#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ACTRT2	140625	broad.mit.edu	37	1	2939246	2939246	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:2939246G>T	ENST00000378404.2	+	1	1201	c.996G>T	c.(994-996)acG>acT	p.T332T		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	332						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		TCAAGATCACGGCTCCCCCCG	0.617																																							uc001ajz.2		NA																	0					0						c.(994-996)ACG>ACT		actin-related protein M2							61.0	69.0	66.0					1																	2939246		2203	4300	6503	SO:0001819	synonymous_variant	140625					cytoplasm|cytoskeleton		g.chr1:2939246G>T	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.996G>T	1.37:g.2939246G>T			Somatic					p.T332T	NM_080431	NP_536356	WXS	Illumina HiSeq	Unspecified	Q8TDY3	ACTT2_HUMAN		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)	1	1201	+	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	332					B1AN52|Q8NHS6|Q8TDG1	Silent	SNP	ENST00000378404.2	37	c.996G>T	CCDS45.1																																																																																				0.617	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431		63	96	1	0	1.08141e-31	0.048971	1.66632e-31	63	96				
TAS1R2	80834	broad.mit.edu	37	1	19181198	19181198	+	Missense_Mutation	SNP	G	G	A	rs370587266		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:19181198G>A	ENST00000375371.3	-	3	787	c.766C>T	c.(766-768)Cgc>Tgc	p.R256C	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	256					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GTCACCAGGCGCTGGCGCTCC	0.637																																							uc001bba.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(766-768)CGC>TGC		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)	G	CYS/ARG	0,4406		0,0,2203	62.0	55.0	57.0		766	2.7	0.3	1		57	1,8599	2.2+/-6.3	0,1,4299	no	missense	TAS1R2	NM_152232.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	256/840	19181198	1,13005	2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19181198G>A		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.766C>T	1.37:g.19181198G>A	ENSP00000364520:p.Arg256Cys		Somatic					p.R256C	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	3	767	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	256			Extracellular (Potential).		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.766C>T	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632664	0.29068	0.0	1.16E-4	ENSG00000179002	ENST00000375371	D	0.83075	-1.68	4.78	2.73	0.32206	Extracellular ligand-binding receptor (1);	0.181409	0.25436	N	0.030692	D	0.86698	0.5995	M	0.62723	1.935	0.09310	N	1	D	0.89917	1.0	D	0.69307	0.963	T	0.76222	-0.3038	10	0.87932	D	0	.	6.9459	0.24518	0.0:0.1595:0.4735:0.367	.	256	Q8TE23	TS1R2_HUMAN	C	256	ENSP00000364520:R256C	ENSP00000364520:R256C	R	-	1	0	TAS1R2	19053785	0.000000	0.05858	0.318000	0.25279	0.067000	0.16453	0.518000	0.22847	1.235000	0.43724	0.561000	0.74099	CGC		0.637	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			7	33	0	0	0	0.038147	0	7	33				
WNT4	54361	broad.mit.edu	37	1	22456296	22456296	+	Silent	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:22456296C>G	ENST00000290167.6	-	2	169	c.126G>C	c.(124-126)acG>acC	p.T42T	WNT4_ENST00000542383.1_5'UTR	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	42					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GTTTCTCGCACGTCTCCTCCT	0.622																																							uc001bfs.3		NA																	0				ovary(1)	1						c.(124-126)ACG>ACC		wingless-type MMTV integration site family,							177.0	171.0	173.0					1																	22456296		2203	4300	6503	SO:0001819	synonymous_variant	54361				adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity	g.chr1:22456296C>G	AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.126G>C	1.37:g.22456296C>G			Somatic				WNT4_uc010odt.1_5'UTR	p.T42T	NM_030761	NP_110388	WXS	Illumina HiSeq	Unspecified	P56705	WNT4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)	2	230	-		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	42					B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Silent	SNP	ENST00000290167.6	37	c.126G>C	CCDS223.1	.	.	.	.	.	.	.	.	.	.	C	8.390	0.839590	0.16891	.	.	ENSG00000162552	ENST00000415567	.	.	.	5.18	-8.18	0.01053	.	.	.	.	.	T	0.45013	0.1321	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51741	-0.8667	4	.	.	.	.	6.6663	0.23042	0.0826:0.1226:0.5267:0.268	.	.	.	.	L	17	.	.	V	-	1	0	WNT4	22328883	0.000000	0.05858	0.429000	0.26710	0.965000	0.64279	-2.417000	0.01034	-1.076000	0.03125	0.462000	0.41574	GTG		0.622	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008088.2			62	135	0	0	0	0.048971	0	62	135				
PITHD1	57095	broad.mit.edu	37	1	24112859	24112859	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:24112859C>T	ENST00000246151.4	+	5	591	c.480C>T	c.(478-480)ttC>ttT	p.F160F	PITHD1_ENST00000374524.1_Silent_p.F47F	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	160	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						CAAAAAACTTCGGAGCAGATA	0.388																																							uc001bhq.2		NA																	0					0						c.(478-480)TTC>TTT		chromosome 1 open reading frame 128							125.0	115.0	118.0					1																	24112859		2203	4300	6503	SO:0001819	synonymous_variant	57095							g.chr1:24112859C>T		CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.480C>T	1.37:g.24112859C>T			Somatic				C1orf128_uc010oeb.1_Silent_p.F67F	p.F160F	NM_020362	NP_065095	WXS	Illumina HiSeq	Unspecified	Q9GZP4	PITH1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.97e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)	5	610	+		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.0034)|all_lung(284;0.00519)|Breast(348;0.0222)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)	160			PITH.		B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Silent	SNP	ENST00000246151.4	37	c.480C>T	CCDS240.1																																																																																				0.388	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362		17	43	0	0	0	0.038395	0	17	43				
CSMD2	114784	broad.mit.edu	37	1	34002679	34002679	+	Silent	SNP	C	C	A	rs61801993	byFrequency	TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:34002679C>A	ENST00000373381.4	-	62	9998	c.9822G>T	c.(9820-9822)acG>acT	p.T3274T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGTCCGCACACGTGGTCAGGG	0.517																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(9388-9390)ACG>ACT		CUB and Sushi multiple domains 2		C		3,4403	6.2+/-15.9	0,3,2200	144.0	122.0	129.0		9390	0.4	0.1	1	dbSNP_129	129	16,8584	11.9+/-42.8	0,16,4284	no	coding-synonymous	CSMD2	NM_052896.3		0,19,6484	AA,AC,CC		0.186,0.0681,0.1461		3130/3488	34002679	19,12987	2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34002679C>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9822G>T	1.37:g.34002679C>A			Somatic				CSMD2_uc001bxm.1_Silent_p.T3274T	p.T3130T	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			61	9419	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	3130			Sushi 25.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37	c.9390G>T																																																																																					0.517	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		4	96	1	0	1.23904e-05	0.014758	1.37984e-05	4	96				
RAD54L	8438	broad.mit.edu	37	1	46726628	46726628	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:46726628G>C	ENST00000371975.4	+	7	1381	c.707G>C	c.(706-708)gGg>gCg	p.G236A	RAD54L_ENST00000442598.1_Missense_Mutation_p.G236A|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	236	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		TGGCTCGGAGGGAGGATCCAA	0.532								Direct reversal of damage;Homologous recombination																															uc009vye.2		NA																	0				ovary(2)|skin(1)	3						c.(706-708)GGG>GCG	Direct_reversal_of_damage|Homologous_recombination	RAD54-like protein							77.0	76.0	76.0					1																	46726628		2203	4300	6503	SO:0001583	missense	8438				meiosis	nucleus	ATP binding|DNA binding|helicase activity	g.chr1:46726628G>C	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.707G>C	1.37:g.46726628G>C	ENSP00000361043:p.Gly236Ala		Somatic				RAD54L_uc001cpl.2_Missense_Mutation_p.G236A|RAD54L_uc001cpm.1_Missense_Mutation_p.G56A	p.G236A	NM_001142548	NP_001136020	WXS	Illumina HiSeq	Unspecified	Q92698	RAD54_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)	8	821	+	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)	236			Helicase ATP-binding.		Q5TE31|Q6IUY3	Missense_Mutation	SNP	ENST00000371975.4	37	c.707G>C	CCDS532.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815189	0.70912	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.94497	-3.44;-3.44	5.5	5.5	0.81552	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.93207	0.7836	L	0.31157	0.91	0.80722	D	1	B;P	0.40638	0.091;0.725	B;P	0.47402	0.054;0.546	D	0.91698	0.5371	10	0.31617	T	0.26	-21.9137	19.7895	0.96452	0.0:0.0:1.0:0.0	.	56;236	G3V1N0;Q92698	.;RAD54_HUMAN	A	236;236;56	ENSP00000396113:G236A;ENSP00000361043:G236A	ENSP00000361043:G236A	G	+	2	0	RAD54L	46499215	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.654000	0.67974	2.763000	0.94921	0.561000	0.74099	GGG		0.532	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	NM_003579		13	30	0	0	0	0.09319	0	13	30				
DAB1	1600	broad.mit.edu	37	1	57480898	57480898	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:57480898G>T	ENST00000371231.1	-	13	1235	c.1201C>A	c.(1201-1203)Ccc>Acc	p.P401T	DAB1_ENST00000420954.2_Missense_Mutation_p.P366T|DAB1_ENST00000371234.4_Missense_Mutation_p.P368T|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Missense_Mutation_p.P282T|DAB1_ENST00000371236.2_Missense_Mutation_p.P368T|DAB1_ENST00000414851.2_Missense_Mutation_p.P350T			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	401					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GTTTGTGTGGGCATGAAGGCG	0.647																																							uc001cys.1		NA																	0				skin(2)|ovary(1)	3						c.(1102-1104)CCC>ACC		disabled homolog 1							84.0	73.0	77.0					1																	57480898		2203	4300	6503	SO:0001583	missense	1600				cell differentiation|nervous system development			g.chr1:57480898G>T	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1201C>A	1.37:g.57480898G>T	ENSP00000360275:p.Pro401Thr		Somatic				DAB1_uc001cyt.1_Missense_Mutation_p.P366T|DAB1_uc001cyq.1_Missense_Mutation_p.P366T|DAB1_uc001cyr.1_Missense_Mutation_p.P282T|DAB1_uc009vzw.1_Missense_Mutation_p.P350T|DAB1_uc009vzx.1_Missense_Mutation_p.P368T	p.P368T	NM_021080	NP_066566	WXS	Illumina HiSeq	Unspecified	O75553	DAB1_HUMAN			14	1776	-			401					A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37	c.1102C>A		.	.	.	.	.	.	.	.	.	.	G	19.96	3.923853	0.73213	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.61627	0.11;0.11;0.12;0.09;1.21;0.23	5.54	4.63	0.57726	.	0.047447	0.85682	D	0.000000	T	0.67534	0.2903	L	0.42245	1.32	0.80722	D	1	D;D;D;P;D	0.69078	0.997;0.997;0.997;0.733;0.997	D;D;D;B;D	0.66847	0.928;0.933;0.947;0.338;0.946	T	0.70766	-0.4783	10	0.66056	D	0.02	-30.4116	14.3922	0.66986	0.0705:0.0:0.9295:0.0	.	350;401;368;282;366	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	T	368;368;368;366;350;282;401	ENSP00000360280:P368T;ENSP00000360278:P368T;ENSP00000395296:P366T;ENSP00000387581:P350T;ENSP00000409328:P282T;ENSP00000360275:P401T	ENSP00000360275:P401T	P	-	1	0	DAB1	57253486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.130000	0.71663	1.572000	0.49736	0.650000	0.86243	CCC		0.647	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		39	83	1	0	1.03484e-13	0.080422	1.33439e-13	39	83				
UBE2U	148581	broad.mit.edu	37	1	64671320	64671320	+	Splice_Site	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:64671320A>G	ENST00000371076.3	+	2	310		c.e2-1			NM_152489.1	NP_689702.1	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)						protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			large_intestine(3)|lung(2)|skin(1)	6						TTTAACTTCAAGGGTATCACT	0.303																																							uc001dbn.1		NA																	0					0						c.e2-2		ubiquitin-conjugating enzyme E2U (putative)							89.0	92.0	91.0					1																	64671320		2203	4298	6501	SO:0001630	splice_region_variant	148581						ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr1:64671320A>G	BC029895	CCDS627.1	1p31.3	2008-02-05			ENSG00000177414	ENSG00000177414		"""Ubiquitin-conjugating enzymes E2"""	28559	protein-coding gene	gene with protein product						12477932	Standard	NM_152489		Approved	MGC35130	uc001dbn.1	Q5VVX9	OTTHUMG00000009023	ENST00000371076.3:c.67-1A>G	1.37:g.64671320A>G			Somatic					p.G23_splice	NM_152489	NP_689702	WXS	Illumina HiSeq	Unspecified	Q5VVX9	UBE2U_HUMAN			2	311	+								Q8N1D4	Splice_Site	SNP	ENST00000371076.3	37	c.67_splice	CCDS627.1	.	.	.	.	.	.	.	.	.	.	A	5.806	0.332955	0.11013	.	.	ENSG00000177414	ENST00000371077;ENST00000371076	.	.	.	5.35	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5936	0.28035	0.9038:0.0:0.0962:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE2U	64443908	0.998000	0.40836	0.830000	0.32933	0.033000	0.12548	4.972000	0.63756	0.892000	0.36259	0.477000	0.44152	.		0.303	UBE2U-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025005.1	NM_152489	Intron	24	44	0	0	0	0.076483	0	24	44				
NBPF20	100288142	broad.mit.edu	37	1	148344690	148344690	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:148344690C>G	ENST00000369202.1	-	3	425	c.228G>C	c.(226-228)caG>caC	p.Q76H	NBPF20_ENST00000414710.2_Missense_Mutation_p.Q76H			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	76						cytoplasm (GO:0005737)				breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						CCTCCTTGAACTGTCGCTCAT	0.532																																							uc001eqf.2		NA																	0					0						c.(226-228)CAG>CAC		hypothetical protein LOC55672							98.0	100.0	100.0					1																	148344690		1268	3030	4298	SO:0001583	missense	200030					cytoplasm		g.chr1:148344690C>G		CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.228G>C	1.37:g.148344690C>G	ENSP00000358203:p.Gln76His		Somatic				LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc009wkf.1_Intron|uc001erd.3_Missense_Mutation_p.Q76H|uc001erc.3_Intron|uc010paj.1_Intron|uc010pau.1_5'Flank|uc010pav.1_Missense_Mutation_p.Q76H|uc010paw.1_Intron	p.Q76H	NM_017940	NP_060410	WXS	Illumina HiSeq	Unspecified	Q86T75	NBPFB_HUMAN			2	263	-			76			Potential.			Missense_Mutation	SNP	ENST00000369202.1	37	c.228G>C		.	.	.	.	.	.	.	.	.	.	.	1.084	-0.666205	0.03428	.	.	ENSG00000203832	ENST00000369202;ENST00000369188;ENST00000414710	T;T;T	0.04758	3.92;4.0;3.56	0.521	0.521	0.17046	.	.	.	.	.	T	0.06690	0.0171	.	.	.	0.22401	N	0.99914	P;D	0.76494	0.872;0.999	B;D	0.72075	0.078;0.976	T	0.29336	-1.0015	6	0.31617	T	0.26	.	.	.	.	.	76;76	Q6P3W6;F5H1Q5	NBPFA_HUMAN;.	H	76	ENSP00000358203:Q76H;ENSP00000358189:Q76H;ENSP00000389520:Q76H	ENSP00000358189:Q76H	Q	-	3	2	NBPF20	146711314	0.000000	0.05858	0.155000	0.22561	0.041000	0.13682	-0.610000	0.05629	0.529000	0.28599	0.184000	0.17185	CAG		0.532	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000100689.2			20	534	0	0	0	0.059317	0	20	534				
FLG2	388698	broad.mit.edu	37	1	152329873	152329873	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:152329873C>T	ENST00000388718.5	-	3	461	c.389G>A	c.(388-390)aGa>aAa	p.R130K	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	130					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTTGAATGTCTGTAACCTGA	0.478																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(388-390)AGA>AAA		filaggrin family member 2							223.0	207.0	212.0					1																	152329873		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152329873C>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.389G>A	1.37:g.152329873C>T	ENSP00000373370:p.Arg130Lys		Somatic				uc001ezv.2_Intron	p.R130K	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	462	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		130					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.389G>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278833	0.40294	.	.	ENSG00000143520	ENST00000388718	T	0.00711	5.8	5.62	4.7	0.59300	.	.	.	.	.	T	0.00384	0.0012	L	0.43152	1.355	0.09310	N	1	P	0.37330	0.59	B	0.30251	0.113	T	0.49103	-0.8974	9	0.51188	T	0.08	-14.7802	10.8889	0.46984	0.0:0.9119:0.0:0.0881	.	130	Q5D862	FILA2_HUMAN	K	130	ENSP00000373370:R130K	ENSP00000373370:R130K	R	-	2	0	FLG2	150596497	0.011000	0.17503	0.299000	0.25016	0.925000	0.55904	0.305000	0.19254	1.357000	0.45904	0.557000	0.71058	AGA		0.478	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		85	180	0	0	0	0.048971	0	85	180				
LCE2A	353139	broad.mit.edu	37	1	152671522	152671522	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:152671522G>T	ENST00000368779.1	+	2	196	c.145G>T	c.(145-147)Ggg>Tgg	p.G49W		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	49	Cys-rich.				keratinization (GO:0031424)			p.C51_G64delCCGSSSGGCCSSGG(2)		breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCAGCTCTGGGGGCTGCTG	0.687																																							uc001faj.2		NA																	2	Deletion - In frame(2)		liver(2)		0						c.(145-147)GGG>TGG		late cornified envelope 2A							53.0	66.0	61.0					1																	152671522		2203	4300	6503	SO:0001583	missense	353139				keratinization			g.chr1:152671522G>T		CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.145G>T	1.37:g.152671522G>T	ENSP00000357768:p.Gly49Trp		Somatic					p.G49W	NM_178428	NP_848515	WXS	Illumina HiSeq	Unspecified	Q5TA79	LCE2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	196	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		49			Cys-rich.		A4QMZ9	Missense_Mutation	SNP	ENST00000368779.1	37	c.145G>T	CCDS1021.1	.	.	.	.	.	.	.	.	.	.	G	9.214	1.031599	0.19590	.	.	ENSG00000187173	ENST00000368779	T	0.05996	3.36	4.33	4.33	0.51752	.	.	.	.	.	T	0.16471	0.0396	M	0.83012	2.62	0.24338	N	0.994976	D	0.89917	1.0	D	0.97110	1.0	T	0.02498	-1.1150	9	0.87932	D	0	.	12.4942	0.55918	0.0:0.0:1.0:0.0	.	49	Q5TA79	LCE2A_HUMAN	W	49	ENSP00000357768:G49W	ENSP00000357768:G49W	G	+	1	0	LCE2A	150938146	0.988000	0.35896	0.895000	0.35142	0.600000	0.36913	0.639000	0.24690	1.987000	0.57996	0.540000	0.68198	GGG		0.687	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034512.1	NM_178428		60	156	1	0	1.80625e-27	0.048971	2.69837e-27	60	156				
SLC25A44	9673	broad.mit.edu	37	1	156169858	156169858	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:156169858T>C	ENST00000359511.4	+	2	392	c.220T>C	c.(220-222)Tac>Cac	p.Y74H	SLC25A44_ENST00000469537.1_3'UTR|SLC25A44_ENST00000423538.2_Missense_Mutation_p.Y74H	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	74					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					CACTGGCCTCTACCGAGGGTT	0.537																																							uc001fnp.2		NA																	0				ovary(1)	1						c.(220-222)TAC>CAC		solute carrier family 25, member 44							117.0	107.0	110.0					1																	156169858		2203	4300	6503	SO:0001583	missense	9673				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr1:156169858T>C	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.220T>C	1.37:g.156169858T>C	ENSP00000352497:p.Tyr74His		Somatic				SLC25A44_uc010phc.1_Intron|SLC25A44_uc009wrr.2_Missense_Mutation_p.Y74H|SLC25A44_uc010phd.1_Intron|SLC25A44_uc010phe.1_Intron	p.Y74H	NM_014655	NP_055470	WXS	Illumina HiSeq	Unspecified	Q96H78	S2544_HUMAN			2	542	+	Hepatocellular(266;0.158)		74			Solcar 1.|Helical; Name=2; (Potential).		O75034	Missense_Mutation	SNP	ENST00000359511.4	37	c.220T>C	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.509576	0.85282	.	.	ENSG00000160785	ENST00000359511;ENST00000423538;ENST00000412949	D;D	0.83992	-1.79;-1.79	5.9	5.9	0.94986	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94781	0.8315	H	0.99391	4.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96834	0.9613	10	0.87932	D	0	-16.184	14.2753	0.66175	0.0:0.0:0.0:1.0	.	74;74;74	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	H	74	ENSP00000352497:Y74H;ENSP00000407560:Y74H	ENSP00000352497:Y74H	Y	+	1	0	SLC25A44	154436482	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.825000	0.86693	2.254000	0.74563	0.482000	0.46254	TAC		0.537	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655		18	37	0	0	0	0.038395	0	18	37				
SMG5	23381	broad.mit.edu	37	1	156244463	156244463	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:156244463C>A	ENST00000361813.5	-	5	613	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L	SMG5_ENST00000368267.5_Missense_Mutation_p.V157L	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	157					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GAGGCAGACACTGGCTTCTTG	0.478																																							uc001foc.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(469-471)GTG>TTG		SMG5 homolog nonsense mediated mRNA decay							157.0	135.0	142.0					1																	156244463		2203	4300	6503	SO:0001583	missense	23381				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding	g.chr1:156244463C>A	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.469G>T	1.37:g.156244463C>A	ENSP00000355261:p.Val157Leu		Somatic					p.V157L	NM_015327	NP_056142	WXS	Illumina HiSeq	Unspecified	Q9UPR3	SMG5_HUMAN			5	618	-	Hepatocellular(266;0.158)		157					D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	c.469G>T	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562804	0.45694	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.16897	2.31;2.31	5.6	3.75	0.43078	Telomerase activating protein Est1 (1);	0.062950	0.64402	D	0.000005	T	0.08714	0.0216	L	0.38175	1.15	0.49483	D	0.99979	P	0.38551	0.636	B	0.44044	0.439	T	0.12041	-1.0563	10	0.33940	T	0.23	-14.0056	11.6912	0.51516	0.0:0.879:0.0:0.121	.	157	Q9UPR3	SMG5_HUMAN	L	157	ENSP00000355261:V157L;ENSP00000357250:V157L	ENSP00000355261:V157L	V	-	1	0	SMG5	154511087	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	4.924000	0.63418	0.734000	0.32515	0.591000	0.81541	GTG		0.478	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		38	75	1	0	3.78316e-11	0.086207	4.58848e-11	38	75				
OR6N2	81442	broad.mit.edu	37	1	158747268	158747268	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:158747268G>A	ENST00000339258.1	-	1	157	c.158C>T	c.(157-159)gCa>gTa	p.A53V		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					GTGCAGAGCTGCATCCAGTCG	0.468																																							uc010pir.1		NA																	0					0						c.(157-159)GCA>GTA		olfactory receptor, family 6, subfamily N,							161.0	151.0	154.0					1																	158747268		2203	4300	6503	SO:0001583	missense	81442				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158747268G>A	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.158C>T	1.37:g.158747268G>A	ENSP00000344101:p.Ala53Val		Somatic					p.A53V	NM_001005278	NP_001005278	WXS	Illumina HiSeq	Unspecified	Q8NGY6	OR6N2_HUMAN			1	158	-	all_hematologic(112;0.0378)		53			Cytoplasmic (Potential).		Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	c.158C>T	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	G	2.987	-0.209102	0.06140	.	.	ENSG00000188340	ENST00000339258	T	0.00428	7.44	5.17	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	1.649030	0.03944	N	0.287404	T	0.00073	0.0002	N	0.17922	0.545	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.31833	-0.9929	10	0.48119	T	0.1	1.8584	5.6613	0.17670	0.2317:0.2656:0.5026:0.0	.	53	Q8NGY6	OR6N2_HUMAN	V	53	ENSP00000344101:A53V	ENSP00000344101:A53V	A	-	2	0	OR6N2	157013892	0.000000	0.05858	0.000000	0.03702	0.493000	0.33554	-1.472000	0.02341	0.071000	0.16664	0.650000	0.86243	GCA		0.468	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			65	118	0	0	0	0.048971	0	65	118				
ATP1A4	480	broad.mit.edu	37	1	160141399	160141399	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:160141399G>T	ENST00000368081.4	+	12	2177	c.1706G>T	c.(1705-1707)aGc>aTc	p.S569I	ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	569					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AATCTGCCTAGCAGCTTCTCC	0.473																																							uc001fve.3		NA																	0				ovary(2)|skin(2)	4						c.(1705-1707)AGC>ATC		Na+/K+ -ATPase alpha 4 subunit isoform 1							142.0	157.0	152.0					1																	160141399		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160141399G>T	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1706G>T	1.37:g.160141399G>T	ENSP00000357060:p.Ser569Ile		Somatic				ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.S72I	p.S569I	NM_144699	NP_653300	WXS	Illumina HiSeq	Unspecified	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		12	2185	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		569			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.1706G>T	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422229	0.25639	.	.	ENSG00000132681	ENST00000368081	T	0.76578	-1.03	4.19	-0.767	0.11016	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.958426	0.08779	N	0.894955	T	0.50497	0.1619	L	0.35414	1.06	0.22305	N	0.99922	B	0.28055	0.199	B	0.36335	0.222	T	0.55321	-0.8159	10	0.87932	D	0	.	5.4119	0.16352	0.2141:0.1871:0.5989:0.0	.	569	Q13733	AT1A4_HUMAN	I	569	ENSP00000357060:S569I	ENSP00000357060:S569I	S	+	2	0	ATP1A4	158408023	0.779000	0.28652	0.058000	0.19502	0.789000	0.44602	1.792000	0.38754	-0.104000	0.12154	0.655000	0.94253	AGC		0.473	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		96	182	1	0	8.2166e-39	0.048971	1.28221e-38	96	182				
FCGR3A	2214	broad.mit.edu	37	1	161595976	161595976	+	Intron	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:161595976T>G	ENST00000540048.1	-	2	94				FCGR3B_ENST00000367964.2_Missense_Mutation_p.K179T|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.K179T|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000531221.1_Missense_Mutation_p.K215T			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGACACATTTTTACTCCCAAC	0.483																																							uc009wul.2		NA																	0					0						c.(535-537)AAA>ACA		low affinity immunoglobulin gamma Fc region	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						101.0	108.0	106.0					1																	161595976		2200	4300	6500	SO:0001627	intron_variant	2215				immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity	g.chr1:161595976T>G	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+4181A>C	1.37:g.161595976T>G			Somatic					p.K179T	NM_000570	NP_000561	WXS	Illumina HiSeq	Unspecified	O75015	FCG3B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		4	810	-	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		179			Ig-like C2-type 2.		A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37	c.536A>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	1.253|1.253	-0.618121|-0.618121	0.03663|0.03663	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221|ENST00000421702	T;T;T|.	0.11063|.	2.81;2.81;2.81|.	2.47|2.47	-1.03|-1.03	0.10102|0.10102	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	1.852830|.	0.02724|.	N|.	0.114292|.	T|.	0.13628|.	0.0330|.	L|L	0.37630|0.37630	1.12|1.12	0.09310|0.09310	N|N	1|1	P|.	0.39940|.	0.696|.	B|.	0.43251|.	0.413|.	T|.	0.32134|.	-0.9918|.	10|.	0.15499|.	T|.	0.54|.	.|.	5.3182|5.3182	0.15866|0.15866	0.0:0.4884:0.0:0.5116|0.0:0.4884:0.0:0.5116	.|.	179|.	O75015|.	FCG3B_HUMAN|.	T|Y	179;179;215|199	ENSP00000356941:K179T;ENSP00000294800:K179T;ENSP00000433642:K215T|.	ENSP00000294800:K179T|.	K|X	-|-	2|3	0|2	FCGR3B|FCGR3B	159862600|159862600	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.027000|0.027000	0.11550|0.11550	-2.198000|-2.198000	0.01239|0.01239	-0.159000|-0.159000	0.11021|0.11021	0.324000|0.324000	0.21423|0.21423	AAA|TAA		0.483	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569		8	118	0	0	0	0.058154	0	8	118				
NUF2	83540	broad.mit.edu	37	1	163315595	163315595	+	Missense_Mutation	SNP	G	G	T	rs375668189		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:163315595G>T	ENST00000271452.3	+	11	1214	c.935G>T	c.(934-936)aGt>aTt	p.S312I	NUF2_ENST00000367900.3_Missense_Mutation_p.S312I|NUF2_ENST00000524800.1_Intron	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	312	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AAATTAGCCAGTATCTTAAAG	0.328																																							uc001gcq.1		NA																	0				ovary(3)|skin(1)	4						c.(934-936)AGT>ATT		NUF2, NDC80 kinetochore complex component							67.0	69.0	68.0					1																	163315595		2203	4300	6503	SO:0001583	missense	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163315595G>T	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.935G>T	1.37:g.163315595G>T	ENSP00000271452:p.Ser312Ile		Somatic				NUF2_uc001gcp.2_Missense_Mutation_p.S312I|NUF2_uc001gcr.1_Missense_Mutation_p.S312I|NUF2_uc009wvc.1_Intron	p.S312I	NM_145697	NP_663735	WXS	Illumina HiSeq	Unspecified	Q9BZD4	NUF2_HUMAN			11	1235	+	all_hematologic(923;0.101)		312			Interaction with the N-terminus of NDC80.|Potential.		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	c.935G>T	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	G	9.139	1.013374	0.19277	.	.	ENSG00000143228	ENST00000367900;ENST00000271452	T;T	0.32272	1.46;1.46	4.88	-1.62	0.08372	.	0.750508	0.14290	N	0.328967	T	0.07863	0.0197	L	0.44542	1.39	0.28218	N	0.926641	B	0.20671	0.047	B	0.16289	0.015	T	0.21075	-1.0256	9	0.41790	T	0.15	-1.1763	4.7967	0.13276	0.3389:0.3012:0.36:0.0	.	312	Q9BZD4	NUF2_HUMAN	I	312	ENSP00000356875:S312I;ENSP00000271452:S312I	ENSP00000271452:S312I	S	+	2	0	NUF2	161582219	0.000000	0.05858	0.001000	0.08648	0.864000	0.49448	-0.688000	0.05150	-0.524000	0.06400	0.591000	0.81541	AGT		0.328	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		22	83	1	0	1.64113e-05	0.055883	1.81936e-05	22	83				
ILDR2	387597	broad.mit.edu	37	1	166890569	166890569	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:166890569G>T	ENST00000271417.3	-	9	1314	c.1259C>A	c.(1258-1260)aCg>aAg	p.T420K	ILDR2_ENST00000528703.1_Missense_Mutation_p.T361K|ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000525740.1_Missense_Mutation_p.T293K|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000526687.1_Missense_Mutation_p.T312K|ILDR2_ENST00000529071.1_Missense_Mutation_p.T401K	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	420					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						CGGCACCCCCGTGGCGAAGTT	0.716																																							uc001gdx.1		NA																	0				ovary(1)	1						c.(1258-1260)ACG>AAG		immunoglobulin-like domain containing receptor							16.0	19.0	18.0					1																	166890569		2173	4246	6419	SO:0001583	missense	387597					integral to membrane		g.chr1:166890569G>T	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1259C>A	1.37:g.166890569G>T	ENSP00000271417:p.Thr420Lys		Somatic					p.T420K	NM_199351	NP_955383	WXS	Illumina HiSeq	Unspecified	Q71H61	ILDR2_HUMAN			9	1315	-			420			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000271417.3	37	c.1259C>A	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	4.003	-0.002081	0.07819	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.77098	0.56;-1.07;0.56;-1.05;-0.05	4.52	2.24	0.28232	.	1.472120	0.04149	N	0.321032	T	0.45316	0.1336	L	0.36672	1.1	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.20174	-1.0283	10	0.30078	T	0.28	.	2.1606	0.03824	0.3457:0.329:0.3253:0.0	.	420	Q71H61	ILDR2_HUMAN	K	420;293;401;312;361	ENSP00000271417:T420K;ENSP00000436120:T293K;ENSP00000436882:T401K;ENSP00000434273:T312K;ENSP00000432750:T361K	ENSP00000271417:T420K	T	-	2	0	ILDR2	165157193	0.016000	0.18221	0.379000	0.26080	0.021000	0.10359	1.976000	0.40579	0.851000	0.35264	0.558000	0.71614	ACG		0.716	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351		13	18	1	0	4.93089e-13	0.020292	6.32496e-13	13	18				
DUSP27	92235	broad.mit.edu	37	1	167097764	167097764	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:167097764G>T	ENST00000361200.2	+	6	3562	c.3396G>T	c.(3394-3396)atG>atT	p.M1132I	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.M1132I|DUSP27_ENST00000443333.1_Missense_Mutation_p.M1132I			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1132					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGGAAGAAATGGACGATGAAG	0.522																																							uc001geb.1		NA																	0				ovary(3)	3						c.(3394-3396)ATG>ATT		dual specificity phosphatase 27							47.0	43.0	44.0					1																	167097764		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097764G>T	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3396G>T	1.37:g.167097764G>T	ENSP00000354483:p.Met1132Ile		Somatic					p.M1132I	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	3396	+			1132					A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.3396G>T	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944367	0.34283	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03272	3.99;3.99;3.99	5.4	4.49	0.54785	.	0.108238	0.42821	D	0.000659	T	0.02610	0.0079	M	0.63428	1.95	0.43527	D	0.995802	B	0.26318	0.146	B	0.22152	0.038	T	0.21861	-1.0233	10	0.72032	D	0.01	-20.0436	13.7559	0.62937	0.0736:0.0:0.9264:0.0	.	1132	Q5VZP5	DUS27_HUMAN	I	1132	ENSP00000354483:M1132I;ENSP00000271385:M1132I;ENSP00000404874:M1132I	ENSP00000271385:M1132I	M	+	3	0	DUSP27	165364388	1.000000	0.71417	0.892000	0.35008	0.681000	0.39784	4.028000	0.57246	1.281000	0.44480	0.549000	0.68633	ATG		0.522	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		18	32	1	0	3.99206e-14	0.043863	5.17489e-14	18	32				
TNR	7143	broad.mit.edu	37	1	175355377	175355377	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:175355377T>A	ENST00000367674.2	-	8	2276	c.1568A>T	c.(1567-1569)gAg>gTg	p.E523V	TNR_ENST00000263525.2_Missense_Mutation_p.E523V			Q92752	TENR_HUMAN	tenascin R	523	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGGAATCCACTCCACAAAAGC	0.537																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1567-1569)GAG>GTG		tenascin R precursor							34.0	37.0	36.0					1																	175355377		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175355377T>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1568A>T	1.37:g.175355377T>A	ENSP00000356646:p.Glu523Val		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.E523V	p.E523V	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			6	1649	-	Renal(580;0.146)		523			Fibronectin type-III 3.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.1568A>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.907721	0.92107	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.58797	0.31;0.31	5.68	5.68	0.88126	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68016	0.2955	L	0.41236	1.265	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65809	-0.6078	10	0.33940	T	0.23	.	15.5934	0.76558	0.0:0.0:0.0:1.0	.	523	Q92752	TENR_HUMAN	V	523	ENSP00000356646:E523V;ENSP00000263525:E523V	ENSP00000263525:E523V	E	-	2	0	TNR	173622000	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.346000	0.79347	2.149000	0.67028	0.528000	0.53228	GAG		0.537	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		15	30	0	0	0	0.020292	0	15	30				
TNR	7143	broad.mit.edu	37	1	175375666	175375666	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:175375666G>A	ENST00000367674.2	-	3	893	c.185C>T	c.(184-186)cCt>cTt	p.P62L	TNR_ENST00000263525.2_Missense_Mutation_p.P62L			Q92752	TENR_HUMAN	tenascin R	62					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GAAGACCACAGGCTGCTCTTT	0.552																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(184-186)CCT>CTT		tenascin R precursor							271.0	228.0	242.0					1																	175375666		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175375666G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.185C>T	1.37:g.175375666G>A	ENSP00000356646:p.Pro62Leu		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.P62L|TNR_uc010pmz.1_Missense_Mutation_p.P62L	p.P62L	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			1	266	-	Renal(580;0.146)		62					C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.185C>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108509	0.77096	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.32272	1.46;1.46	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.57330	0.2046	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.60611	-0.7229	10	0.72032	D	0.01	.	18.5367	0.91013	0.0:0.0:1.0:0.0	.	62;62	B4DIX8;Q92752	.;TENR_HUMAN	L	62	ENSP00000356646:P62L;ENSP00000263525:P62L	ENSP00000263525:P62L	P	-	2	0	TNR	173642289	1.000000	0.71417	0.812000	0.32479	0.431000	0.31685	9.731000	0.98807	2.468000	0.83385	0.561000	0.74099	CCT		0.552	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		67	133	0	0	0	0.048971	0	67	133				
