR	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:110762783G>A	ENST00000422987.3	+	0	786				LRRN3_ENST00000308478.5_5'UTR|IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000451085.1_5'UTR|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000447215.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3						positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AGCACTGACTGTGGAATCCTT	0.408																																							uc003vft.3		NA																	0				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8						c.(-47--43)CTGTG>CTATG		leucine rich repeat neuronal 3 precursor							45.0	42.0	43.0					7																	110762783		2203	4300	6503	SO:0001623	5_prime_UTR_variant	54674					integral to membrane		g.chr7:110762783G>A	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.-46G>A	7.37:g.110762783G>A			Somatic				IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Translation_Start_Site|LRRN3_uc003vfs.3_Translation_Start_Site		NM_001099660	NP_001093130	WXS	Illumina HiSeq	Unspecified	Q9H3W5	LRRN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)	4	1001	+								O43377|Q6I9V8|Q8IYQ6	Translation_Start_Site	SNP	ENST00000422987.3	37	c.-45G>A	CCDS5754.1																																																																																				0.408	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		13	49	0	0	0	0.013537	0	13	49				
PLXNA4	91584	broad.mit.edu	37	7	131844299	131844299	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:131844299C>A	ENST00000359827.3	-	25	5555	c.4593G>T	c.(4591-4593)aaG>aaT	p.K1531N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.K1531N			Q9HCM2	PLXA4_HUMAN	plexin A4	1531					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CATCCAGAATCTTCTCCTTGA	0.552																																							uc003vra.3		NA																	0				ovary(1)	1						c.(4591-4593)AAG>AAT		plexin A4 isoform 1							263.0	274.0	271.0					7																	131844299		2200	4300	6500	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131844299C>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4593G>T	7.37:g.131844299C>A	ENSP00000352882:p.Lys1531Asn		Somatic					p.K1531N	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			25	4822	-			1531			Cytoplasmic (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.4593G>T	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518048	0.85495	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.23754	1.89;1.89	5.22	5.22	0.72569	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75045	-0.3456	10	0.87932	D	0	.	18.7828	0.91941	0.0:1.0:0.0:0.0	.	1531	Q9HCM2	PLXA4_HUMAN	N	1531	ENSP00000323194:K1531N;ENSP00000352882:K1531N	ENSP00000323194:K1531N	K	-	3	2	PLXNA4	131494839	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.918000	0.63376	2.427000	0.82271	0.655000	0.94253	AAG		0.552	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		65	166	1	0	9.40535e-28	0.01441	1.30115e-27	65	166				
NOS3	4846	broad.mit.edu	37	7	150695764	150695764	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr7:150695764C>G	ENST00000484524.1	+	6	812	c.812C>G	c.(811-813)aCc>aGc	p.T271S	NOS3_ENST00000461406.1_Missense_Mutation_p.T65S|NOS3_ENST00000297494.3_Missense_Mutation_p.T271S|NOS3_ENST00000467517.1_Missense_Mutation_p.T271S	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGGAGATCACCGAGGTGGGC	0.652																																							uc003wif.2		NA																	0				central_nervous_system(5)|large_intestine(2)|skin(1)	8						c.(811-813)ACC>AGC		nitric oxide synthase 3 isoform 1	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)						11.0	12.0	12.0					7																	150695764		2176	4268	6444	SO:0001583	missense	4846				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr7:150695764C>G		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.812C>G	7.37:g.150695764C>G	ENSP00000420215:p.Thr271Ser		Somatic				NOS3_uc011kuy.1_Missense_Mutation_p.T65S|NOS3_uc011kuz.1_Missense_Mutation_p.T271S|NOS3_uc011kva.1_Missense_Mutation_p.T271S|NOS3_uc011kvb.1_Missense_Mutation_p.T271S	p.T271S	NM_000603	NP_000594	WXS	Illumina HiSeq	Unspecified	P29474	NOS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	7	1108	+	all_neural(206;0.219)		271			Interaction with NOSIP.		Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	c.812C>G	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	c	22.1	4.242050	0.79912	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.29917	1.57;1.55;1.57;1.57	5.13	5.13	0.70059	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000012	T	0.66228	0.2768	M	0.93150	3.385	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.985;0.985;1.0;1.0;0.999	D;D;D;D;D	0.83275	0.961;0.961;0.996;0.996;0.981	T	0.75365	-0.3343	10	0.62326	D	0.03	-19.6386	16.4458	0.83932	0.0:1.0:0.0:0.0	.	271;271;271;65;271	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	S	271;65;271;271	ENSP00000297494:T271S;ENSP00000417143:T65S;ENSP00000420215:T271S;ENSP00000420551:T271S	ENSP00000297494:T271S	T	+	2	0	NOS3	150326697	1.000000	0.71417	0.972000	0.41901	0.521000	0.34408	6.038000	0.70964	2.548000	0.85928	0.637000	0.83480	ACC		0.652	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603		3	5	0	0	0	0.004672	0	3	5				
UBXN2B	137886	broad.mit.edu	37	8	59329441	59329441	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:59329441G>A	ENST00000399598.2	+	2	239	c.117G>A	c.(115-117)gtG>gtA	p.V39V	UBXN2B_ENST00000522978.1_3'UTR	NM_001077619.1	NP_001071087.1	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	39						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13						AAGATGAAGTGAAGTGCAAAT	0.373																																							uc003xtl.2		NA																	0				ovary(2)	2						c.(115-117)GTG>GTA		UBX domain protein 2B							96.0	87.0	90.0					8																	59329441		1871	4097	5968	SO:0001819	synonymous_variant	137886					cytosol|endoplasmic reticulum|Golgi apparatus|nucleus		g.chr8:59329441G>A	AK054658	CCDS43741.1	8q12.1	2008-08-08			ENSG00000215114	ENSG00000215114		"""UBX domain containing"""	27035	protein-coding gene	gene with protein product		610686				8619474, 9110174	Standard	NM_001077619		Approved	p37	uc003xtl.3	Q14CS0	OTTHUMG00000164300	ENST00000399598.2:c.117G>A	8.37:g.59329441G>A			Somatic					p.V39V	NM_001077619	NP_001071087	WXS	Illumina HiSeq	Unspecified	Q14CS0	UBX2B_HUMAN			2	239	+			39					B3KWZ3	Silent	SNP	ENST00000399598.2	37	c.117G>A	CCDS43741.1																																																																																				0.373	UBXN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378184.1	NM_001077619		10	71	0	0	0	0.001855	0	10	71				
HRSP12	10247	broad.mit.edu	37	8	99120937	99120937	+	Missense_Mutation	SNP	C	C	G	rs201559618		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:99120937C>G	ENST00000254878.3	-	2	252	c.108G>C	c.(106-108)caG>caC	p.Q36H		NM_005836.2	NP_005827.1	P52758	UK114_HUMAN	heat-responsive protein 12	36					regulation of translational termination (GO:0006449)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deaminase activity (GO:0019239)|endonuclease activity (GO:0004519)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	6	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CCATGCCTATCTGTCCTGAAA	0.378																																							uc003yii.1		NA																	0				ovary(1)	1						c.(106-108)CAG>CAC		heat-responsive protein 12							164.0	140.0	148.0					8																	99120937		2203	4300	6503	SO:0001583	missense	10247				regulation of translational termination	nucleus	endonuclease activity	g.chr8:99120937C>G	BC008418	CCDS6276.1	8q22	2014-05-09			ENSG00000132541	ENSG00000132541			16897	protein-coding gene	gene with protein product	"""translational inhibitor p14.5"""	602487				8973653, 9405234, 20817725	Standard	NM_005836		Approved	UK114, P14.5, PSP	uc003yii.1	P52758	OTTHUMG00000164670	ENST00000254878.3:c.108G>C	8.37:g.99120937C>G	ENSP00000254878:p.Gln36His		Somatic					p.Q36H	NM_005836	NP_005827	WXS	Illumina HiSeq	Unspecified	P52758	UK114_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.214)		2	202	-	Breast(36;1.78e-06)		36					Q6FHU9|Q6IBG0	Missense_Mutation	SNP	ENST00000254878.3	37	c.108G>C	CCDS6276.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.82|18.82	3.706109|3.706109	0.68615|0.68615	.|.	.|.	ENSG00000132541|ENSG00000132541	ENST00000520507|ENST00000254878;ENST00000520989	.|.	.|.	.|.	5.91|5.91	4.13|4.13	0.48395|0.48395	.|Endoribonuclease L-PSP/chorismate mutase-like (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85665|0.85665	0.5749|0.5749	H|H	0.95950|0.95950	3.745|3.745	0.43133|0.43133	D|D	0.994877|0.994877	.|D	.|0.89917	.|1.0	.|D	.|0.81914	.|0.995	D|D	0.87454|0.87454	0.2403|0.2403	5|9	.|0.87932	.|D	.|0	.|.	9.9004|9.9004	0.41344|0.41344	0.0:0.8425:0.0:0.1575|0.0:0.8425:0.0:0.1575	.|.	.|36	.|P52758	.|UK114_HUMAN	H|H	47|36	.|.	.|ENSP00000254878:Q36H	D|Q	-|-	1|3	0|2	HRSP12|HRSP12	99190113|99190113	0.956000|0.956000	0.32656|0.32656	0.714000|0.714000	0.30535|0.30535	0.991000|0.991000	0.79684|0.79684	2.114000|2.114000	0.41911|0.41911	0.847000|0.847000	0.35167|0.35167	0.655000|0.655000	0.94253|0.94253	GAT|CAG		0.378	HRSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379687.1	NM_005836		26	135	0	0	0	0.003954	0	26	135				
UTP23	84294	broad.mit.edu	37	8	117782546	117782546	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:117782546G>C	ENST00000309822.2	+	2	405	c.304G>C	c.(304-306)Gaa>Caa	p.E102Q	UTP23_ENST00000520733.1_5'UTR|UTP23_ENST00000357148.3_Missense_Mutation_p.E102Q|UTP23_ENST00000517820.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	102					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						GAGTGGATCAGAATGTCTGCT	0.393																																							uc003yoc.2		NA																	0					0						c.(304-306)GAA>CAA		UTP23, small subunit (SSU) processome component,							129.0	118.0	122.0					8																	117782546		2203	4300	6503	SO:0001583	missense	84294				rRNA processing	nucleolus		g.chr8:117782546G>C		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.304G>C	8.37:g.117782546G>C	ENSP00000308332:p.Glu102Gln		Somatic					p.E102Q	NM_032334	NP_115710	WXS	Illumina HiSeq	Unspecified	Q9BRU9	UTP23_HUMAN			2	405	+			102					B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	c.304G>C	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349891	0.41599	.	