PAPPA2	60676	broad.mit.edu	37	1	176709187	176709187	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:176709187C>T	ENST00000367662.3	+	14	5170	c.4006C>T	c.(4006-4008)Cac>Tac	p.H1336Y		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1336					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGTCCTTTTCCACCATACCAC	0.488																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(4006-4008)CAC>TAC		pappalysin 2 isoform 1							219.0	211.0	214.0					1																	176709187		2031	4187	6218	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176709187C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4006C>T	1.37:g.176709187C>T	ENSP00000356634:p.His1336Tyr		Somatic				PAPPA2_uc009www.2_RNA	p.H1336Y	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			14	5170	+			1336					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.4006C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.765521	0.00651	.	.	ENSG00000116183	ENST00000367662	T	0.01414	4.92	5.77	1.79	0.24919	.	0.449080	0.28436	N	0.015349	T	0.00815	0.0027	N	0.16743	0.435	0.26931	N	0.966471	B	0.02656	0.0	B	0.01281	0.0	T	0.49224	-0.8962	10	0.02654	T	1	-7.0548	5.6251	0.17478	0.1374:0.6457:0.0:0.217	.	1336	Q9BXP8	PAPP2_HUMAN	Y	1336	ENSP00000356634:H1336Y	ENSP00000356634:H1336Y	H	+	1	0	PAPPA2	174975810	0.655000	0.27376	0.001000	0.08648	0.105000	0.19272	1.400000	0.34577	0.078000	0.16900	0.561000	0.74099	CAC		0.488	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			65	87	0	0	0	0.048971	0	65	87				
ASTN1	460	broad.mit.edu	37	1	176863906	176863906	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:176863906G>A	ENST00000367654.3	-	17	2967	c.2756C>T	c.(2755-2757)cCa>cTa	p.P919L	ASTN1_ENST00000361833.2_Missense_Mutation_p.P911L|ASTN1_ENST00000367657.3_Missense_Mutation_p.P911L|ASTN1_ENST00000424564.2_Missense_Mutation_p.P911L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	919					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GATGTATTCTGGGAATGTCAG	0.562																																							uc001glc.2		NA																	0				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2731-2733)CCA>CTA		astrotactin isoform 1							128.0	124.0	126.0					1																	176863906		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176863906G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2756C>T	1.37:g.176863906G>A	ENSP00000356626:p.Pro919Leu		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.P911L|ASTN1_uc001gld.1_Missense_Mutation_p.P911L	p.P911L	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			17	2944	-			919					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.2732C>T		.	.	.	.	.	.	.	.	.	.	G	18.72	3.684498	0.68157	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.13778	2.56;2.97;2.97;2.56	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.40543	1.245	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.01512	-1.1336	10	0.72032	D	0.01	-11.4948	18.8334	0.92150	0.0:0.0:1.0:0.0	.	911;911	O14525-2;B1AJS1	.;.	L	911;911;919;911;911	ENSP00000356629:P911L;ENSP00000354536:P911L;ENSP00000356626:P919L;ENSP00000395041:P911L	ENSP00000354536:P911L	P	-	2	0	ASTN1	175130529	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	8.924000	0.92827	2.640000	0.89533	0.655000	0.94253	CCA		0.562	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		47	88	0	0	0	0.048971	0	47	88				
BRINP2	57795	broad.mit.edu	37	1	177226442	177226443	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:177226442_177226443GG>CT	ENST00000361539.4	+	4	903_904	c.591_592GG>CT	c.(589-594)ctGGcc>ctCTcc	p.A198S	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	198	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TGCACCAGCTGGCCGCCTCCTA	0.579																																							uc001glf.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(589-594)CTGGCC>CTCTCC		family with sequence similarity 5, member B																																				SO:0001583	missense	57795					extracellular region		g.chr1:177226442_177226443GG>CT		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	Exception_encountered	1.37:g.177226442_177226443delinsCT	ENSP00000354481:p.Ala198Ser		Somatic				FAM5B_uc010pna.1_5'UTR|FAM5B_uc001glg.2_Missense_Mutation_p.A93S	p.A198S	NM_021165	NP_066988	WXS	Illumina HiSeq	Unspecified	Q9C0B6	FAM5B_HUMAN			4	903_904	+			198					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	DNP	ENST00000361539.4	37	c.591_592GG>CT	CCDS1320.1																																																																																				0.579	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		10	33	0	0	0	0.004672	0	10	33				
ZBTB41	360023	broad.mit.edu	37	1	197141290	197141290	+	Splice_Site	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:197141290C>G	ENST00000367405.4	-	9	2142	c.2074G>C	c.(2074-2076)Ggt>Cgt	p.G692R	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	692					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TAAATTTTACCTGAATGCGTT	0.264																																							uc001gtx.1		NA																	0				ovary(1)|skin(1)	2						c.(2074-2076)GGT>CGT		zinc finger and BTB domain containing 41							17.0	17.0	17.0					1																	197141290		2181	4249	6430	SO:0001630	splice_region_variant	360023				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:197141290C>G		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.2074+1G>C	1.37:g.197141290C>G			Somatic				ZBTB41_uc009wyz.1_RNA	p.G692R	NM_194314	NP_919290	WXS	Illumina HiSeq	Unspecified	Q5SVQ8	ZBT41_HUMAN			9	2143	-			692					A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	c.2074G>C	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819401	0.90873	.	.	ENSG00000177888	ENST00000367405	T	0.26223	1.75	5.6	5.6	0.85130	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	U	0.000690	T	0.48804	0.1520	L	0.55017	1.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25047	-1.0143	9	.	.	.	.	19.6097	0.95600	0.0:1.0:0.0:0.0	.	692	Q5SVQ8	ZBT41_HUMAN	R	692	ENSP00000356375:G692R	.	G	-	1	0	ZBTB41	195407913	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.383000	0.79741	2.629000	0.89072	0.650000	0.86243	GGT		0.264	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	Missense_Mutation	5	4	0	0	0	0.047766	0	5	4				
CAMK1G	57172	broad.mit.edu	37	1	209782371	209782371	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:209782371T>C	ENST00000009105.1	+	8	927	c.682T>C	c.(682-684)Ttc>Ctc	p.F228L	CAMK1G_ENST00000494990.1_3'UTR|CAMK1G_ENST00000361322.2_Missense_Mutation_p.F228L			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		GTCTAAGCTTTTCGAGAAGAT	0.493																																					Ovarian(163;530 1939 9680 28669 48710)	Ovarian(163;530 1939 9680 28669 48710)	uc001hhd.2		NA																	0				breast(1)	1						c.(682-684)TTC>CTC		calcium/calmodulin-dependent protein kinase IG							164.0	150.0	155.0					1																	209782371		2203	4300	6503	SO:0001583	missense	57172					Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr1:209782371T>C		CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.682T>C	1.37:g.209782371T>C	ENSP00000009105:p.Phe228Leu		Somatic				CAMK1G_uc001hhf.3_Missense_Mutation_p.F228L|CAMK1G_uc001hhe.2_Missense_Mutation_p.F228L	p.F228L	NM_020439	NP_065172	WXS	Illumina HiSeq	Unspecified	Q96NX5	KCC1G_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0475)	8	784	+			228			Protein kinase.		Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	37	c.682T>C	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	T	35	5.415556	0.96092	.	.	ENSG00000008118	ENST00000009105;ENST00000361322	T;T	0.64085	-0.08;-0.08	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000035	T	0.57489	0.2057	N	0.10707	0.03	0.80722	D	1	P;D	0.60160	0.803;0.987	B;P	0.56563	0.411;0.801	T	0.66858	-0.5817	10	0.62326	D	0.03	.	15.5714	0.76341	0.0:0.0:0.0:1.0	.	228;228	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	L	228	ENSP00000009105:F228L;ENSP00000354861:F228L	ENSP00000009105:F228L	F	+	1	0	CAMK1G	207848994	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.751000	0.85126	2.096000	0.63516	0.459000	0.35465	TTC		0.493	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439		71	112	0	0	0	0.048971	0	71	112				
PGBD5	79605	broad.mit.edu	37	1	230472975	230472975	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:230472975C>A	ENST00000525115.1	-	4	770	c.747G>T	c.(745-747)aaG>aaT	p.K249N	PGBD5_ENST00000391860.1_Missense_Mutation_p.K203N|PGBD5_ENST00000321327.2_Missense_Mutation_p.K348N|PGBD5_ENST00000530424.1_5'Flank			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	249						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGAGCTGGGGCTTATTCTTCA	0.567																																							uc010pwb.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(745-747)AAG>AAT		piggyBac transposable element derived 5							64.0	56.0	59.0					1																	230472975		2203	4300	6503	SO:0001583	missense	79605					integral to membrane		g.chr1:230472975C>A	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.747G>T	1.37:g.230472975C>A	ENSP00000431404:p.Lys249Asn		Somatic				PGBD5_uc001htv.2_Missense_Mutation_p.K348N	p.K249N	NM_024554	NP_078830	WXS	Illumina HiSeq	Unspecified	Q8N414	PGBD5_HUMAN		GBM - Glioblastoma multiforme(131;0.201)	4	747	-	Breast(184;0.0397)	Prostate(94;0.167)	249					A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37	c.747G>T		.	.	.	.	.	.	.	.	.	.	c	15.47	2.844326	0.51164	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17691	2.26;2.26;2.26	5.21	3.33	0.38152	.	0.000000	0.85682	D	0.000000	T	0.22551	0.0544	N	0.24115	0.695	0.52099	D	0.999946	D	0.89917	1.0	D	0.87578	0.998	T	0.02860	-1.1101	10	0.25751	T	0.34	-34.1128	8.2655	0.31810	0.0:0.6227:0.0:0.3773	.	249	Q8N414	PGBD5_HUMAN	N	203;348;249	ENSP00000375733:K203N;ENSP00000322530:K348N;ENSP00000431404:K249N	ENSP00000322530:K348N	K	-	3	2	PGBD5	228539598	0.971000	0.33674	1.000000	0.80357	0.564000	0.35744	0.192000	0.17096	0.570000	0.29347	0.585000	0.79938	AAG		0.567	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554		21	35	1	0	2.39187e-15	0.049695	3.18483e-15	21	35				
HEATR1	55127	broad.mit.edu	37	1	236719125	236719125	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:236719125A>C	ENST00000366582.3	-	39	5743	c.5629T>G	c.(5629-5631)Ttc>Gtc	p.F1877V	HEATR1_ENST00000366581.2_Missense_Mutation_p.F1796V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1877					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGGGCTCGGAAGTCCAGGGCT	0.493																																							uc001hyd.1		NA																	0				ovary(2)|skin(1)	3						c.(5629-5631)TTC>GTC		protein BAP28							121.0	114.0	117.0					1																	236719125		2203	4300	6503	SO:0001583	missense	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236719125A>C	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.5629T>G	1.37:g.236719125A>C	ENSP00000355541:p.Phe1877Val		Somatic				HEATR1_uc009xgh.1_Missense_Mutation_p.F1039V	p.F1877V	NM_018072	NP_060542	WXS	Illumina HiSeq	Unspecified	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		39	5754	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	1877					Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	c.5629T>G	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554242	0.86231	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.44482	0.92;0.92	4.93	4.93	0.64822	BP28, C-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.051625	0.85682	D	0.000000	T	0.58878	0.2153	M	0.62088	1.915	0.80722	D	1	D;D	0.65815	0.987;0.995	P;P	0.62298	0.9;0.812	T	0.63216	-0.6687	10	0.72032	D	0.01	.	14.7392	0.69440	1.0:0.0:0.0:0.0	.	1796;1877	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	V	1877;1796	ENSP00000355541:F1877V;ENSP00000355540:F1796V	ENSP00000355540:F1796V	F	-	1	0	HEATR1	234785748	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	9.077000	0.94016	2.074000	0.62210	0.374000	0.22700	TTC		0.493	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		13	137	0	0	0	0.105934	0	13	137				
OR2M2	391194	broad.mit.edu	37	1	248343812	248343812	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:248343812C>A	ENST00000359682.2	+	1	525	c.525C>A	c.(523-525)gcC>gcA	p.A175A		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGGAAATAGCCCACTTCTTCT	0.423																																							uc010pzf.1		NA																	0				ovary(3)|skin(1)	4						c.(523-525)GCC>GCA		olfactory receptor, family 2, subfamily M,							234.0	229.0	231.0					1																	248343812		2203	4300	6503	SO:0001819	synonymous_variant	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248343812C>A	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.525C>A	1.37:g.248343812C>A			Somatic					p.A175A	NM_001004688	NP_001004688	WXS	Illumina HiSeq	Unspecified	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	525	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		175			Extracellular (Potential).		A3KFT4	Silent	SNP	ENST00000359682.2	37	c.525C>A	CCDS31106.1																																																																																				0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		199	321	1	0	9.29173e-92	0.048971	1.48789e-91	199	321				
OR2M7	391196	broad.mit.edu	37	1	248487522	248487523	+	Missense_Mutation	DNP	CA	CA	AG	rs140426612		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:248487522_248487523CA>AG	ENST00000317965.2	-	1	376_377	c.348_349TG>CT	c.(346-351)gcTGtt>gcCTtt	p.V117F		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAAGACATAACAGCCAACAGAA	0.441																																							uc010pzk.1		NA																	0				skin(2)	2						c.(346-351)GCTGTT>GCCTTT		olfactory receptor, family 2, subfamily M,																																				SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487522_248487523CA>AG	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.348_349delinsAG	1.37:g.248487522_248487523delinsAG	ENSP00000324557:p.Val117Phe		Somatic					p.V117F	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	348_349	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		117			Helical; Name=3; (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	DNP	ENST00000317965.2	37	c.348_349TG>CT	CCDS31111.1																																																																																				0.441	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		158	254	0	0	0	0.004672	0	158	254				
SFMBT2	57713	broad.mit.edu	37	10	7325988	7325988	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:7325988C>T	ENST00000361972.4	-	6	740	c.650G>A	c.(649-651)cGc>cAc	p.R217H	SFMBT2_ENST00000397167.1_Missense_Mutation_p.R217H	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	217					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						ATAGCGAAGGCGTAATCTTCC	0.418																																							uc009xio.1		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						c.(649-651)CGC>CAC		Scm-like with four mbt domains 2							146.0	126.0	133.0					10																	7325988		2203	4300	6503	SO:0001583	missense	57713				regulation of transcription, DNA-dependent	nucleus		g.chr10:7325988C>T	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.650G>A	10.37:g.7325988C>T	ENSP00000355109:p.Arg217His		Somatic				SFMBT2_uc001ijn.1_Missense_Mutation_p.R217H|SFMBT2_uc010qay.1_Missense_Mutation_p.R217H	p.R217H	NM_001029880	NP_001025051	WXS	Illumina HiSeq	Unspecified	Q5VUG0	SMBT2_HUMAN			6	741	-			217			MBT 2.		A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	c.650G>A	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	c	26.8	4.769503	0.90020	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.47177	0.85;0.85	4.7	4.7	0.59300	.	0.096815	0.64402	D	0.000001	T	0.64594	0.2612	M	0.75884	2.315	0.80722	D	1	D	0.57571	0.98	P	0.58331	0.837	T	0.64245	-0.6453	10	0.31617	T	0.26	.	17.9978	0.89189	0.0:1.0:0.0:0.0	.	217	Q5VUG0	SMBT2_HUMAN	H	217	ENSP00000355109:R217H;ENSP00000380353:R217H	ENSP00000355109:R217H	R	-	2	0	SFMBT2	7365994	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.780000	0.55386	2.318000	0.78349	0.431000	0.28591	CGC		0.418	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		51	65	0	0	0	0.048971	0	51	65				
ITIH5	80760	broad.mit.edu	37	10	7608297	7608297	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:7608297C>T	ENST00000256861.6	-	13	2301	c.2223G>A	c.(2221-2223)ttG>ttA	p.L741L	ITIH5_ENST00000298441.6_Silent_p.L527L|ITIH5_ENST00000446830.2_Silent_p.L523L|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	741					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGATAGTGCGCAAGTAAGTGC	0.527																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(2221-2223)TTG>TTA		inter-alpha trypsin inhibitor heavy chain							110.0	95.0	101.0					10																	7608297		2203	4300	6503	SO:0001819	synonymous_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7608297C>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2223G>A	10.37:g.7608297C>T			Somatic				ITIH5_uc001ijp.2_Silent_p.L527L	p.L741L	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			13	2302	-			741					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37	c.2223G>A																																																																																					0.527	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		15	13	0	0	0	0.0333	0	15	13				
ITIH5	80760	broad.mit.edu	37	10	7611748	7611748	+	Splice_Site	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:7611748C>T	ENST00000256861.6	-	12	2111		c.e12-1		ITIH5_ENST00000298441.6_Splice_Site|ITIH5_ENST00000434980.1_5'Flank|ITIH5_ENST00000446830.2_Splice_Site|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5						hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TCACCATCCACTGCCAGAGCA	0.468																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.e12-1		inter-alpha trypsin inhibitor heavy chain							42.0	37.0	38.0					10																	7611748		2203	4300	6503	SO:0001630	splice_region_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7611748C>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2033-1G>A	10.37:g.7611748C>T			Somatic				ITIH5_uc001ijp.2_Splice_Site_p.V464_splice	p.V678_splice	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			12	2112	-								Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Splice_Site	SNP	ENST00000256861.6	37	c.2033_splice		.	.	.	.	.	.	.	.	.	.	C	11.73	1.724548	0.30593	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4186	0.94712	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITIH5	7651754	1.000000	0.71417	0.999000	0.59377	0.039000	0.13416	7.356000	0.79445	2.586000	0.87340	0.557000	0.71058	.		0.468	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	Intron	5	21	0	0	0	0.014758	0	5	21				
OPTN	10133	broad.mit.edu	37	10	13154608	13154608	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:13154608A>G	ENST00000378748.3	+	6	887	c.525A>G	c.(523-525)gaA>gaG	p.E175E	OPTN_ENST00000378757.2_Silent_p.E175E|OPTN_ENST00000378747.3_Silent_p.E175E|OPTN_ENST00000482140.1_3'UTR|OPTN_ENST00000378752.3_Silent_p.E175E|OPTN_ENST00000378764.2_Silent_p.E175E|OPTN_ENST00000263036.5_Silent_p.E175E	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	175	Interaction with Rab8.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GCTCCTCAGAAGATTCCTTTG	0.463																																							uc001ilu.1		NA																	0				ovary(2)	2						c.(523-525)GAA>GAG		optineurin							114.0	119.0	117.0					10																	13154608		2203	4300	6503	SO:0001819	synonymous_variant	10133				cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding	g.chr10:13154608A>G	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.525A>G	10.37:g.13154608A>G			Somatic				OPTN_uc001ilv.1_Silent_p.E175E|OPTN_uc001ilw.1_Silent_p.E175E|OPTN_uc001ilx.1_Silent_p.E175E|OPTN_uc001ily.1_Silent_p.E175E|OPTN_uc010qbr.1_Silent_p.E118E|OPTN_uc001ilz.1_Silent_p.E175E	p.E175E	NM_001008213	NP_001008214	WXS	Illumina HiSeq	Unspecified	Q96CV9	OPTN_HUMAN			6	963	+			175			Interaction with Rab8.		B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Silent	SNP	ENST00000378748.3	37	c.525A>G	CCDS7094.1																																																																																				0.463	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980		52	81	0	0	0	0.048971	0	52	81				
CHST3	9469	broad.mit.edu	37	10	73767038	73767038	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:73767038C>A	ENST00000373115.4	+	3	686	c.249C>A	c.(247-249)ctC>ctA	p.L83L		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	83					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						TGAGCGAGCTCGATTCAGCCT	0.597																																							uc001jsn.2		NA																	0					0						c.(247-249)CTC>CTA		chondroitin 6-sulfotransferase 3							75.0	67.0	69.0					10																	73767038		2203	4300	6503	SO:0001819	synonymous_variant	9469				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity	g.chr10:73767038C>A	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.249C>A	10.37:g.73767038C>A			Somatic					p.L83L	NM_004273	NP_004264	WXS	Illumina HiSeq	Unspecified	Q7LGC8	CHST3_HUMAN			3	689	+			83			Lumenal (Potential).		O75099|Q52M30	Silent	SNP	ENST00000373115.4	37	c.249C>A	CCDS7312.1																																																																																				0.597	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273		22	10	1	0	3.8784e-16	0.062417	5.22093e-16	22	10				
PDZD8	118987	broad.mit.edu	37	10	119078424	119078424	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr10:119078424T>G	ENST00000334464.5	-	3	1296	c.1057A>C	c.(1057-1059)Agt>Cgt	p.S353R		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	353					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		CAAACACTACTGCTTAACTCA	0.338																																							uc001lde.1		NA																	0					0						c.(1057-1059)AGT>CGT		PDZ domain containing 8							118.0	116.0	117.0					10																	119078424		2203	4299	6502	SO:0001583	missense	118987				intracellular signal transduction		metal ion binding	g.chr10:119078424T>G	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1057A>C	10.37:g.119078424T>G	ENSP00000334642:p.Ser353Arg		Somatic					p.S353R	NM_173791	NP_776152	WXS	Illumina HiSeq	Unspecified	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	3	1256	-		Colorectal(252;0.19)	353					Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	c.1057A>C	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	8.486	0.860987	0.17178	.	.	ENSG00000165650	ENST00000334464	D	0.86865	-2.18	5.38	5.38	0.77491	.	0.252301	0.45126	D	0.000399	T	0.77418	0.4127	N	0.22421	0.69	0.35710	D	0.816292	B	0.13145	0.007	B	0.08055	0.003	T	0.76157	-0.3062	10	0.36615	T	0.2	-5.8381	9.2616	0.37616	0.0:0.0825:0.0:0.9175	.	353	Q8NEN9	PDZD8_HUMAN	R	353	ENSP00000334642:S353R	ENSP00000334642:S353R	S	-	1	0	PDZD8	119068414	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	3.225000	0.51246	2.169000	0.68431	0.528000	0.53228	AGT		0.338	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		14	53	0	0	0	0.028581	0	14	53				
OR51D1	390038	broad.mit.edu	37	11	4661574	4661574	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:4661574A>G	ENST00000357605.2	+	1	630	c.554A>G	c.(553-555)cAt>cGt	p.H185R		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCCAAACACATACTGTCACA	0.478																																							uc010qyk.1		NA																	0					0						c.(553-555)CAT>CGT		olfactory receptor, family 51, subfamily D,							290.0	244.0	260.0					11																	4661574		2201	4298	6499	SO:0001583	missense	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661574A>G	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.554A>G	11.37:g.4661574A>G	ENSP00000350222:p.His185Arg		Somatic					p.H185R	NM_001004751	NP_001004751	WXS	Illumina HiSeq	Unspecified	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	554	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	185			Extracellular (Potential).		B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	c.554A>G	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.926106	0.00493	.	.	ENSG00000197428	ENST00000357605	T	0.36520	1.25	4.43	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.150250	0.31020	N	0.008409	T	0.16514	0.0397	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12218	-1.0556	10	0.30854	T	0.27	.	2.9451	0.05843	0.5556:0.0:0.2661:0.1782	.	185	Q8NGF3	O51D1_HUMAN	R	185	ENSP00000350222:H185R	ENSP00000350222:H185R	H	+	2	0	OR51D1	4618150	0.000000	0.05858	0.036000	0.18154	0.001000	0.01503	0.054000	0.14205	0.291000	0.22468	-1.580000	0.00857	CAT		0.478	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		71	52	0	0	0	0.048971	0	71	52				
TRIM22	10346	broad.mit.edu	37	11	5719619	5719619	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:5719619G>T	ENST00000379965.3	+	4	871	c.594G>T	c.(592-594)gaG>gaT	p.E198D	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	198					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		ACAATGAGGAGCAGAGAGAGC	0.483																																					GBM(104;491 2336 5222)	GBM(104;491 2336 5222)	uc001mbr.2		NA																	0					0						c.(592-594)GAG>GAT		tripartite motif-containing 22							72.0	81.0	78.0					11																	5719619		2080	4231	6311	SO:0001583	missense	10346				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr11:5719619G>T	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.594G>T	11.37:g.5719619G>T	ENSP00000369299:p.Glu198Asp		Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Missense_Mutation_p.E166D|TRIM22_uc009yes.2_Missense_Mutation_p.E194D|TRIM22_uc010qzm.1_Missense_Mutation_p.E26D|TRIM22_uc009yeu.2_Missense_Mutation_p.E9D	p.E198D	NM_006074	NP_006065	WXS	Illumina HiSeq	Unspecified	Q8IYM9	TRI22_HUMAN		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)	4	871	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	198			Potential.		Q05CQ0|Q15521	Missense_Mutation	SNP	ENST00000379965.3	37	c.594G>T	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997200	0.74818	.	.	ENSG00000132274	ENST00000379965;ENST00000425490;ENST00000545338;ENST00000454828;ENST00000414641;ENST00000455293	T;T;T;T	0.74842	3.03;-0.66;3.03;-0.88	3.76	1.46	0.22682	.	.	.	.	.	D	0.84529	0.5492	M	0.87900	2.915	0.09310	N	1	D;P;D;D	0.67145	0.99;0.893;0.996;0.989	D;B;D;P	0.73380	0.98;0.446;0.96;0.85	T	0.71297	-0.4635	9	0.87932	D	0	.	5.4884	0.16763	0.3203:0.0:0.6797:0.0	.	120;166;194;198	F8WAP8;C9JWC5;Q8IYM9-2;Q8IYM9	.;.;.;TRI22_HUMAN	D	198;198;9;166;198;120	ENSP00000369299:E198D;ENSP00000400417:E198D;ENSP00000393250:E166D;ENSP00000396849:E198D	ENSP00000369299:E198D	E	+	3	2	TRIM22	5676195	0.846000	0.29590	0.001000	0.08648	0.979000	0.70002	1.106000	0.31098	0.378000	0.24764	0.460000	0.39030	GAG		0.483	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074		29	30	1	0	1.39806e-14	0.037714	1.82193e-14	29	30				
OR52N2	390077	broad.mit.edu	37	11	5842468	5842468	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:5842468G>T	ENST00000317037.2	+	1	925	c.903G>T	c.(901-903)caG>caT	p.Q301H	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGACCAAGCAGATTCAGGAAG	0.383																																							uc010qzp.1		NA																	0				ovary(1)|skin(1)	2						c.(901-903)CAG>CAT		olfactory receptor, family 52, subfamily N,							92.0	87.0	89.0					11																	5842468		2201	4296	6497	SO:0001583	missense	390077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5842468G>T	AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.903G>T	11.37:g.5842468G>T	ENSP00000322801:p.Gln301His		Somatic				TRIM5_uc001mbq.1_Intron	p.Q301H	NM_001005174	NP_001005174	WXS	Illumina HiSeq	Unspecified	Q8NGI0	O52N2_HUMAN		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	903	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	301			Cytoplasmic (Potential).		Q6IFF9	Missense_Mutation	SNP	ENST00000317037.2	37	c.903G>T	CCDS31399.1	.	.	.	.	.	.	.	.	.	.	G	3.977	-0.007290	0.07773	.	.	ENSG00000180988	ENST00000317037	T	0.38887	1.11	6.09	2.19	0.27852	.	0.264851	0.27284	N	0.020068	T	0.34803	0.0910	L	0.54908	1.71	0.24081	N	0.995949	B	0.12630	0.006	B	0.19946	0.027	T	0.34551	-0.9824	10	0.72032	D	0.01	.	6.2131	0.20640	0.1238:0.1064:0.66:0.1099	.	301	Q8NGI0	O52N2_HUMAN	H	301	ENSP00000322801:Q301H	ENSP00000322801:Q301H	Q	+	3	2	OR52N2	5799044	0.980000	0.34600	0.986000	0.45419	0.004000	0.04260	0.192000	0.17096	0.422000	0.26005	-1.898000	0.00530	CAG		0.383	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174		57	38	1	0	1.78197e-24	0.048971	2.55311e-24	57	38				
MAPK8IP1	9479	broad.mit.edu	37	11	45925566	45925566	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:45925566T>G	ENST00000241014.2	+	7	1690	c.1520T>G	c.(1519-1521)cTt>cGt	p.L507R	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.L497R	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	507	Interaction with VRK2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GAAGACGAACTTGAGCTGGAA	0.587																																							uc001nbr.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1519-1521)CTT>CGT		mitogen-activated protein kinase 8 interacting							128.0	116.0	120.0					11																	45925566		2203	4299	6502	SO:0001583	missense	9479				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	g.chr11:45925566T>G		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1520T>G	11.37:g.45925566T>G	ENSP00000241014:p.Leu507Arg		Somatic					p.L507R	NM_005456	NP_005447	WXS	Illumina HiSeq	Unspecified	Q9UQF2	JIP1_HUMAN		GBM - Glioblastoma multiforme(35;0.231)	7	1690	+			507			SH3.		D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	c.1520T>G	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451904	0.84209	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.51817	0.69;0.69	5.25	5.25	0.73442	Src homology-3 domain (4);	0.000000	0.64402	D	0.000001	T	0.79873	0.4521	H	0.97390	3.995	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.87383	0.2358	10	0.87932	D	0	-19.3034	15.4549	0.75305	0.0:0.0:0.0:1.0	.	507	Q9UQF2	JIP1_HUMAN	R	507;497	ENSP00000241014:L507R;ENSP00000378991:L497R	ENSP00000241014:L507R	L	+	2	0	MAPK8IP1	45882142	1.000000	0.71417	0.898000	0.35279	0.793000	0.44817	7.997000	0.88414	2.114000	0.64651	0.459000	0.35465	CTT		0.587	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456		10	139	0	0	0	0.080935	0	10	139				
TRIM51	84767	broad.mit.edu	37	11	55655631	55655631	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:55655631C>A	ENST00000449290.2	+	4	723	c.631C>A	c.(631-633)Caa>Aaa	p.Q211K	TRIM51_ENST00000244891.3_Missense_Mutation_p.Q68K	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	211						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										CATTTTTCAGCAACTCAATGA	0.443																																							uc010rip.1		NA																	0					0						c.(631-633)CAA>AAA		SPRY domain containing 5							55.0	53.0	53.0					11																	55655631		2201	4296	6497	SO:0001583	missense	84767					intracellular	zinc ion binding	g.chr11:55655631C>A	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.631C>A	11.37:g.55655631C>A	ENSP00000395086:p.Gln211Lys		Somatic				SPRYD5_uc010riq.1_Missense_Mutation_p.Q68K	p.Q211K	NM_032681	NP_116070	WXS	Illumina HiSeq	Unspecified	Q9BSJ1	SPRY5_HUMAN			4	723	+		all_epithelial(135;0.226)	211					A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37	c.631C>A		.	.	.	.	.	.	.	.	.	.	.	5.044	0.193713	0.09599	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.05139	3.49;3.49	0.757	0.757	0.18427	.	.	.	.	.	T	0.07369	0.0186	M	0.67625	2.065	0.09310	N	1	P	0.39847	0.691	B	0.37833	0.259	T	0.27938	-1.0059	9	0.33141	T	0.24	.	4.8849	0.13697	0.0:1.0:0.0:0.0	.	211	Q9BSJ1	SPRY5_HUMAN	K	211;68	ENSP00000395086:Q211K;ENSP00000244891:Q68K	ENSP00000244891:Q68K	Q	+	1	0	SPRYD5	55412207	0.003000	0.15002	0.073000	0.20177	0.569000	0.35902	1.133000	0.31430	0.714000	0.32081	0.152000	0.16155	CAA		0.443	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		5	88	1	0	2.27111e-07	0.09319	2.61231e-07	5	88				
TRIM51	84767	broad.mit.edu	37	11	55658922	55658922	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:55658922C>A	ENST00000449290.2	+	7	1265	c.1173C>A	c.(1171-1173)ctC>ctA	p.L391L	TRIM51_ENST00000244891.3_Silent_p.L248L	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	391	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ACTGCAGTCTCTTTACCACCT	0.443																																							uc010rip.1		NA																	0					0						c.(1171-1173)CTC>CTA		SPRY domain containing 5							30.0	30.0	30.0					11																	55658922		2124	4089	6213	SO:0001819	synonymous_variant	84767					intracellular	zinc ion binding	g.chr11:55658922C>A	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1173C>A	11.37:g.55658922C>A			Somatic				SPRYD5_uc010riq.1_Silent_p.L248L	p.L391L	NM_032681	NP_116070	WXS	Illumina HiSeq	Unspecified	Q9BSJ1	SPRY5_HUMAN			7	1265	+		all_epithelial(135;0.226)	391			B30.2/SPRY.		A6NMG2	Silent	SNP	ENST00000449290.2	37	c.1173C>A																																																																																					0.443	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		32	68	1	0	3.38236e-24	0.092188	4.81789e-24	32	68				
OR8H1	219469	broad.mit.edu	37	11	56058409	56058410	+	Missense_Mutation	DNP	CC	CC	GA			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:56058409_56058410CC>GA	ENST00000313022.2	-	1	156_157	c.129_130GG>TC	c.(127-132)gtGGgg>gtTCgg	p.G44R		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					AATATCATCCCCACATTGCCCA	0.426																																							uc010rje.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(127-132)GTGGGG>GTTCGG		olfactory receptor, family 8, subfamily H,																																				SO:0001583	missense	219469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56058409_56058410CC>GA	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.129_130delinsGA	11.37:g.56058409_56058410delinsGA	ENSP00000323595:p.Gly44Arg		Somatic					p.G44R	NM_001005199	NP_001005199	WXS	Illumina HiSeq	Unspecified	Q8NGG4	OR8H1_HUMAN			1	129_130	-	Esophageal squamous(21;0.00448)		44			Helical; Name=1; (Potential).		B2RNI7|Q6IFC5	Missense_Mutation	DNP	ENST00000313022.2	37	c.129_130GG>TC	CCDS31526.1																																																																																				0.426	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199		96	213	0	0	0	0.004672	0	96	213				
MS4A3	932	broad.mit.edu	37	11	59834462	59834462	+	Silent	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:59834462A>T	ENST00000278865.3	+	5	463	c.390A>T	c.(388-390)acA>acT	p.T130T	MS4A3_ENST00000534744.1_Silent_p.T84T|MS4A3_ENST00000395032.2_Silent_p.T7T|MS4A3_ENST00000358152.2_Silent_p.T84T	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	130						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				CCAGTGCTACAATTGCACTAG	0.373																																							uc001nom.2		NA																	0				ovary(2)|skin(1)	3						c.(388-390)ACA>ACT		membrane-spanning 4-domains, subfamily A, member							82.0	73.0	76.0					11																	59834462		2201	4295	6496	SO:0001819	synonymous_variant	932					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity	g.chr11:59834462A>T	L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.390A>T	11.37:g.59834462A>T			Somatic				MS4A3_uc001non.2_Silent_p.T84T|MS4A3_uc001noo.2_Silent_p.T7T	p.T130T	NM_006138	NP_006129	WXS	Illumina HiSeq	Unspecified	Q96HJ5	MS4A3_HUMAN			5	518	+		all_epithelial(135;0.245)	130			Helical; (Potential).		A8MTP8|Q8NHW2	Silent	SNP	ENST00000278865.3	37	c.390A>T	CCDS31567.1																																																																																				0.373	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1			20	17	0	0	0	0.069288	0	20	17				
PGR	5241	broad.mit.edu	37	11	100922259	100922259	+	Silent	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:100922259A>T	ENST00000325455.5	-	5	3706	c.2253T>A	c.(2251-2253)atT>atA	p.I751I	PGR_ENST00000263463.5_Silent_p.I649I|PGR_ENST00000534013.1_Silent_p.I157I	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	751	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	AAGAATACTGAATGAGAGTTA	0.343																																					Pancreas(124;2271 2354 21954 22882)	Pancreas(124;2271 2354 21954 22882)	uc001pgh.2		NA																	0				lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4						c.(2251-2253)ATT>ATA		progesterone receptor	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)						109.0	107.0	108.0					11																	100922259		2203	4300	6503	SO:0001819	synonymous_variant	5241				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr11:100922259A>T	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2253T>A	11.37:g.100922259A>T			Somatic				PGR_uc001pgg.2_Silent_p.I132I|PGR_uc001pgi.2_Silent_p.I649I|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	p.I751I	NM_000926	NP_000917	WXS	Illumina HiSeq	Unspecified	P06401	PRGR_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	5	2996	-		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)	751			Steroid-binding.		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Silent	SNP	ENST00000325455.5	37	c.2253T>A	CCDS8310.1																																																																																				0.343	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			28	68	0	0	0	0.108266	0	28	68				