.	ENSG00000147679	ENST00000309822;ENST00000357148;ENST00000517814	T	0.27256	1.68	5.9	5.01	0.66863	.	0.366753	0.33457	N	0.004896	T	0.24198	0.0586	L	0.58810	1.83	0.34628	D	0.719366	B	0.24823	0.112	B	0.24006	0.05	T	0.31308	-0.9948	10	0.56958	D	0.05	-11.3736	6.3873	0.21568	0.174:0.0:0.6796:0.1464	.	102	Q9BRU9	UTP23_HUMAN	Q	102	ENSP00000308332:E102Q	ENSP00000308332:E102Q	E	+	1	0	UTP23	117851727	0.996000	0.38824	0.952000	0.39060	0.995000	0.86356	2.375000	0.44283	1.464000	0.47987	0.650000	0.86243	GAA		0.393	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334		15	173	0	0	0	0.003163	0	15	173				
UTP23	84294	broad.mit.edu	37	8	117783724	117783724	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:117783724G>C	ENST00000309822.2	+	3	494	c.393G>C	c.(391-393)aaG>aaC	p.K131N	UTP23_ENST00000520733.1_Intron|UTP23_ENST00000357148.3_Intron|UTP23_ENST00000517820.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	131					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						AAGTAAAAAAGAAGCCTGGAG	0.333																																							uc003yoc.2		NA																	0					0						c.(391-393)AAG>AAC		UTP23, small subunit (SSU) processome component,							60.0	68.0	66.0					8																	117783724		2203	4300	6503	SO:0001583	missense	84294				rRNA processing	nucleolus		g.chr8:117783724G>C		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.393G>C	8.37:g.117783724G>C	ENSP00000308332:p.Lys131Asn		Somatic					p.K131N	NM_032334	NP_115710	WXS	Illumina HiSeq	Unspecified	Q9BRU9	UTP23_HUMAN			3	494	+			131					B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	c.393G>C	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793152	0.31685	.	.	ENSG00000147679	ENST00000309822	T	0.25414	1.8	5.96	1.07	0.20283	.	0.328018	0.38897	N	0.001522	T	0.29684	0.0741	M	0.82716	2.605	0.46396	D	0.999026	B	0.20550	0.046	B	0.17433	0.018	T	0.11275	-1.0594	10	0.45353	T	0.12	-16.9316	9.8247	0.40905	0.4969:0.0:0.5031:0.0	.	131	Q9BRU9	UTP23_HUMAN	N	131	ENSP00000308332:K131N	ENSP00000308332:K131N	K	+	3	2	UTP23	117852905	0.938000	0.31826	0.775000	0.31657	0.976000	0.68499	0.756000	0.26419	0.163000	0.19507	0.655000	0.94253	AAG		0.333	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334		24	161	0	0	0	0.00278	0	24	161				
DEPTOR	64798	broad.mit.edu	37	8	121061886	121061886	+	Silent	SNP	G	G	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:121061886G>A	ENST00000286234.5	+	9	1303	c.1173G>A	c.(1171-1173)ctG>ctA	p.L391L	DEPTOR_ENST00000523492.1_Silent_p.L290L	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	391	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						TGAGCAATCTGATTCTGACGG	0.547																																							uc003yow.3		NA																	0					0						c.(1171-1173)CTG>CTA		DEP domain containing 6							173.0	150.0	158.0					8																	121061886		2203	4300	6503	SO:0001819	synonymous_variant	64798				intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding	g.chr8:121061886G>A		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.1173G>A	8.37:g.121061886G>A			Somatic				DEPDC6_uc011lid.1_Silent_p.L290L	p.L391L	NM_022783	NP_073620	WXS	Illumina HiSeq	Unspecified	Q8TB45	DPTOR_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		9	1360	+	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		391			PDZ.		B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Silent	SNP	ENST00000286234.5	37	c.1173G>A	CCDS6331.1																																																																																				0.547	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783		24	141	0	0	0	0.007291	0	24	141				
TAF1L	138474	broad.mit.edu	37	9	32635343	32635343	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:32635343C>T	ENST00000242310.4	-	1	324	c.235G>A	c.(235-237)Gaa>Aaa	p.E79K	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	79					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCCGTGAGTTCAGTGATTAGG	0.527																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(235-237)GAA>AAA		TBP-associated factor RNA polymerase 1-like							153.0	148.0	150.0					9																	32635343		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32635343C>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.235G>A	9.37:g.32635343C>T	ENSP00000418379:p.Glu79Lys		Somatic				uc003zrh.1_Intron	p.E79K	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	325	-			79					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.235G>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340923	0.60963	.	.	ENSG00000122728	ENST00000242310	T	0.12984	2.63	1.04	1.04	0.20106	TAFII-230 TBP-binding (2);	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	M	0.71036	2.16	0.50039	D	0.999843	D	0.63046	0.992	D	0.65140	0.932	T	0.02167	-1.1202	10	0.72032	D	0.01	.	7.4859	0.27432	0.0:1.0:0.0:0.0	.	79	Q8IZX4	TAF1L_HUMAN	K	79	ENSP00000418379:E79K	ENSP00000418379:E79K	E	-	1	0	TAF1L	32625343	1.000000	0.71417	0.808000	0.32385	0.074000	0.17049	3.101000	0.50283	0.507000	0.28148	0.195000	0.17529	GAA		0.527	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			37	58	0	0	0	0.004289	0	37	58				