TRPC6	7225	broad.mit.edu	37	11	101454093	101454093	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:101454093G>C	ENST00000344327.3	-	1	566	c.142C>G	c.(142-144)Ctg>Gtg	p.L48V	TRPC6_ENST00000526713.1_Intron|TRPC6_ENST00000348423.4_Missense_Mutation_p.L48V|TRPC6_ENST00000532133.1_Missense_Mutation_p.L48V|RP11-748H22.1_ENST00000527374.1_RNA|TRPC6_ENST00000360497.4_Missense_Mutation_p.L48V	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	48					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TAGCAAGGCAGCGGGGCTTGC	0.721																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(142-144)CTG>GTG		transient receptor potential cation channel,							14.0	15.0	15.0					11																	101454093		2193	4283	6476	SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101454093G>C	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.142C>G	11.37:g.101454093G>C	ENSP00000340913:p.Leu48Val		Somatic				TRPC6_uc009ywy.2_Missense_Mutation_p.L48V|TRPC6_uc009ywz.1_Missense_Mutation_p.L48V	p.L48V	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	1	567	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	48			Cytoplasmic (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	c.142C>G	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.384242	0.25031	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.79141	-1.05;-1.13;-0.98;-1.24	4.99	4.99	0.66335	.	1.178640	0.06329	N	0.705825	T	0.69459	0.3113	N	0.22421	0.69	0.18873	N	0.999983	B;B;B	0.23316	0.017;0.007;0.083	B;B;B	0.18263	0.011;0.021;0.011	T	0.55685	-0.8102	10	0.39692	T	0.17	-11.5051	13.7762	0.63055	0.0:0.0:1.0:0.0	.	48;48;48	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	V	48	ENSP00000340913:L48V;ENSP00000435574:L48V;ENSP00000343672:L48V;ENSP00000353687:L48V	ENSP00000340913:L48V	L	-	1	2	TRPC6	100959303	1.000000	0.71417	0.628000	0.29241	0.040000	0.13550	3.312000	0.51927	2.300000	0.77407	0.561000	0.74099	CTG		0.721	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		6	9	0	0	0	0.047766	0	6	9				
ZC3H12C	85463	broad.mit.edu	37	11	110035866	110035866	+	Silent	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:110035866A>C	ENST00000278590.3	+	6	2107	c.2056A>C	c.(2056-2058)Aga>Cga	p.R686R	ZC3H12C_ENST00000453089.2_Silent_p.R655R|ZC3H12C_ENST00000528673.1_Silent_p.R687R	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	686							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CCCCTTAACCAGAGGGCAAAG	0.562																																							uc009yxw.2		NA																	0					0						c.(2056-2058)AGA>CGA		zinc finger CCCH-type containing 12C							185.0	202.0	197.0					11																	110035866		2066	4209	6275	SO:0001819	synonymous_variant	85463						endonuclease activity|nucleic acid binding|zinc ion binding	g.chr11:110035866A>C		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.2056A>C	11.37:g.110035866A>C			Somatic				ZC3H12C_uc010rwc.1_Silent_p.R687R|ZC3H12C_uc010rwd.1_Silent_p.R687R|ZC3H12C_uc001pkr.3_Silent_p.R655R	p.R686R	NM_033390	NP_203748	WXS	Illumina HiSeq	Unspecified	Q9C0D7	ZC12C_HUMAN		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)	6	2107	+		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	686					B4DI65|B4DR47	Silent	SNP	ENST00000278590.3	37	c.2056A>C	CCDS44727.1																																																																																				0.562	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390		64	258	0	0	0	0.048971	0	64	258				
TMPRSS13	84000	broad.mit.edu	37	11	117789384	117789384	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:117789384G>A	ENST00000430170.2	-	2	278	c.191C>T	c.(190-192)aCa>aTa	p.T64I	TMPRSS13_ENST00000526090.1_Missense_Mutation_p.T64I|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.T64I|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.T64I|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.T64I	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	64	13 X 5 AA repeats of A-S-P-A-[GLQR].|4 X 5 AA repeats of T-P-P-G-R.|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GCCTGGAGGTGTACCAGCTGG	0.687																																							uc001prs.1		NA																	0				pancreas(1)	1						c.(190-192)ACA>ATA		transmembrane protease, serine 13							44.0	51.0	49.0					11																	117789384		1901	4090	5991	SO:0001583	missense	84000				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr11:117789384G>A	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.191C>T	11.37:g.117789384G>A	ENSP00000387702:p.Thr64Ile		Somatic				TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.T64I	p.T64I	NM_001077263	NP_001070731	WXS	Illumina HiSeq	Unspecified	Q9BYE2	TMPSD_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)	2	284	-	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	64			4 X 5 AA repeats of T-P-P-G-R.|2-4.|12 X 5 AA repeats of A-S-P-A-[GLQR].|Cytoplasmic (Potential).|Ala-rich.		B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	c.191C>T	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	g	11.56	1.673953	0.29693	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.88741	-2.42;-2.39;-2.41;-2.41;-2.33	1.22	1.22	0.21188	.	0.971289	0.08372	N	0.955938	T	0.80633	0.4660	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.70096	-0.4966	10	0.59425	D	0.04	.	8.311	0.32071	0.0:0.0:1.0:0.0	.	64	E9PRA0	.	I	64	ENSP00000435813:T64I;ENSP00000434279:T64I;ENSP00000387702:T64I;ENSP00000394114:T64I;ENSP00000436502:T64I	ENSP00000337113:T64I	T	-	2	0	TMPRSS13	117294594	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.584000	0.23864	0.954000	0.37851	0.205000	0.17691	ACA		0.687	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046		26	46	0	0	0	0.034045	0	26	46				
OR8D2	283160	broad.mit.edu	37	11	124189725	124189725	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:124189725A>G	ENST00000357438.2	-	1	459	c.369T>C	c.(367-369)taT>taC	p.Y123Y		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AGATAGCAACATAACGGTCAT	0.418																																							uc010sah.1		NA																	0				breast(1)|central_nervous_system(1)|pancreas(1)	3						c.(367-369)TAT>TAC		olfactory receptor, family 8, subfamily D,							94.0	89.0	91.0					11																	124189725		2201	4299	6500	SO:0001819	synonymous_variant	283160				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124189725A>G	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.369T>C	11.37:g.124189725A>G			Somatic					p.Y123Y	NM_001002918	NP_001002918	WXS	Illumina HiSeq	Unspecified	Q9GZM6	OR8D2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)	1	369	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	123			Cytoplasmic (Potential).		B9EH49|Q6IFR0	Silent	SNP	ENST00000357438.2	37	c.369T>C	CCDS31707.1																																																																																				0.418	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918		23	52	0	0	0	0.069288	0	23	52				
KIRREL3	84623	broad.mit.edu	37	11	126306850	126306850	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:126306850C>A	ENST00000525144.2	-	12	1657	c.1408G>T	c.(1408-1410)Gtg>Ttg	p.V470L	KIRREL3_ENST00000416561.2_5'UTR|KIRREL3_ENST00000525704.2_Missense_Mutation_p.V470L|KIRREL3_ENST00000529097.2_Missense_Mutation_p.V470L	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	470	Ig-like C2-type 5.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ATGGTCTCCACCGTATAGCGC	0.642																																							uc001qea.2		NA																	0				ovary(3)	3						c.(1408-1410)GTG>TTG		kin of IRRE like 3 isoform 1							84.0	94.0	91.0					11																	126306850		2185	4291	6476	SO:0001583	missense	84623				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding	g.chr11:126306850C>A	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1408G>T	11.37:g.126306850C>A	ENSP00000435466:p.Val470Leu		Somatic				KIRREL3_uc001qeb.2_Missense_Mutation_p.V470L|KIRREL3_uc001qec.1_Missense_Mutation_p.V470L|ST3GAL4_uc001qdx.1_Intron	p.V470L	NM_032531	NP_115920	WXS	Illumina HiSeq	Unspecified	Q8IZU9	KIRR3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)	12	1769	-	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)	470			Extracellular (Potential).|Ig-like C2-type 5.		Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	c.1408G>T	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318085	0.60524	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.69561	-0.41;-0.41;-0.41	4.29	4.29	0.51040	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162937	0.40469	N	0.001083	T	0.71736	0.3375	M	0.67569	2.06	0.80722	D	1	B;B;P	0.44478	0.142;0.021;0.836	B;B;P	0.47044	0.086;0.044;0.535	T	0.77512	-0.2560	10	0.72032	D	0.01	-8.2436	16.3305	0.83010	0.0:1.0:0.0:0.0	.	470;470;470	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	L	470	ENSP00000435466:V470L;ENSP00000434081:V470L;ENSP00000435094:V470L	ENSP00000435466:V470L	V	-	1	0	KIRREL3	125812060	1.000000	0.71417	0.991000	0.47740	0.546000	0.35178	7.751000	0.85126	1.934000	0.56057	0.407000	0.27541	GTG		0.642	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		7	13	1	0	2.7689e-08	0.02938	3.21507e-08	7	13				
KIRREL3	84623	broad.mit.edu	37	11	126318921	126318921	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr11:126318921C>T	ENST00000525144.2	-	8	1229	c.980G>A	c.(979-981)cGc>cAc	p.R327H	KIRREL3_ENST00000525704.2_Missense_Mutation_p.R327H|KIRREL3_ENST00000529097.2_Missense_Mutation_p.R327H	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	327	Ig-like C2-type 3.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		GTCAACCGTGCGGCTGAGGTT	0.587																																							uc001qea.2		NA																	0				ovary(3)	3						c.(979-981)CGC>CAC		kin of IRRE like 3 isoform 1							71.0	77.0	75.0					11																	126318921		2100	4223	6323	SO:0001583	missense	84623				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding	g.chr11:126318921C>T	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.980G>A	11.37:g.126318921C>T	ENSP00000435466:p.Arg327His		Somatic				KIRREL3_uc001qeb.2_Missense_Mutation_p.R327H|KIRREL3_uc001qec.1_Missense_Mutation_p.R327H	p.R327H	NM_032531	NP_115920	WXS	Illumina HiSeq	Unspecified	Q8IZU9	KIRR3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)	8	1341	-	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)	327			Extracellular (Potential).|Ig-like C2-type 3.		Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	c.980G>A	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210849	0.79240	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.15139	2.45;2.45;2.45	5.32	4.4	0.53042	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.33147	0.0853	L	0.41236	1.265	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.921;0.98	T	0.03268	-1.1054	10	0.45353	T	0.12	.	15.6468	0.77061	0.0:0.8621:0.1379:0.0	.	327;327;327	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	H	327	ENSP00000435466:R327H;ENSP00000434081:R327H;ENSP00000435094:R327H	ENSP00000435466:R327H	R	-	2	0	KIRREL3	125824131	1.000000	0.71417	0.956000	0.39512	0.963000	0.63663	4.608000	0.61141	1.228000	0.43614	0.643000	0.83706	CGC		0.587	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		13	48	0	0	0	0.09319	0	13	48				
ANO2	57101	broad.mit.edu	37	12	5685081	5685081	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr12:5685081A>T	ENST00000356134.5	-	25	2614	c.2543T>A	c.(2542-2544)cTc>cAc	p.L848H	ANO2_ENST00000546188.1_Missense_Mutation_p.L848H|ANO2_ENST00000327087.8_Missense_Mutation_p.L847H	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	852					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						GAAAAAGGAGAGGGTGTGGTT	0.517																																							uc001qnm.2		NA																	0				ovary(4)|large_intestine(2)|central_nervous_system(1)	7						c.(2539-2541)CTC>CAC		anoctamin 2							71.0	73.0	72.0					12																	5685081		1938	4150	6088	SO:0001583	missense	57101					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity	g.chr12:5685081A>T	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2543T>A	12.37:g.5685081A>T	ENSP00000348453:p.Leu848His		Somatic					p.L847H	NM_020373	NP_065106	WXS	Illumina HiSeq	Unspecified	Q9NQ90	ANO2_HUMAN			24	2612	-			852			Extracellular (Potential).		C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37	c.2540T>A		.	.	.	.	.	.	.	.	.	.	A	24.8	4.567830	0.86439	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	D;D;D	0.83075	-1.67;-1.68;-1.68	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95577	0.8643	10	0.87932	D	0	.	14.6997	0.69147	1.0:0.0:0.0:0.0	.	847	Q9NQ90-3	.	H	847;848;848;852	ENSP00000314048:L847H;ENSP00000348453:L848H;ENSP00000440981:L848H	ENSP00000314048:L847H	L	-	2	0	ANO2	5555342	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.287000	0.95975	2.119000	0.64992	0.528000	0.53228	CTC		0.517	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		14	8	0	0	0	0.024245	0	14	8				
ST8SIA1	6489	broad.mit.edu	37	12	22487150	22487150	+	Missense_Mutation	SNP	C	C	T	rs146610334		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr12:22487150C>T	ENST00000396037.4	-	1	498	c.17G>A	c.(16-18)cGg>cAg	p.R6Q	ST8SIA1_ENST00000539510.1_5'Flank|ST8SIA1_ENST00000404299.3_Missense_Mutation_p.R6Q|ST8SIA1_ENST00000536558.1_Intron|ST8SIA1_ENST00000381424.3_Missense_Mutation_p.R6Q	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	6					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						TCGCCGGGCCCGCCCGCAGGG	0.731																																							uc001rfo.3		NA																	0				ovary(3)	3						c.(16-18)CGG>CAG		alpha-2,8-sialyltransferase 1							27.0	29.0	29.0					12																	22487150		2202	4298	6500	SO:0001583	missense	6489				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr12:22487150C>T	L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.17G>A	12.37:g.22487150C>T	ENSP00000379353:p.Arg6Gln		Somatic				ST8SIA1_uc009zix.2_5'UTR|uc001rfp.1_Intron	p.R6Q	NM_003034	NP_003025	WXS	Illumina HiSeq	Unspecified	Q92185	SIA8A_HUMAN			1	499	-			6			Cytoplasmic (Potential).		A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	ENST00000396037.4	37	c.17G>A	CCDS8697.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684594	0.47991	.	.	ENSG00000111728	ENST00000396037;ENST00000404299;ENST00000381424	T	0.28666	1.6	4.38	1.35	0.21983	.	0.570879	0.16121	N	0.228668	T	0.18173	0.0436	L	0.34521	1.04	0.27487	N	0.952405	B	0.10296	0.003	B	0.04013	0.001	T	0.21724	-1.0237	10	0.66056	D	0.02	-5.0513	1.2247	0.01931	0.1749:0.4461:0.1705:0.2085	.	6	Q92185	SIA8A_HUMAN	Q	6	ENSP00000379353:R6Q	ENSP00000261197:R6Q	R	-	2	0	ST8SIA1	22378417	0.776000	0.28616	0.866000	0.34008	0.931000	0.56810	-0.202000	0.09451	0.144000	0.18951	0.650000	0.86243	CGG		0.731	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402245.2	NM_003034		21	22	0	0	0	0.055883	0	21	22				
TSPAN11	441631	broad.mit.edu	37	12	31144811	31144811	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr12:31144811C>A	ENST00000261177.9	+	8	782	c.723C>A	c.(721-723)acC>acA	p.T241T	TSPAN11_ENST00000546076.1_Silent_p.T241T|TSPAN11_ENST00000535215.1_Silent_p.T170T|TSPAN11_ENST00000544427.1_Silent_p.T231T	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	241						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TGGTTCTCACCTGCTGCTTGC	0.577																																							uc010sju.1		NA																	0					0						c.(721-723)ACC>ACA		tetraspanin 11							122.0	107.0	112.0					12																	31144811		2203	4300	6503	SO:0001819	synonymous_variant	441631					integral to membrane		g.chr12:31144811C>A		CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.723C>A	12.37:g.31144811C>A			Somatic				TSPAN11_uc001rjp.2_Silent_p.T241T|TSPAN11_uc010sjv.1_Silent_p.T231T	p.T241T	NM_001080509	NP_001073978	WXS	Illumina HiSeq	Unspecified	A1L157	TSN11_HUMAN			8	1103	+	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		241					A1L158|B2RUX6	Silent	SNP	ENST00000261177.9	37	c.723C>A	CCDS31765.1																																																																																				0.577	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1	XM_497334		26	26	1	0	9.80776e-20	0.030593	1.36528e-19	26	26				
PTGES3	10728	broad.mit.edu	37	12	57058275	57058275	+	Silent	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr12:57058275T>A	ENST00000262033.6	-	8	771	c.471A>T	c.(469-471)ccA>ccT	p.P157P	PTGES3_ENST00000537473.1_5'UTR|PTGES3_ENST00000436399.2_Silent_p.P124P|PTGES3_ENST00000456859.2_Silent_p.P121P|PTGES3_ENST00000414274.3_Silent_p.P127P|PTGES3_ENST00000448157.2_Silent_p.P136P	NM_006601.5	NP_006592.3	Q15185	TEBP_HUMAN	prostaglandin E synthase 3 (cytosolic)	157	Asp/Glu-rich.				arachidonic acid metabolic process (GO:0019369)|cell proliferation (GO:0008283)|chaperone cofactor-dependent protein refolding (GO:0070389)|cyclooxygenase pathway (GO:0019371)|glucocorticoid receptor signaling pathway (GO:0042921)|glycogen biosynthetic process (GO:0005978)|lung saccule development (GO:0060430)|prostaglandin biosynthetic process (GO:0001516)|RNA-dependent DNA replication (GO:0006278)|signal transduction (GO:0007165)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	prostaglandin-E synthase activity (GO:0050220)|telomerase activity (GO:0003720)|unfolded protein binding (GO:0051082)			large_intestine(1)|lung(1)	2						ACTCCAGATCTGGCATTTCTG	0.299																																							uc001slu.3		NA																	0					0						c.(469-471)CCA>CCT		prostaglandin-E synthase 3							45.0	51.0	49.0					12																	57058275		2187	4289	6476	SO:0001819	synonymous_variant	10728				chaperone cofactor-dependent protein refolding|hormone biosynthetic process|prostaglandin biosynthetic process|signal transduction|telomere maintenance	cytosol|telomerase holoenzyme complex	prostaglandin-E synthase activity|telomerase activity|unfolded protein binding	g.chr12:57058275T>A	BC003005	CCDS31836.1, CCDS61158.1, CCDS61159.1, CCDS61160.1, CCDS73485.1	12q13.13	2012-03-14			ENSG00000110958	ENSG00000110958			16049	protein-coding gene	gene with protein product		607061				8114727, 12077419	Standard	XR_245889		Approved	p23, TEBP, cPGES	uc001slu.4	Q15185	OTTHUMG00000170217	ENST00000262033.6:c.471A>T	12.37:g.57058275T>A			Somatic				PTGES3_uc001slw.3_RNA|PTGES3_uc010sqs.1_Silent_p.P124P|PTGES3_uc001slv.3_Silent_p.P127P|PTGES3_uc010sqt.1_Silent_p.P136P|PTGES3_uc009zox.2_RNA	p.P157P	NM_006601	NP_006592	WXS	Illumina HiSeq	Unspecified	Q15185	TEBP_HUMAN			8	766	-			157			Asp/Glu-rich.		A8K7D0|B4DHP2|B4DP11|B4DP21|Q8WU70	Silent	SNP	ENST00000262033.6	37	c.471A>T	CCDS31836.1																																																																																				0.299	PTGES3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408054.1	NM_006601		29	27	0	0	0	0.045705	0	29	27				
IFT88	8100	broad.mit.edu	37	13	21199956	21199956	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr13:21199956G>C	ENST00000319980.6	+	17	1621	c.1294G>C	c.(1294-1296)Gtt>Ctt	p.V432L	IFT88_ENST00000382778.4_Missense_Mutation_p.V432L|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.V404L|IFT88_ENST00000351808.5_Missense_Mutation_p.V423L	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	432					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AAACAAAGCAGTTACATACTT	0.318																																							uc001unh.2		NA																	0				ovary(1)	1						c.(1294-1296)GTT>CTT		intraflagellar transport 88 homolog isoform 1							101.0	95.0	97.0					13																	21199956		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21199956G>C	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1294G>C	13.37:g.21199956G>C	ENSP00000323580:p.Val432Leu		Somatic				IFT88_uc001uni.2_Missense_Mutation_p.V423L|IFT88_uc001unj.2_Missense_Mutation_p.V422L|IFT88_uc010tcq.1_Missense_Mutation_p.V403L|IFT88_uc001unk.2_Missense_Mutation_p.V178L|IFT88_uc001unl.1_Missense_Mutation_p.V50L	p.V432L	NM_175605	NP_783195	WXS	Illumina HiSeq	Unspecified	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	17	1690	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	432			TPR 5.		A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.1294G>C	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	7.843	0.722382	0.15439	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.75477	-0.94;0.84;0.84;0.84	5.35	2.88	0.33553	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.173266	0.49305	D	0.000152	T	0.50871	0.1641	N	0.12663	0.25	0.31997	N	0.603859	B;B;B;B	0.09022	0.0;0.002;0.0;0.001	B;B;B;B	0.08055	0.003;0.003;0.001;0.001	T	0.46190	-0.9209	10	0.10902	T	0.67	-8.0598	9.3864	0.38345	0.8481:0.0:0.1519:0.0	.	404;432;230;432	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	L	432;295;423;432;404	ENSP00000372228:V432L;ENSP00000261632:V423L;ENSP00000323580:V432L;ENSP00000437719:V404L	ENSP00000323580:V432L	V	+	1	0	IFT88	20097956	1.000000	0.71417	0.798000	0.32154	0.501000	0.33797	4.133000	0.57983	0.414000	0.25790	-0.482000	0.04802	GTT		0.318	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		24	10	0	0	0	0.0918	0	24	10				
NBEA	26960	broad.mit.edu	37	13	35751179	35751179	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr13:35751179C>A	ENST00000400445.3	+	28	5135	c.4601C>A	c.(4600-4602)cCg>cAg	p.P1534Q	NBEA_ENST00000310336.4_Missense_Mutation_p.P1534Q|NBEA_ENST00000540320.1_Missense_Mutation_p.P1534Q|NBEA_ENST00000379939.2_Missense_Mutation_p.P1531Q	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1534					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.P1534L(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ATTAAGGATCCGGATAGACTT	0.348																																							uc001uvb.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(9)|large_intestine(2)	11						c.(4600-4602)CCG>CAG		neurobeachin							130.0	112.0	117.0					13																	35751179		1820	4088	5908	SO:0001583	missense	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:35751179C>A	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4601C>A	13.37:g.35751179C>A	ENSP00000383295:p.Pro1534Gln		Somatic				NBEA_uc010abi.2_Missense_Mutation_p.P222Q	p.P1534Q	NM_015678	NP_056493	WXS	Illumina HiSeq	Unspecified	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	28	4807	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	1534					B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.4601C>A	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897385	0.33535	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	6.17	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	L	0.55990	1.75	0.80722	D	1	D;P	0.53619	0.961;0.688	P;B	0.48488	0.579;0.306	T	0.52124	-0.8617	10	0.34782	T	0.22	.	10.4023	0.44237	0.1338:0.7996:0.0:0.0667	.	1534;1531	Q8NFP9;Q5T321	NBEA_HUMAN;.	Q	1534;1534;1531;1534;193	ENSP00000440951:P1534Q;ENSP00000383295:P1534Q;ENSP00000369271:P1531Q;ENSP00000308534:P1534Q	ENSP00000308534:P1534Q	P	+	2	0	NBEA	34649179	1.000000	0.71417	0.900000	0.35374	0.066000	0.16364	5.985000	0.70556	1.632000	0.50472	-0.140000	0.14226	CCG		0.348	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		11	4	1	0	1.61879e-10	0.09319	1.93465e-10	11	4				
LIG4	3981	broad.mit.edu	37	13	108863171	108863171	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr13:108863171T>A	ENST00000356922.4	-	2	718	c.446A>T	c.(445-447)aAc>aTc	p.N149I	LIG4_ENST00000405925.1_Missense_Mutation_p.N149I|LIG4_ENST00000442234.1_Missense_Mutation_p.N149I	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	149					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TAAAAGGTCGTTTACTTGCTG	0.368								Non-homologous end-joining																															uc001vqn.2		NA																	0					0						c.(445-447)AAC>ATC	NHEJ	DNA ligase IV							110.0	113.0	112.0					13																	108863171		2203	4300	6503	SO:0001583	missense	3981				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding	g.chr13:108863171T>A	X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.446A>T	13.37:g.108863171T>A	ENSP00000349393:p.Asn149Ile		Somatic				LIG4_uc001vqo.2_Missense_Mutation_p.N149I|LIG4_uc010agg.1_Missense_Mutation_p.N82I|LIG4_uc010agf.2_Missense_Mutation_p.N149I|LIG4_uc001vqp.2_Missense_Mutation_p.N149I	p.N149I	NM_002312	NP_002303	WXS	Illumina HiSeq	Unspecified	P49917	DNLI4_HUMAN			2	719	-	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)		149					Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	c.446A>T	CCDS9508.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.748591	0.69533	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.20463	2.07;2.07;2.07	5.69	5.69	0.88448	DNA ligase, ATP-dependent, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66999	-0.5781	10	0.59425	D	0.04	.	15.1249	0.72475	0.0:0.0:0.0:1.0	.	149	P49917	DNLI4_HUMAN	I	149	ENSP00000385955:N149I;ENSP00000402030:N149I;ENSP00000349393:N149I	ENSP00000349393:N149I	N	-	2	0	LIG4	107661172	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	7.633000	0.83260	2.172000	0.68678	0.523000	0.50628	AAC		0.368	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312		108	47	0	0	0	0.048971	0	108	47				
OR11H6	122748	broad.mit.edu	37	14	20691969	20691969	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:20691969G>T	ENST00000315519.2	+	1	179	c.101G>T	c.(100-102)gGt>gTt	p.G34V		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		GTCCTCCTGGGTTTCCATGGT	0.433																																							uc010tlc.1		NA																	0				ovary(2)|skin(1)	3						c.(100-102)GGT>GTT		olfactory receptor, family 11, subfamily H,							137.0	134.0	135.0					14																	20691969		2203	4300	6503	SO:0001583	missense	122748				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20691969G>T		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.101G>T	14.37:g.20691969G>T	ENSP00000319071:p.Gly34Val		Somatic					p.G34V	NM_001004480	NP_001004480	WXS	Illumina HiSeq	Unspecified	Q8NGC7	O11H6_HUMAN	Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)	1	101	+	all_cancers(95;0.00108)		34			Extracellular (Potential).		Q6IF08	Missense_Mutation	SNP	ENST00000315519.2	37	c.101G>T	CCDS32033.1	.	.	.	.	.	.	.	.	.	.	g	14.95	2.687414	0.48097	.	.	ENSG00000176219	ENST00000315519	T	0.00659	5.94	4.47	3.58	0.41010	.	0.126703	0.35525	N	0.003152	T	0.06142	0.0159	H	0.94886	3.595	0.46927	D	0.999256	D	0.89917	1.0	D	0.74674	0.984	T	0.00872	-1.1532	10	0.87932	D	0	.	10.894	0.47012	0.0941:0.0:0.9059:0.0	.	34	Q8NGC7	O11H6_HUMAN	V	34	ENSP00000319071:G34V	ENSP00000319071:G34V	G	+	2	0	OR11H6	19761809	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	5.176000	0.65026	1.229000	0.43630	-0.423000	0.05987	GGT		0.433	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1			75	54	1	0	6.6428e-20	0.048971	9.29992e-20	75	54				
OR4E2	26686	broad.mit.edu	37	14	22133543	22133543	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:22133543G>T	ENST00000408935.1	+	1	247	c.247G>T	c.(247-249)Gag>Tag	p.E83*		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TAAGATGTTGGAGGGTTTGCT	0.438																																							uc010tmd.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(247-249)GAG>TAG		olfactory receptor, family 4, subfamily E,							265.0	250.0	255.0					14																	22133543		1994	4192	6186	SO:0001587	stop_gained	26686				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22133543G>T		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.247G>T	14.37:g.22133543G>T	ENSP00000386195:p.Glu83*		Somatic					p.E83*	NM_001001912	NP_001001912	WXS	Illumina HiSeq	Unspecified	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	247	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	83			Extracellular (Potential).		Q6IET6|Q96R62	Nonsense_Mutation	SNP	ENST00000408935.1	37	c.247G>T	CCDS41916.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778100	0.70107	.	.	ENSG00000221977	ENST00000408935	.	.	.	5.31	2.41	0.29592	.	0.000000	0.38436	U	0.001681	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	5.7431	0.18104	0.1681:0.3073:0.5247:0.0	.	.	.	.	X	83	.	ENSP00000386195:E83X	E	+	1	0	OR4E2	21203383	0.000000	0.05858	0.987000	0.45799	0.850000	0.48378	-1.159000	0.03150	0.207000	0.20607	-0.225000	0.12378	GAG		0.438	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			143	119	1	0	4.23873e-62	0.048971	6.74344e-62	143	119				
BNIP3P1	319138	broad.mit.edu	37	14	28733879	28733879	+	RNA	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:28733879T>G	ENST00000550043.1	+	0	284									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		CTATTTATAATGGTGACATGG	0.527																																							uc001wqd.2		NA																	0					NA						c.(118-120)AAT>AAG		SubName: Full=cDNA FLJ60537, highly similar to BCL2/adenovirus E1B 19 kDa protein-interacting protein 3;																																						0							g.chr14:28733879T>G			14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28733879T>G			Somatic					p.N40K			WXS	Illumina HiSeq	Unspecified					1	260	+									Missense_Mutation	SNP	ENST00000550043.1	37	c.120T>G																																																																																					0.527	BNIP3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000408770.1			40	26	0	0	0	0.11126	0	40	26				
DDHD1	80821	broad.mit.edu	37	14	53619470	53619470	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:53619470G>A	ENST00000323669.5	-	1	346	c.347C>T	c.(346-348)tCg>tTg	p.S116L	AL356020.1_ENST00000584587.1_RNA|RP11-547D23.1_ENST00000554235.1_RNA|DDHD1_ENST00000357758.3_Missense_Mutation_p.S116L|DDHD1_ENST00000395606.1_Missense_Mutation_p.S116L	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	116					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					CGGGTGCAGCGACAAGGAGCT	0.701																																							uc001xai.2		NA																	0				ovary(2)	2						c.(346-348)TCG>TTG		DDHD domain containing 1 isoform c							5.0	7.0	6.0					14																	53619470		1984	3863	5847	SO:0001583	missense	80821				lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding	g.chr14:53619470G>A	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.347C>T	14.37:g.53619470G>A	ENSP00000327104:p.Ser116Leu		Somatic				DDHD1_uc001xaj.2_Missense_Mutation_p.S116L|DDHD1_uc001xah.2_Missense_Mutation_p.S116L	p.S116L	NM_001160148	NP_001153620	WXS	Illumina HiSeq	Unspecified	Q8NEL9	DDHD1_HUMAN			1	577	-	Breast(41;0.037)		116					G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	c.347C>T	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614107	0.28712	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.77	3.77	0.43336	.	1.260100	0.05920	N	0.633408	T	0.27524	0.0676	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21724	-1.0237	9	0.07325	T	0.83	-1.1816	8.1818	0.31315	0.0:0.146:0.6078:0.2462	.	116;116;116	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	L	116	.	ENSP00000327104:S116L	S	-	2	0	DDHD1	52689220	0.251000	0.23961	0.118000	0.21660	0.955000	0.61496	3.969000	0.56816	1.914000	0.55421	0.455000	0.32223	TCG		0.701	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			9	2	0	0	0	0.047766	0	9	2				
SAMD4A	23034	broad.mit.edu	37	14	55227114	55227114	+	Missense_Mutation	SNP	T	T	C	rs202093286		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:55227114T>C	ENST00000554335.1	+	7	2075	c.1412T>C	c.(1411-1413)cTc>cCc	p.L471P	SAMD4A_ENST00000392067.3_Missense_Mutation_p.L471P|SAMD4A_ENST00000555192.1_Missense_Mutation_p.L62P|SAMD4A_ENST00000251091.5_Missense_Mutation_p.L383P|SAMD4A_ENST00000357634.3_Missense_Mutation_p.L470P			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	471					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						AGCGGGGGGCTCCAGCCGCAC	0.736																																							uc001xbb.2		NA																	0					0						c.(1408-1410)CTC>CCC		sterile alpha motif domain containing 4 isoform							3.0	5.0	4.0					14																	55227114		1674	3492	5166	SO:0001583	missense	23034				positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity	g.chr14:55227114T>C	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1412T>C	14.37:g.55227114T>C	ENSP00000452535:p.Leu471Pro		Somatic				SAMD4A_uc001xbc.2_Missense_Mutation_p.L382P|SAMD4A_uc001xbg.2_Missense_Mutation_p.L62P	p.L470P	NM_015589	NP_056404	WXS	Illumina HiSeq	Unspecified	Q9UPU9	SMAG1_HUMAN			6	1410	+			471					A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	c.1409T>C	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648075	0.47258	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	5.22	5.22	0.72569	.	0.320649	0.28736	N	0.014306	T	0.49525	0.1562	N	0.03608	-0.345	0.58432	D	0.999996	D;B;B	0.76494	0.999;0.001;0.001	D;B;B	0.68943	0.961;0.007;0.002	T	0.61850	-0.6978	9	0.48119	T	0.1	-17.7987	15.265	0.73654	0.0:0.0:0.0:1.0	.	62;383;471	G3V2R1;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	P	471;471;383;382;470;62	.	ENSP00000251091:L100P	L	+	2	0	SAMD4A	54296864	0.996000	0.38824	1.000000	0.80357	0.966000	0.64601	3.698000	0.54771	2.190000	0.69967	0.496000	0.49642	CTC		0.736	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589		2	1	0	0	0	0.004672	0	2	1				
TSHR	7253	broad.mit.edu	37	14	81609890	81609890	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:81609890G>A	ENST00000541158.2	+	11	1810	c.1488G>A	c.(1486-1488)acG>acA	p.T496T	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Silent_p.T496T			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	496					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GGTGCAACACGGCTGGTTTCT	0.562			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																																uc001xvd.1		NA	yes	Dom	yes		14	14q31	7253	Mis	thyroid stimulating hormone receptor	yes	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 	E		thyroid  adenoma	toxic thyroid adenoma		0				thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299						c.(1486-1488)ACG>ACA		thyroid stimulating hormone receptor isoform 1	Thyrotropin Alfa(DB00024)						542.0	387.0	439.0					14																	81609890		2203	4300	6503	SO:0001819	synonymous_variant	7253				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity	g.chr14:81609890G>A	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1488G>A	14.37:g.81609890G>A			Somatic					p.T496T	NM_000369	NP_000360	WXS	Illumina HiSeq	Unspecified	P16473	TSHR_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0402)	10	1644	+			496			Helical; Name=3; (Potential).		A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	c.1488G>A	CCDS9872.1																																																																																				0.562	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		25	12	0	0	0	0.076483	0	25	12				
SERPINA9	327657	broad.mit.edu	37	14	94935754	94935754	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:94935754G>T	ENST00000380365.3	-	2	502	c.424C>A	c.(424-426)Ctg>Atg	p.L142M	SERPINA9_ENST00000448305.2_Missense_Mutation_p.L62M|SERPINA9_ENST00000424550.2_Missense_Mutation_p.L11M|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000337425.5_Missense_Mutation_p.L160M|SERPINA9_ENST00000298845.7_Intron|SERPINA9_ENST00000546329.1_Missense_Mutation_p.L124M			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	142					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		TGCAGCTGCAGCTCCTTCTTG	0.522																																							uc001ydf.2		NA																	0				lung(1)|central_nervous_system(1)	2						c.(478-480)CTG>ATG		serine (or cysteine) proteinase inhibitor, clade							111.0	112.0	112.0					14																	94935754		1988	4169	6157	SO:0001583	missense	327657				regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity	g.chr14:94935754G>T	AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.424C>A	14.37:g.94935754G>T	ENSP00000369723:p.Leu142Met		Somatic				SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Missense_Mutation_p.L11M|SERPINA9_uc001ydg.2_Missense_Mutation_p.L124M|SERPINA9_uc001ydh.1_Missense_Mutation_p.L160M|SERPINA9_uc001ydi.1_Missense_Mutation_p.L124M	p.L160M	NM_175739	NP_783866	WXS	Illumina HiSeq	Unspecified	Q86WD7	SPA9_HUMAN		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)	2	639	-		all_cancers(154;0.0691)|all_epithelial(191;0.233)	142					B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	ENST00000380365.3	37	c.478C>A		.	.	.	.	.	.	.	.	.	.	G	5.775	0.327318	0.10956	.	.	ENSG00000170054	ENST00000448305;ENST00000424550;ENST00000337425;ENST00000380365;ENST00000546329	D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99	3.97	1.93	0.25924	Serpin domain (3);	0.509728	0.16043	U	0.232312	D	0.88377	0.6420	L	0.58583	1.82	0.09310	N	1	P;D;D;D	0.65815	0.918;0.995;0.994;0.97	P;D;D;P	0.74674	0.74;0.984;0.972;0.873	T	0.77197	-0.2676	10	0.66056	D	0.02	.	6.789	0.23689	0.168:0.2539:0.578:0.0	.	124;142;62;160	Q86WD7-4;Q86WD7;Q86WD7-6;Q86WD7-7	.;SPA9_HUMAN;.;.	M	62;11;160;142;124	ENSP00000414092:L62M;ENSP00000409012:L11M;ENSP00000337133:L160M;ENSP00000369723:L142M;ENSP00000445476:L124M	ENSP00000337133:L160M	L	-	1	2	SERPINA9	94005507	0.000000	0.05858	0.887000	0.34795	0.645000	0.38454	0.416000	0.21198	0.793000	0.33875	0.462000	0.41574	CTG		0.522	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739		70	56	1	0	6.52717e-41	0.048971	1.0251e-40	70	56				
SERPINA13P	388007	broad.mit.edu	37	14	95108087	95108087	+	RNA	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:95108087C>G	ENST00000469935.1	+	0	692					NR_015340.1		Q6UXR4	SPA13_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13, pseudogene						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)										GTTCAGCGGCCTGGGCGCGAG	0.627																																							uc001ydt.2		NA																	0				lung(1)|skin(1)	2						c.(604-606)CTG>GTG		RecName: Full=Serpin A13; Flags: Precursor;							55.0	66.0	62.0					14																	95108087		2203	4300	6503			388007							g.chr14:95108087C>G	AY358238		14q32.13	2014-02-18	2012-10-03	2012-10-03	ENSG00000187483	ENSG00000187483		"""Serine (or cysteine) peptidase inhibitors"""	30909	pseudogene	pseudogene			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"", ""serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"""	SERPINA13		15014966, 16395595, 24172014	Standard	NR_015340		Approved	UNQ6121	uc001ydt.3	Q6UXR4	OTTHUMG00000150191		14.37:g.95108087C>G			Somatic					p.L202V	NR_015340		WXS	Illumina HiSeq	Unspecified					2	692	+									Missense_Mutation	SNP	ENST00000469935.1	37	c.604C>G																																																																																					0.627	SERPINA13P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000316754.1	NR_015340		58	34	0	0	0	0.048971	0	58	34				
ATG2B	55102	broad.mit.edu	37	14	96792136	96792136	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:96792136A>G	ENST00000359933.4	-	15	3180	c.2287T>C	c.(2287-2289)Tct>Cct	p.S763P	snoU13_ENST00000458931.1_RNA	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	763					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TCTTGATCAGATCGAAGATCA	0.393																																							uc001yfi.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(2287-2289)TCT>CCT		ATG2 autophagy related 2 homolog B							97.0	89.0	91.0					14																	96792136		1916	4115	6031	SO:0001583	missense	55102							g.chr14:96792136A>G	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2287T>C	14.37:g.96792136A>G	ENSP00000353010:p.Ser763Pro		Somatic					p.S763P	NM_018036	NP_060506	WXS	Illumina HiSeq	Unspecified	Q96BY7	ATG2B_HUMAN		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)	15	2652	-		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)	763					Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	c.2287T>C	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	6.632	0.485150	0.12641	.	.	ENSG00000066739	ENST00000359933	T	0.09538	2.97	5.6	5.6	0.85130	.	0.000000	0.56097	U	0.000025	T	0.15478	0.0373	N	0.17082	0.46	0.58432	D	0.999994	D	0.76494	0.999	D	0.80764	0.994	T	0.03784	-1.1004	10	0.02654	T	1	.	15.7992	0.78439	1.0:0.0:0.0:0.0	.	763	Q96BY7	ATG2B_HUMAN	P	763	ENSP00000353010:S763P	ENSP00000353010:S763P	S	-	1	0	ATG2B	95861889	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	7.327000	0.79147	2.143000	0.66587	0.460000	0.39030	TCT		0.393	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036		45	36	0	0	0	0.045515	0	45	36				
GABRG3	2567	broad.mit.edu	37	15	27777965	27777965	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr15:27777965T>C	ENST00000333743.6	+	10	1596	c.1342T>C	c.(1342-1344)Ttt>Ctt	p.F448L	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	448					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTCCCGGGTCTTTTTCCCCAC	0.473																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(1342-1344)TTT>CTT		gamma-aminobutyric acid (GABA) A receptor, gamma							72.0	73.0	73.0					15																	27777965		1952	4142	6094	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27777965T>C		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1342T>C	15.37:g.27777965T>C	ENSP00000331912:p.Phe448Leu		Somatic					p.F448L	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	10	1508	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	448			Helical; (Probable).		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.1342T>C	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954120	0.53293	.	.	ENSG00000182256	ENST00000333743	T	0.80824	-1.42	5.75	3.4	0.38934	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.175067	0.50627	D	0.000109	T	0.65080	0.2657	N	0.20401	0.57	0.80722	D	1	B	0.25206	0.12	B	0.33196	0.159	T	0.49504	-0.8933	10	0.08837	T	0.75	.	7.9945	0.30261	0.0:0.0709:0.1369:0.7922	.	448	Q99928	GBRG3_HUMAN	L	448	ENSP00000331912:F448L	ENSP00000331912:F448L	F	+	1	0	GABRG3	25451560	1.000000	0.71417	0.319000	0.25293	0.894000	0.52154	4.846000	0.62860	0.422000	0.26005	0.528000	0.53228	TTT		0.473	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			3	35	0	0	0	0.009096	0	3	35				
DPP8	54878	broad.mit.edu	37	15	65782569	65782569	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr15:65782569C>G	ENST00000341861.5	-	6	2412	c.832G>C	c.(832-834)Gat>Cat	p.D278H	DPP8_ENST00000300141.6_Missense_Mutation_p.D262H|DPP8_ENST00000559233.1_Missense_Mutation_p.D278H|DPP8_ENST00000358939.4_Missense_Mutation_p.D262H|DPP8_ENST00000339244.5_Missense_Mutation_p.D278H|DPP8_ENST00000321147.6_Missense_Mutation_p.D278H|DPP8_ENST00000321118.7_Missense_Mutation_p.D278H	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	278					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GAATATCTATCAAATTCTTCT	0.363																																							uc002aov.2		NA																	0				ovary(1)	1						c.(832-834)GAT>CAT		dipeptidyl peptidase 8 isoform 1							88.0	88.0	88.0					15																	65782569		2201	4299	6500	SO:0001583	missense	54878				immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr15:65782569C>G	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.832G>C	15.37:g.65782569C>G	ENSP00000339208:p.Asp278His		Somatic				DPP8_uc002aow.2_Missense_Mutation_p.D278H|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.D262H|DPP8_uc002aoy.2_Missense_Mutation_p.D278H|DPP8_uc002aoz.2_Missense_Mutation_p.D262H|DPP8_uc010bhj.2_Missense_Mutation_p.D278H|DPP8_uc002apa.2_Missense_Mutation_p.D175H|DPP8_uc010bhk.1_Missense_Mutation_p.D20H	p.D278H	NM_130434	NP_569118	WXS	Illumina HiSeq	Unspecified	Q6V1X1	DPP8_HUMAN			6	2410	-			278					Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	ENST00000341861.5	37	c.832G>C	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701913	0.88924	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244;ENST00000395652	T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.87	5.87	0.94306	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	M	0.84433	2.695	0.37820	D	0.928349	D;P;D;P;P	0.89917	1.0;0.943;1.0;0.943;0.954	D;P;D;P;P	0.87578	0.998;0.754;0.998;0.823;0.841	T	0.69669	-0.5083	10	0.72032	D	0.01	-21.3387	20.2119	0.98289	0.0:1.0:0.0:0.0	.	278;262;262;278;278	C9JSG1;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;DPP8_HUMAN	H	278;262;262;278;278;278;278	ENSP00000339208:D278H;ENSP00000351817:D262H;ENSP00000300141:D262H;ENSP00000318111:D278H;ENSP00000316373:D278H;ENSP00000341230:D278H;ENSP00000379013:D278H	ENSP00000300141:D262H	D	-	1	0	DPP8	63569622	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.951000	0.75983	2.784000	0.95788	0.585000	0.79938	GAT		0.363	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743		37	30	0	0	0	0.09836	0	37	30				
KIAA1024	23251	broad.mit.edu	37	15	79749274	79749274	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr15:79749274A>C	ENST00000305428.3	+	2	860	c.785A>C	c.(784-786)gAg>gCg	p.E262A		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	262						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						ATCTTCAAAGAGGATTTTCAC	0.498																																							uc002bew.1		NA																	0				pancreas(2)|ovary(1)|central_nervous_system(1)	4						c.(784-786)GAG>GCG		hypothetical protein LOC23251							74.0	84.0	80.0					15																	79749274		2196	4293	6489	SO:0001583	missense	23251					integral to membrane		g.chr15:79749274A>C	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.785A>C	15.37:g.79749274A>C	ENSP00000307461:p.Glu262Ala		Somatic				KIAA1024_uc010unk.1_Missense_Mutation_p.E262A	p.E262A	NM_015206	NP_056021	WXS	Illumina HiSeq	Unspecified	Q9UPX6	K1024_HUMAN			2	860	+			262					A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	c.785A>C	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174744	0.57692	.	.	ENSG00000169330	ENST00000305428	T	0.35236	1.32	5.29	5.29	0.74685	.	0.108891	0.64402	D	0.000006	T	0.33644	0.0870	M	0.65975	2.015	0.46586	D	0.999116	P	0.38922	0.651	B	0.27887	0.084	T	0.21280	-1.0250	9	.	.	.	.	15.2145	0.73254	1.0:0.0:0.0:0.0	.	262	Q9UPX6	K1024_HUMAN	A	262	ENSP00000307461:E262A	.	E	+	2	0	KIAA1024	77536329	1.000000	0.71417	0.998000	0.56505	0.793000	0.44817	8.476000	0.90421	1.986000	0.57962	0.482000	0.46254	GAG		0.498	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		14	74	0	0	0	0.020292	0	14	74				
SSTR5	6755	broad.mit.edu	37	16	1129350	1129350	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:1129350C>A	ENST00000293897.4	+	1	570	c.482C>A	c.(481-483)gCc>gAc	p.A161D	SSTR5_ENST00000562758.1_Missense_Mutation_p.A161D|SSTR5_ENST00000397547.2_Missense_Mutation_p.A161D|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	161					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CTGGCGAGCGCCGCGGCCTGG	0.711																																							uc002ckq.2		NA																	0				lung(1)	1						c.(481-483)GCC>GAC		somatostatin receptor 5	Octreotide(DB00104)						12.0	14.0	13.0					16																	1129350		2157	4184	6341	SO:0001583	missense	6755				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity	g.chr16:1129350C>A	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.482C>A	16.37:g.1129350C>A	ENSP00000293897:p.Ala161Asp		Somatic				LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	p.A161D	NM_001053	NP_001044	WXS	Illumina HiSeq	Unspecified	P35346	SSR5_HUMAN			1	570	+		Hepatocellular(780;0.00369)	161			Helical; Name=4; (Potential).		P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	ENST00000293897.4	37	c.482C>A	CCDS10429.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301012	0.40694	.	.	ENSG00000162009	ENST00000397547;ENST00000293897;ENST00000539762	T;T	0.42513	0.97;0.97	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.342039	0.29791	N	0.011195	T	0.69223	0.3087	M	0.93854	3.465	0.39327	D	0.965344	D	0.54207	0.965	P	0.61477	0.889	T	0.78362	-0.2233	10	0.66056	D	0.02	.	12.5321	0.56122	0.0:0.9158:0.0:0.0842	.	161	P35346	SSR5_HUMAN	D	161	ENSP00000380680:A161D;ENSP00000293897:A161D	ENSP00000293897:A161D	A	+	2	0	SSTR5	1069351	0.002000	0.14202	0.759000	0.31340	0.408000	0.30992	0.160000	0.16462	2.260000	0.74910	0.561000	0.74099	GCC		0.711	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1			4	14	1	0	0.000602214	0.014758	0.000641489	4	14				
PKD1	5310	broad.mit.edu	37	16	2161139	2161139	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:2161139C>A	ENST00000262304.4	-	15	4237	c.4029G>T	c.(4027-4029)ccG>ccT	p.P1343P	PKD1_ENST00000423118.1_Silent_p.P1343P|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1343	PKD 8. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTGTCACCGTCGGGCACCCCC	0.672																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(4027-4029)CCG>CCT		polycystin 1 isoform 1 precursor							30.0	32.0	31.0					16																	2161139		2190	4292	6482	SO:0001819	synonymous_variant	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2161139C>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.4029G>T	16.37:g.2161139C>A			Somatic				PKD1_uc002cot.1_Silent_p.P1343P	p.P1343P	NM_001009944	NP_001009944	WXS	Illumina HiSeq	Unspecified	P98161	PKD1_HUMAN			15	4238	-			1343			PKD 8.|Extracellular (Potential).		Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	c.4029G>T	CCDS32369.1																																																																																				0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			13	22	1	0	4.3838e-07	0.105934	5.01884e-07	13	22				
MYH11	4629	broad.mit.edu	37	16	15815294	15815294	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:15815294A>G	ENST00000300036.5	-	32	4672	c.4563T>C	c.(4561-4563)gaT>gaC	p.D1521D	NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron|MYH11_ENST00000396324.3_Silent_p.D1528D|MYH11_ENST00000452625.2_Silent_p.D1528D|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000576790.2_Silent_p.D1521D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1521					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TGCCCACGTCATCCTTGGAGC	0.557			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		0				ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(4561-4563)GAT>GAC		smooth muscle myosin heavy chain 11 isoform							130.0	103.0	112.0					16																	15815294		2197	4300	6497	SO:0001819	synonymous_variant	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15815294A>G	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.4563T>C	16.37:g.15815294A>G			Somatic				MYH11_uc002ddv.2_Silent_p.D1528D|MYH11_uc002ddw.2_Silent_p.D1521D|MYH11_uc002ddx.2_Silent_p.D1528D|MYH11_uc010bvg.2_Silent_p.D1353D|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Silent_p.D227D|NDE1_uc002ddz.1_5'Flank	p.D1521D	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			32	4670	-			1521			Potential.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	c.4563T>C	CCDS10565.1																																																																																				0.557	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		30	60	0	0	0	0.054565	0	30	60				
LONP2	83752	broad.mit.edu	37	16	48295479	48295479	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:48295479T>C	ENST00000285737.4	+	5	961	c.868T>C	c.(868-870)Tgt>Cgt	p.C290R	LONP2_ENST00000535754.1_Missense_Mutation_p.C246R	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCATAAAGTCTGTGTCAAAGA	0.338																																							uc002efi.1		NA																	0					0						c.(868-870)TGT>CGT		peroxisomal LON protease-like							99.0	99.0	99.0					16																	48295479		2200	4299	6499	SO:0001583	missense	83752				misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity	g.chr16:48295479T>C	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.868T>C	16.37:g.48295479T>C	ENSP00000285737:p.Cys290Arg		Somatic				LONP2_uc010vgm.1_RNA|LONP2_uc002efj.1_Missense_Mutation_p.C246R	p.C290R	NM_031490	NP_113678	WXS	Illumina HiSeq	Unspecified	Q86WA8	LONP2_HUMAN			5	957	+			290						Missense_Mutation	SNP	ENST00000285737.4	37	c.868T>C	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725045	0.68959	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T	0.29917	1.55;1.55	5.88	5.88	0.94601	.	0.226661	0.56097	D	0.000039	T	0.41396	0.1157	M	0.77820	2.39	0.80722	D	1	D;D	0.56035	0.974;0.974	B;B	0.43331	0.416;0.416	T	0.50725	-0.8794	10	0.87932	D	0	-12.9859	16.2898	0.82742	0.0:0.0:0.0:1.0	.	246;290	B7ZKL7;Q86WA8	.;LONP2_HUMAN	R	290;19;246;246	ENSP00000285737:C290R;ENSP00000445426:C246R	ENSP00000285737:C290R	C	+	1	0	LONP2	46852980	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.126000	0.64721	2.250000	0.74265	0.482000	0.46254	TGT		0.338	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490		52	25	0	0	0	0.048971	0	52	25				
NFAT5	10725	broad.mit.edu	37	16	69726354	69726354	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:69726354G>C	ENST00000354436.2	+	12	2890	c.2572G>C	c.(2572-2574)Gat>Cat	p.D858H	NFAT5_ENST00000393742.2_Missense_Mutation_p.D782H|NFAT5_ENST00000349945.1_Missense_Mutation_p.D782H|NFAT5_ENST00000567239.1_Missense_Mutation_p.D875H|NFAT5_ENST00000566899.1_Missense_Mutation_p.D782H|NFAT5_ENST00000432919.1_Missense_Mutation_p.D876H	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	858					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TACCAGACCAGATAATTTATT	0.433																																							uc002exm.1		NA																	0					0						c.(2572-2574)GAT>CAT		nuclear factor of activated T-cells 5 isoform c							85.0	86.0	86.0					16																	69726354		2198	4300	6498	SO:0001583	missense	10725				excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:69726354G>C	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2572G>C	16.37:g.69726354G>C	ENSP00000346420:p.Asp858His		Somatic				NFAT5_uc002exi.2_Missense_Mutation_p.D782H|NFAT5_uc002exj.1_Missense_Mutation_p.D782H|NFAT5_uc002exk.1_Missense_Mutation_p.D782H|NFAT5_uc002exl.1_Missense_Mutation_p.D876H|NFAT5_uc002exn.1_Missense_Mutation_p.D875H|NFAT5_uc002exo.1_5'Flank	p.D858H	NM_006599	NP_006590	WXS	Illumina HiSeq	Unspecified	O94916	NFAT5_HUMAN			12	3780	+			858					A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	c.2572G>C	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102023	0.56183	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.51071	0.75;0.72;0.75;0.72	5.69	5.69	0.88448	.	0.144210	0.47093	D	0.000241	T	0.44850	0.1313	N	0.22421	0.69	0.50171	D	0.999853	P;P;P	0.47409	0.895;0.895;0.895	P;P;P	0.45946	0.498;0.498;0.498	T	0.43410	-0.9393	10	0.59425	D	0.04	-3.8246	20.181	0.98201	0.0:0.0:1.0:0.0	.	875;858;876	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	H	876;875;782;858;782	ENSP00000396538:D876H;ENSP00000338806:D782H;ENSP00000346420:D858H;ENSP00000377343:D782H	ENSP00000338806:D782H	D	+	1	0	NFAT5	68283855	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.205000	0.77881	2.840000	0.97914	0.655000	0.94253	GAT		0.433	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714		63	46	0	0	0	0.048971	0	63	46				
JPH3	57338	broad.mit.edu	37	16	87678279	87678279	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr16:87678279G>T	ENST00000284262.2	+	2	1040	c.798G>T	c.(796-798)ctG>ctT	p.L266L		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	266					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CCATCAGCCTGGGCGAGGCTG	0.662																																							uc002fkd.2		NA																	0				ovary(1)|pancreas(1)	2						c.(796-798)CTG>CTT		junctophilin 3							74.0	67.0	69.0					16																	87678279		2198	4299	6497	SO:0001819	synonymous_variant	57338				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	g.chr16:87678279G>T	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.798G>T	16.37:g.87678279G>T			Somatic				JPH3_uc010vou.1_RNA	p.L266L	NM_020655	NP_065706	WXS	Illumina HiSeq	Unspecified	Q8WXH2	JPH3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0287)	2	1052	+			266			Cytoplasmic (Potential).		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	ENST00000284262.2	37	c.798G>T	CCDS10962.1																																																																																				0.662	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			5	65	1	0	0.00116845	0.021553	0.00123926	5	65				
TP53	7157	broad.mit.edu	37	17	7578275	7578275	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:7578275G>A	ENST00000269305.4	-	6	763	c.574C>T	c.(574-576)Cag>Tag	p.Q192*	TP53_ENST00000445888.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q192*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	192	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		144	Substitution - Nonsense(95)|Deletion - In frame(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(6)|Unknown(6)|Insertion - Frameshift(1)|Complex - frameshift(1)|Substitution - Missense(1)	p.Q192*(64)|p.0?(7)|p.Q192R(5)|p.A189_V197delAPPQHLIRV(4)|p.Q192H(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.Q192Q(2)|p.P191del(2)|p.K164_P219del(1)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192>XXXXXXXXX(1)|p.Q192K(1)|p.A189fs*53(1)|p.Q192fs*56(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)	breast(26)|ovary(20)|urinary_tract(15)|lung(12)|upper_aerodigestive_tract(10)|skin(8)|biliary_tract(7)|oesophagus(7)|large_intestine(6)|kidney(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(574-576)CAG>TAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							89.0	80.0	83.0					17																	7578275		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578275G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.574C>T	17.37:g.7578275G>A	ENSP00000269305:p.Gln192*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.Q192*|TP53_uc002gih.2_Nonsense_Mutation_p.Q192*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.Q60*|TP53_uc010cng.1_Nonsense_Mutation_p.Q60*|TP53_uc002gii.1_Nonsense_Mutation_p.Q60*|TP53_uc010cnh.1_Nonsense_Mutation_p.Q192*|TP53_uc010cni.1_Nonsense_Mutation_p.Q192*|TP53_uc002gij.2_Nonsense_Mutation_p.Q192*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.Q99*|TP53_uc002gio.2_Nonsense_Mutation_p.Q60*|TP53_uc010vug.1_Nonsense_Mutation_p.Q153*	p.Q192*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	768	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	192		Q -> P (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.574C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269040	0.40095	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	3.36	0.38483	.	0.242461	0.43260	D	0.000594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.6404	8.6971	0.34303	0.0:0.1484:0.545:0.3066	.	.	.	.	X	192;192;192;192;192;192;181;99;60;99;60	.	ENSP00000269305:Q192X	Q	-	1	0	TP53	7519000	1.000000	0.71417	0.987000	0.45799	0.035000	0.12851	2.163000	0.42377	0.732000	0.32470	0.655000	0.94253	CAG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		22	23	0	0	0	0.069288	0	22	23				
MYH2	4620	broad.mit.edu	37	17	10443940	10443940	+	Missense_Mutation	SNP	C	C	A	rs200893594		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:10443940C>A	ENST00000245503.5	-	11	1363	c.979G>T	c.(979-981)Gat>Tat	p.D327Y	MYH2_ENST00000532183.2_Missense_Mutation_p.D327Y|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.D327Y	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	327	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TCCTGATCATCGATGCTGGCC	0.403																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(979-981)GAT>TAT		myosin heavy chain IIa							111.0	97.0	101.0					17																	10443940		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10443940C>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.979G>T	17.37:g.10443940C>A	ENSP00000245503:p.Asp327Tyr		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.D327Y|MYH2_uc010coj.2_Missense_Mutation_p.D327Y	p.D327Y	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			11	1107	-			327			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.979G>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.590917	0.66219	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.91843	-2.92;-2.92;-2.92	4.95	2.96	0.34315	Myosin head, motor domain (2);	0.175886	0.26816	U	0.022352	D	0.97601	0.9214	H	0.99815	4.805	0.44175	D	0.996989	P;D	0.76494	0.955;0.999	P;D	0.79108	0.81;0.992	D	0.96052	0.9032	10	0.87932	D	0	.	7.717	0.28710	0.0:0.751:0.0:0.249	.	327;327	Q567P6;Q9UKX2	.;MYH2_HUMAN	Y	327	ENSP00000433944:D327Y;ENSP00000245503:D327Y;ENSP00000380367:D327Y	ENSP00000245503:D327Y	D	-	1	0	MYH2	10384665	0.173000	0.23056	1.000000	0.80357	0.990000	0.78478	0.080000	0.14802	1.449000	0.47699	0.650000	0.86243	GAT		0.403	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		29	16	1	0	1.39806e-14	0.037714	1.82193e-14	29	16				
SLFN11	91607	broad.mit.edu	37	17	33679953	33679953	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:33679953A>C	ENST00000394566.1	-	7	2400	c.2128T>G	c.(2128-2130)Ttg>Gtg	p.L710V	SLFN11_ENST00000308377.4_Missense_Mutation_p.L710V	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	710					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGCAATCCAAGTGGCTGGTC	0.483																																							uc010ctp.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2128-2130)TTG>GTG		schlafen family member 11							115.0	120.0	118.0					17																	33679953		2203	4300	6503	SO:0001583	missense	91607					nucleus	ATP binding	g.chr17:33679953A>C	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2128T>G	17.37:g.33679953A>C	ENSP00000378067:p.Leu710Val		Somatic				SLFN11_uc010ctq.2_Missense_Mutation_p.L710V|SLFN11_uc002hjh.3_Missense_Mutation_p.L710V|SLFN11_uc002hjg.3_Missense_Mutation_p.L710V|SLFN11_uc010ctr.2_Missense_Mutation_p.L710V	p.L710V	NM_001104588	NP_001098058	WXS	Illumina HiSeq	Unspecified	Q7Z7L1	SLN11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	7	2570	-		Ovarian(249;0.17)	710					E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	37	c.2128T>G	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	a	13.67	2.307262	0.40795	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	D;D	0.86497	-2.13;-2.13	4.0	-6.08	0.02151	.	2.275240	0.02266	N	0.067974	D	0.84745	0.5540	M	0.82323	2.585	0.18873	N	0.999987	B	0.31351	0.32	B	0.34138	0.176	T	0.66830	-0.5824	10	0.25751	T	0.34	.	2.3704	0.04329	0.2151:0.1407:0.0939:0.5503	.	710	Q7Z7L1	SLN11_HUMAN	V	710	ENSP00000312402:L710V;ENSP00000378067:L710V	ENSP00000312402:L710V	L	-	1	2	SLFN11	30704066	0.000000	0.05858	0.484000	0.27391	0.828000	0.46876	-7.692000	0.00031	-0.955000	0.03636	0.533000	0.62120	TTG		0.483	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270		25	134	0	0	0	0.083992	0	25	134				
KCNH6	81033	broad.mit.edu	37	17	61611300	61611300	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:61611300C>T	ENST00000583023.1	+	5	740	c.729C>T	c.(727-729)cgC>cgT	p.R243R	KCNH6_ENST00000456941.2_Silent_p.R243R|KCNH6_ENST00000581784.1_Silent_p.R243R|KCNH6_ENST00000580652.1_Silent_p.R243R|KCNH6_ENST00000314672.5_Silent_p.R243R	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	243					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGGCGCCGCGCATCCACCGCT	0.672																																							uc002jay.2		NA																	0				skin(1)	1						c.(727-729)CGC>CGT		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						121.0	100.0	107.0					17																	61611300		2203	4300	6503	SO:0001819	synonymous_variant	81033				regulation of transcription, DNA-dependent|signal transduction			g.chr17:61611300C>T	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.729C>T	17.37:g.61611300C>T			Somatic				KCNH6_uc002jax.1_Silent_p.R243R|KCNH6_uc010wpl.1_Silent_p.R120R|KCNH6_uc010wpm.1_Silent_p.R243R|KCNH6_uc002jaz.1_Silent_p.R243R	p.R243R	NM_030779	NP_110406	WXS	Illumina HiSeq	Unspecified	Q9H252	KCNH6_HUMAN			5	809	+			243			Cytoplasmic (Potential).		Q9BRD7	Silent	SNP	ENST00000583023.1	37	c.729C>T	CCDS11638.1																																																																																				0.672	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779		61	47	0	0	0	0.048971	0	61	47				
MYOM1	8736	broad.mit.edu	37	18	3067414	3067414	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:3067414C>A	ENST00000356443.4	-	38	5237	c.4904G>T	c.(4903-4905)gGc>gTc	p.G1635V	MYOM1_ENST00000400569.3_Missense_Mutation_p.G1635V|MYOM1_ENST00000261606.7_Missense_Mutation_p.G1539V	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1635	Ig-like C2-type 5.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GGTGCTCACGCCGTTGATGGT	0.592																																							uc002klp.2		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(4903-4905)GGC>GTC		myomesin 1 isoform a							75.0	78.0	77.0					18																	3067414		2203	4300	6503	SO:0001583	missense	8736					striated muscle myosin thick filament	structural constituent of muscle	g.chr18:3067414C>A	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4904G>T	18.37:g.3067414C>A	ENSP00000348821:p.Gly1635Val		Somatic				MYOM1_uc002klq.2_Missense_Mutation_p.G1539V	p.G1635V	NM_003803	NP_003794	WXS	Illumina HiSeq	Unspecified	P52179	MYOM1_HUMAN			38	5238	-			1635			Ig-like C2-type 5.		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	c.4904G>T	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648638	0.29336	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.43294	0.95;0.95;0.95	5.79	2.82	0.32997	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.628294	0.16609	N	0.206983	T	0.49287	0.1548	M	0.76170	2.325	0.23277	N	0.997995	D;D	0.59357	0.966;0.985	P;P	0.50162	0.633;0.605	T	0.38156	-0.9674	10	0.39692	T	0.17	.	9.7107	0.40243	0.0:0.5492:0.3591:0.0917	.	1539;1635	P52179-2;P52179	.;MYOM1_HUMAN	V	1635;1635;1539	ENSP00000348821:G1635V;ENSP00000383413:G1635V;ENSP00000261606:G1539V	ENSP00000261606:G1539V	G	-	2	0	MYOM1	3057414	0.000000	0.05858	0.051000	0.19133	0.047000	0.14425	0.213000	0.17521	0.713000	0.32060	-0.345000	0.07892	GGC		0.592	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		3	54	1	0	0.00909568	0.009096	0.00952325	3	54				
LAMA1	284217	broad.mit.edu	37	18	7002306	7002306	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:7002306T>A	ENST00000389658.3	-	30	4432	c.4339A>T	c.(4339-4341)Agt>Tgt	p.S1447C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1447	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCACAGTCACTTGCTGAGCCA	0.577																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(4339-4341)AGT>TGT		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						185.0	141.0	156.0					18																	7002306		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7002306T>A	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4339A>T	18.37:g.7002306T>A	ENSP00000374309:p.Ser1447Cys		Somatic				LAMA1_uc010wzj.1_Missense_Mutation_p.S923C	p.S1447C	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			30	4433	-		Colorectal(10;0.172)	1447			Laminin EGF-like 15.			Missense_Mutation	SNP	ENST00000389658.3	37	c.4339A>T	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.465122	0.43839	.	.	ENSG00000101680	ENST00000389658	T	0.62364	0.03	6.17	-8.49	0.00931	EGF-like, laminin (4);	1.211220	0.05524	N	0.562703	T	0.68293	0.2985	M	0.64997	1.995	0.09310	N	1	D	0.57571	0.98	P	0.56343	0.796	T	0.73219	-0.4052	10	0.72032	D	0.01	.	13.2146	0.59851	0.0:0.5524:0.1113:0.3363	.	1447	P25391	LAMA1_HUMAN	C	1447	ENSP00000374309:S1447C	ENSP00000374309:S1447C	S	-	1	0	LAMA1	6992306	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.140000	0.10342	-1.406000	0.02045	-0.899000	0.02877	AGT		0.577	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		12	68	0	0	0	0.09319	0	12	68				
LAMA3	3909	broad.mit.edu	37	18	21481106	21481106	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:21481106G>A	ENST00000313654.9	+	48	6261	c.6020G>A	c.(6019-6021)aGg>aAg	p.R2007K	LAMA3_ENST00000269217.6_Missense_Mutation_p.R398K|LAMA3_ENST00000587184.1_Missense_Mutation_p.R342K|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000399516.3_Missense_Mutation_p.R1951K	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2007	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AACCGGATAAGGACCTGGCAG	0.438																																							uc002kuq.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(6019-6021)AGG>AAG		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						63.0	64.0	64.0					18																	21481106		2203	4300	6503	SO:0001583	missense	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21481106G>A	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6020G>A	18.37:g.21481106G>A	ENSP00000324532:p.Arg2007Lys		Somatic				LAMA3_uc002kur.2_Missense_Mutation_p.R1951K|LAMA3_uc002kus.3_Missense_Mutation_p.R398K|LAMA3_uc002kut.3_Missense_Mutation_p.R342K	p.R2007K	NM_198129	NP_937762	WXS	Illumina HiSeq	Unspecified	Q16787	LAMA3_HUMAN			48	6106	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		2007			Domain II and I.|Potential.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	c.6020G>A	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.541608	0.00934	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.77877	2.93;-1.13;2.93	5.61	0.791	0.18619	Laminin I (1);	.	.	.	.	T	0.58694	0.2140	N	0.25890	0.77	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.002;0.003;0.003	T	0.39722	-0.9600	9	0.02654	T	1	.	9.2242	0.37395	0.5664:0.0:0.4336:0.0	.	342;398;1951;2007	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	K	2007;1951;398	ENSP00000324532:R2007K;ENSP00000382432:R1951K;ENSP00000269217:R398K	ENSP00000269217:R398K	R	+	2	0	LAMA3	19735104	0.131000	0.22433	0.137000	0.22149	0.167000	0.22549	0.231000	0.17872	0.139000	0.18822	-0.137000	0.14449	AGG		0.438	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		11	29	0	0	0	0.020292	0	11	29				
CCDC178	374864	broad.mit.edu	37	18	30554619	30554619	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:30554619G>T	ENST00000383096.3	-	22	2597	c.2415C>A	c.(2413-2415)caC>caA	p.H805Q	CCDC178_ENST00000403303.1_Missense_Mutation_p.H805Q|CCDC178_ENST00000579947.1_Missense_Mutation_p.H805Q|CCDC178_ENST00000402325.1_Missense_Mutation_p.H755Q|CCDC178_ENST00000300227.8_Missense_Mutation_p.H767Q|CCDC178_ENST00000581852.1_Missense_Mutation_p.H10Q|CCDC178_ENST00000406524.2_Missense_Mutation_p.H829Q|CCDC178_ENST00000583930.1_Missense_Mutation_p.H829Q|CCDC178_ENST00000579916.1_Missense_Mutation_p.H125Q			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	805																	GCCACAGTGTGTGCATCCTTC	0.483																																							uc002kxn.2		NA																	0				ovary(1)	1						c.(2413-2415)CAC>CAA		hypothetical protein LOC374864 isoform 1							54.0	48.0	50.0					18																	30554619		2203	4300	6503	SO:0001583	missense	374864							g.chr18:30554619G>T	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.2415C>A	18.37:g.30554619G>T	ENSP00000372576:p.His805Gln		Somatic				C18orf34_uc010xbq.1_RNA|C18orf34_uc010dme.1_Missense_Mutation_p.H269Q|C18orf34_uc010xbr.1_Missense_Mutation_p.H829Q|C18orf34_uc010dmf.1_Missense_Mutation_p.H125Q|C18orf34_uc002kxo.2_Missense_Mutation_p.H767Q|C18orf34_uc002kxp.2_Missense_Mutation_p.H805Q	p.H805Q	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			21	2557	-			805					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.2415C>A	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	G	1.316	-0.600755	0.03744	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.17691	2.26;2.26;2.3;2.3;2.28	5.5	0.931	0.19460	.	.	.	.	.	T	0.09555	0.0235	L	0.40543	1.245	0.21675	N	0.999592	B;P;B;B;B;B	0.38335	0.395;0.627;0.22;0.395;0.395;0.395	B;B;B;B;B;B	0.32090	0.068;0.14;0.068;0.068;0.068;0.068	T	0.25606	-1.0127	9	0.09590	T	0.72	-0.2469	5.6537	0.17631	0.1432:0.1132:0.6276:0.116	.	829;805;755;805;767;805	F8W7A7;A1L4G8;Q5BJE1-3;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;.;CR034_HUMAN	Q	805;805;767;829;755	ENSP00000385591:H805Q;ENSP00000372576:H805Q;ENSP00000300227:H767Q;ENSP00000385867:H829Q;ENSP00000385234:H755Q	ENSP00000300227:H767Q	H	-	3	2	C18orf34	28808617	0.998000	0.40836	0.107000	0.21349	0.184000	0.23303	1.750000	0.38329	0.242000	0.21303	-0.251000	0.11542	CAC		0.483	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		13	13	1	0	0.000219431	0.020292	0.000238936	13	13				
MYO5B	4645	broad.mit.edu	37	18	47462712	47462712	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:47462712G>C	ENST00000285039.7	-	16	2212	c.1913C>G	c.(1912-1914)aCc>aGc	p.T638S		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	638	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		ATGCAGGGAGGTACGGAACTA	0.473																																							uc002leb.2		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(1912-1914)ACC>AGC		myosin VB							86.0	88.0	87.0					18																	47462712		2047	4219	6266	SO:0001583	missense	4645				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr18:47462712G>C	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1913C>G	18.37:g.47462712G>C	ENSP00000285039:p.Thr638Ser		Somatic				MYO5B_uc002lec.1_Missense_Mutation_p.T637S	p.T638S	NM_001080467	NP_001073936	WXS	Illumina HiSeq	Unspecified	Q9ULV0	MYO5B_HUMAN		READ - Rectum adenocarcinoma(32;0.103)	16	2201	-			638			Myosin head-like.		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	c.1913C>G	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	G	6.396	0.441156	0.12164	.	.	ENSG00000167306	ENST00000285039	D	0.94966	-3.57	5.51	3.64	0.41730	Myosin head, motor domain (2);	0.353112	0.32134	N	0.006526	T	0.82208	0.4987	N	0.03084	-0.415	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.001	T	0.72590	-0.4247	10	0.05833	T	0.94	.	8.7541	0.34635	0.0:0.1381:0.4444:0.4174	.	637;638	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	S	638	ENSP00000285039:T638S	ENSP00000285039:T638S	T	-	2	0	MYO5B	45716710	1.000000	0.71417	0.995000	0.50966	0.959000	0.62525	1.416000	0.34759	0.612000	0.30071	0.555000	0.69702	ACC		0.473	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			2	14	0	0	0	0.004672	0	2	14				
ALPK2	115701	broad.mit.edu	37	18	56202748	56202748	+	Silent	SNP	C	C	T	rs561304855		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:56202748C>T	ENST00000361673.3	-	5	4884	c.4671G>A	c.(4669-4671)acG>acA	p.T1557T	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1557						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGGAGTTGTGCGTGTCAACCC	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		20855	0.001		0.0	False		,,,				2504	0.0						uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(4669-4671)ACG>ACA		heart alpha-kinase							123.0	118.0	119.0					18																	56202748		2203	4300	6503	SO:0001819	synonymous_variant	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56202748C>T	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4671G>A	18.37:g.56202748C>T			Somatic				ALPK2_uc002lhk.1_Silent_p.T888T	p.T1557T	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			5	4885	-			1557					Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	c.4671G>A	CCDS11966.2																																																																																				0.448	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		52	32	0	0	0	0.048971	0	52	32				