SPIN1	10927	broad.mit.edu	37	9	91041471	91041471	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:91041471G>T	ENST00000375859.3	+	2	295	c.17G>T	c.(16-18)gGa>gTa	p.G6V	SPIN1_ENST00000541629.1_Missense_Mutation_p.G6V|SPIN1_ENST00000469017.2_3'UTR	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1	6					chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						ACCCCATTCGGAAAGACACCT	0.393																																							uc010mqj.2		NA																	0					0						c.(16-18)GGA>GTA		spindlin							34.0	36.0	35.0					9																	91041471		1832	4077	5909	SO:0001583	missense	10927				cell cycle|gamete generation|multicellular organismal development	nucleus	methylated histone residue binding	g.chr9:91041471G>T	AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.17G>T	9.37:g.91041471G>T	ENSP00000365019:p.Gly6Val		Somatic				SPIN1_uc004apy.2_Missense_Mutation_p.G6V|SPIN1_uc004apz.2_Missense_Mutation_p.G6V|SPIN1_uc010mqk.2_Missense_Mutation_p.G6V	p.G6V	NM_006717	NP_006708	WXS	Illumina HiSeq	Unspecified	Q9Y657	SPIN1_HUMAN			2	517	+			6					A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	Missense_Mutation	SNP	ENST00000375859.3	37	c.17G>T	CCDS43843.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.377098	0.42105	.	.	ENSG00000106723	ENST00000375859;ENST00000541629	T;T	0.42900	0.96;0.96	4.27	3.38	0.38709	.	0.255361	0.30210	N	0.010155	T	0.35653	0.0939	L	0.43152	1.355	0.80722	D	1	B	0.20671	0.047	B	0.19946	0.027	T	0.24764	-1.0151	10	0.45353	T	0.12	-6.0113	13.1214	0.59329	0.0795:0.0:0.9205:0.0	.	6	Q9Y657	SPIN1_HUMAN	V	6	ENSP00000365019:G6V;ENSP00000441864:G6V	ENSP00000365019:G6V	G	+	2	0	SPIN1	90231291	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.898000	0.75676	1.398000	0.46701	0.585000	0.79938	GGA		0.393	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052967.1	NM_006717		8	17	1	0	5.18039e-06	0.00308	5.3404e-06	8	17				
SMC2	10592	broad.mit.edu	37	9	106864469	106864469	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:106864469G>C	ENST00000286398.7	+	8	1153	c.865G>C	c.(865-867)Gat>Cat	p.D289H	SMC2_ENST00000374787.3_Missense_Mutation_p.D289H|SMC2_ENST00000303219.8_Missense_Mutation_p.D289H|SMC2_ENST00000374793.3_Missense_Mutation_p.D289H	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	289					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AAAAAGAAAAGATAAGGTCTG	0.269																																							uc004bbv.2		NA																	0				ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						c.(865-867)GAT>CAT		structural maintenance of chromosomes 2							21.0	25.0	24.0					9																	106864469		2156	4264	6420	SO:0001583	missense	10592				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity	g.chr9:106864469G>C	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.865G>C	9.37:g.106864469G>C	ENSP00000286398:p.Asp289His		Somatic				SMC2_uc004bbu.1_Missense_Mutation_p.D289H|SMC2_uc004bbw.2_Missense_Mutation_p.D289H|SMC2_uc011lvl.1_Missense_Mutation_p.D289H|SMC2_uc010mtg.1_Missense_Mutation_p.D144H|SMC2_uc010mth.1_Missense_Mutation_p.D239H|SMC2_uc004bbx.2_Missense_Mutation_p.D289H	p.D289H	NM_001042551	NP_001036016	WXS	Illumina HiSeq	Unspecified	O95347	SMC2_HUMAN			8	1153	+			289			Potential.		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	c.865G>C	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794781	0.90453	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T	0.80566	-1.28;-1.28;-1.39;-1.28	5.8	5.8	0.92144	RecF/RecN/SMC (1);	0.263355	0.44688	D	0.000422	D	0.89410	0.6707	M	0.71036	2.16	0.80722	D	1	D;D;D	0.71674	0.965;0.981;0.998	D;P;D	0.72338	0.93;0.897;0.977	D	0.89536	0.3789	10	0.87932	D	0	-28.1989	18.9952	0.92810	0.0:0.0:1.0:0.0	.	289;289;289	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	H	289;144;289;289;289;289	ENSP00000286398:D289H;ENSP00000363925:D289H;ENSP00000306152:D289H;ENSP00000363919:D289H	ENSP00000286398:D289H	D	+	1	0	SMC2	105904290	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.676000	0.84012	2.902000	0.99343	0.650000	0.86243	GAT		0.269	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1			9	27	0	0	0	0.006214	0	9	27				
MUSK	4593	broad.mit.edu	37	9	113562746	113562746	+	Silent	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:113562746C>A	ENST00000374448.4	+	15	2222	c.2088C>A	c.(2086-2088)ccC>ccA	p.P696P	MUSK_ENST00000416899.2_Silent_p.P688P|MUSK_ENST00000189978.5_Silent_p.P696P	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	696	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in dbSNP:rs56126328). {ECO:0000269|PubMed:17344846}.		cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GGCCCCCACCCCTCTCCTGTG	0.577																																							uc004bey.2		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(2086-2088)CCC>CCA		skeletal muscle receptor tyrosine kinase							108.0	112.0	111.0					9																	113562746		2005	4166	6171	SO:0001819	synonymous_variant	4593				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr9:113562746C>A	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2088C>A	9.37:g.113562746C>A			Somatic				MUSK_uc004bez.1_Silent_p.P276P	p.P696P	NM_005592	NP_005583	WXS	Illumina HiSeq	Unspecified	O15146	MUSK_HUMAN			14	2186	+			696			Protein kinase.|Cytoplasmic (Potential).		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Silent	SNP	ENST00000374448.4	37	c.2088C>A	CCDS48005.1																																																																																				0.577	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				71	75	1	0	1.07363e-35	0.01441	1.53294e-35	71	75				