NETO1	81832	broad.mit.edu	37	18	70423324	70423324	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr18:70423324C>G	ENST00000327305.6	-	8	1584	c.927G>C	c.(925-927)ttG>ttC	p.L309F	NETO1_ENST00000299430.2_Missense_Mutation_p.L308F|NETO1_ENST00000583169.1_Missense_Mutation_p.L309F	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	309	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CATTGCAGACCAAAGTATTAT	0.368																																							uc002lkw.2		NA																	0				ovary(2)|skin(2)	4						c.(925-927)TTG>TTC		neuropilin- and tolloid-like protein 1 isoform 3							114.0	110.0	111.0					18																	70423324		2203	4300	6503	SO:0001583	missense	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70423324C>G	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.927G>C	18.37:g.70423324C>G	ENSP00000313088:p.Leu309Phe		Somatic				NETO1_uc002lkx.1_Missense_Mutation_p.L308F|NETO1_uc002lky.1_Missense_Mutation_p.L309F	p.L309F	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	8	1211	-		Esophageal squamous(42;0.129)	309			LDL-receptor class A.|Extracellular (Potential).		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	c.927G>C	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596304	0.66332	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	D;D	0.95853	-3.83;-3.83	5.41	4.53	0.55603	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.42964	D	0.000639	D	0.96605	0.8892	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.96238	0.9173	10	0.59425	D	0.04	-24.6655	9.9753	0.41779	0.1381:0.7881:0.0:0.0739	.	308;309	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	F	309;308	ENSP00000313088:L309F;ENSP00000299430:L308F	ENSP00000299430:L308F	L	-	3	2	NETO1	68574304	0.976000	0.34144	0.990000	0.47175	0.866000	0.49608	0.252000	0.18278	1.400000	0.46741	0.655000	0.94253	TTG		0.368	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		27	36	0	0	0	0.037714	0	27	36				
STK11	6794	broad.mit.edu	37	19	1221211	1221211	+	Splice_Site	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:1221211G>T	ENST00000326873.7	+	6	1907		c.e6-1			NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11						activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGAAATGAAGCTACAACATC	0.587		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(3)	p.0?(19)|p.?(3)	cervix(14)|lung(5)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CS012226	STK11	S		c.e6-1		serine/threonine protein kinase 11							61.0	64.0	63.0					19																	1221211		2008	4165	6173	SO:0001630	splice_region_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221211G>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.735-1G>T	19.37:g.1221211G>T		TSP Lung(3;<1E-08)	Somatic					p.L245_splice	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1850	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)						B2RBX7|E7EW76	Splice_Site	SNP	ENST00000326873.7	37	c.735_splice	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960208	0.74016	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4287	0.83833	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK11	1172211	1.000000	0.71417	0.983000	0.44433	0.757000	0.42996	9.492000	0.97957	2.355000	0.79922	0.561000	0.74099	.		0.587	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	Intron	9	10	1	0	6.42651e-13	0.080935	8.15801e-13	9	10				
MUC16	94025	broad.mit.edu	37	19	9085453	9085453	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:9085453A>C	ENST00000397910.4	-	1	6565	c.6362T>G	c.(6361-6363)tTg>tGg	p.L2121W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2121	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATCAGTGTTCAAAGTACTCGC	0.483																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(6361-6363)TTG>TGG		mucin 16							122.0	118.0	119.0					19																	9085453		1920	4132	6052	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9085453A>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6362T>G	19.37:g.9085453A>C	ENSP00000381008:p.Leu2121Trp		Somatic					p.L2121W	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	6566	-			2121			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.6362T>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	1.689	-0.504602	0.04261	.	.	ENSG00000181143	ENST00000397910	T	0.03301	3.98	0.235	0.235	0.15431	.	.	.	.	.	T	0.05410	0.0143	N	0.08118	0	.	.	.	D	0.71674	0.998	D	0.69824	0.966	T	0.41270	-0.9518	7	0.87932	D	0	.	.	.	.	.	2121	B5ME49	.	W	2121	ENSP00000381008:L2121W	ENSP00000381008:L2121W	L	-	2	0	MUC16	8946453	0.011000	0.17503	0.113000	0.21522	0.114000	0.19823	-0.036000	0.12185	0.263000	0.21812	0.260000	0.18958	TTG		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		76	51	0	0	0	0.048971	0	76	51				
HAUS8	93323	broad.mit.edu	37	19	17170437	17170437	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:17170437G>T	ENST00000253669.5	-	6	540	c.350C>A	c.(349-351)cCa>cAa	p.P117Q	HAUS8_ENST00000593360.1_Missense_Mutation_p.P56Q|HAUS8_ENST00000448593.2_Missense_Mutation_p.P116Q			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	117					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						TGCTAACTGTGGCGTCTTTTT	0.413																																							uc002nfe.2		NA																	0					0						c.(349-351)CCA>CAA		sarcoma antigen NY-SAR-48 isoform a							157.0	151.0	153.0					19																	17170437		2203	4300	6503	SO:0001583	missense	93323				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole		g.chr19:17170437G>T	BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.350C>A	19.37:g.17170437G>T	ENSP00000253669:p.Pro117Gln		Somatic				HAUS8_uc002nff.2_Missense_Mutation_p.P116Q|HAUS8_uc002nfg.1_Missense_Mutation_p.P56Q|HAUS8_uc002nfh.1_Missense_Mutation_p.P117Q	p.P117Q	NM_033417	NP_219485	WXS	Illumina HiSeq	Unspecified	Q9BT25	HAUS8_HUMAN			6	461	-			117					B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Missense_Mutation	SNP	ENST00000253669.5	37	c.350C>A	CCDS32948.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974520	0.34848	.	.	ENSG00000131351	ENST00000253669;ENST00000448593	T;T	0.53423	0.62;0.64	2.92	0.743	0.18347	.	0.854982	0.10240	N	0.698569	T	0.60104	0.2243	M	0.63843	1.955	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.44907	-0.9297	10	0.66056	D	0.02	-8.0495	4.8883	0.13713	0.2979:0.0:0.7021:0.0	.	56;116;117	Q9BT25-2;C9JBZ4;Q9BT25	.;.;HAUS8_HUMAN	Q	117;116	ENSP00000253669:P117Q;ENSP00000395298:P116Q	ENSP00000253669:P117Q	P	-	2	0	HAUS8	17031437	0.984000	0.35163	0.031000	0.17742	0.015000	0.08874	1.764000	0.38471	0.285000	0.22329	0.462000	0.41574	CCA		0.413	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463015.1	NM_001011699		21	25	1	0	2.4624e-09	0.049695	2.90042e-09	21	25				
LRFN3	79414	broad.mit.edu	37	19	36430384	36430384	+	Silent	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:36430384A>C	ENST00000588831.1	+	3	1111	c.57A>C	c.(55-57)ccA>ccC	p.P19P	LRFN3_ENST00000246529.3_Silent_p.P19P			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	19	LRRNT.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCTCATCCCCACCCCAGTCAG	0.711																																							uc002oco.2		NA																	0					0						c.(55-57)CCA>CCC		leucine rich repeat and fibronectin type III							23.0	27.0	26.0					19																	36430384		2127	4172	6299	SO:0001819	synonymous_variant	79414				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane		g.chr19:36430384A>C	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.57A>C	19.37:g.36430384A>C			Somatic					p.P19P	NM_024509	NP_078785	WXS	Illumina HiSeq	Unspecified	Q9BTN0	LRFN3_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		2	509	+	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		19			Extracellular (Potential).|LRRNT.		Q6UY10	Silent	SNP	ENST00000588831.1	37	c.57A>C	CCDS12483.1																																																																																				0.711	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2	NM_024509		4	51	0	0	0	0.047766	0	4	51				
FCGBP	8857	broad.mit.edu	37	19	40367841	40367841	+	Silent	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:40367841T>G	ENST00000221347.6	-	29	13126	c.13119A>C	c.(13117-13119)gcA>gcC	p.A4373A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4373	TIL 10.					extracellular vesicular exosome (GO:0070062)		p.A4373A(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCGTAAGGGGTGCAGGGGACG	0.627																																							uc002omp.3		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(13117-13119)GCA>GCC		Fc fragment of IgG binding protein precursor							17.0	32.0	27.0					19																	40367841		2132	4018	6150	SO:0001819	synonymous_variant	8857					extracellular region	protein binding	g.chr19:40367841T>G	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13119A>C	19.37:g.40367841T>G			Somatic					p.A4373A	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		29	13127	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		4373			TIL 10.		O95784	Silent	SNP	ENST00000221347.6	37	c.13119A>C	CCDS12546.1																																																																																				0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		10	15	0	0	0	0.043863	0	10	15				
C19orf54	284325	broad.mit.edu	37	19	41248552	41248552	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:41248552G>A	ENST00000378313.2	-	6	961	c.842C>T	c.(841-843)tCc>tTc	p.S281F	C19orf54_ENST00000339153.3_Missense_Mutation_p.S109F|C19orf54_ENST00000598729.1_Missense_Mutation_p.S109F|C19orf54_ENST00000470681.1_3'UTR|C19orf54_ENST00000594163.1_5'Flank|C19orf54_ENST00000598485.2_Intron	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	281										breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGCTCCCGGGGAGCCCTCCTC	0.652																																							uc002oou.1		NA																	0					0						c.(841-843)TCC>TTC		hypothetical protein LOC284325							34.0	32.0	33.0					19																	41248552		2203	4299	6502	SO:0001583	missense	284325							g.chr19:41248552G>A	AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.842C>T	19.37:g.41248552G>A	ENSP00000367564:p.Ser281Phe		Somatic				C19orf54_uc002oow.1_Missense_Mutation_p.S109F|C19orf54_uc002oox.1_RNA|C19orf54_uc002ooy.1_Intron|C19orf54_uc010xvs.1_RNA	p.S281F	NM_198476	NP_940878	WXS	Illumina HiSeq	Unspecified	Q5BKX5	CS054_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		6	962	-			281					A8MSZ5|B4DNU7	Missense_Mutation	SNP	ENST00000378313.2	37	c.842C>T	CCDS12564.2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371778	0.82573	.	.	ENSG00000188493	ENST00000378313;ENST00000339153	.	.	.	5.48	0.72	0.18214	.	0.594286	0.17082	N	0.187736	T	0.35682	0.0940	L	0.60455	1.87	0.09310	N	1	D;D	0.53312	0.958;0.959	P;P	0.48141	0.568;0.52	T	0.20571	-1.0271	9	0.66056	D	0.02	-6.0859	5.1067	0.14787	0.2373:0.2842:0.4785:0.0	.	109;281	Q5BKX5-3;Q5BKX5	.;CS054_HUMAN	F	281;109	.	ENSP00000341122:S109F	S	-	2	0	C19orf54	45940392	0.000000	0.05858	0.000000	0.03702	0.885000	0.51271	0.013000	0.13310	0.060000	0.16281	0.563000	0.77884	TCC		0.652	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316701.1	NM_198476		12	9	0	0	0	0.080935	0	12	9				
PSG3	5671	broad.mit.edu	37	19	43233396	43233396	+	Silent	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:43233396T>G	ENST00000327495.5	-	5	1306	c.1122A>C	c.(1120-1122)ctA>ctC	p.L374L	PSG3_ENST00000595140.1_Silent_p.L374L	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	374	Ig-like C2-type 3.			Missing (in Ref. 9). {ECO:0000305}.	defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TTTGTCCTGATAGCTGAAACT	0.453																																							uc002oue.2		NA																	0				ovary(1)|skin(1)	2						c.(1120-1122)CTA>CTC		pregnancy specific beta-1-glycoprotein 3							183.0	194.0	190.0					19																	43233396		2203	4300	6503	SO:0001819	synonymous_variant	5671				defense response|female pregnancy	extracellular region		g.chr19:43233396T>G		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.1122A>C	19.37:g.43233396T>G			Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Silent_p.L374L|PSG3_uc010eil.2_Silent_p.L396L	p.L374L	NM_021016	NP_066296	WXS	Illumina HiSeq	Unspecified	Q16557	PSG3_HUMAN			5	1254	-		Prostate(69;0.00682)	374	Missing (in Ref. 9).		Ig-like C2-type 3.		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Silent	SNP	ENST00000327495.5	37	c.1122A>C	CCDS12611.1																																																																																				0.453	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016		154	127	0	0	0	0.048971	0	154	127				
PSG3	5671	broad.mit.edu	37	19	43244532	43244532	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:43244532C>A	ENST00000327495.5	-	1	189	c.5G>T	c.(4-6)gGg>gTg	p.G2V	PSG3_ENST00000595140.1_Missense_Mutation_p.G2V|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	2					defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TGAGAGGGGCCCCATGGTCTC	0.607																																							uc002oue.2		NA																	0				ovary(1)|skin(1)	2						c.(4-6)GGG>GTG		pregnancy specific beta-1-glycoprotein 3							142.0	150.0	147.0					19																	43244532		1511	2709	4220	SO:0001583	missense	5671				defense response|female pregnancy	extracellular region		g.chr19:43244532C>A		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.5G>T	19.37:g.43244532C>A	ENSP00000332215:p.Gly2Val		Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Missense_Mutation_p.G24V	p.G2V	NM_021016	NP_066296	WXS	Illumina HiSeq	Unspecified	Q16557	PSG3_HUMAN			1	137	-		Prostate(69;0.00682)	2					Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	c.5G>T	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	N	11.48	1.652425	0.29336	.	.	ENSG00000221826	ENST00000327495	T	0.19394	2.15	1.21	-2.42	0.06542	.	.	.	.	.	T	0.29158	0.0725	L	0.49513	1.565	0.31069	N	0.713234	D	0.76494	0.999	D	0.70227	0.968	T	0.36962	-0.9726	9	0.62326	D	0.03	.	1.4909	0.02456	0.3092:0.2349:0.0:0.4559	.	2	Q16557	PSG3_HUMAN	V	2	ENSP00000332215:G2V	ENSP00000332215:G2V	G	-	2	0	PSG3	47936372	0.252000	0.23972	0.542000	0.28115	0.207000	0.24258	-0.080000	0.11339	-0.606000	0.05746	0.121000	0.15741	GGG		0.607	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016		73	61	1	0	1.31311e-47	0.048971	2.07556e-47	73	61				
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	G	T	rs201682072		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr19:58385546G>T	ENST00000435989.2	-	3	1446	c.1212C>A	c.(1210-1212)gaC>gaA	p.D404E	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D404E(10)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTGTCAGTGTGAA	0.393																																							uc002qqo.2		NA																	10	Substitution - Missense(10)		urinary_tract(3)|kidney(3)|prostate(2)|NS(1)|skin(1)		0						c.(1210-1212)GAC>GAA		zinc finger protein 814							117.0	93.0	100.0					19																	58385546		692	1591	2283	SO:0001583	missense	730051				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58385546G>T		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1212C>A	19.37:g.58385546G>T	ENSP00000410545:p.Asp404Glu		Somatic				ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	p.D404E	NM_001144989	NP_001138461	WXS	Illumina HiSeq	Unspecified	B7Z6K7	ZN814_HUMAN			3	1484	-			404					A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	c.1212C>A	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.545823	0.27652	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.14640	2.49	2.33	-4.66	0.03329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.03177	-0.4	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.33574	-0.9863	9	0.54805	T	0.06	.	1.2175	0.01917	0.3897:0.3041:0.1331:0.1731	.	404	B7Z6K7	ZN814_HUMAN	E	404;266	ENSP00000410545:D404E	ENSP00000365378:D266E	D	-	3	2	ZNF814	63077358	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.489000	0.02306	-2.531000	0.00491	-1.292000	0.01352	GAC		0.393	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708		4	7	1	0	0.00024832	0.009096	0.000268011	4	7				
FAM49A	81553	broad.mit.edu	37	2	16736390	16736390	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:16736390T>G	ENST00000381323.3	-	11	1075	c.855A>C	c.(853-855)aaA>aaC	p.K285N	FAM49A_ENST00000406434.1_Missense_Mutation_p.K285N|FAM49A_ENST00000355549.2_Missense_Mutation_p.K285N	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	285						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CCTTCAAAACTTTTATGCAGC	0.458																																							uc010exm.1		NA																	0					0						c.(853-855)AAA>AAC		family with sequence similarity 49, member A							52.0	51.0	52.0					2																	16736390		2203	4300	6503	SO:0001583	missense	81553					intracellular		g.chr2:16736390T>G	AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.855A>C	2.37:g.16736390T>G	ENSP00000370724:p.Lys285Asn		Somatic				FAM49A_uc002rck.1_Missense_Mutation_p.K285N	p.K285N	NM_030797	NP_110424	WXS	Illumina HiSeq	Unspecified	Q9H0Q0	FA49A_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)		10	1003	-	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		285					B3KNZ1|Q53QW2	Missense_Mutation	SNP	ENST00000381323.3	37	c.855A>C	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600995	0.66332	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.51071	0.72;0.72;0.72	5.37	2.45	0.29901	.	0.000000	0.85682	D	0.000000	T	0.67050	0.2852	M	0.85373	2.75	0.80722	D	1	D	0.63046	0.992	D	0.70227	0.968	T	0.69465	-0.5138	10	0.72032	D	0.01	-39.0542	9.4627	0.38794	0.0:0.6879:0.0:0.3121	.	285	Q9H0Q0	FA49A_HUMAN	N	285	ENSP00000370724:K285N;ENSP00000384771:K285N;ENSP00000347744:K285N	ENSP00000347744:K285N	K	-	3	2	FAM49A	16599871	0.382000	0.25148	0.999000	0.59377	0.979000	0.70002	-0.270000	0.08584	0.761000	0.33130	-0.177000	0.13119	AAA		0.458	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	NM_030797		5	24	0	0	0	0.02938	0	5	24				
KIF3C	3797	broad.mit.edu	37	2	26204592	26204592	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:26204592A>G	ENST00000264712.3	-	1	774	c.195T>C	c.(193-195)gaT>gaC	p.D65D	KIF3C_ENST00000405914.1_Silent_p.D65D	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	65	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGAGCTGGCATCATACACGG	0.622																																							uc002rgu.2		NA																	0				ovary(3)|skin(1)	4						c.(193-195)GAT>GAC		kinesin family member 3C							86.0	88.0	87.0					2																	26204592		2203	4300	6503	SO:0001819	synonymous_variant	3797				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:26204592A>G		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.195T>C	2.37:g.26204592A>G			Somatic				KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Silent_p.D65D	p.D65D	NM_002254	NP_002245	WXS	Illumina HiSeq	Unspecified	O14782	KIF3C_HUMAN			1	852	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		65			Kinesin-motor.		O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	ENST00000264712.3	37	c.195T>C	CCDS1719.1																																																																																				0.622	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			52	93	0	0	0	0.048971	0	52	93				
HNRNPLL	92906	broad.mit.edu	37	2	38809125	38809125	+	Silent	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:38809125T>A	ENST00000449105.3	-	6	1071	c.732A>T	c.(730-732)ccA>ccT	p.P244P	HNRNPLL_ENST00000358367.4_Silent_p.P244P|HNRNPLL_ENST00000410076.1_Silent_p.P239P|HNRNPLL_ENST00000378915.3_Silent_p.P210P|HNRNPLL_ENST00000608859.1_Silent_p.P244P|HNRNPLL_ENST00000409328.1_Intron|HNRNPLL_ENST00000409636.1_Silent_p.P239P			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	244	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										TTAGACGAGTTGGCTGTTAAG	0.328																																							uc002rqw.2		NA																	0				skin(1)	1						c.(730-732)CCA>CCT		heterogeneous nuclear ribonucleoprotein L-like							116.0	117.0	117.0					2																	38809125		2203	4299	6502	SO:0001819	synonymous_variant	92906				mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding	g.chr2:38809125T>A	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.732A>T	2.37:g.38809125T>A			Somatic				HNRPLL_uc002rqv.2_5'UTR|HNRPLL_uc002rqx.2_Silent_p.P239P	p.P244P	NM_138394	NP_612403	WXS	Illumina HiSeq	Unspecified	Q8WVV9	HNRLL_HUMAN			6	1142	-		all_hematologic(82;0.248)	244			RRM 2.		Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Silent	SNP	ENST00000449105.3	37	c.732A>T																																																																																					0.328	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394		16	37	0	0	0	0.0333	0	16	37				
C2orf73	129852	broad.mit.edu	37	2	54571011	54571011	+	Splice_Site	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:54571011G>T	ENST00000398634.2	+	3	430		c.e3+1		C2orf73_ENST00000491538.1_Intron|C2orf73_ENST00000405749.1_Splice_Site	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73											breast(2)	2						TGTGGAATAGGTAAGGTTTTG	0.398																																							uc002rxt.1		NA																	0					0						c.e3+1		hypothetical protein LOC129852							46.0	47.0	47.0					2																	54571011		1862	4086	5948	SO:0001630	splice_region_variant	129852							g.chr2:54571011G>T	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.388+1G>T	2.37:g.54571011G>T			Somatic				C2orf73_uc010yor.1_Splice_Site_p.V72_splice|C2orf73_uc002rxs.1_Splice_Site_p.V9_splice|C2orf73_uc010yos.1_Splice_Site	p.V130_splice	NM_001100396	NP_001093866	WXS	Illumina HiSeq	Unspecified	Q8N5S3	CB073_HUMAN			3	430	+								A0AV79|A0AV81|Q8N7V4	Splice_Site	SNP	ENST00000398634.2	37	c.388_splice	CCDS46285.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847246	0.71603	.	.	ENSG00000177994	ENST00000486488;ENST00000405749;ENST00000398634;ENST00000447328	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3236	0.82964	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C2orf73	54424515	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.034000	0.64152	2.838000	0.97847	0.591000	0.81541	.		0.398	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396	Intron	7	15	1	0	0.00307968	0.038147	0.00325225	7	15				
CCDC88A	55704	broad.mit.edu	37	2	55523591	55523591	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:55523591G>T	ENST00000436346.1	-	30	5735	c.4894C>A	c.(4894-4896)Cat>Aat	p.H1632N	CCDC88A_ENST00000422883.2_Missense_Mutation_p.H133N|CCDC88A_ENST00000413716.2_Missense_Mutation_p.H1631N|CCDC88A_ENST00000263630.8_Missense_Mutation_p.H1604N|CCDC88A_ENST00000336838.6_Missense_Mutation_p.H1631N	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1632					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CAAGCCTCATGGTCATGAAGC	0.468																																							uc002ryv.2		NA																	0				ovary(2)|skin(2)	4						c.(4891-4893)CAT>AAT		coiled-coil domain containing 88A isoform 1							131.0	114.0	120.0					2																	55523591		2203	4300	6503	SO:0001583	missense	55704				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding	g.chr2:55523591G>T	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4894C>A	2.37:g.55523591G>T	ENSP00000410608:p.His1632Asn		Somatic				CCDC88A_uc010yoz.1_Missense_Mutation_p.H1604N|CCDC88A_uc010ypa.1_Missense_Mutation_p.H1631N|CCDC88A_uc002ryt.2_5'UTR|CCDC88A_uc010fbw.2_Missense_Mutation_p.H133N|CCDC88A_uc002ryu.2_Missense_Mutation_p.H886N|CCDC88A_uc002rys.2_Missense_Mutation_p.H589N|CCDC88A_uc002ryw.2_Missense_Mutation_p.H915N|CCDC88A_uc010fby.1_Missense_Mutation_p.H483N	p.H1631N	NM_001135597	NP_001129069	WXS	Illumina HiSeq	Unspecified	Q3V6T2	GRDN_HUMAN			30	5733	-			1632					A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37	c.4891C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.498|4.498	0.092365|0.092365	0.08632|0.08632	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000456975	T;T;T;T;T;T|.	0.43688|.	2.56;2.72;2.78;0.94;2.57;1.54|.	5.39|5.39	3.59|3.59	0.41128|0.41128	.|.	0.000000|.	0.49305|.	U|.	0.000145|.	T|T	0.29190|0.29190	0.0726|0.0726	N|N	0.22421|0.22421	0.69|0.69	0.31699|0.31699	N|N	0.640938|0.640938	B;B;B;P;B;B;B|.	0.45827|.	0.0;0.0;0.0;0.867;0.0;0.0;0.0|.	B;B;B;B;B;B;B|.	0.41510|.	0.0;0.0;0.0;0.359;0.0;0.001;0.0|.	T|T	0.31336|0.31336	-0.9947|-0.9947	10|5	0.15066|.	T|.	0.55|.	-3.893|-3.893	6.4981|6.4981	0.22153|0.22153	0.1492:0.0:0.7048:0.146|0.1492:0.0:0.7048:0.146	.|.	1631;1604;1549;133;1632;1631;1603|.	B7ZM78;Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;.;GRDN_HUMAN;.;.|.	N|Q	1631;1604;1632;133;649;1631;807|584	ENSP00000338728:H1631N;ENSP00000263630:H1604N;ENSP00000410608:H1632N;ENSP00000390012:H649N;ENSP00000404431:H1631N;ENSP00000405080:H807N|.	ENSP00000263630:H1604N|.	H|P	-|-	1|2	0|0	CCDC88A|CCDC88A	55377095|55377095	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.966000|0.966000	0.64601|0.64601	2.499000|2.499000	0.45372|0.45372	0.659000|0.659000	0.30945|0.30945	0.467000|0.467000	0.42956|0.42956	CAT|CCA		0.468	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571		31	44	1	0	1.7881e-09	0.037714	2.11635e-09	31	44				
DYSF	8291	broad.mit.edu	37	2	71894573	71894573	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:71894573G>T	ENST00000258104.3	+	47	5545	c.5268G>T	c.(5266-5268)caG>caT	p.Q1756H	DYSF_ENST00000394120.2_Missense_Mutation_p.Q1757H|DYSF_ENST00000409366.1_Missense_Mutation_p.Q1778H|DYSF_ENST00000429174.2_Missense_Mutation_p.Q1777H|DYSF_ENST00000410041.1_Missense_Mutation_p.Q1774H|DYSF_ENST00000409744.1_Missense_Mutation_p.Q1764H|DYSF_ENST00000413539.2_Missense_Mutation_p.Q1787H|DYSF_ENST00000409582.3_Missense_Mutation_p.Q1794H|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409762.1_Missense_Mutation_p.Q1773H|DYSF_ENST00000410020.3_Missense_Mutation_p.Q1795H|DYSF_ENST00000409651.1_Missense_Mutation_p.Q1788H	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1756					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ATGTGCTTCAGCAGCAGGGCC	0.627																																							uc002sie.2		NA																	0				ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(5266-5268)CAG>CAT		dysferlin isoform 8							67.0	69.0	69.0					2																	71894573		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71894573G>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5268G>T	2.37:g.71894573G>T	ENSP00000258104:p.Gln1756His		Somatic				DYSF_uc010feg.2_Missense_Mutation_p.Q1787H|DYSF_uc010feh.2_Missense_Mutation_p.Q1763H|DYSF_uc002sig.3_Missense_Mutation_p.Q1742H|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.Q1777H|DYSF_uc010fef.2_Missense_Mutation_p.Q1794H|DYSF_uc010fei.2_Missense_Mutation_p.Q1773H|DYSF_uc010fek.2_Missense_Mutation_p.Q1774H|DYSF_uc010fej.2_Missense_Mutation_p.Q1764H|DYSF_uc010fel.2_Missense_Mutation_p.Q1743H|DYSF_uc010feo.2_Missense_Mutation_p.Q1788H|DYSF_uc010fem.2_Missense_Mutation_p.Q1778H|DYSF_uc010fen.2_Missense_Mutation_p.Q1795H|DYSF_uc002sif.2_Missense_Mutation_p.Q1757H|DYSF_uc010yqy.1_Missense_Mutation_p.Q637H|DYSF_uc010yqz.1_Missense_Mutation_p.Q517H	p.Q1756H	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			47	5644	+			1756			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.5268G>T	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977839	0.34942	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12;-2.12;-2.12;-2.12;-2.12;-2.12;-2.12	5.05	3.24	0.37175	.	0.149742	0.64402	D	0.000020	T	0.69691	0.3139	N	0.05050	-0.12	0.31524	N	0.661987	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.14012	0.002;0.007;0.007;0.007;0.007;0.009;0.001;0.001;0.0;0.007;0.003;0.0;0.004;0.007;0.004	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.18561	0.002;0.011;0.011;0.011;0.011;0.022;0.003;0.003;0.003;0.011;0.01;0.003;0.011;0.011;0.005	T	0.62238	-0.6896	10	0.20519	T	0.43	-14.3679	7.2181	0.25971	0.2718:0.0:0.7282:0.0	.	520;1788;1795;1778;1743;1774;1764;1773;1763;1787;1794;1777;1742;1757;1756	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	H	1787;1773;1794;1777;1756;1788;1757;1764;1778;1795;1774	ENSP00000407046:Q1787H;ENSP00000387137:Q1773H;ENSP00000386547:Q1794H;ENSP00000398305:Q1777H;ENSP00000258104:Q1756H;ENSP00000386683:Q1788H;ENSP00000377678:Q1757H;ENSP00000386285:Q1764H;ENSP00000386512:Q1778H;ENSP00000386881:Q1795H;ENSP00000386617:Q1774H	ENSP00000258104:Q1756H	Q	+	3	2	DYSF	71748081	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	1.386000	0.34419	0.710000	0.31997	0.491000	0.48974	CAG		0.627	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		46	57	1	0	3.05275e-18	0.045515	4.15513e-18	46	57				
ITPRIPL1	150771	broad.mit.edu	37	2	96993360	96993360	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:96993360G>C	ENST00000439118.2	+	3	1242	c.991G>C	c.(991-993)Gcc>Ccc	p.A331P	ITPRIPL1_ENST00000542887.1_Missense_Mutation_p.A323P|ITPRIPL1_ENST00000361124.4_Missense_Mutation_p.A339P|ITPRIPL1_ENST00000536814.1_Missense_Mutation_p.A323P	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	331						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAATGCCTGGGCCCTTGTGGC	0.557																																							uc002svx.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(991-993)GCC>CCC		inositol 1,4,5-triphosphate receptor interacting							64.0	64.0	64.0					2																	96993360		2203	4300	6503	SO:0001583	missense	150771					integral to membrane		g.chr2:96993360G>C		CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.991G>C	2.37:g.96993360G>C	ENSP00000389308:p.Ala331Pro		Somatic				ITPRIPL1_uc010yuk.1_Missense_Mutation_p.A323P|ITPRIPL1_uc002svy.2_Missense_Mutation_p.A339P|ITPRIPL1_uc010yul.1_Missense_Mutation_p.A323P	p.A331P	NM_001008949	NP_001008949	WXS	Illumina HiSeq	Unspecified	Q6GPH6	IPIL1_HUMAN			3	1326	+			331			Cytoplasmic (Potential).		F5H1L8|Q8NE61	Missense_Mutation	SNP	ENST00000439118.2	37	c.991G>C	CCDS46360.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450871	0.43531	.	.	ENSG00000198885	ENST00000536814;ENST00000439118;ENST00000361124;ENST00000542887	T;T;T;T	0.19806	2.13;2.13;2.12;2.13	5.65	4.77	0.60923	.	0.305751	0.23616	N	0.046284	T	0.16557	0.0398	N	0.14661	0.345	0.41174	D	0.98618	P;P	0.48589	0.912;0.857	P;B	0.48425	0.577;0.373	T	0.05886	-1.0858	10	0.29301	T	0.29	-4.0561	10.3804	0.44108	0.1548:0.0:0.8452:0.0	.	339;331	Q6GPH6-2;Q6GPH6	.;IPIL1_HUMAN	P	323;331;339;323	ENSP00000439566:A323P;ENSP00000389308:A331P;ENSP00000355121:A339P;ENSP00000438212:A323P	ENSP00000355121:A339P	A	+	1	0	ITPRIPL1	96357087	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	4.720000	0.61944	1.636000	0.50526	-0.136000	0.14681	GCC		0.557	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1	NM_178495		31	53	0	0	0	0.037714	0	31	53				
AFF3	3899	broad.mit.edu	37	2	100623170	100623170	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:100623170C>A	ENST00000409236.2	-	5	909	c.797G>T	c.(796-798)gGa>gTa	p.G266V	AFF3_ENST00000409579.1_Missense_Mutation_p.G291V|AFF3_ENST00000356421.2_Missense_Mutation_p.G291V|AFF3_ENST00000317233.4_Missense_Mutation_p.G266V			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	266					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GGCAGGGACTCCCCTGTATGA	0.582																																							uc002tag.2		NA																	0				ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						c.(796-798)GGA>GTA		AF4/FMR2 family, member 3 isoform 1							53.0	53.0	53.0					2																	100623170		2203	4300	6503	SO:0001583	missense	3899				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:100623170C>A	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.797G>T	2.37:g.100623170C>A	ENSP00000387207:p.Gly266Val		Somatic				AFF3_uc002taf.2_Missense_Mutation_p.G291V|AFF3_uc010fiq.1_Missense_Mutation_p.G266V|AFF3_uc010yvr.1_Missense_Mutation_p.G420V|AFF3_uc002tah.1_Missense_Mutation_p.G291V|AFF3_uc010fir.1_Missense_Mutation_p.G343V|AFF3_uc002tai.2_Missense_Mutation_p.G188V	p.G266V	NM_002285	NP_002276	WXS	Illumina HiSeq	Unspecified	P51826	AFF3_HUMAN			6	1033	-			266					B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	c.797G>T	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562298	0.45694	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.46	5.46	0.80206	.	0.203205	0.34507	N	0.003901	T	0.71426	0.3338	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.995;1.0;0.996;0.995	T	0.72077	-0.4399	10	0.48119	T	0.1	.	19.3032	0.94151	0.0:1.0:0.0:0.0	.	420;420;266;266;291	B7Z4I6;C9JXV5;A8K353;P51826;P51826-2	.;.;.;AFF3_HUMAN;.	V	266;291;291;266;266;420;291	ENSP00000317421:G266V;ENSP00000348793:G291V;ENSP00000386834:G291V;ENSP00000387207:G266V	ENSP00000317421:G266V	G	-	2	0	AFF3	99989602	1.000000	0.71417	0.349000	0.25694	0.013000	0.08279	5.861000	0.69553	2.563000	0.86464	0.655000	0.94253	GGA		0.582	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		28	31	1	0	3.65163e-15	0.030593	4.83594e-15	28	31				
IL18RAP	8807	broad.mit.edu	37	2	103061734	103061734	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:103061734G>T	ENST00000264260.2	+	9	1595	c.1006G>T	c.(1006-1008)Gtt>Ttt	p.V336F	IL18RAP_ENST00000409369.1_Missense_Mutation_p.V194F	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	336	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CAGGAAGTTTGTTTGCTTTGT	0.428																																							uc002tbx.2		NA																	0				skin(3)|ovary(2)	5						c.(1006-1008)GTT>TTT		interleukin 18 receptor accessory protein							118.0	109.0	112.0					2																	103061734		2203	4300	6503	SO:0001583	missense	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103061734G>T	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1006G>T	2.37:g.103061734G>T	ENSP00000264260:p.Val336Phe		Somatic				IL18RAP_uc010fiz.2_Missense_Mutation_p.V194F	p.V336F	NM_003853	NP_003844	WXS	Illumina HiSeq	Unspecified	O95256	I18RA_HUMAN			9	1490	+			336			Ig-like C2-type 2.|Extracellular (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.1006G>T	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261017	0.39995	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.13778	2.56;2.56	5.63	-0.694	0.11294	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.534882	0.17805	N	0.161425	T	0.08537	0.0212	L	0.43152	1.355	0.09310	N	1	P	0.39920	0.695	B	0.37047	0.24	T	0.34551	-0.9824	10	0.13853	T	0.58	.	5.9643	0.19316	0.2549:0.5268:0.2183:0.0	.	336	O95256	I18RA_HUMAN	F	336;194	ENSP00000264260:V336F;ENSP00000387201:V194F	ENSP00000264260:V336F	V	+	1	0	IL18RAP	102428166	0.045000	0.20229	0.032000	0.17829	0.770000	0.43624	0.890000	0.28295	-0.054000	0.13266	0.655000	0.94253	GTT		0.428	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		23	45	1	0	1.36565e-18	0.076483	1.86918e-18	23	45				
PAX8	7849	broad.mit.edu	37	2	114002029	114002029	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:114002029C>A	ENST00000429538.3	-	4	558	c.364G>T	c.(364-366)Gtg>Ttg	p.V122L	PAX8_ENST00000348715.5_Missense_Mutation_p.V122L|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Missense_Mutation_p.V122L|AC016683.6_ENST00000553869.2_RNA|PAX8_ENST00000263335.7_Missense_Mutation_p.V122L|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000556070.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.V122L	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	122	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						ACACTGGGCACAGTGTCATTG	0.552			T	PPARG	follicular thyroid		Thyroid dysgenesis																														Ovarian(188;7 2067 9084 29802 29892)	Ovarian(188;7 2067 9084 29802 29892)	uc010yxt.1		NA		Dom	yes		2	2q12-q14	7849	T	paired box gene 8	yes	Thyroid dysgenesis 	E	PPARG		follicular thyroid		0				ovary(1)|lung(1)	2						c.(364-366)GTG>TTG		paired box 8 isoform PAX8A							115.0	130.0	125.0					2																	114002029		2199	4298	6497	SO:0001583	missense	7849				branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity	g.chr2:114002029C>A	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.364G>T	2.37:g.114002029C>A	ENSP00000395498:p.Val122Leu		Somatic				PAX8_uc010yxu.1_Missense_Mutation_p.V122L|PAX8_uc010yxv.1_Missense_Mutation_p.V122L|PAX8_uc002tjm.2_Missense_Mutation_p.V122L|PAX8_uc002tjn.2_Missense_Mutation_p.V122L|PAX8_uc010fku.1_Missense_Mutation_p.V122L|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	p.V122L	NM_003466	NP_003457	WXS	Illumina HiSeq	Unspecified	Q06710	PAX8_HUMAN			4	530	-			122			Paired.		Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	c.364G>T	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061740	0.93846	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.99418	-5.87;-5.87;-5.87;-5.87;-5.87	5.19	5.19	0.71726	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99432	0.9799	M	0.81239	2.535	0.80722	D	1	P;D;D;P;D	0.67145	0.785;0.996;0.967;0.897;0.971	P;D;P;P;P	0.65010	0.766;0.931;0.827;0.72;0.869	D	0.98626	1.0669	10	0.87932	D	0	.	16.2017	0.82087	0.0:1.0:0.0:0.0	.	122;122;122;122;122	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	L	122	ENSP00000263335:V122L;ENSP00000380768:V122L;ENSP00000314750:V122L;ENSP00000395498:V122L;ENSP00000263334:V122L	ENSP00000263334:V122L	V	-	1	0	PAX8	113718499	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.433000	0.82419	0.563000	0.77884	GTG		0.552	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5			53	196	1	0	2.81731e-22	0.048971	3.98983e-22	53	196				
GLI2	2736	broad.mit.edu	37	2	121726411	121726411	+	Silent	SNP	G	G	T	rs200901345		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:121726411G>T	ENST00000452319.1	+	6	825	c.765G>T	c.(763-765)tcG>tcT	p.S255S	GLI2_ENST00000361492.4_Silent_p.S255S|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CACCCAACTCGCTAGTGGCCT	0.672																																							uc010flp.2		NA																	0				ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13						c.(763-765)TCG>TCT		GLI-Kruppel family member GLI2							77.0	68.0	71.0					2																	121726411		2203	4300	6503	SO:0001819	synonymous_variant	2736				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:121726411G>T		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.765G>T	2.37:g.121726411G>T			Somatic				GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Missense_Mutation_p.A126S|GLI2_uc010flo.1_Silent_p.S130S|GLI2_uc002tmw.1_Silent_p.S255S	p.S255S	NM_005270	NP_005261	WXS	Illumina HiSeq	Unspecified	P10070	GLI2_HUMAN			5	795	+	Renal(3;0.0496)	Prostate(154;0.0623)	255						Silent	SNP	ENST00000452319.1	37	c.765G>T	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818637	0.50633	.	.	ENSG00000074047	ENST00000440937;ENST00000360874	.	.	.	4.91	-9.82	0.00484	.	.	.	.	.	T	0.35098	0.0920	.	.	.	0.80722	D	1	B	0.14805	0.011	B	0.15484	0.013	T	0.27191	-1.0081	7	0.87932	D	0	.	0.7505	0.00989	0.3462:0.2196:0.1076:0.3267	.	126	F5H4D9	.	S	126;118	.	ENSP00000441454:A118S	A	+	1	0	GLI2	121442881	0.000000	0.05858	0.223000	0.23860	0.574000	0.36063	-3.750000	0.00376	-2.621000	0.00439	-0.181000	0.13052	GCT		0.672	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		25	57	1	0	5.35356e-11	0.076483	6.46119e-11	25	57				
MYO7B	4648	broad.mit.edu	37	2	128324229	128324229	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:128324229C>T	ENST00000409816.2	+	4	329	c.297C>T	c.(295-297)ggC>ggT	p.G99G	MYO7B_ENST00000428314.1_Silent_p.G99G|MYO7B_ENST00000389524.4_Silent_p.G99G			Q6PIF6	MYO7B_HUMAN	myosin VIIB	99	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CATACACAGGCTCCATCCTGG	0.652																																							uc002top.2		NA																	0				ovary(1)|pancreas(1)	2						c.(295-297)GGC>GGT		myosin VIIB							22.0	27.0	26.0					2																	128324229		2010	4154	6164	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128324229C>T		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.297C>T	2.37:g.128324229C>T			Somatic					p.G99G	NM_001080527	NP_001073996	WXS	Illumina HiSeq	Unspecified	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	5	350	+	Colorectal(110;0.1)		99			Myosin head-like.		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.297C>T	CCDS46405.1																																																																																				0.652	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		4	15	0	0	0	0.014758	0	4	15				
POTEF	728378	broad.mit.edu	37	2	130877719	130877719	+	Missense_Mutation	SNP	C	C	T	rs376091861	byFrequency	TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:130877719C>T	ENST00000409914.2	-	3	769	c.370G>A	c.(370-372)Gat>Aat	p.D124N	POTEF_ENST00000360967.5_Missense_Mutation_p.D124N|POTEF_ENST00000361163.4_Missense_Mutation_p.D124N|POTEF_ENST00000357462.5_Missense_Mutation_p.D124N	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	124					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.D124N(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCACTGTCATCGTAGTCTCCC	0.577													.|||	4	0.000798722	0.003	0.0	5008	,	,		17097	0.0		0.0	False		,,,				2504	0.0						uc010fmh.2		NA																	2	Substitution - Missense(2)		large_intestine(2)	skin(3)|ovary(2)	5						c.(370-372)GAT>AAT		prostate, ovary, testis expressed protein on		C	ASN/ASP	4,4398		0,4,2197	80.0	96.0	90.0		370	-1.2	0.0	2		90	1,8597		0,1,4298	no	missense	POTEF	NM_001099771.2	23	0,5,6495	TT,TC,CC		0.0116,0.0909,0.0385	benign	124/1076	130877719	5,12995	2201	4299	6500	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130877719C>T	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.370G>A	2.37:g.130877719C>T	ENSP00000386786:p.Asp124Asn		Somatic					p.D124N	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			3	770	-			124					A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.370G>A	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	11.10	1.540657	0.27563	9.09E-4	1.16E-4	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.77098	-1.07;-1.07;1.75;1.73	0.619	-1.16	0.09678	.	.	.	.	.	T	0.61949	0.2388	L	0.58101	1.795	0.09310	N	1	P	0.52463	0.953	B	0.29267	0.1	T	0.56335	-0.7996	8	0.87932	D	0	.	.	.	.	.	124	A5A3E0	POTEF_HUMAN	N	124	ENSP00000350052:D124N;ENSP00000386786:D124N;ENSP00000354232:D124N;ENSP00000355012:D124N	ENSP00000350052:D124N	D	-	1	0	POTEF	130594189	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.497000	0.02289	-0.409000	0.07553	0.162000	0.16502	GAT		0.577	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		82	110	0	0	0	0.048971	0	82	110				
CFC1	55997	broad.mit.edu	37	2	131356257	131356257	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:131356257C>A	ENST00000259216.4	-	3	467	c.205G>T	c.(205-207)Ggg>Tgg	p.G69W		NM_032545.3	NP_115934.1	P0CG37	CFC1_HUMAN	cripto, FRL-1, cryptic family 1	69					determination of left/right symmetry (GO:0007368)|gastrulation (GO:0007369)|nodal signaling pathway (GO:0038092)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nodal binding (GO:0038100)			endometrium(1)|lung(4)	5	Colorectal(110;0.1)					TCCTCCGGCCCCCAGCCCTCG	0.627																																							uc002tro.1		NA																	0					0						c.(205-207)GGG>TGG		cripto, FRL-1, cryptic family 1B							31.0	46.0	41.0					2																	131356257		2193	4294	6487	SO:0001583	missense	653275				gastrulation	extracellular region		g.chr2:131356257C>A	AF312769	CCDS2162.1, CCDS74573.1, CCDS74574.1	2q21.2	2014-02-04			ENSG00000136698	ENSG00000136698			18292	protein-coding gene	gene with protein product		605194	"""heterotaxy 2 (autosomal dominant)"""	HTX2		11062482, 10858660	Standard	NM_032545		Approved	CRYPTIC, HTX2	uc002tro.2	P0CG37	OTTHUMG00000131628	ENST00000259216.4:c.205G>T	2.37:g.131356257C>A	ENSP00000259216:p.Gly69Trp		Somatic					p.G69W	NM_001079530	NP_001072998	WXS	Illumina HiSeq	Unspecified	P0CG36	CFC1B_HUMAN			3	596	-	Colorectal(110;0.1)		69					B2RCY0|B9EJD3|Q53T05|Q9GZR3	Missense_Mutation	SNP	ENST00000259216.4	37	c.205G>T	CCDS2162.1	.	.	.	.	.	.	.	.	.	.	.	12.86	2.065379	0.36470	.	.	ENSG00000136698	ENST00000259216	D	0.89681	-2.55	1.91	-1.21	0.09524	.	0.491185	0.17606	N	0.168253	D	0.83018	0.5163	N	0.22421	0.69	0.09310	N	1	D	0.58620	0.983	P	0.53062	0.717	T	0.74825	-0.3533	10	0.62326	D	0.03	-52.2556	5.0719	0.14611	0.0:0.5812:0.0:0.4188	.	69	P0CG37	CFC1_HUMAN	W	69	ENSP00000259216:G69W	ENSP00000259216:G69W	G	-	1	0	CFC1	131072727	0.000000	0.05858	0.110000	0.21437	0.029000	0.11900	-1.055000	0.03493	-0.251000	0.09542	0.436000	0.28706	GGG		0.627	CFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333367.1	NM_032545		16	89	1	0	2.21704e-12	0.076483	2.75723e-12	16	89				
AMER3	205147	broad.mit.edu	37	2	131520357	131520357	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:131520357G>T	ENST00000423981.1	+	2	822	c.712G>T	c.(712-714)Gtg>Ttg	p.V238L	AMER3_ENST00000321420.4_Missense_Mutation_p.V238L	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	238					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										GTGTGAGGACGTGGCCTCACT	0.657																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(712-714)GTG>TTG		hypothetical protein LOC205147							57.0	65.0	63.0					2																	131520357		2203	4300	6503	SO:0001583	missense	205147							g.chr2:131520357G>T	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.712G>T	2.37:g.131520357G>T	ENSP00000392700:p.Val238Leu		Somatic				FAM123C_uc010fmv.2_Missense_Mutation_p.V238L|FAM123C_uc010fms.1_Missense_Mutation_p.V238L|FAM123C_uc010fmt.1_Missense_Mutation_p.V238L|FAM123C_uc010fmu.1_Missense_Mutation_p.V238L	p.V238L	NM_152698	NP_689911	WXS	Illumina HiSeq	Unspecified	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	902	+	Colorectal(110;0.1)		238					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.712G>T	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593425	0.66219	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.38887	1.11;1.11	5.21	4.33	0.51752	.	0.000000	0.64402	D	0.000001	T	0.56978	0.2022	M	0.76328	2.33	0.35817	D	0.824331	D	0.58970	0.984	P	0.56700	0.804	T	0.70502	-0.4854	10	0.66056	D	0.02	.	11.9922	0.53182	0.0852:0.0:0.9148:0.0	.	238	Q8N944	F123C_HUMAN	L	238	ENSP00000314914:V238L;ENSP00000392700:V238L	ENSP00000314914:V238L	V	+	1	0	FAM123C	131236827	1.000000	0.71417	0.967000	0.41034	0.454000	0.32378	5.687000	0.68219	1.331000	0.45412	0.561000	0.74099	GTG		0.657	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		41	52	1	0	2.58029e-29	0.11126	3.92652e-29	41	52				
XIRP2	129446	broad.mit.edu	37	2	168105645	168105645	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:168105645A>G	ENST00000409195.1	+	9	7832	c.7743A>G	c.(7741-7743)acA>acG	p.T2581T	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Silent_p.T2359T|XIRP2_ENST00000295237.9_Silent_p.T2581T	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2406					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AACACATAACAGAGGTGGAAA	0.368																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(7741-7743)ACA>ACG		xin actin-binding repeat containing 2 isoform 1							96.0	90.0	92.0					2																	168105645		1830	4084	5914	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168105645A>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7743A>G	2.37:g.168105645A>G			Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.T2406T|XIRP2_uc010fpq.2_Silent_p.T2359T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	p.T2581T	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	7761	+			2406					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.7743A>G	CCDS42769.1																																																																																				0.368	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		44	81	0	0	0	0.039052	0	44	81				
HOXD12	3238	broad.mit.edu	37	2	176964707	176964708	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:176964707_176964708CC>AA	ENST00000406506.2	+	1	250_251	c.178_179CC>AA	c.(178-180)CCc>AAc	p.P60N	HOXD12_ENST00000404162.2_Missense_Mutation_p.P60N			P35452	HXD12_HUMAN	homeobox D12	60					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CTCCTGCGCCCCCGCGCAGCCT	0.748																																							uc010zev.1		NA																	0					0						c.(178-180)CCC>AAC		homeobox D12																																				SO:0001583	missense	3238					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176964707_176964708CC>AA		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	Exception_encountered	2.37:g.176964707_176964708delinsAA	ENSP00000385586:p.Pro60Asn		Somatic				HOXD12_uc010zew.1_Missense_Mutation_p.P60N	p.P60N	NM_021193	NP_067016	WXS	Illumina HiSeq	Unspecified	P35452	HXD12_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)	1	178_179	+			60					B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	DNP	ENST00000406506.2	37	c.178_179CC>AA	CCDS46456.1																																																																																				0.748	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193		10	18	0	0	0	0.004672	0	10	18				
FAM171B	165215	broad.mit.edu	37	2	187627205	187627205	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:187627205T>A	ENST00000304698.5	+	8	2339	c.2136T>A	c.(2134-2136)aaT>aaA	p.N712K		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	712						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TGGACATGAATGAGCTTCACT	0.458																																							uc002ups.2		NA																	0				ovary(6)|breast(3)|central_nervous_system(1)	10						c.(2134-2136)AAT>AAA		KIAA1946							63.0	66.0	65.0					2																	187627205		2203	4300	6503	SO:0001583	missense	165215					integral to membrane	DNA binding	g.chr2:187627205T>A	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2136T>A	2.37:g.187627205T>A	ENSP00000304108:p.Asn712Lys		Somatic				FAM171B_uc002upr.1_Missense_Mutation_p.N679K|FAM171B_uc002upt.2_Missense_Mutation_p.N181K	p.N712K	NM_177454	NP_803237	WXS	Illumina HiSeq	Unspecified	Q6P995	F171B_HUMAN			8	2248	+			712			Cytoplasmic (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	c.2136T>A	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.917094	0.52546	.	.	ENSG00000144369	ENST00000304698	T	0.34667	1.35	6.02	1.17	0.20885	.	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	L	0.55990	1.75	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.44483	-0.9325	10	0.87932	D	0	-26.8722	9.1611	0.37023	0.0:0.2763:0.0:0.7237	.	712;713	Q6P995;A8K122	F171B_HUMAN;.	K	712	ENSP00000304108:N712K	ENSP00000304108:N712K	N	+	3	2	FAM171B	187335450	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	1.142000	0.31540	0.181000	0.19994	-0.297000	0.09499	AAT		0.458	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		22	60	0	0	0	0.062417	0	22	60				
STAT4	6775	broad.mit.edu	37	2	191934452	191934452	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:191934452A>T	ENST00000392320.2	-	6	825	c.511T>A	c.(511-513)Ttt>Att	p.F171I	STAT4_ENST00000358470.4_Missense_Mutation_p.F171I	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	171					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CTGTAGTCAAATTCGTCTTGC	0.328																																							uc002usm.1		NA																	0				breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9						c.(511-513)TTT>ATT		signal transducer and activator of transcription							193.0	186.0	189.0					2																	191934452		2202	4298	6500	SO:0001583	missense	6775				JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr2:191934452A>T		CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.511T>A	2.37:g.191934452A>T	ENSP00000376134:p.Phe171Ile		Somatic				STAT4_uc002usn.1_Missense_Mutation_p.F171I|STAT4_uc010zgk.1_Missense_Mutation_p.F16I|STAT4_uc002uso.2_Missense_Mutation_p.F171I	p.F171I	NM_003151	NP_003142	WXS	Illumina HiSeq	Unspecified	Q14765	STAT4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)		6	765	-			171					Q96NZ6	Missense_Mutation	SNP	ENST00000392320.2	37	c.511T>A	CCDS2310.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.027998	0.93518	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	T;T	0.70045	-0.45;-0.45	5.81	5.81	0.92471	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.109388	0.64402	D	0.000005	D	0.83303	0.5225	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.85918	0.1444	10	0.87932	D	0	-21.6101	16.1667	0.81768	1.0:0.0:0.0:0.0	.	80;171;171	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	I	171	ENSP00000351255:F171I;ENSP00000376134:F171I	ENSP00000351255:F171I	F	-	1	0	STAT4	191642697	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.238000	0.89809	2.210000	0.71456	0.533000	0.62120	TTT		0.328	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151		28	110	0	0	0	0.041601	0	28	110				
DNAH7	56171	broad.mit.edu	37	2	196750928	196750928	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:196750928A>G	ENST00000312428.6	-	34	5575	c.5475T>C	c.(5473-5475)gaT>gaC	p.D1825D		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1825					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAGCAAAATCATCCATAAAAC	0.373																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(5473-5475)GAT>GAC		dynein, axonemal, heavy chain 7							132.0	129.0	130.0					2																	196750928		1848	4096	5944	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196750928A>G	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5475T>C	2.37:g.196750928A>G			Somatic					p.D1825D	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			34	5576	-			1825					B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.5475T>C	CCDS42794.1																																																																																				0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		20	66	0	0	0	0.055883	0	20	66				
GTF3C3	9330	broad.mit.edu	37	2	197657796	197657796	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:197657796C>T	ENST00000263956.3	-	3	384	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	GTF3C3_ENST00000409364.3_Missense_Mutation_p.E99K|GTF3C3_ENST00000470386.1_5'Flank	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	99	Glu-rich.				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						tcttcctcttcctcctcATCA	0.468																																							uc002uts.2		NA																	0				ovary(3)|breast(3)|pancreas(1)	7						c.(295-297)GAA>AAA		general transcription factor IIIC, polypeptide							62.0	62.0	62.0					2																	197657796		2203	4300	6503	SO:0001583	missense	9330					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr2:197657796C>T	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.295G>A	2.37:g.197657796C>T	ENSP00000263956:p.Glu99Lys		Somatic				GTF3C3_uc010zgu.1_Missense_Mutation_p.E99K|GTF3C3_uc002utu.2_Missense_Mutation_p.E99K	p.E99K	NM_012086	NP_036218	WXS	Illumina HiSeq	Unspecified	Q9Y5Q9	TF3C3_HUMAN			3	385	-			99			Glu-rich.		Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	c.295G>A	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841096	0.51057	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.47177	0.9;0.85	5.01	3.14	0.36123	.	0.435679	0.23682	N	0.045601	T	0.23688	0.0573	N	0.08118	0	0.43107	D	0.994808	B;B	0.30914	0.3;0.037	B;B	0.26094	0.066;0.034	T	0.07290	-1.0780	10	0.25106	T	0.35	.	9.8981	0.41331	0.1376:0.7882:0.0:0.0742	.	99;99	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	K	99	ENSP00000263956:E99K;ENSP00000386465:E99K	ENSP00000263956:E99K	E	-	1	0	GTF3C3	197366041	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	5.458000	0.66679	1.313000	0.45069	-0.293000	0.09583	GAA		0.468	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1			22	30	0	0	0	0.055883	0	22	30				
SATB2	23314	broad.mit.edu	37	2	200137136	200137136	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:200137136C>A	ENST00000417098.1	-	11	2816	c.2000G>T	c.(1999-2001)cGg>cTg	p.R667L	SATB2_ENST00000457245.1_Missense_Mutation_p.R667L|SATB2_ENST00000443023.1_Missense_Mutation_p.R608L|SATB2_ENST00000260926.5_Missense_Mutation_p.R667L|SATB2_ENST00000428695.1_Missense_Mutation_p.R549L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	667					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.R667L(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CACGTGGTACCGCTGGTTCTG	0.567																																					Colon(30;262 767 11040 24421 36230)	Colon(30;262 767 11040 24421 36230)	uc002uuy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1999-2001)CGG>CTG		SATB homeobox 2							161.0	142.0	148.0					2																	200137136		2203	4300	6503	SO:0001583	missense	23314					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity	g.chr2:200137136C>A	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.2000G>T	2.37:g.200137136C>A	ENSP00000401112:p.Arg667Leu		Somatic				SATB2_uc010fsq.1_Missense_Mutation_p.R549L|SATB2_uc002uuz.1_Missense_Mutation_p.R667L|SATB2_uc002uva.1_Missense_Mutation_p.R667L	p.R667L	NM_015265	NP_056080	WXS	Illumina HiSeq	Unspecified	Q9UPW6	SATB2_HUMAN			11	2817	-			667			Homeobox.		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	c.2000G>T	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875632	0.91664	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	D;D;D;D;D	0.99158	-5.5;-5.5;-5.5;-5.5;-5.5	5.5	5.5	0.81552	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	L	0.27053	0.805	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.79784	0.982;0.993	D	0.99936	1.1358	10	0.87932	D	0	-17.9892	19.762	0.96323	0.0:1.0:0.0:0.0	.	549;667	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	667;608;667;549;667	ENSP00000401112:R667L;ENSP00000388764:R608L;ENSP00000260926:R667L;ENSP00000388581:R549L;ENSP00000405420:R667L	ENSP00000260926:R667L	R	-	2	0	SATB2	199845381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.741000	0.93983	0.650000	0.86243	CGG		0.567	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265		27	88	1	0	1.38854e-25	0.037714	2.03708e-25	27	88				
CARF	79800	broad.mit.edu	37	2	203846375	203846375	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:203846375C>T	ENST00000402905.3	+	14	1977	c.1656C>T	c.(1654-1656)tcC>tcT	p.S552S	CARF_ENST00000438828.2_Silent_p.S552S|CARF_ENST00000414439.1_Silent_p.S450S|CARF_ENST00000320443.8_Silent_p.S552S|CARF_ENST00000545253.1_Silent_p.S464S|WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Silent_p.S476S|CARF_ENST00000545262.1_Silent_p.S476S	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	552					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCTCACTCTCCTCATTTCAGC	0.413																																							uc002uzo.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1654-1656)TCC>TCT		amyotrophic lateral sclerosis 2 (juvenile)							120.0	115.0	117.0					2																	203846375		1841	4088	5929	SO:0001819	synonymous_variant	79800							g.chr2:203846375C>T	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1656C>T	2.37:g.203846375C>T			Somatic				ALS2CR8_uc010zia.1_Silent_p.S476S|ALS2CR8_uc010zib.1_Silent_p.S476S|ALS2CR8_uc010zic.1_Silent_p.S464S|ALS2CR8_uc002uzp.2_Silent_p.S552S	p.S552S	NM_001104586	NP_001098056	WXS	Illumina HiSeq	Unspecified	Q8N187	AL2S8_HUMAN			14	1936	+			552					B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Silent	SNP	ENST00000402905.3	37	c.1656C>T	CCDS42801.1																																																																																				0.413	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586		36	76	0	0	0	0.080422	0	36	76				
TNP1	7141	broad.mit.edu	37	2	217724654	217724654	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:217724654T>A	ENST00000236979.2	-	1	133	c.104A>T	c.(103-105)aAg>aTg	p.K35M	AC007563.5_ENST00000447289.1_RNA|AC007563.5_ENST00000607591.1_RNA	NM_003284.3	NP_003275.1	P09430	STP1_HUMAN	transition protein 1 (during histone to protamine replacement)	35					chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|fertilization, exchange of chromosomal proteins (GO:0035042)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|sexual reproduction (GO:0019953)|single strand break repair (GO:0000012)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|spermatid nucleus elongation (GO:0007290)	male germ cell nucleus (GO:0001673)|nucleosome (GO:0000786)	DNA binding (GO:0003677)			large_intestine(1)|lung(1)|stomach(1)	3		Renal(207;0.0822)		Epithelial(149;8.97e-07)|all cancers(144;2.46e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGTTGCCCTTACGGTATTT	0.532																																							uc002vgk.2		NA																	0					0						c.(103-105)AAG>ATG		transition protein 1 (during histone to							211.0	191.0	198.0					2																	217724654		2203	4300	6503	SO:0001583	missense	7141				chromatin silencing|fertilization, exchange of chromosomal proteins|multicellular organismal development|nucleosome disassembly|single strand break repair|sperm motility|spermatid nucleus elongation	nucleosome	DNA binding	g.chr2:217724654T>A		CCDS2406.1	2q35-q36	2008-06-03			ENSG00000118245	ENSG00000118245			11951	protein-coding gene	gene with protein product		190231				2249851	Standard	NM_003284		Approved		uc002vgk.3	P09430	OTTHUMG00000133057	ENST00000236979.2:c.104A>T	2.37:g.217724654T>A	ENSP00000236979:p.Lys35Met		Somatic					p.K35M	NM_003284	NP_003275	WXS	Illumina HiSeq	Unspecified	P09430	STP1_HUMAN		Epithelial(149;8.97e-07)|all cancers(144;2.46e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	1	129	-		Renal(207;0.0822)	35						Missense_Mutation	SNP	ENST00000236979.2	37	c.104A>T	CCDS2406.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347718	0.41599	.	.	ENSG00000118245	ENST00000236979	.	.	.	5.55	1.89	0.25635	Nuclear transition protein 1, conserved site (1);	0.097005	0.45867	D	0.000340	T	0.51278	0.1665	.	.	.	0.23082	N	0.998325	D	0.58620	0.983	P	0.60886	0.88	T	0.42015	-0.9476	8	0.87932	D	0	-9.0784	4.4822	0.11773	0.0:0.1702:0.1668:0.663	.	35	P09430	STP1_HUMAN	M	35	.	ENSP00000236979:K35M	K	-	2	0	TNP1	217432899	0.299000	0.24426	0.689000	0.30133	0.959000	0.62525	0.444000	0.21661	0.176000	0.19873	-0.274000	0.10170	AAG		0.532	TNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256673.1	NM_003284		39	111	0	0	0	0.104719	0	39	111				
ATG9A	79065	broad.mit.edu	37	2	220087499	220087499	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr2:220087499C>T	ENST00000409618.1	-	11	2155	c.1716G>A	c.(1714-1716)gaG>gaA	p.E572E	ATG9A_ENST00000396761.2_Silent_p.E572E|ATG9A_ENST00000409422.1_Silent_p.E511E|ATG9A_ENST00000361242.4_Silent_p.E572E|AC068946.1_ENST00000408417.1_RNA			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	572					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGCTGTGCTCTCACGTGGTG	0.572																																							uc002vke.1		NA																	0				skin(1)	1						c.(1714-1716)GAG>GAA		APG9 autophagy 9-like 1							122.0	133.0	129.0					2																	220087499		2120	4235	6355	SO:0001819	synonymous_variant	79065				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane		g.chr2:220087499C>T	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.1716G>A	2.37:g.220087499C>T			Somatic				ABCB6_uc010fwe.1_5'Flank|ABCB6_uc010zku.1_5'Flank|ATG9A_uc002vkd.1_RNA|ATG9A_uc002vkf.1_Silent_p.E572E	p.E572E	NM_001077198	NP_001070666	WXS	Illumina HiSeq	Unspecified	Q7Z3C6	ATG9A_HUMAN		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	11	1902	-		Renal(207;0.0474)	572			Cytoplasmic (By similarity).		Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Silent	SNP	ENST00000409618.1	37	c.1716G>A	CCDS42820.1																																																																																				0.572	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085		37	90	0	0	0	0.074837	0	37	90				
JPH2	57158	broad.mit.edu	37	20	42788302	42788302	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr20:42788302G>T	ENST00000372980.3	-	2	1997	c.1125C>A	c.(1123-1125)cgC>cgA	p.R375R		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	375	Ala-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TAGCAGCGGCGCGCTGGGCAC	0.667																																							uc002xli.1		NA																	0					0						c.(1123-1125)CGC>CGA		junctophilin 2 isoform 1							35.0	31.0	33.0					20																	42788302		2202	4300	6502	SO:0001819	synonymous_variant	57158				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane		g.chr20:42788302G>T	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1125C>A	20.37:g.42788302G>T			Somatic					p.R375R	NM_020433	NP_065166	WXS	Illumina HiSeq	Unspecified	Q9BR39	JPH2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		2	1998	-		Myeloproliferative disorder(115;0.0122)	375			Ala-rich.|Cytoplasmic (Potential).		E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	ENST00000372980.3	37	c.1125C>A	CCDS13325.1																																																																																				0.667	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1			13	31	1	0	1.5739e-10	0.028581	1.89022e-10	13	31				
MMP9	4318	broad.mit.edu	37	20	44640804	44640804	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr20:44640804G>T	ENST00000372330.3	+	7	1045	c.1026G>T	c.(1024-1026)tcG>tcT	p.S342S	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	342	Fibronectin type-II 3. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	GGGGCAACTCGGCGGGGGAGC	0.632																																							uc002xqz.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1024-1026)TCG>TCT		matrix metalloproteinase 9 preproprotein	Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)						57.0	67.0	63.0					20																	44640804		2203	4300	6503	SO:0001819	synonymous_variant	4318				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding	g.chr20:44640804G>T		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1026G>T	20.37:g.44640804G>T			Somatic					p.S342S	NM_004994	NP_004985	WXS	Illumina HiSeq	Unspecified	P14780	MMP9_HUMAN			7	1045	+		Myeloproliferative disorder(115;0.0122)	342			Fibronectin type-II 3.		B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	ENST00000372330.3	37	c.1026G>T	CCDS13390.1																																																																																				0.632	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1			49	100	1	0	3.50607e-19	0.048971	4.85303e-19	49	100				
PREX1	57580	broad.mit.edu	37	20	47265961	47265961	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr20:47265961T>A	ENST00000371941.3	-	25	3204	c.3182A>T	c.(3181-3183)gAc>gTc	p.D1061V	PREX1_ENST00000396220.1_Missense_Mutation_p.D1061V	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1061					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GAGGCCCCGGTCTTCCTGACC	0.612																																							uc002xtw.1		NA																	0				lung(3)|ovary(2)|pancreas(1)	6						c.(3181-3183)GAC>GTC		phosphatidylinositol-3,4,							67.0	67.0	67.0					20																	47265961		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47265961T>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3182A>T	20.37:g.47265961T>A	ENSP00000361009:p.Asp1061Val		Somatic				PREX1_uc002xtv.1_Missense_Mutation_p.D358V	p.D1061V	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		25	3205	-			1061					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.3182A>T	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.488866	0.64074	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.37915	1.17;1.17	4.74	4.74	0.60224	.	0.237771	0.28790	U	0.014135	T	0.34366	0.0895	N	0.22421	0.69	0.52501	D	0.999959	P;P	0.44734	0.822;0.842	B;P	0.47827	0.432;0.558	T	0.22906	-1.0203	10	0.66056	D	0.02	.	14.2689	0.66140	0.0:0.0:0.0:1.0	.	1061;358	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	V	1061	ENSP00000361009:D1061V;ENSP00000379522:D1061V	ENSP00000361009:D1061V	D	-	2	0	PREX1	46699368	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	3.387000	0.52501	1.763000	0.52060	0.533000	0.62120	GAC		0.612	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		27	60	0	0	0	0.041601	0	27	60				
KRTAP19-5	337972	broad.mit.edu	37	21	31874246	31874246	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr21:31874246A>G	ENST00000334151.2	-	1	189	c.163T>C	c.(163-165)Tac>Cac	p.Y55H		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	55						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CAGCTGCGGTATCCATAGCCT	0.532																																							uc011ada.1		NA																	0					0						c.(163-165)TAC>CAC		keratin associated protein 19-5							117.0	115.0	116.0					21																	31874246		2203	4300	6503	SO:0001583	missense	337972					intermediate filament	protein binding	g.chr21:31874246A>G	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.163T>C	21.37:g.31874246A>G	ENSP00000334985:p.Tyr55His		Somatic					p.Y55H	NM_181611	NP_853642	WXS	Illumina HiSeq	Unspecified	Q3LI72	KR195_HUMAN			1	163	-			55					A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	c.163T>C	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	A	9.274	1.046320	0.19748	.	.	ENSG00000186977	ENST00000334151	T	0.16743	2.32	4.5	3.31	0.37934	.	0.000000	0.36409	U	0.002608	T	0.12817	0.0311	.	.	.	0.09310	N	1	B	0.24258	0.1	B	0.21151	0.033	T	0.20638	-1.0269	9	0.87932	D	0	-0.1439	7.2331	0.26053	0.8931:0.0:0.1069:0.0	.	55	Q3LI72	KR195_HUMAN	H	55	ENSP00000334985:Y55H	ENSP00000334985:Y55H	Y	-	1	0	KRTAP19-5	30796117	0.002000	0.14202	0.001000	0.08648	0.171000	0.22731	1.508000	0.35769	0.639000	0.30564	0.482000	0.46254	TAC		0.532	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2			59	164	0	0	0	0.048971	0	59	164				
PAXBP1	94104	broad.mit.edu	37	21	34132126	34132126	+	Silent	SNP	G	G	A	rs144407550		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr21:34132126G>A	ENST00000331923.4	-	6	1344	c.1155C>T	c.(1153-1155)ccC>ccT	p.P385P	PAXBP1_ENST00000290178.4_Silent_p.P385P|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	385	Necessary and sufficient for interaction with PAX7. {ECO:0000250}.				muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CAATAGTAACGGGAGTCATCT	0.408																																							uc002yqn.2		NA																	0				ovary(2)	2						c.(1153-1155)CCC>CCT		GC-rich sequence DNA-binding factor candidate		G	,	0,4406		0,0,2203	178.0	172.0	174.0		1155,1155	3.8	1.0	21	dbSNP_134	174	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GCFC1	NM_013329.3,NM_016631.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	385/816,385/918	34132126	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	94104					cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr21:34132126G>A	AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1155C>T	21.37:g.34132126G>A			Somatic				GCFC1_uc002yqo.2_RNA|GCFC1_uc002yqp.2_Silent_p.P385P|GCFC1_uc002yqr.2_Silent_p.P385P	p.P385P	NM_016631	NP_057715	WXS	Illumina HiSeq	Unspecified	Q9Y5B6	GCFC1_HUMAN			6	1345	-			385					D3DSE7|Q96DU8|Q9NYQ0	Silent	SNP	ENST00000331923.4	37	c.1155C>T	CCDS13619.1																																																																																				0.408	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329		85	144	0	0	0	0.048971	0	85	144				
KCNE1	3753	broad.mit.edu	37	21	35821633	35821633	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr21:35821633C>A	ENST00000337385.3	-	3	675	c.300G>T	c.(298-300)ctG>ctT	p.L100L	KCNE1_ENST00000432085.1_Silent_p.L100L|KCNE1_ENST00000399284.1_Silent_p.L100L|KCNE1_ENST00000399286.2_Silent_p.L100L|KCNE1_ENST00000399289.3_Silent_p.L100L|KCNE1_ENST00000416357.2_Silent_p.L100L	NM_001270402.1|NM_001270403.1	NP_001257331.1|NP_001257332.1	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related family, member 1	100					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular response to cAMP (GO:0071320)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|protein N-linked glycosylation (GO:0006487)|protein O-linked glycosylation (GO:0006493)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	potassium channel regulator activity (GO:0015459)|telethonin binding (GO:0031433)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(4)|lung(1)|ovary(2)	7					Indapamide(DB00808)	TGTAGCTCTCCAGGACCCGGG	0.557																																							uc010gmp.2		NA																	0				ovary(2)	2						c.(298-300)CTG>CTT		potassium voltage-gated channel, Isk-related	Indapamide(DB00808)						111.0	118.0	115.0					21																	35821633		2203	4300	6503	SO:0001819	synonymous_variant	3753				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound	lysosome	delayed rectifier potassium channel activity|potassium channel regulator activity	g.chr21:35821633C>A	L28168	CCDS13636.1	21q22.1-q22.2	2014-09-17			ENSG00000180509	ENSG00000180509		"""Potassium channels"""	6240	protein-coding gene	gene with protein product		176261				8432548	Standard	NM_001127670		Approved	minK, ISK, JLNS2, LQT5	uc010gmp.4	P15382	OTTHUMG00000086236	ENST00000337385.3:c.300G>T	21.37:g.35821633C>A			Somatic				KCNE1_uc002ytz.2_Silent_p.L100L|KCNE1_uc010gmq.2_Silent_p.L100L|KCNE1_uc010gmr.2_Silent_p.L100L|KCNE1_uc010gms.2_Silent_p.L100L|KCNE1_uc002yua.2_RNA	p.L100L	NM_001127670	NP_001121142	WXS	Illumina HiSeq	Unspecified	P15382	KCNE1_HUMAN			2	730	-			100			Cytoplasmic (Potential).		A5H1P2|Q8N709|Q91Z94	Silent	SNP	ENST00000337385.3	37	c.300G>T	CCDS13636.1																																																																																				0.557	KCNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194155.1			63	120	1	0	1.53716e-24	0.048971	2.21531e-24	63	120				
ADARB1	104	broad.mit.edu	37	21	46596226	46596226	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr21:46596226G>T	ENST00000360697.3	+	2	625	c.610G>T	c.(610-612)Ggg>Tgg	p.G204W	ADARB1_ENST00000348831.4_Missense_Mutation_p.G204W|ADARB1_ENST00000389863.4_Missense_Mutation_p.G204W|ADARB1_ENST00000539173.1_Missense_Mutation_p.G204W|ADARB1_ENST00000437626.1_Intron			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	204					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		CAGTTCCAGCGGGGACCTCAG	0.592																																							uc002zgy.2		NA																	0				skin(1)	1						c.(610-612)GGG>TGG		RNA-specific adenosine deaminase B1 isoform 2							60.0	60.0	60.0					21																	46596226		2203	4300	6503	SO:0001583	missense	104				adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding	g.chr21:46596226G>T	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.610G>T	21.37:g.46596226G>T	ENSP00000353920:p.Gly204Trp		Somatic				ADARB1_uc002zgr.2_Missense_Mutation_p.G204W|ADARB1_uc002zgs.2_RNA|ADARB1_uc002zgw.2_Missense_Mutation_p.G204W|ADARB1_uc002zgv.2_RNA|ADARB1_uc002zgt.2_Missense_Mutation_p.G204W|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_RNA|ADARB1_uc002zgu.2_RNA|ADARB1_uc011afo.1_Missense_Mutation_p.G253W	p.G204W	NM_015833	NP_056648	WXS	Illumina HiSeq	Unspecified	P78563	RED1_HUMAN		Colorectal(79;0.115)	4	1045	+			204					A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	c.610G>T	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.752944	0.69648	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	T;T;T;T	0.33654	1.4;1.4;1.42;1.4	4.96	4.96	0.65561	.	0.474164	0.24691	N	0.036399	T	0.51618	0.1685	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.998;0.999	D;D;D;D;D	0.67382	0.943;0.921;0.951;0.934;0.943	T	0.52719	-0.8538	10	0.72032	D	0.01	-29.4935	9.6926	0.40139	0.095:0.0:0.905:0.0	.	231;204;204;232;204	P78563-4;P78563;Q4AE77;G5E9B4;P78563-3	.;RED1_HUMAN;.;.;.	W	204	ENSP00000441897:G204W;ENSP00000374513:G204W;ENSP00000015877:G204W;ENSP00000353920:G204W	ENSP00000015877:G204W	G	+	1	0	ADARB1	45420654	1.000000	0.71417	0.990000	0.47175	0.966000	0.64601	5.016000	0.64041	2.460000	0.83146	0.655000	0.94253	GGG		0.592	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833		18	40	1	0	5.3912e-06	0.038395	6.05892e-06	18	40				