OR1N2	138882	broad.mit.edu	37	9	125315631	125315631	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:125315631C>T	ENST00000373688.2	+	1	241	c.183C>T	c.(181-183)ctC>ctT	p.L61L		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						GGAACCTGCTCATTATCCTGG	0.522																																							uc011lyx.1		NA																	0				ovary(2)|skin(2)	4						c.(181-183)CTC>CTT		olfactory receptor, family 1, subfamily N,							231.0	205.0	214.0					9																	125315631		2203	4300	6503	SO:0001819	synonymous_variant	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125315631C>T		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.183C>T	9.37:g.125315631C>T			Somatic					p.L61L	NM_001004457	NP_001004457	WXS	Illumina HiSeq	Unspecified	Q8NGR9	OR1N2_HUMAN			1	183	+			61			Helical; Name=1; (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	37	c.183C>T	CCDS35123.1																																																																																				0.522	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			36	85	0	0	0	0.003271	0	36	85				
OR1B1	347169	broad.mit.edu	37	9	125391523	125391523	+	Missense_Mutation	SNP	G	G	A	rs140947515	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:125391523G>A	ENST00000304833.3	-	1	329	c.292C>T	c.(292-294)Cgc>Tgc	p.R98C	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						GCCAAGCAGCGGGCAGCAGGA	0.517																																							uc011lyz.1		NA																	0					0						c.(292-294)CGC>TGC		olfactory receptor, family 1, subfamily B,							87.0	76.0	80.0					9																	125391523		2203	4300	6503	SO:0001583	missense	347169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125391523G>A	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.292C>T	9.37:g.125391523G>A	ENSP00000303151:p.Arg98Cys		Somatic					p.R98C	NM_001004450	NP_001004450	WXS	Illumina HiSeq	Unspecified	Q8NGR6	OR1B1_HUMAN			1	292	-			98			Extracellular (Potential).		Q6IFN3	Missense_Mutation	SNP	ENST00000304833.3	37	c.292C>T	CCDS35126.1	.	.	.	.	.	.	.	.	.	.	G	2.893	-0.229245	0.06022	.	.	ENSG00000171484	ENST00000304833	T	0.03035	4.07	4.3	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42053	D	0.000770	T	0.02380	0.0073	N	0.12527	0.23	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.42832	-0.9428	10	0.56958	D	0.05	-4.5251	7.8499	0.29448	0.0926:0.4433:0.4641:0.0	.	98	Q8NGR6	OR1B1_HUMAN	C	98	ENSP00000303151:R98C	ENSP00000303151:R98C	R	-	1	0	OR1B1	124431344	0.000000	0.05858	0.252000	0.24328	0.116000	0.19942	-0.131000	0.10482	0.524000	0.28502	-0.133000	0.14855	CGC		0.517	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053947.2	NM_001004450		14	24	0	0	0	0.00245	0	14	24				
OR1K1	392392	broad.mit.edu	37	9	125563287	125563287	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:125563287C>A	ENST00000277309.2	+	1	918	c.886C>A	c.(886-888)Cgc>Agc	p.R296S		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						CCTCTGGAATCGCGATGTACA	0.607																																							uc011lze.1		NA																	0				ovary(1)	1						c.(886-888)CGC>AGC		olfactory receptor, family 1, subfamily K,							69.0	63.0	65.0					9																	125563287		2203	4300	6503	SO:0001583	missense	392392				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125563287C>A	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.886C>A	9.37:g.125563287C>A	ENSP00000277309:p.Arg296Ser		Somatic					p.R296S	NM_080859	NP_543135	WXS	Illumina HiSeq	Unspecified	Q8NGR3	OR1K1_HUMAN			1	886	+			296			Cytoplasmic (Potential).		B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	c.886C>A	CCDS35132.1	.	.	.	.	.	.	.	.	.	.	C	5.749	0.322652	0.10900	.	.	ENSG00000165204	ENST00000277309	T	0.37058	1.22	4.49	1.55	0.23275	.	0.000000	0.38837	U	0.001555	T	0.25680	0.0625	L	0.32530	0.975	0.09310	N	1	P	0.39883	0.693	B	0.42087	0.375	T	0.11324	-1.0592	10	0.59425	D	0.04	.	4.0934	0.09980	0.4399:0.3775:0.0:0.1826	.	296	Q8NGR3	OR1K1_HUMAN	S	296	ENSP00000277309:R296S	ENSP00000277309:R296S	R	+	1	0	OR1K1	124603108	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.313000	0.08103	0.131000	0.18576	-0.251000	0.11542	CGC		0.607	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1			27	38	1	0	2.48779e-11	0.005443	2.8755e-11	27	38				
FAM69B	138311	broad.mit.edu	37	9	139617467	139617467	+	Silent	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr9:139617467C>G	ENST00000371692.4	+	5	633	c.537C>G	c.(535-537)ctC>ctG	p.L179L	SNHG7_ENST00000447221.1_RNA|SNHG7_ENST00000416970.1_RNA|SNHG7_ENST00000414282.1_RNA|FAM69B_ENST00000371691.1_Silent_p.L92L|SNHG7_ENST00000436596.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	179						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		AGGTCCTGCTCATGGCTGACT	0.607																																							uc004cik.2		NA																	0					0						c.(535-537)CTC>CTG		hypothetical protein LOC138311							36.0	36.0	36.0					9																	139617467		2203	4300	6503	SO:0001819	synonymous_variant	138311					endoplasmic reticulum membrane|integral to membrane		g.chr9:139617467C>G		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.537C>G	9.37:g.139617467C>G			Somatic				FAM69B_uc004cil.2_Silent_p.L92L|SNHG7_uc004cim.2_RNA	p.L179L	NM_152421	NP_689634	WXS	Illumina HiSeq	Unspecified	Q5VUD6	FA69B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)	5	631	+	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)	179			Lumenal (Potential).		Q5VUD7|Q8N5N0|Q8WYU5	Silent	SNP	ENST00000371692.4	37	c.537C>G	CCDS7004.1																																																																																				0.607	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421		11	22	0	0	0	0.001855	0	11	22				
PLCXD1	55344	broad.mit.edu	37	X	215942	215942	+	Silent	SNP	C	C	T			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chrX:215942C>T	ENST00000381657.2	+	7	1426	c.912C>T	c.(910-912)atC>atT	p.I304I	PLCXD1_ENST00000399012.1_Silent_p.I304I|PLCXD1_ENST00000381663.3_Silent_p.I304I	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	304					lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)	p.I304I(1)		endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGACTTCATCGGCGCAGACG	0.647																																							uc004cpc.2		NA																	1	Substitution - coding silent(1)		endometrium(1)		0						c.(910-912)ATC>ATT		phosphatidylinositol-specific phospholipase C, X							94.0	84.0	88.0					X																	215942		2203	4296	6499	SO:0001819	synonymous_variant	55344				intracellular signal transduction|lipid metabolic process		phospholipase C activity	g.chrX:215942C>T	AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.912C>T	X.37:g.215942C>T			Somatic				PLCXD1_uc011mgx.1_RNA	p.I304I	NM_018390	NP_060860	WXS	Illumina HiSeq	Unspecified	Q9NUJ7	PLCX1_HUMAN			7	1224	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	304					A2BH51|A2BH52	Silent	SNP	ENST00000381657.2	37	c.912C>T	CCDS14103.1																																																																																				0.647	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058879.2	NM_018390		10	38	0	0	0	0.008291	0	10	38				
MAGEC3	139081	broad.mit.edu	37	X	140926162	140926162	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chrX:140926162T>C	ENST00000298296.1	+	1	61	c.61T>C	c.(61-63)Tgg>Cgg	p.W21R		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	21										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TCTAGGCCAGTGGGTGAAAAA	0.562																																							uc011mwp.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(61-63)TGG>CGG		melanoma antigen family C, 3 isoform 1							124.0	88.0	100.0					X																	140926162		2203	4300	6503	SO:0001583	missense	139081							g.chrX:140926162T>C	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.61T>C	X.37:g.140926162T>C	ENSP00000298296:p.Trp21Arg		Somatic					p.W21R	NM_138702	NP_619647	WXS	Illumina HiSeq	Unspecified	Q8TD91	MAGC3_HUMAN			1	61	+	Acute lymphoblastic leukemia(192;6.56e-05)		21					Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	c.61T>C	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	T	9.037	0.988739	0.18966	.	.	ENSG00000165509	ENST00000298296	T	0.08370	3.1	0.427	0.427	0.16489	.	.	.	.	.	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	D	0.55605	0.972	P	0.59643	0.861	T	0.33675	-0.9859	8	0.87932	D	0	.	.	.	.	.	21	Q8TD91	MAGC3_HUMAN	R	21	ENSP00000298296:W21R	ENSP00000298296:W21R	W	+	1	0	MAGEC3	140753828	0.226000	0.23696	0.008000	0.14137	0.008000	0.06430	0.310000	0.19356	0.350000	0.24002	0.345000	0.21793	TGG		0.562	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		32	3	0	0	0	0.012213	0	32	3				
MAGEA10	4109	broad.mit.edu	37	X	151304067	151304067	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chrX:151304067C>G	ENST00000370323.4	-	4	342	c.26G>C	c.(25-27)cGc>cCc	p.R9P	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.R9P	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	9						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCATGCAGCGCTGACGCTT	0.597																																							uc004ffk.2		NA																	0					0						c.(25-27)CGC>CCC		melanoma antigen family A, 10							88.0	90.0	89.0					X																	151304067		2202	4296	6498	SO:0001583	missense	4109							g.chrX:151304067C>G		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.26G>C	X.37:g.151304067C>G	ENSP00000359347:p.Arg9Pro		Somatic				MAGEA10_uc004ffl.2_Missense_Mutation_p.R9P	p.R9P	NM_001011543	NP_001011543	WXS	Illumina HiSeq	Unspecified	P43363	MAGAA_HUMAN			5	434	-	Acute lymphoblastic leukemia(192;6.56e-05)		9						Missense_Mutation	SNP	ENST00000370323.4	37	c.26G>C	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	C	5.823	0.336094	0.11013	.	