COL6A2	1292	broad.mit.edu	37	21	47535957	47535957	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr21:47535957C>G	ENST00000300527.4	+	7	994	c.890C>G	c.(889-891)cCa>cGa	p.P297R	COL6A2_ENST00000310645.5_Missense_Mutation_p.P297R|COL6A2_ENST00000397763.1_Missense_Mutation_p.P297R|COL6A2_ENST00000357838.4_Missense_Mutation_p.P297R|COL6A2_ENST00000409416.1_Missense_Mutation_p.P297R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	297	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ATTGGATTCCCAGGACCCAAG	0.711																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(889-891)CCA>CGA		alpha 2 type VI collagen isoform 2C2 precursor							23.0	23.0	23.0					21																	47535957		2191	4291	6482	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47535957C>G	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.890C>G	21.37:g.47535957C>G	ENSP00000300527:p.Pro297Arg		Somatic				COL6A2_uc002zhy.1_Missense_Mutation_p.P297R|COL6A2_uc002zhz.1_Missense_Mutation_p.P297R|COL6A2_uc002zib.1_Intron	p.P297R	NM_001849	NP_001840	WXS	Illumina HiSeq	Unspecified	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	7	972	+	Breast(49;0.245)		297			Triple-helical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.890C>G	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178490	0.57692	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-3.34	4.26	4.26	0.50523	.	0.115441	0.64402	D	0.000012	D	0.94686	0.8286	L	0.57536	1.79	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.829	D;D;P	0.79784	0.993;0.993;0.46	D	0.92059	0.5655	10	0.05351	T	0.99	-4.2384	17.0468	0.86505	0.0:1.0:0.0:0.0	.	297;297;297	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	R	297	ENSP00000300527:P297R;ENSP00000350497:P297R;ENSP00000312529:P297R;ENSP00000387115:P297R;ENSP00000380870:P297R	ENSP00000300527:P297R	P	+	2	0	COL6A2	46360385	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.436000	0.66538	2.101000	0.63845	0.561000	0.74099	CCA		0.711	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			4	6	0	0	0	0.009096	0	4	6				
EFCAB6	64800	broad.mit.edu	37	22	43930600	43930600	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr22:43930600G>C	ENST00000262726.7	-	30	4454	c.4201C>G	c.(4201-4203)Cac>Gac	p.H1401D	EFCAB6-AS1_ENST00000431327.3_RNA|EFCAB6_ENST00000461800.1_5'UTR|EFCAB6_ENST00000396231.2_Missense_Mutation_p.H1249D	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1401	Interaction with PARK7.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TTCATCCTGTGCATCAGTGAG	0.433																																							uc003bdy.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7						c.(4201-4203)CAC>GAC		CAP-binding protein complex interacting protein							116.0	96.0	103.0					22																	43930600		2203	4300	6503	SO:0001583	missense	64800				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding	g.chr22:43930600G>C	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.4201C>G	22.37:g.43930600G>C	ENSP00000262726:p.His1401Asp		Somatic				EFCAB6_uc003bdz.1_Missense_Mutation_p.H1249D|EFCAB6_uc010gzi.1_Missense_Mutation_p.H1249D	p.H1401D	NM_022785	NP_073622	WXS	Illumina HiSeq	Unspecified	Q5THR3	EFCB6_HUMAN			30	4416	-		Ovarian(80;0.0247)|all_neural(38;0.025)	1401			Interaction with PARK7.		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	c.4201C>G	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.424920	0.25639	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.14144	2.53;2.53	5.31	5.31	0.75309	.	0.557556	0.18273	N	0.146258	T	0.09423	0.0232	N	0.14661	0.345	0.80722	D	1	B	0.18610	0.029	B	0.15870	0.014	T	0.26503	-1.0101	10	0.14656	T	0.56	-3.8279	16.7759	0.85550	0.0:0.0:1.0:0.0	.	1401	Q5THR3	EFCB6_HUMAN	D	1249;1401	ENSP00000379533:H1249D;ENSP00000262726:H1401D	ENSP00000262726:H1401D	H	-	1	0	EFCAB6	42261933	1.000000	0.71417	0.977000	0.42913	0.036000	0.12997	3.969000	0.56816	2.480000	0.83734	0.655000	0.94253	CAC		0.433	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		12	21	0	0	0	0.105934	0	12	21				
LRPAP1	4043	broad.mit.edu	37	4	3521828	3521828	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr4:3521828C>A	ENST00000500728.2	-	3	588	c.442G>T	c.(442-444)Gac>Tac	p.D148Y	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	148					extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		AGCCTGGGGTCATCCAGCCCG	0.552																																							uc003ghi.2		NA																	0				ovary(1)|skin(1)	2						c.(442-444)GAC>TAC		low density lipoprotein receptor-related protein							125.0	111.0	116.0					4																	3521828		2203	4300	6503	SO:0001583	missense	4043				negative regulation of protein binding|negative regulation of very-low-density lipoprotein particle clearance|protein folding|vesicle-mediated transport	cell surface|integral to membrane|plasma membrane	asialoglycoprotein receptor activity|heparin binding|low-density lipoprotein particle receptor binding|receptor antagonist activity|unfolded protein binding|very-low-density lipoprotein particle receptor binding	g.chr4:3521828C>A		CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.442G>T	4.37:g.3521828C>A	ENSP00000421922:p.Asp148Tyr		Somatic					p.D148Y	NM_002337	NP_002328	WXS	Illumina HiSeq	Unspecified	P30533	AMRP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.165)	3	527	-			148					D3DVR9|Q2M310|Q53HQ3|Q53HS6	Missense_Mutation	SNP	ENST00000500728.2	37	c.442G>T	CCDS3371.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976640	0.53720	.	.	ENSG00000163956	ENST00000500728	T	0.64085	-0.08	4.83	4.83	0.62350	Alpha-2-macroglobulin receptor-associated protein, domain 1 (1);Alpha-2-macroglobulin RAP, C-terminal (1);	0.106278	0.64402	D	0.000008	T	0.80460	0.4627	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83985	0.0334	10	0.87932	D	0	-57.6159	15.4438	0.75213	0.0:1.0:0.0:0.0	.	148	P30533	AMRP_HUMAN	Y	148	ENSP00000421922:D148Y	ENSP00000421922:D148Y	D	-	1	0	LRPAP1	3491626	1.000000	0.71417	0.633000	0.29310	0.004000	0.04260	6.388000	0.73195	2.218000	0.71995	0.563000	0.77884	GAC		0.552	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4			17	67	1	0	5.35267e-07	0.043863	6.09955e-07	17	67				
SLIT2	9353	broad.mit.edu	37	4	20570575	20570575	+	Silent	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr4:20570575A>T	ENST00000504154.1	+	29	3288	c.3036A>T	c.(3034-3036)acA>acT	p.T1012T	SLIT2_ENST00000273739.5_Silent_p.T1016T|SLIT2_ENST00000503823.1_Silent_p.T1004T|SLIT2_ENST00000503837.1_Silent_p.T1008T	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1012	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ATAATTCTACATGTGTCGATG	0.363																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(3034-3036)ACA>ACT		slit homolog 2 precursor							171.0	161.0	164.0					4																	20570575		2203	4300	6503	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20570575A>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3036A>T	4.37:g.20570575A>T			Somatic				SLIT2_uc003gps.1_Silent_p.T1004T	p.T1012T	NM_004787	NP_004778	WXS	Illumina HiSeq	Unspecified	O94813	SLIT2_HUMAN			29	3240	+			1012			EGF-like 3; calcium-binding (Potential).		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.3036A>T	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	A	7.948	0.744248	0.15710	.	.	ENSG00000145147	ENST00000509941	.	.	.	5.61	-11.2	0.00127	.	.	.	.	.	T	0.32882	0.0844	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42155	-0.9468	4	.	.	.	.	2.5546	0.04756	0.1015:0.26:0.3205:0.318	.	.	.	.	L	143	.	.	M	+	1	0	SLIT2	20179673	0.004000	0.15560	0.151000	0.22473	0.985000	0.73830	-0.939000	0.03933	-2.843000	0.00334	-1.139000	0.01908	ATG		0.363	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			40	56	0	0	0	0.074837	0	40	56				
CCKAR	886	broad.mit.edu	37	4	26483656	26483656	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr4:26483656C>A	ENST00000295589.3	-	5	1085	c.891G>T	c.(889-891)cgG>cgT	p.R297R		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	297					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	AGCTGTTACTCCGGATGCGGT	0.602																																							uc003gse.1		NA																	0				lung(3)|pancreas(1)	4						c.(889-891)CGG>CGT		cholecystokinin A receptor	Ceruletide(DB00403)						92.0	82.0	85.0					4																	26483656		2203	4300	6503	SO:0001819	synonymous_variant	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26483656C>A	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.891G>T	4.37:g.26483656C>A			Somatic					p.R297R	NM_000730	NP_000721	WXS	Illumina HiSeq	Unspecified	P32238	CCKAR_HUMAN			5	1044	-		Breast(46;0.0503)	297			Cytoplasmic (Potential).		B2R9Z5	Silent	SNP	ENST00000295589.3	37	c.891G>T	CCDS3438.1																																																																																				0.602	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			56	101	1	0	5.22555e-25	0.048971	7.6206e-25	56	101				
FRYL	285527	broad.mit.edu	37	4	48555252	48555252	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr4:48555252T>C	ENST00000503238.1	-	33	4414	c.4415A>G	c.(4414-4416)aAa>aGa	p.K1472R	FRYL_ENST00000358350.4_Missense_Mutation_p.K1472R|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.K1472R|FRYL_ENST00000507711.1_Missense_Mutation_p.K1472R|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGAAGGGATTTTATAGCTGGA	0.448																																							uc003gyh.1		NA																	0				skin(1)	1						c.(4414-4416)AAA>AGA		furry-like							89.0	89.0	89.0					4																	48555252		1886	4123	6009	SO:0001583	missense	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48555252T>C	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4415A>G	4.37:g.48555252T>C	ENSP00000426064:p.Lys1472Arg		Somatic				FRYL_uc003gyk.2_Missense_Mutation_p.K1472R|FRYL_uc003gyg.1_Missense_Mutation_p.K168R|FRYL_uc003gyi.1_Missense_Mutation_p.K361R	p.K1472R	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			36	5020	-			1472					O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	c.4415A>G	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466566	0.84425	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.50277	1.68;1.68;1.68;0.75	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.76494	0.979;0.999;0.998;0.997	D;D;D;D	0.79784	0.973;0.993;0.978;0.984	T	0.64368	-0.6424	10	0.44086	T	0.13	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	1472;303;1472;1472	F2Z2S2;Q6ZR29;O94915;F5GX82	.;.;FRYL_HUMAN;.	R	1472	ENSP00000426064:K1472R;ENSP00000351113:K1472R;ENSP00000441114:K1472R;ENSP00000421584:K1472R	ENSP00000351113:K1472R	K	-	2	0	FRYL	48250009	1.000000	0.71417	0.376000	0.26042	0.449000	0.32228	5.914000	0.69964	2.324000	0.78689	0.533000	0.62120	AAA		0.448	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			24	54	0	0	0	0.099896	0	24	54				
NDST4	64579	broad.mit.edu	37	4	115760697	115760697	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr4:115760697C>A	ENST00000264363.2	-	11	2801	c.2123G>T	c.(2122-2124)cGa>cTa	p.R708L		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	708	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TTCATGTGATCGTTGGTGCTT	0.378																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(2122-2124)CGA>CTA		heparan sulfate N-deacetylase/N-sulfotransferase							114.0	116.0	116.0					4																	115760697		2203	4300	6503	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115760697C>A	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2123G>T	4.37:g.115760697C>A	ENSP00000264363:p.Arg708Leu		Somatic				NDST4_uc010imw.2_RNA	p.R708L	NM_022569	NP_072091	WXS	Illumina HiSeq	Unspecified	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	11	2802	-		Ovarian(17;0.156)	708			Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.2123G>T	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504086	0.64410	.	.	ENSG00000138653	ENST00000264363	D	0.83914	-1.78	6.17	6.17	0.99709	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.81427	0.4820	L	0.49699	1.58	0.80722	D	1	B	0.29378	0.243	B	0.29267	0.1	T	0.75476	-0.3304	10	0.31617	T	0.26	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	708	Q9H3R1	NDST4_HUMAN	L	708	ENSP00000264363:R708L	ENSP00000264363:R708L	R	-	2	0	NDST4	115980146	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CGA		0.378	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		31	20	1	0	9.65021e-13	0.045705	1.21246e-12	31	20				
ADAMTS16	170690	broad.mit.edu	37	5	5191905	5191905	+	Splice_Site	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:5191905T>G	ENST00000274181.7	+	8	1451		c.e8+2		ADAMTS16_ENST00000511368.1_Splice_Site	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16						branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TGGACACAAGTAAGTGCATCT	0.443																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.e8+2		ADAM metallopeptidase with thrombospondin type 1							152.0	145.0	147.0					5																	5191905		1956	4153	6109	SO:0001630	splice_region_variant	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5191905T>G	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1313+2T>G	5.37:g.5191905T>G			Somatic				ADAMTS16_uc003jdk.1_Splice_Site_p.N438_splice|ADAMTS16_uc003jdj.1_Splice_Site_p.N438_splice	p.N438_splice	NM_139056	NP_620687	WXS	Illumina HiSeq	Unspecified	Q8TE57	ATS16_HUMAN			8	1451	+								C6G490|Q8IVE2	Splice_Site	SNP	ENST00000274181.7	37	c.1313_splice	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.233835	0.79688	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8875	0.58053	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS16	5244905	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	7.532000	0.81985	1.691000	0.51100	0.533000	0.62120	.		0.443	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	Intron	47	75	0	0	0	0.048971	0	47	75				
PAPD7	11044	broad.mit.edu	37	5	6753049	6753049	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:6753049G>T	ENST00000230859.6	+	12	1462	c.1333G>T	c.(1333-1335)Gta>Tta	p.V445L		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	675	PAP-associated.				double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ACAAGCTGGTGTAGAAGGAAC	0.542																																					NSCLC(7;212 333 5667 23379 46547)	NSCLC(7;212 333 5667 23379 46547)	uc003jdx.1		NA																	0				ovary(1)	1						c.(1333-1335)GTA>TTA		DNA polymerase sigma							137.0	124.0	128.0					5																	6753049		2203	4300	6503	SO:0001583	missense	11044				cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding	g.chr5:6753049G>T	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1333G>T	5.37:g.6753049G>T	ENSP00000230859:p.Val445Leu		Somatic				PAPD7_uc011cmn.1_Missense_Mutation_p.V436L|PAPD7_uc010itl.1_Missense_Mutation_p.V265L	p.V445L	NM_006999	NP_008930	WXS	Illumina HiSeq	Unspecified	Q5XG87	PAPD7_HUMAN			12	1462	+			445					A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	c.1333G>T	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	G	6.356	0.433843	0.12045	.	.	ENSG00000112941	ENST00000230859	T	0.30182	1.54	5.35	0.845	0.18950	.	0.831855	0.10804	N	0.632341	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35992	-0.9766	10	0.10636	T	0.68	-7.9369	5.2492	0.15514	0.3604:0.1794:0.4602:0.0	.	445;445	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	L	445	ENSP00000230859:V445L	ENSP00000230859:V445L	V	+	1	0	PAPD7	6806049	0.003000	0.15002	0.000000	0.03702	0.131000	0.20780	0.347000	0.20014	0.218000	0.20820	0.655000	0.94253	GTA		0.542	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999		50	94	1	0	5.82388e-19	0.048971	8.01602e-19	50	94				
CDH10	1008	broad.mit.edu	37	5	24511448	24511448	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:24511448G>C	ENST00000264463.4	-	6	1497	c.990C>G	c.(988-990)atC>atG	p.I330M		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	330	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TTTTCACAGTGATGATGCCTT	0.413										HNSCC(23;0.051)																													uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(988-990)ATC>ATG		cadherin 10, type 2 preproprotein							241.0	192.0	209.0					5																	24511448		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24511448G>C	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.990C>G	5.37:g.24511448G>C	ENSP00000264463:p.Ile330Met	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.I330M	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	6	1322	-			330			Cadherin 3.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.990C>G	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	T	7.887	0.731482	0.15507	.	.	ENSG00000040731	ENST00000264463	T	0.61040	0.14	5.22	-2.03	0.07365	Cadherin (5);Cadherin-like (1);	0.103516	0.64402	D	0.000007	T	0.80757	0.4684	H	0.97491	4.015	0.30469	N	0.773495	P	0.38078	0.617	D	0.70227	0.968	T	0.76027	-0.3109	10	0.87932	D	0	.	5.7311	0.18040	0.1805:0.0645:0.5094:0.2455	.	330	Q9Y6N8	CAD10_HUMAN	M	330	ENSP00000264463:I330M	ENSP00000264463:I330M	I	-	3	3	CDH10	24547205	0.277000	0.24220	0.975000	0.42487	0.830000	0.47004	-0.556000	0.05992	-0.273000	0.09246	-1.170000	0.01741	ATC		0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		58	152	0	0	0	0.048971	0	58	152				
DAB2	1601	broad.mit.edu	37	5	39377150	39377150	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:39377150G>A	ENST00000320816.6	-	12	2206	c.1739C>T	c.(1738-1740)gCa>gTa	p.A580V	DAB2_ENST00000509337.1_Missense_Mutation_p.A559V|DAB2_ENST00000339788.6_Missense_Mutation_p.A362V|DAB2_ENST00000545653.1_Missense_Mutation_p.A559V	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	580					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			AGCATTGGGTGCCACAGATGC	0.547											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003jlx.2		NA																	0				kidney(2)|skin(1)	3						c.(1738-1740)GCA>GTA		disabled homolog 2							75.0	83.0	80.0					5																	39377150		2203	4300	6503	SO:0001583	missense	1601				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding	g.chr5:39377150G>A	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1739C>T	5.37:g.39377150G>A	ENSP00000313391:p.Ala580Val		Somatic	OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	885	DAB2_uc003jlw.2_Missense_Mutation_p.A559V	p.A580V	NM_001343	NP_001334	WXS	Illumina HiSeq	Unspecified	P98082	DAB2_HUMAN	Epithelial(62;0.137)		12	2270	-	all_lung(31;0.000197)		580					A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	c.1739C>T	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187224	0.38609	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.37752	1.21;1.18;1.21;1.21	5.57	5.57	0.84162	.	0.570913	0.17728	N	0.163993	T	0.33177	0.0854	L	0.40543	1.245	0.09310	N	1	B;B	0.23058	0.079;0.015	B;B	0.23419	0.046;0.046	T	0.21621	-1.0240	10	0.51188	T	0.08	-3.1415	14.3978	0.67022	0.0:0.0:0.8524:0.1476	.	580;559	P98082;P98082-3	DAB2_HUMAN;.	V	580;362;559;559	ENSP00000313391:A580V;ENSP00000345508:A362V;ENSP00000439919:A559V;ENSP00000426245:A559V	ENSP00000313391:A580V	A	-	2	0	DAB2	39412907	0.562000	0.26586	0.996000	0.52242	0.823000	0.46562	3.249000	0.51437	2.617000	0.88574	0.655000	0.94253	GCA		0.547	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343		57	80	0	0	0	0.048971	0	57	80				
DAB2	1601	broad.mit.edu	37	5	39383033	39383033	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:39383033A>G	ENST00000320816.6	-	10	1495	c.1028T>C	c.(1027-1029)tTt>tCt	p.F343S	DAB2_ENST00000509337.1_Missense_Mutation_p.F322S|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000545653.1_Missense_Mutation_p.F322S|DAB2_ENST00000512525.1_5'Flank	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	343	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TTGCTGACCAAAGTAGTCAAC	0.493																																							uc003jlx.2		NA																	0				kidney(2)|skin(1)	3						c.(1027-1029)TTT>TCT		disabled homolog 2							86.0	89.0	88.0					5																	39383033		2203	4300	6503	SO:0001583	missense	1601				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding	g.chr5:39383033A>G	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1028T>C	5.37:g.39383033A>G	ENSP00000313391:p.Phe343Ser		Somatic				DAB2_uc003jlw.2_Missense_Mutation_p.F322S	p.F343S	NM_001343	NP_001334	WXS	Illumina HiSeq	Unspecified	P98082	DAB2_HUMAN	Epithelial(62;0.137)		10	1559	-	all_lung(31;0.000197)		343					A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	c.1028T>C	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	A	18.36	3.607977	0.66558	.	.	ENSG00000153071	ENST00000320816;ENST00000545653;ENST00000509337	T;T;T	0.48201	0.86;0.82;0.82	5.73	4.55	0.56014	.	0.189573	0.56097	D	0.000022	T	0.61286	0.2335	L	0.60455	1.87	0.36738	D	0.882054	D;D	0.76494	0.998;0.999	D;D	0.71656	0.909;0.974	T	0.64664	-0.6354	10	0.29301	T	0.29	-15.1749	12.5187	0.56046	0.8749:0.0:0.0:0.1251	.	343;322	P98082;P98082-3	DAB2_HUMAN;.	S	343;322;322	ENSP00000313391:F343S;ENSP00000439919:F322S;ENSP00000426245:F322S	ENSP00000313391:F343S	F	-	2	0	DAB2	39418790	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.532000	0.90613	1.078000	0.41014	0.533000	0.62120	TTT		0.493	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343		6	115	0	0	0	0.021553	0	6	115				
HCN1	348980	broad.mit.edu	37	5	45303793	45303793	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:45303793C>A	ENST00000303230.4	-	6	1583	c.1526G>T	c.(1525-1527)gGt>gTt	p.G509V		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	509					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CATTTTTTTACCCACGGCTCC	0.398																																							uc003jok.2		NA																	0				ovary(1)	1						c.(1525-1527)GGT>GTT		hyperpolarization activated cyclic							113.0	111.0	112.0					5																	45303793		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45303793C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1526G>T	5.37:g.45303793C>A	ENSP00000307342:p.Gly509Val		Somatic					p.G509V	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			6	1551	-			509			cAMP.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.1526G>T	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904152	0.92035	.	.	ENSG00000164588	ENST00000303230	D	0.93076	-3.16	5.62	5.62	0.85841	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000002	D	0.98257	0.9423	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99013	1.0815	10	0.87932	D	0	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	509	O60741	HCN1_HUMAN	V	509	ENSP00000307342:G509V	ENSP00000307342:G509V	G	-	2	0	HCN1	45339550	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.809000	0.96659	0.655000	0.94253	GGT		0.398	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		42	83	1	0	3.54909e-21	0.042209	4.99728e-21	42	83				
EDIL3	10085	broad.mit.edu	37	5	83259126	83259126	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:83259126T>G	ENST00000296591.5	-	10	1609	c.1191A>C	c.(1189-1191)aaA>aaC	p.K397N	EDIL3_ENST00000380138.3_Missense_Mutation_p.K387N	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	397	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GACCAAAATCTTTAGCTCCTT	0.383																																							uc003kio.1		NA																	0				skin(2)	2						c.(1189-1191)AAA>AAC		EGF-like repeats and discoidin I-like							134.0	129.0	130.0					5																	83259126		2203	4300	6503	SO:0001583	missense	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83259126T>G	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.1191A>C	5.37:g.83259126T>G	ENSP00000296591:p.Lys397Asn		Somatic				EDIL3_uc003kip.1_Missense_Mutation_p.K387N	p.K397N	NM_005711	NP_005702	WXS	Illumina HiSeq	Unspecified	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	10	1610	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	397			F5/8 type C 2.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.1191A>C	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.990544	0.74589	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.98249	-4.82;-4.82	5.72	1.99	0.26369	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	L	0.41492	1.28	0.58432	D	0.999998	D;D	0.76494	0.989;0.999	D;D	0.76575	0.985;0.988	D	0.96669	0.9495	10	0.87932	D	0	-31.7194	9.4447	0.38690	0.0:0.2035:0.0:0.7965	.	387;397	O43854-2;O43854	.;EDIL3_HUMAN	N	397;387	ENSP00000296591:K397N;ENSP00000369483:K387N	ENSP00000296591:K397N	K	-	3	2	EDIL3	83294882	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.415000	0.25817	0.528000	0.53228	AAA		0.383	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		13	44	0	0	0	0.09319	0	13	44				
CAMK4	814	broad.mit.edu	37	5	110819995	110819995	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:110819995C>A	ENST00000282356.4	+	11	1651	c.1253C>A	c.(1252-1254)cCc>cAc	p.P418H	CAMK4_ENST00000512453.1_Missense_Mutation_p.P418H|CAMK4_ENST00000512890.1_3'UTR	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	418					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AAAATGGTGCCCAAGGCAGTG	0.547																																							uc011cvj.1		NA																	0				ovary(3)|lung(2)	5						c.(1252-1254)CCC>CAC		calcium/calmodulin-dependent protein kinase IV							51.0	54.0	53.0					5																	110819995		2202	4300	6502	SO:0001583	missense	814				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:110819995C>A	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1253C>A	5.37:g.110819995C>A	ENSP00000282356:p.Pro418His		Somatic				CAMK4_uc003kpf.2_Missense_Mutation_p.P418H|CAMK4_uc010jbv.2_Missense_Mutation_p.P221H|CAMK4_uc003kpg.2_Missense_Mutation_p.P109H	p.P418H	NM_001744	NP_001735	WXS	Illumina HiSeq	Unspecified	Q16566	KCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)	12	1352	+		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)	418					D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	c.1253C>A	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523732	0.44866	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.67865	-0.29;-0.29	4.4	4.4	0.53042	.	0.231983	0.22422	N	0.060271	T	0.48259	0.1490	N	0.14661	0.345	0.09310	N	0.999999	P	0.49635	0.926	B	0.39738	0.308	T	0.51741	-0.8667	10	0.66056	D	0.02	.	12.666	0.56842	0.0:1.0:0.0:0.0	.	418	Q16566	KCC4_HUMAN	H	418	ENSP00000422634:P418H;ENSP00000282356:P418H	ENSP00000282356:P418H	P	+	2	0	CAMK4	110847894	0.001000	0.12720	0.084000	0.20598	0.149000	0.21700	1.085000	0.30840	2.453000	0.82957	0.460000	0.39030	CCC		0.547	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		29	15	1	0	9.65021e-13	0.045705	1.21246e-12	29	15				
PCDHB7	56129	broad.mit.edu	37	5	140552500	140552500	+	Silent	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:140552500C>A	ENST00000231137.3	+	1	258	c.84C>A	c.(82-84)gcC>gcA	p.A28A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	28					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A28A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCTGGCGCCGAACCGCTTC	0.517																																							uc003lit.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(82-84)GCC>GCA		protocadherin beta 7 precursor							169.0	149.0	156.0					5																	140552500		2203	4300	6503	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140552500C>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.84C>A	5.37:g.140552500C>A			Somatic					p.A28A	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	258	+			28			Extracellular (Potential).		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.84C>A	CCDS4249.1																																																																																				0.517	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		45	31	1	0	7.77092e-38	0.048971	1.20498e-37	45	31				
PCDHB11	56125	broad.mit.edu	37	5	140579566	140579566	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:140579566G>T	ENST00000354757.3	+	1	219	c.219G>T	c.(217-219)caG>caT	p.Q73H	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATAAGAAACAGCGTTTGCAGC	0.527																																							uc003liy.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(217-219)CAG>CAT		protocadherin beta 11 precursor							102.0	112.0	108.0					5																	140579566		2203	4300	6503	SO:0001583	missense	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140579566G>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.219G>T	5.37:g.140579566G>T	ENSP00000346802:p.Gln73His		Somatic				PCDHB11_uc011daj.1_Intron	p.Q73H	NM_018931	NP_061754	WXS	Illumina HiSeq	Unspecified	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	219	+			73			Extracellular (Potential).|Cadherin 1.		B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	c.219G>T	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693485	0.30052	.	.	ENSG00000197479	ENST00000354757	T	0.31769	1.48	2.8	1.91	0.25777	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.31670	0.0804	M	0.73372	2.23	0.09310	N	0.999996	B	0.11235	0.004	B	0.17098	0.017	T	0.34030	-0.9845	9	0.72032	D	0.01	.	6.7909	0.23699	0.2304:0.0:0.7696:0.0	.	73	Q9Y5F2	PCDBB_HUMAN	H	73	ENSP00000346802:Q73H	ENSP00000346802:Q73H	Q	+	3	2	PCDHB11	140559750	0.000000	0.05858	0.015000	0.15790	0.429000	0.31625	-1.397000	0.02511	0.495000	0.27882	0.467000	0.42956	CAG		0.527	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		69	35	1	0	1.65906e-26	0.048971	2.46345e-26	69	35				
PANK3	79646	broad.mit.edu	37	5	167995679	167995679	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:167995679G>C	ENST00000239231.6	-	2	669	c.353C>G	c.(352-354)gCt>gGt	p.A118G	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	118					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		AAACTTGTAAGCACCACCTCC	0.383																																							uc003lzz.1		NA																	0				ovary(1)	1						c.(352-354)GCT>GGT		pantothenate kinase 3							102.0	99.0	100.0					5																	167995679		2203	4300	6503	SO:0001583	missense	79646				coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity	g.chr5:167995679G>C	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.353C>G	5.37:g.167995679G>C	ENSP00000239231:p.Ala118Gly		Somatic					p.A118G	NM_024594	NP_078870	WXS	Illumina HiSeq	Unspecified	Q9H999	PANK3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)	2	653	-	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	118					D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	c.353C>G	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808552	0.90707	.	.	ENSG00000120137	ENST00000239231;ENST00000522176	D;D	0.99527	-6.09;-6.09	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	H	0.95917	3.74	0.80722	D	1	D	0.57257	0.979	D	0.68353	0.957	D	0.97558	1.0096	10	0.87932	D	0	-20.9247	19.0666	0.93114	0.0:0.0:1.0:0.0	.	118	Q9H999	PANK3_HUMAN	G	118;103	ENSP00000239231:A118G;ENSP00000428631:A103G	ENSP00000239231:A118G	A	-	2	0	PANK3	167928257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.860000	0.99555	2.736000	0.93811	0.655000	0.94253	GCT		0.383	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594		58	50	0	0	0	0.048971	0	58	50				
RANBP17	64901	broad.mit.edu	37	5	170667972	170667972	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:170667972G>T	ENST00000523189.1	+	23	2627	c.2463G>T	c.(2461-2463)caG>caT	p.Q821H	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	821					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAAAAGATCAGATTTATCCAA	0.413			T	TRD@	ALL																																		uc003mba.2		NA		Dom	yes		5	5q34	64901	T	RAN binding protein 17			L	TRD@		ALL		0				ovary(2)|central_nervous_system(1)	3						c.(2461-2463)CAG>CAT		RAN binding protein 17							192.0	184.0	187.0					5																	170667972		2203	4300	6503	SO:0001583	missense	64901				mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity	g.chr5:170667972G>T	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2463G>T	5.37:g.170667972G>T	ENSP00000427975:p.Gln821His		Somatic				RANBP17_uc003mbb.2_Missense_Mutation_p.Q146H|RANBP17_uc003mbd.2_Missense_Mutation_p.Q184H|RANBP17_uc010jjs.2_RNA	p.Q821H	NM_022897	NP_075048	WXS	Illumina HiSeq	Unspecified	Q9H2T7	RBP17_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		23	2479	+	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	821					Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	c.2463G>T	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565643	0.45694	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.43294	0.95	5.36	3.47	0.39725	Armadillo-type fold (1);	0.241831	0.29218	N	0.012798	T	0.41789	0.1174	M	0.77820	2.39	0.35508	D	0.800378	B;B	0.14012	0.009;0.009	B;B	0.19148	0.024;0.024	T	0.45804	-0.9236	10	0.48119	T	0.1	-0.5832	7.1149	0.25411	0.1627:0.141:0.6963:0.0	.	821;821	Q546R4;Q9H2T7	.;RBP17_HUMAN	H	821;251	ENSP00000427975:Q821H	ENSP00000427975:Q821H	Q	+	3	2	RANBP17	170600577	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.912000	0.48782	0.558000	0.29135	0.557000	0.71058	CAG		0.413	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		79	65	1	0	3.00167e-28	0.048971	4.53957e-28	79	65				
STC2	8614	broad.mit.edu	37	5	172755169	172755169	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:172755169T>C	ENST00000265087.4	-	1	1337	c.28A>G	c.(28-30)Atg>Gtg	p.M10V		NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	10					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCCAGGGTCATGAACTGGCCC	0.627																																							uc003mco.1		NA																	0				skin(2)|ovary(1)	3						c.(28-30)ATG>GTG		stanniocalcin 2 precursor							94.0	94.0	94.0					5																	172755169		2203	4300	6503	SO:0001583	missense	8614				cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity	g.chr5:172755169T>C	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.28A>G	5.37:g.172755169T>C	ENSP00000265087:p.Met10Val		Somatic				STC2_uc003mcn.1_5'Flank	p.M10V	NM_003714	NP_003705	WXS	Illumina HiSeq	Unspecified	O76061	STC2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		1	1338	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	10						Missense_Mutation	SNP	ENST00000265087.4	37	c.28A>G	CCDS4388.1	.	.	.	.	.	.	.	.	.	.	T	1.341	-0.593977	0.03771	.	.	ENSG00000113739	ENST00000265087	.	.	.	4.91	1.07	0.20283	.	0.309709	0.34725	N	0.003725	T	0.07098	0.0180	N	0.00926	-1.1	0.20873	N	0.999839	B	0.02656	0.0	B	0.01281	0.0	T	0.39418	-0.9615	9	0.02654	T	1	-14.0897	6.543	0.22390	0.0:0.5983:0.121:0.2807	.	10	O76061	STC2_HUMAN	V	10	.	ENSP00000265087:M10V	M	-	1	0	STC2	172687775	0.963000	0.33076	0.978000	0.43139	0.941000	0.58515	1.035000	0.30216	0.029000	0.15352	-0.904000	0.02843	ATG		0.627	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714		54	37	0	0	0	0.048971	0	54	37				
SLC34A1	6569	broad.mit.edu	37	5	176825246	176825246	+	Missense_Mutation	SNP	C	C	A	rs540771067		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:176825246C>A	ENST00000324417.5	+	13	1970	c.1879C>A	c.(1879-1881)Cgt>Agt	p.R627S	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	627					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCCTCCCCCCGTCTTGCACT	0.692																																							uc003mgk.3		NA																	0				ovary(1)	1						c.(1879-1881)CGT>AGT		solute carrier family 34 (sodium phosphate),							24.0	27.0	26.0					5																	176825246		2203	4294	6497	SO:0001583	missense	6569				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr5:176825246C>A	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1879C>A	5.37:g.176825246C>A	ENSP00000321424:p.Arg627Ser		Somatic					p.R627S	NM_003052	NP_003043	WXS	Illumina HiSeq	Unspecified	Q06495	NPT2A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		13	1980	+	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	627			Cytoplasmic (Potential).		B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	c.1879C>A	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	C	6.938	0.542837	0.13250	.	.	ENSG00000131183	ENST00000324417	T	0.32988	1.43	4.48	1.48	0.22813	.	0.954110	0.08773	N	0.895987	T	0.16257	0.0391	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33650	-0.9860	10	0.14656	T	0.56	-3.2693	2.7559	0.05293	0.2679:0.4384:0.2008:0.093	.	627	Q06495	NPT2A_HUMAN	S	627	ENSP00000321424:R627S	ENSP00000321424:R627S	R	+	1	0	SLC34A1	176757852	0.000000	0.05858	0.234000	0.24042	0.510000	0.34073	0.140000	0.16056	0.489000	0.27749	0.305000	0.20034	CGT		0.692	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		23	6	1	0	2.70639e-06	0.069288	3.06975e-06	23	6				
FAM50B	26240	broad.mit.edu	37	6	3850329	3850329	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr6:3850329A>G	ENST00000380274.1	+	1	710	c.284A>G	c.(283-285)gAg>gGg	p.E95G	FAM50B_ENST00000380272.3_Missense_Mutation_p.E95G			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	95						nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				CAGCACCTGGAGGagcagcgg	0.682																																							uc003mvu.2		NA																	0				pancreas(1)	1						c.(283-285)GAG>GGG		family with sequence similarity 50, member B							11.0	16.0	14.0					6																	3850329		2193	4282	6475	SO:0001583	missense	26240					nucleus		g.chr6:3850329A>G	Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.284A>G	6.37:g.3850329A>G	ENSP00000369627:p.Glu95Gly		Somatic					p.E95G	NM_012135	NP_036267	WXS	Illumina HiSeq	Unspecified	Q9Y247	FA50B_HUMAN			2	396	+	Ovarian(93;0.0925)	all_hematologic(90;0.108)	95					Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	37	c.284A>G	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.456121	0.26161	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	4.4	4.4	0.53042	.	0.245296	0.38605	N	0.001628	T	0.17195	0.0413	L	0.29908	0.895	0.27498	N	0.952081	B	0.06786	0.001	B	0.11329	0.006	T	0.06826	-1.0805	9	0.23891	T	0.37	-12.5985	11.9439	0.52918	1.0:0.0:0.0:0.0	.	95	Q9Y247	FA50B_HUMAN	G	95	.	ENSP00000369625:E95G	E	+	2	0	FAM50B	3795328	1.000000	0.71417	0.020000	0.16555	0.051000	0.14879	7.098000	0.76974	1.988000	0.58038	0.397000	0.26171	GAG		0.682	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135		9	3	0	0	0	0.047766	0	9	3				