.	ENSG00000124260	ENST00000370323;ENST00000244096;ENST00000444834;ENST00000427322	T;T;T;T	0.04406	3.63;3.63;3.63;3.63	2.54	-3.79	0.04320	Melanoma associated antigen, MAGE, N-terminal (1);	2.728460	0.01345	N	0.011705	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B	0.23185	0.081	B	0.28638	0.092	T	0.37798	-0.9690	10	0.32370	T	0.25	.	3.2684	0.06873	0.5014:0.2459:0.0:0.2528	.	9	P43363	MAGAA_HUMAN	P	9	ENSP00000359347:R9P;ENSP00000244096:R9P;ENSP00000406161:R9P;ENSP00000391977:R9P	ENSP00000244096:R9P	R	-	2	0	MAGEA10	151054723	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-0.076000	0.11412	-1.313000	0.02303	0.292000	0.19580	CGC		0.597	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		38	12	0	0	0	0.004878	0	38	12				
FASN	2194	broad.mit.edu	37	17	80042538	80042539	+	Frame_Shift_Ins	INS	-	-	C			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr17:80042538_80042539insC	ENST00000306749.2	-	27	4836_4837	c.4618_4619insG	c.(4618-4620)gacfs	p.D1540fs	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1540					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGAGGACAGGTCCCCCCGGGTG	0.673																																					Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	0				central_nervous_system(1)	1						c.(4618-4620)GACfs		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)																																			SO:0001589	frameshift_variant	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80042538_80042539insC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4619dupG	17.37:g.80042544_80042544dupC	ENSP00000304592:p.Asp1540fs		Somatic				FASN_uc002kdv.1_5'Flank	p.D1540fs	NM_004104	NP_004095	WXS	Illumina HiSeq	Unspecified	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		27	4735_4736	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		1540					Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Frame_Shift_Ins	INS	ENST00000306749.2	37	c.4618_4619insG	CCDS11801.1																																																																																				0.673	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1223056	1223069	+	Frame_Shift_Del	DEL	GTGGCGCAGCATGA	GTGGCGCAGCATGA	-	rs587782267|rs121913325		TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	GTGGCGCAGCATGA	GTGGCGCAGCATGA	-	-	GTGGCGCAGCATGA	GTGGCGCAGCATGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr19:1223056_1223069delGTGGCGCAGCATGA	ENST00000326873.7	+	8	2166_2179	c.993_1006delGTGGCGCAGCATGA	c.(991-1008)cggtggcgcagcatgactfs	p.WRSMT332fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	332					activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.W332*(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAAGGACCGGTGGCGCAGCATGACTGTGGTGCC	0.617	W332*(NCIH23_LUNG)	14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1	W332*(NCIH23_LUNG)	14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Substitution - Nonsense(3)	p.0?(19)|p.W332*(3)	cervix(14)|lung(5)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CD077783	STK11	D		c.(991-1008)CGGTGGCGCAGCATGACTfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1223056_1223069delGTGGCGCAGCATGA	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.993_1006delGTGGCGCAGCATGA	19.37:g.1223056_1223069delGTGGCGCAGCATGA	ENSP00000324856:p.Trp332fs	TSP Lung(3;<1E-08)	Somatic					p.R331fs	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	8	2108_2121	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	331_336					B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	c.993_1006delGTGGCGCAGCATGA	CCDS45896.1																																																																																				0.617	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		12	3	NA	NA	NA	NA	NA	12	3	---	---	---	---
HEG1	57493	broad.mit.edu	37	3	124731518	124731519	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr3:124731518_124731519insA	ENST00000311127.4	-	6	2971_2972	c.2904_2905insT	c.(2902-2907)tttgctfs	p.A969fs	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	969					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						CTCTGAACAGCAAAGGTGGCAG	0.525																																							uc003ehs.3		NA																	0				ovary(2)	2						c.(2902-2907)TTTGCTfs		HEG homolog 1 precursor																																				SO:0001589	frameshift_variant	57493					extracellular region|integral to membrane	calcium ion binding	g.chr3:124731518_124731519insA	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2905dupT	3.37:g.124731521_124731521dupA	ENSP00000311502:p.Ala969fs		Somatic				HEG1_uc011bke.1_Frame_Shift_Ins_p.F1068fs	p.F968fs	NM_020733	NP_065784	WXS	Illumina HiSeq	Unspecified	Q9ULI3	HEG1_HUMAN			6	2972_2973	-			968_969			Extracellular (Potential).		Q6NX66|Q8NC40|Q9BSV0	Frame_Shift_Ins	INS	ENST00000311127.4	37	c.2904_2905insT	CCDS46898.1																																																																																				0.525	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		17	16	NA	NA	NA	NA	NA	17	16	---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	37962391	37962402	+	Intron	DEL	AGAAATAGAAAA	AGAAATAGAAAA	-			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	AGAAATAGAAAA	AGAAATAGAAAA	-	-	AGAAATAGAAAA	AGAAATAGAAAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr4:37962391_37962402delAGAAATAGAAAA	ENST00000261439.4	+	3	772				PTTG2_ENST00000504686.1_In_Frame_Del_p.EIEK113del|TBC1D1_ENST00000508802.1_Intron	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						ACGCCTATCCAGAAATAGAAAAATTCTTTCCC	0.439																																							uc011bye.1		NA																	0					0						c.(334-348)CCAGAAATAGAAAAA>CCA		pituitary tumor-transforming 2																																				SO:0001627	intron_variant	10744				chromosome organization|DNA metabolic process	cytoplasm|nucleus	SH3 domain binding	g.chr4:37962391_37962402delAGAAATAGAAAA	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.418-53728AGAAATAGAAAA>-	4.37:g.37962391_37962402delAGAAATAGAAAA			Somatic				TBC1D1_uc003gtb.2_Intron|TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	p.EIEK113del	NM_006607	NP_006598	WXS	Illumina HiSeq	Unspecified	Q9NZH5	PTTG2_HUMAN			1	336_347	+			113_116					B7Z3D9|E9PGH8|Q96K82|Q9UPP4	In_Frame_Del	DEL	ENST00000261439.4	37	c.336_347delAGAAATAGAAAA	CCDS33972.1																																																																																				0.439	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173		31	156	NA	NA	NA	NA	NA	31	156	---	---	---	---
ARAP3	64411	broad.mit.edu	37	5	141052424	141052424	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr5:141052424delG	ENST00000239440.4	-	8	1227	c.1162delC	c.(1162-1164)cggfs	p.R388fs	ARAP3_ENST00000508305.1_Frame_Shift_Del_p.R310fs|ARAP3_ENST00000513878.1_Frame_Shift_Del_p.R50fs	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	388					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TGGGGGGGCCGGGGGTGGCCC	0.672																																							uc003llm.2		NA																	0				breast(5)|ovary(1)|large_intestine(1)	7						c.(1162-1164)CGGfs		ArfGAP with RhoGAP domain, ankyrin repeat and PH							10.0	12.0	11.0					5																	141052424		2185	4263	6448	SO:0001589	frameshift_variant	64411				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding	g.chr5:141052424delG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1162delC	5.37:g.141052424delG	ENSP00000239440:p.Arg388fs		Somatic				ARAP3_uc011dbe.1_Frame_Shift_Del_p.R50fs|ARAP3_uc003lln.2_Frame_Shift_Del_p.R310fs|ARAP3_uc003llo.1_Frame_Shift_Del_p.R388fs	p.R388fs	NM_022481	NP_071926	WXS	Illumina HiSeq	Unspecified	Q8WWN8	ARAP3_HUMAN			8	1240	-			388					B4DIT1|D3DQE3	Frame_Shift_Del	DEL	ENST00000239440.4	37	c.1162delC	CCDS4266.1																																																																																				0.672	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
EYA1	2138	broad.mit.edu	37	8	72234058	72234067	+	Frame_Shift_Del	DEL	CCATATGCAG	CCATATGCAG	-	rs112282055|rs141779040	byFrequency	TCGA-78-7167-01A-11D-2063-08	TCGA-78-7167-11A-01D-2063-08	CCATATGCAG	CCATATGCAG	-	-	CCATATGCAG	CCATATGCAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	47f8509a-3dd2-4750-b291-035218152168	3ca799b9-0f69-41aa-a0b5-e9ee6a1ec7da	g.chr8:72234058_72234067delCCATATGCAG	ENST00000340726.3	-	6	959_968	c.320_329delCTGCATATGG	c.(319-330)gctgcatatgggfs	p.AAYG107fs	EYA1_ENST00000388743.2_Frame_Shift_Del_p.AAYG106fs|EYA1_ENST00000419131.1_Frame_Shift_Del_p.AAYG107fs|EYA1_ENST00000388742.4_Frame_Shift_Del_p.AAYG107fs|EYA1_ENST00000388741.2_Frame_Shift_Del_p.AAYG73fs|EYA1_ENST00000303824.7_Frame_Shift_Del_p.AAYG106fs|EYA1_ENST00000388740.3_Frame_Shift_Del_p.AAYG74fs	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	107					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CTGTGTTTGCCCATATGCAGCCATAGTTTG	0.462																																							uc003xys.3		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5						c.(319-330)GCTGCATATGGGfs		eyes absent 1 isoform b																																				SO:0001589	frameshift_variant	2138				double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr8:72234058_72234067delCCATATGCAG	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.320_329delCTGCATATGG	8.37:g.72234058_72234067delCCATATGCAG	ENSP00000342626:p.Ala107fs		Somatic				EYA1_uc003xyr.3_Frame_Shift_Del_p.A107fs|EYA1_uc003xyt.3_Frame_Shift_Del_p.A74fs|EYA1_uc010lzf.2_Frame_Shift_Del_p.A34fs|EYA1_uc003xyu.2_Frame_Shift_Del_p.A107fs|EYA1_uc011lfe.1_Frame_Shift_Del_p.A106fs|EYA1_uc003xyv.2_Intron	p.A107fs	NM_172058	NP_742055	WXS	Illumina HiSeq	Unspecified	Q99502	EYA1_HUMAN	Epithelial(68;0.0837)|all cancers(69;0.247)		5	607_616	-	Breast(64;0.046)		107_110					A6NHQ0|G5E9R4|Q0P516|Q8WX80	Frame_Shift_Del	DEL	ENST00000340726.3	37	c.320_329delCTGCATATGG	CCDS34906.1																																																																																				0.462	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		11	114	NA	NA	NA	NA	NA	11	114	---	---	---	---