ZNRD1-AS1	80862	broad.mit.edu	37	6	29976906	29976906	+	RNA	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr6:29976906C>T	ENST00000376797.3	-	0	773				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TCTCACAGGACGTTTTCTTCC	0.507																																							uc003rtl.3		NA																	0					0						c.(232-234)GAC>GAT		Homo sapiens major histocompatibility complex, class I, J (pseudogene), mRNA (cDNA clone IMAGE:4694038).																																						3137							g.chr6:29976906C>T	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29976906C>T			Somatic				HLA-G_uc011dmb.1_Intron|NCRNA00171_uc011dme.1_Intron|HLA-J_uc003nou.3_RNA|HLA-J_uc003nov.3_RNA	p.D78D			WXS	Illumina HiSeq	Unspecified					3	596	+									Silent	SNP	ENST00000376797.3	37	c.234C>T																																																																																					0.507	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000253083.1	NR_026751		34	43	0	0	0	0.064281	0	34	43				
ZNF451	26036	broad.mit.edu	37	6	56989619	56989619	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr6:56989619G>A	ENST00000370706.4	+	4	518	c.274G>A	c.(274-276)Gag>Aag	p.E92K	RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.E92K|ZNF451_ENST00000491832.2_Missense_Mutation_p.E92K|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	92					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TGTTGAAGTGGAGAAACAGCA	0.303																																							uc003pdm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(274-276)GAG>AAG		zinc finger protein 451 isoform 1							45.0	44.0	44.0					6																	56989619		2203	4300	6503	SO:0001583	missense	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:56989619G>A	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.274G>A	6.37:g.56989619G>A	ENSP00000359740:p.Glu92Lys		Somatic				ZNF451_uc003pdl.2_Missense_Mutation_p.E92K|ZNF451_uc003pdn.1_Missense_Mutation_p.E92K|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.E92K	p.E92K	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		4	498	+	Lung NSC(77;0.145)		92					Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	c.274G>A	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	34	5.369760	0.95900	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	5.37	5.37	0.77165	.	0.059569	0.64402	D	0.000003	T	0.16342	0.0393	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.58268	0.971;0.962;0.982;0.962	P;P;P;P	0.55749	0.783;0.687;0.713;0.687	T	0.00412	-1.1755	10	0.72032	D	0.01	-19.9075	19.0999	0.93269	0.0:0.0:1.0:0.0	.	92;92;92;92	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	K	64;92;92;92	ENSP00000427558:E64K;ENSP00000359740:E92K;ENSP00000350083:E92K;ENSP00000421645:E92K	ENSP00000350083:E92K	E	+	1	0	ZNF451	57097578	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.844000	0.75390	2.665000	0.90641	0.655000	0.94253	GAG		0.303	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		7	19	0	0	0	0.058154	0	7	19				
ZNF451	26036	broad.mit.edu	37	6	56989634	56989634	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr6:56989634G>T	ENST00000370706.4	+	4	533	c.289G>T	c.(289-291)Gaa>Taa	p.E97*	RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000357489.3_Nonsense_Mutation_p.E97*|ZNF451_ENST00000491832.2_Nonsense_Mutation_p.E97*|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ACAGCAGAAAGAAGAGAAGAA	0.303																																							uc003pdm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(289-291)GAA>TAA		zinc finger protein 451 isoform 1							46.0	44.0	44.0					6																	56989634		2203	4300	6503	SO:0001587	stop_gained	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:56989634G>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.289G>T	6.37:g.56989634G>T	ENSP00000359740:p.Glu97*		Somatic				ZNF451_uc003pdl.2_Nonsense_Mutation_p.E97*|ZNF451_uc003pdn.1_Nonsense_Mutation_p.E97*|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Nonsense_Mutation_p.E97*	p.E97*	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		4	513	+	Lung NSC(77;0.145)		97					Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Nonsense_Mutation	SNP	ENST00000370706.4	37	c.289G>T	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437281	0.96168	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	.	.	.	5.37	5.37	0.77165	.	0.059687	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-24.3274	12.4795	0.55833	0.0777:0.0:0.9223:0.0	.	.	.	.	X	69;97;97;97	.	ENSP00000350083:E97X	E	+	1	0	ZNF451	57097593	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.192000	0.65115	2.665000	0.90641	0.655000	0.94253	GAA		0.303	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		7	17	1	0	0.00448238	0.047766	0.00471323	7	17				
ENPP1	5167	broad.mit.edu	37	6	132189226	132189226	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr6:132189226C>A	ENST00000360971.2	+	12	1253	c.1233C>A	c.(1231-1233)aaC>aaA	p.N411K		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	411	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AAGAGCTGAACTTGCACAGAT	0.408																																					Colon(104;336 1535 5856 11019 33782)	Colon(104;336 1535 5856 11019 33782)	uc011ecf.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)	4						c.(1231-1233)AAC>AAA		ectonucleotide pyrophosphatase/phosphodiesterase	Amifostine(DB01143)|Ribavirin(DB00811)						267.0	239.0	249.0					6																	132189226		2203	4300	6503	SO:0001583	missense	5167				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity	g.chr6:132189226C>A	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1233C>A	6.37:g.132189226C>A	ENSP00000354238:p.Asn411Lys		Somatic				ENPP1_uc003qcy.2_Missense_Mutation_p.N41K	p.N411K	NM_006208	NP_006199	WXS	Illumina HiSeq	Unspecified	P22413	ENPP1_HUMAN		GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	12	1253	+	Breast(56;0.0505)		411			Phosphodiesterase.|Extracellular (Potential).		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	c.1233C>A	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513030	0.27123	.	.	ENSG00000197594	ENST00000360971	T	0.72282	-0.64	5.76	-0.539	0.11865	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.374611	0.32444	N	0.006098	T	0.39572	0.1083	M	0.65498	2.005	0.33175	D	0.548772	B;B	0.15719	0.014;0.006	B;B	0.24006	0.05;0.015	T	0.02942	-1.1091	10	0.19590	T	0.45	-5.7934	2.3715	0.04331	0.1176:0.4418:0.1146:0.3259	.	411;41	P22413;Q7Z3P5	ENPP1_HUMAN;.	K	411	ENSP00000354238:N411K	ENSP00000354238:N411K	N	+	3	2	ENPP1	132230919	0.109000	0.22037	0.231000	0.23993	0.989000	0.77384	-0.512000	0.06313	0.147000	0.19030	0.655000	0.94253	AAC		0.408	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2			56	47	1	0	4.96213e-28	0.048971	7.45842e-28	56	47				
RNF216	54476	broad.mit.edu	37	7	5751409	5751409	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:5751409T>A	ENST00000425013.2	-	13	2097	c.1873A>T	c.(1873-1875)Aat>Tat	p.N625Y	RNF216_ENST00000389902.3_Missense_Mutation_p.N682Y	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	625					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		CAGTGAGGATTAGGACAGCTG	0.453																																							uc003soy.1		NA																	0				ovary(3)|breast(2)	5						c.(1873-1875)AAT>TAT		ring finger protein 216 isoform b							79.0	66.0	71.0					7																	5751409		2203	4300	6503	SO:0001583	missense	54476				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding	g.chr7:5751409T>A	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1873A>T	7.37:g.5751409T>A	ENSP00000404602:p.Asn625Tyr		Somatic				RNF216_uc010ksz.1_Missense_Mutation_p.N247Y|RNF216_uc010kta.1_Missense_Mutation_p.N247Y|RNF216_uc011jwj.1_Missense_Mutation_p.N247Y|RNF216_uc003sox.1_Missense_Mutation_p.N682Y	p.N625Y	NM_207116	NP_996999	WXS	Illumina HiSeq	Unspecified	Q9NWF9	RN216_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)	13	2063	-		Ovarian(82;0.07)	625			IBR-type.		Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	c.1873A>T	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.961763	0.74016	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.53857	0.6;0.6	5.69	4.54	0.55810	Zinc finger, C6HC-type (1);	0.048477	0.85682	D	0.000000	T	0.72977	0.3528	M	0.92970	3.365	0.52501	D	0.999952	P;D	0.56521	0.944;0.976	P;P	0.59012	0.8;0.85	T	0.77043	-0.2734	10	0.72032	D	0.01	-20.7173	9.3505	0.38136	0.0:0.0804:0.0:0.9196	.	625;682	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	Y	625;682;437	ENSP00000404602:N625Y;ENSP00000374552:N682Y	ENSP00000374552:N682Y	N	-	1	0	RNF216	5717935	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.853000	0.75435	0.993000	0.38866	0.460000	0.39030	AAT		0.453	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		10	33	0	0	0	0.058154	0	10	33				
EIF2AK1	27102	broad.mit.edu	37	7	6080534	6080534	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:6080534C>A	ENST00000199389.6	-	9	1254	c.1108G>T	c.(1108-1110)Ggt>Tgt	p.G370C	EIF2AK1_ENST00000536084.1_Missense_Mutation_p.G246C|EIF2AK1_ENST00000495565.1_5'Flank	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	370	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TCTGTCTGACCCAAAAAGTTG	0.498																																							uc003spp.2		NA																	0				upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4						c.(1108-1110)GGT>TGT		eukaryotic translation initiation factor 2-alpha							79.0	77.0	78.0					7																	6080534		2203	4300	6503	SO:0001583	missense	27102				negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity	g.chr7:6080534C>A	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1108G>T	7.37:g.6080534C>A	ENSP00000199389:p.Gly370Cys		Somatic				EIF2AK1_uc003spq.2_Missense_Mutation_p.G369C|EIF2AK1_uc011jwm.1_Missense_Mutation_p.G246C|EIF2AK1_uc003spr.1_Missense_Mutation_p.G162C	p.G370C	NM_014413	NP_055228	WXS	Illumina HiSeq	Unspecified	Q9BQI3	E2AK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)	9	1254	-		Ovarian(82;0.0423)	370			Protein kinase.		A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	c.1108G>T	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	12.31	1.900433	0.33535	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	T;T	0.67523	-0.27;-0.27	5.48	3.64	0.41730	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.533036	0.22726	N	0.056393	T	0.77363	0.4119	M	0.79011	2.435	0.35593	D	0.807243	P;D;D	0.69078	0.507;0.997;0.996	B;P;P	0.60345	0.166;0.847;0.873	T	0.82273	-0.0539	10	0.59425	D	0.04	-10.8283	10.489	0.44739	0.1377:0.4611:0.4012:0.0	.	246;369;370	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	C	370;246	ENSP00000199389:G370C;ENSP00000445784:G246C	ENSP00000199389:G370C	G	-	1	0	EIF2AK1	6047060	0.779000	0.28652	0.867000	0.34043	0.149000	0.21700	1.128000	0.31369	0.648000	0.30732	-0.305000	0.09177	GGT		0.498	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413		32	100	1	0	2.08457e-15	0.045705	2.79082e-15	32	100				
HOXA10	3206	broad.mit.edu	37	7	27213851	27213851	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:27213851G>T	ENST00000283921.4	-	1	74	c.75C>A	c.(73-75)gcC>gcA	p.A25A	HOXA10_ENST00000396344.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|HOXA10_ENST00000521421.1_5'Flank|HOXA-AS4_ENST00000523790.1_RNA|RP1-170O19.20_ENST00000465941.1_Intron|RP1-170O19.20_ENST00000470747.4_Intron	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	25					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						AAGAGTTCGCGGCGGGGCTCT	0.602																																							uc011jzm.1		NA																	0					0						c.(73-75)GCC>GCA		homeobox A10 isoform a							55.0	61.0	59.0					7																	27213851		1102	2519	3621	SO:0001819	synonymous_variant	3206				spermatogenesis		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27213851G>T		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.75C>A	7.37:g.27213851G>T			Somatic				HOXA10_uc003syw.3_Intron	p.A25A	NM_018951	NP_061824	WXS	Illumina HiSeq	Unspecified	P31260	HXA10_HUMAN			1	105	-			25					O43370|O43605|Q15949|Q504T1	Silent	SNP	ENST00000283921.4	37	c.75C>A	CCDS5410.2																																																																																				0.602	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2			51	34	1	0	1.59911e-31	0.048971	2.44864e-31	51	34				
ZNF679	168417	broad.mit.edu	37	7	63721249	63721249	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:63721249G>A	ENST00000421025.1	+	4	473	c.204G>A	c.(202-204)ctG>ctA	p.L68L	ZNF679_ENST00000255746.4_Silent_p.L68L	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	68	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						TCACCTGTCTGGAGCAAAATA	0.378																																							uc003tsx.2		NA																	0				skin(1)	1						c.(202-204)CTG>CTA		zinc finger protein 679							118.0	103.0	107.0					7																	63721249		692	1591	2283	SO:0001819	synonymous_variant	168417				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63721249G>A	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.204G>A	7.37:g.63721249G>A			Somatic					p.L68L	NM_153363	NP_699194	WXS	Illumina HiSeq	Unspecified	Q8IYX0	ZN679_HUMAN			4	473	+			68			KRAB.			Silent	SNP	ENST00000421025.1	37	c.204G>A	CCDS47592.1																																																																																				0.378	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363		10	42	0	0	0	0.069234	0	10	42				
GTF2IRD1	9569	broad.mit.edu	37	7	73944212	73944212	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:73944212G>A	ENST00000265755.3	+	9	1632	c.1239G>A	c.(1237-1239)ctG>ctA	p.L413L	GTF2IRD1_ENST00000476977.1_Silent_p.L413L|GTF2IRD1_ENST00000455841.2_Silent_p.L445L|GTF2IRD1_ENST00000424337.2_Silent_p.L413L|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	413					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGCGGATCCTGGAGGAGCGCC	0.602																																							uc003uaq.2		NA																	0				ovary(4)	4						c.(1237-1239)CTG>CTA		GTF2I repeat domain containing 1 isoform 1							43.0	44.0	44.0					7																	73944212		2203	4300	6503	SO:0001819	synonymous_variant	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73944212G>A	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1239G>A	7.37:g.73944212G>A			Somatic				GTF2IRD1_uc010lbq.2_Silent_p.L445L|GTF2IRD1_uc003uap.2_Silent_p.L413L|GTF2IRD1_uc003uar.1_Silent_p.L413L	p.L413L	NM_016328	NP_057412	WXS	Illumina HiSeq	Unspecified	Q9UHL9	GT2D1_HUMAN			9	1632	+			413			GTF2I-like 2.		O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	c.1239G>A	CCDS5571.1																																																																																				0.602	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		11	20	0	0	0	0.080935	0	11	20				
ZNF804B	219578	broad.mit.edu	37	7	88964140	88964140	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:88964140A>T	ENST00000333190.4	+	4	2453	c.1844A>T	c.(1843-1845)aAg>aTg	p.K615M		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	615							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GGCTGCAGAAAGGCAGTTCTA	0.388										HNSCC(36;0.09)																													uc011khi.1		NA																	0				ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(1843-1845)AAG>ATG		zinc finger protein 804B							68.0	72.0	71.0					7																	88964140		2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88964140A>T	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1844A>T	7.37:g.88964140A>T	ENSP00000329638:p.Lys615Met	HNSCC(36;0.09)	Somatic					p.K615M	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	2382	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		615					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.1844A>T	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	3.944	-0.013613	0.07727	.	.	ENSG00000182348	ENST00000333190	T	0.05925	3.37	5.49	1.65	0.23941	.	0.400754	0.26262	N	0.025391	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	P	0.51653	0.947	B	0.41571	0.36	T	0.40887	-0.9539	10	0.72032	D	0.01	-3.6909	9.0699	0.36486	0.4392:0.0:0.5608:0.0	.	615	A4D1E1	Z804B_HUMAN	M	615	ENSP00000329638:K615M	ENSP00000329638:K615M	K	+	2	0	ZNF804B	88802076	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	1.271000	0.33098	0.126000	0.18424	-0.242000	0.12053	AAG		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		16	59	0	0	0	0.038395	0	16	59				
MUC17	140453	broad.mit.edu	37	7	100681471	100681471	+	Silent	SNP	T	T	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:100681471T>G	ENST00000306151.4	+	3	6838	c.6774T>G	c.(6772-6774)acT>acG	p.T2258T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2258	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTGAAGCCACTTCATCTCCTA	0.502																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(6772-6774)ACT>ACG		mucin 17 precursor							285.0	289.0	288.0					7																	100681471		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100681471T>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6774T>G	7.37:g.100681471T>G			Somatic				MUC17_uc010lho.1_RNA	p.T2258T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	6827	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2258			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|36.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.6774T>G	CCDS34711.1																																																																																				0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		83	481	0	0	0	0.048971	0	83	481				
MOGAT3	346606	broad.mit.edu	37	7	100839371	100839371	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:100839371G>T	ENST00000223114.4	-	7	1048	c.882C>A	c.(880-882)ccC>ccA	p.P294P	MOGAT3_ENST00000379423.3_Missense_Mutation_p.H227N|MOGAT3_ENST00000440203.2_Missense_Mutation_p.P323Q	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	294					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GGACGGGGATGGGGCGGCCCA	0.682																																							uc003uyc.2		NA																	0				ovary(2)	2						c.(880-882)CCC>CCA		monoacylglycerol O-acyltransferase 3							23.0	24.0	23.0					7																	100839371		2198	4299	6497	SO:0001819	synonymous_variant	346606				glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity	g.chr7:100839371G>T	AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.882C>A	7.37:g.100839371G>T			Somatic				MOGAT3_uc010lhr.2_Missense_Mutation_p.H227N	p.P294P	NM_178176	NP_835470	WXS	Illumina HiSeq	Unspecified	Q86VF5	MOGT3_HUMAN			7	1049	-	Lung NSC(181;0.168)|all_lung(186;0.215)		294					Q496A6|Q496A7|Q496A8|Q9UDW7	Silent	SNP	ENST00000223114.4	37	c.882C>A	CCDS5714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.05|14.05	2.419517|2.419517	0.42918|0.42918	.|.	.|.	ENSG00000106384|ENSG00000106384	ENST00000379423|ENST00000440203	T|T	0.29917|0.26957	1.55|1.7	5.11|5.11	4.17|4.17	0.49024|0.49024	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.22437|0.22437	0.0541|0.0541	.|.	.|.	.|.	0.21325|0.21325	N|N	0.999726|0.999726	B|.	0.33940|.	0.433|.	B|.	0.31686|.	0.134|.	T|T	0.09840|0.09840	-1.0656|-1.0656	8|7	0.87932|0.30854	D|T	0|0.27	-6.5275|-6.5275	7.9232|7.9232	0.29859|0.29859	0.0:0.1744:0.6454:0.1802|0.0:0.1744:0.6454:0.1802	.|.	227|.	Q86VF5-2|.	.|.	N|Q	227|323	ENSP00000368734:H227N|ENSP00000403756:P323Q	ENSP00000368734:H227N|ENSP00000403756:P323Q	H|P	-|-	1|2	0|0	MOGAT3|MOGAT3	100626091|100626091	0.908000|0.908000	0.30866|0.30866	0.997000|0.997000	0.53966|0.53966	0.934000|0.934000	0.57294|0.57294	-0.114000|-0.114000	0.10757|0.10757	2.377000|2.377000	0.81083|0.81083	0.650000|0.650000	0.86243|0.86243	CAT|CCA		0.682	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		9	9	1	0	0.000274275	0.047766	0.000294725	9	9				
DLD	1738	broad.mit.edu	37	7	107542810	107542810	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:107542810G>T	ENST00000205402.5	+	4	520	c.239G>T	c.(238-240)tGc>tTc	p.C80F	DLD_ENST00000437604.2_Missense_Mutation_p.C80F|DLD_ENST00000537148.1_Intron|DLD_ENST00000440410.1_Intron|DLD_ENST00000494441.1_3'UTR	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	80					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GGTGGAACATGCTTGAATGTT	0.368																																							uc003vet.2		NA																	0				central_nervous_system(1)	1						c.(238-240)TGC>TTC		dihydrolipoamide dehydrogenase precursor	NADH(DB00157)						318.0	278.0	292.0					7																	107542810		2203	4300	6503	SO:0001583	missense	1738				branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity	g.chr7:107542810G>T	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.239G>T	7.37:g.107542810G>T	ENSP00000205402:p.Cys80Phe		Somatic				DLD_uc010ljm.1_RNA|DLD_uc011kmg.1_Missense_Mutation_p.C80F|DLD_uc011kmh.1_Intron|DLD_uc011kmi.1_Intron	p.C80F	NM_000108	NP_000099	WXS	Illumina HiSeq	Unspecified	P09622	DLDH_HUMAN			4	349	+			80			FAD.		B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	c.239G>T	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691370	0.88735	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000437604;ENST00000539590	T;T;T	0.52983	0.64;0.64;0.64	6.17	6.17	0.99709	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.83031	0.5166	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88899	0.3351	10	0.87932	D	0	-28.4821	19.8676	0.96824	0.0:0.0:1.0:0.0	.	80;80	B4DT69;P09622	.;DLDH_HUMAN	F	80;80;80;30	ENSP00000205402:C80F;ENSP00000390667:C80F;ENSP00000387542:C80F	ENSP00000205402:C80F	C	+	2	0	DLD	107330046	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.450000	0.90340	2.941000	0.99782	0.655000	0.94253	TGC		0.368	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108		20	71	1	0	1.96895e-08	0.076483	2.29711e-08	20	71				
NRCAM	4897	broad.mit.edu	37	7	107808783	107808783	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:107808783G>A	ENST00000425651.2	-	26	3251	c.3252C>T	c.(3250-3252)atC>atT	p.I1084I	NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379028.3_Silent_p.I1084I|NRCAM_ENST00000379022.4_Silent_p.I1084I|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1084	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATTCCCAACTGATATTGGCAT	0.378																																							uc003vfb.2		NA																	0				ovary(3)|breast(2)	5						c.(3250-3252)ATC>ATT		neuronal cell adhesion molecule isoform A							79.0	77.0	78.0					7																	107808783		1891	4124	6015	SO:0001819	synonymous_variant	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107808783G>A		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3252C>T	7.37:g.107808783G>A			Somatic				NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron|NRCAM_uc011kmj.1_Intron	p.I1084I	NM_001037132	NP_001032209	WXS	Illumina HiSeq	Unspecified	Q92823	NRCAM_HUMAN			29	3723	-			1084			Fibronectin type-III 5.|Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	c.3252C>T	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262972	0.23051	.	.	ENSG00000091129	ENST00000445634	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	T	0.72293	0.3442	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69993	-0.4994	4	.	.	.	.	16.2163	0.82224	0.0:0.1329:0.8671:0.0	.	.	.	.	L	34	.	.	S	-	2	0	NRCAM	107596019	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.416000	0.59815	2.703000	0.92315	0.650000	0.86243	TCA		0.378	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		23	33	0	0	0	0.076483	0	23	33				
CTTNBP2	83992	broad.mit.edu	37	7	117432175	117432175	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:117432175G>C	ENST00000160373.3	-	4	1166	c.1075C>G	c.(1075-1077)Cag>Gag	p.Q359E	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	359					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TAGGAAGCCTGCCTGTCAATA	0.522																																							uc003vjf.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1075-1077)CAG>GAG		cortactin binding protein 2							116.0	103.0	107.0					7																	117432175		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117432175G>C		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1075C>G	7.37:g.117432175G>C	ENSP00000160373:p.Gln359Glu		Somatic					p.Q359E	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	4	1167	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		359					O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.1075C>G	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468404	0.63625	.	.	ENSG00000077063	ENST00000160373	T	0.65364	-0.15	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.67655	0.2916	M	0.83852	2.665	0.53688	D	0.999976	P	0.45531	0.86	B	0.40410	0.328	T	0.70267	-0.4919	10	0.30854	T	0.27	-7.2213	19.5381	0.95262	0.0:0.0:1.0:0.0	.	359	Q8WZ74	CTTB2_HUMAN	E	359	ENSP00000160373:Q359E	ENSP00000160373:Q359E	Q	-	1	0	CTTNBP2	117219411	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.671000	0.54576	2.682000	0.91365	0.650000	0.86243	CAG		0.522	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		25	89	0	0	0	0.083992	0	25	89				
CPA4	51200	broad.mit.edu	37	7	129948207	129948207	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:129948207C>A	ENST00000222482.4	+	8	791	c.763C>A	c.(763-765)Cca>Aca	p.P255T	CPA4_ENST00000445470.2_Missense_Mutation_p.P222T|CPA4_ENST00000493259.1_Missense_Mutation_p.P151T	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	255					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					TGGTGCTGACCCAAATAGAAA	0.547																																							uc003vpr.2		NA																	0				ovary(1)	1						c.(763-765)CCA>ACA		carboxypeptidase A4 preproprotein							100.0	89.0	93.0					7																	129948207		2203	4300	6503	SO:0001583	missense	51200				histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129948207C>A	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.763C>A	7.37:g.129948207C>A	ENSP00000222482:p.Pro255Thr		Somatic				CPA4_uc011kpd.1_Missense_Mutation_p.P222T|CPA4_uc011kpe.1_Missense_Mutation_p.P151T	p.P255T	NM_016352	NP_057436	WXS	Illumina HiSeq	Unspecified	Q9UI42	CBPA4_HUMAN			8	810	+	Melanoma(18;0.0435)		255					B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	37	c.763C>A	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513751	0.64522	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000538687;ENST00000493259	T;T;T	0.10668	2.85;2.85;2.85	5.8	4.92	0.64577	Peptidase M14, carboxypeptidase A (3);	0.000000	0.85682	D	0.000000	T	0.32041	0.0816	M	0.76938	2.355	0.58432	D	0.999994	D;D	0.76494	0.998;0.999	D;D	0.81914	0.995;0.987	T	0.00812	-1.1556	10	0.41790	T	0.15	.	13.1546	0.59509	0.0:0.9208:0.0:0.0792	.	222;255	B7Z576;Q9UI42	.;CBPA4_HUMAN	T	222;255;60;151	ENSP00000412947:P222T;ENSP00000222482:P255T;ENSP00000419660:P151T	ENSP00000222482:P255T	P	+	1	0	CPA4	129735443	0.924000	0.31332	0.995000	0.50966	0.465000	0.32709	4.505000	0.60421	2.741000	0.93983	0.585000	0.79938	CCA		0.547	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352		26	38	1	0	4.59853e-10	0.108266	5.46912e-10	26	38				
PLXNA4	91584	broad.mit.edu	37	7	131895838	131895838	+	Missense_Mutation	SNP	G	G	A	rs377154325		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:131895838G>A	ENST00000359827.3	-	10	3124	c.2162C>T	c.(2161-2163)aCg>aTg	p.T721M	PLXNA4_ENST00000321063.4_Missense_Mutation_p.T721M			Q9HCM2	PLXA4_HUMAN	plexin A4	721					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGCCTTCAGCGTGATAGGCTT	0.652																																							uc003vra.3		NA																	0				ovary(1)	1						c.(2161-2163)ACG>ATG		plexin A4 isoform 1							31.0	35.0	34.0					7																	131895838		2147	4271	6418	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131895838G>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2162C>T	7.37:g.131895838G>A	ENSP00000352882:p.Thr721Met		Somatic					p.T721M	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			10	2391	-			721			Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.2162C>T	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005611	0.93287	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.01059	5.39;5.39	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.00603	-1.1649	10	0.59425	D	0.04	.	19.7362	0.96205	0.0:0.0:1.0:0.0	.	721	Q9HCM2	PLXA4_HUMAN	M	721	ENSP00000323194:T721M;ENSP00000352882:T721M	ENSP00000323194:T721M	T	-	2	0	PLXNA4	131546378	1.000000	0.71417	0.974000	0.42286	0.986000	0.74619	9.796000	0.99103	2.661000	0.90470	0.655000	0.94253	ACG		0.652	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		8	4	0	0	0	0.038147	0	8	4				
TAS2R5	54429	broad.mit.edu	37	7	141490255	141490255	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:141490255T>A	ENST00000247883.4	+	1	239	c.94T>A	c.(94-96)Ttt>Att	p.F32I		NM_018980.2	NP_061853.1	Q9NYW4	TA2R5_HUMAN	taste receptor, type 2, member 5	32					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9	Melanoma(164;0.0171)					GGTCTGGAGTTTTAGAGAATG	0.498																																							uc003vwr.1		NA																	0					0						c.(94-96)TTT>ATT		taste receptor T2R5							104.0	103.0	103.0					7																	141490255		2203	4300	6503	SO:0001583	missense	54429				chemosensory behavior|sensory perception of taste		taste receptor activity	g.chr7:141490255T>A	AF227132	CCDS5869.1	7q31.3-q32	2012-08-22			ENSG00000127366	ENSG00000127366		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14912	protein-coding gene	gene with protein product		605062					Standard	NM_018980		Approved	T2R5	uc003vwr.1	Q9NYW4	OTTHUMG00000157632	ENST00000247883.4:c.94T>A	7.37:g.141490255T>A	ENSP00000247883:p.Phe32Ile		Somatic					p.F32I	NM_018980	NP_061853	WXS	Illumina HiSeq	Unspecified	Q9NYW4	TA2R5_HUMAN			1	239	+	Melanoma(164;0.0171)		32			Cytoplasmic (Potential).		Q645W0|Q75MV7	Missense_Mutation	SNP	ENST00000247883.4	37	c.94T>A	CCDS5869.1	.	.	.	.	.	.	.	.	.	.	T	7.670	0.686746	0.14973	.	.	ENSG00000127366	ENST00000247883	T	0.00724	5.78	4.46	2.0	0.26442	.	.	.	.	.	T	0.00998	0.0033	L	0.58810	1.83	0.09310	N	1	B	0.30211	0.273	B	0.30029	0.11	T	0.46803	-0.9165	9	0.46703	T	0.11	.	3.3976	0.07311	0.0:0.1382:0.234:0.6278	.	32	Q9NYW4	TA2R5_HUMAN	I	32	ENSP00000247883:F32I	ENSP00000247883:F32I	F	+	1	0	TAS2R5	141136724	0.703000	0.27826	0.019000	0.16419	0.003000	0.03518	0.689000	0.25437	0.222000	0.20900	0.459000	0.35465	TTT		0.498	TAS2R5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349283.1			39	42	0	0	0	0.074837	0	39	42				
OR9A4	130075	broad.mit.edu	37	7	141619370	141619370	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:141619370C>T	ENST00000548136.1	+	1	754	c.695C>T	c.(694-696)tCt>tTt	p.S232F	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					CCGTCATCCTCTGGCCGGAGG	0.483																																							uc003vwu.1		NA																	0				skin(1)	1						c.(694-696)TCT>TTT		olfactory receptor, family 9, subfamily A,							111.0	117.0	115.0					7																	141619370		2203	4300	6503	SO:0001583	missense	130075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:141619370C>T		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.695C>T	7.37:g.141619370C>T	ENSP00000448789:p.Ser232Phe		Somatic					p.S232F	NM_001001656	NP_001001656	WXS	Illumina HiSeq	Unspecified	Q8NGU2	OR9A4_HUMAN			1	695	+	Melanoma(164;0.0171)		232			Cytoplasmic (Potential).		B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	c.695C>T	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687735	0.29962	.	.	ENSG00000258083	ENST00000548136	T	0.00351	7.97	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	M	0.84846	2.72	0.22701	N	0.998838	D	0.69078	0.997	D	0.74674	0.984	T	0.42616	-0.9441	9	0.87932	D	0	-30.2641	13.5665	0.61822	0.0:1.0:0.0:0.0	.	232	Q8NGU2	OR9A4_HUMAN	F	232	ENSP00000448789:S232F	ENSP00000386148:S232F	S	+	2	0	OR9A4	141265839	0.000000	0.05858	0.569000	0.28460	0.047000	0.14425	-0.412000	0.07132	2.121000	0.65114	0.655000	0.94253	TCT		0.483	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656		23	123	0	0	0	0.062417	0	23	123				
OR2A12	346525	broad.mit.edu	37	7	143792488	143792488	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:143792488C>T	ENST00000408949.2	+	1	348	c.288C>T	c.(286-288)tgC>tgT	p.C96C		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TTGCTCCTTGCATACTTCAGA	0.443																																							uc011kty.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(286-288)TGC>TGT		olfactory receptor, family 2, subfamily A,							128.0	116.0	120.0					7																	143792488		2002	4192	6194	SO:0001819	synonymous_variant	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792488C>T		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.288C>T	7.37:g.143792488C>T			Somatic					p.C96C	NM_001004135	NP_001004135	WXS	Illumina HiSeq	Unspecified	Q8NGT7	O2A12_HUMAN			1	288	+	Melanoma(164;0.0783)		96			Extracellular (Potential).		Q6IF43	Silent	SNP	ENST00000408949.2	37	c.288C>T	CCDS43670.1																																																																																				0.443	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			22	105	0	0	0	0.076483	0	22	105				
OR2A14	135941	broad.mit.edu	37	7	143826991	143826991	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:143826991G>T	ENST00000408899.2	+	1	841	c.786G>T	c.(784-786)aaG>aaT	p.K262N		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					TGGCCCCCAAGTCCCGCCATC	0.552																																							uc011kua.1		NA																	0					0						c.(784-786)AAG>AAT		olfactory receptor, family 2, subfamily A,							114.0	120.0	118.0					7																	143826991		1987	4176	6163	SO:0001583	missense	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143826991G>T		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.786G>T	7.37:g.143826991G>T	ENSP00000386137:p.Lys262Asn		Somatic					p.K262N	NM_001001659	NP_001001659	WXS	Illumina HiSeq	Unspecified	Q96R47	O2A14_HUMAN			1	786	+	Melanoma(164;0.0783)		262			Extracellular (Potential).		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	c.786G>T	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.157431	0.00321	.	.	ENSG00000221938	ENST00000408899	T	0.00091	8.74	4.18	-8.37	0.00976	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34268	U	0.004103	T	0.00073	0.0002	N	0.17631	0.505	0.09310	N	1	B	0.15141	0.012	B	0.26770	0.073	T	0.49744	-0.8907	10	0.18276	T	0.48	-7.8934	8.9594	0.35838	0.1867:0.1544:0.582:0.0769	.	262	Q96R47	O2A14_HUMAN	N	262	ENSP00000386137:K262N	ENSP00000386137:K262N	K	+	3	2	OR2A14	143457924	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.028000	0.00085	-4.301000	0.00058	-3.772000	0.00021	AAG		0.552	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			7	206	1	0	8.12818e-05	0.02938	8.93007e-05	7	206				
NOBOX	135935	broad.mit.edu	37	7	144098578	144098578	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:144098578G>T	ENST00000467773.1	-	4	404	c.405C>A	c.(403-405)tgC>tgA	p.C135*	NOBOX_ENST00000223140.5_Nonsense_Mutation_p.C50*|NOBOX_ENST00000483238.1_Nonsense_Mutation_p.C135*	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	135					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CTGAGATGGTGCAGGAGGGTG	0.667																																							uc011kue.1		NA																	0				ovary(1)	1						c.(403-405)TGC>TGA		NOBOX oogenesis homeobox							25.0	28.0	27.0					7																	144098578		1885	4062	5947	SO:0001587	stop_gained	135935				cell differentiation|oogenesis	nucleus	sequence-specific DNA binding	g.chr7:144098578G>T			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.405C>A	7.37:g.144098578G>T	ENSP00000419457:p.Cys135*		Somatic					p.C135*	NM_001080413	NP_001073882	WXS	Illumina HiSeq	Unspecified	O60393	NOBOX_HUMAN			4	405	-	Melanoma(164;0.14)		135					A6NCD3|A8MZN5	Nonsense_Mutation	SNP	ENST00000467773.1	37	c.405C>A		.	.	.	.	.	.	.	.	.	.	G	15.64	2.894377	0.52121	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140	.	.	.	4.47	-2.29	0.06805	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-0.0258	5.2025	0.15273	0.5414:0.1728:0.2858:0.0	.	.	.	.	X	135;135;50	.	ENSP00000223140:C50X	C	-	3	2	NOBOX	143729511	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.193000	0.09573	-0.328000	0.08539	-0.291000	0.09656	TGC		0.667	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420		27	38	1	0	3.73148e-12	0.034045	4.57106e-12	27	38				
REPIN1	29803	broad.mit.edu	37	7	150069074	150069074	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:150069074G>A	ENST00000425389.2	+	1	822	c.744G>A	c.(742-744)aaG>aaA	p.K248K	REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000397281.2_Silent_p.K248K|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000489432.2_Silent_p.K305K|REPIN1_ENST00000444957.1_Silent_p.K248K|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000540729.1_Silent_p.K248K	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	248					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCCGGCACAAGCCCAACTTGA	0.701																																							uc010lpq.1		NA																	0				pancreas(1)	1						c.(742-744)AAG>AAA		replication initiator 1 isoform 1							21.0	25.0	23.0					7																	150069074		2041	4177	6218	SO:0001819	synonymous_variant	29803				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding	g.chr7:150069074G>A	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.744G>A	7.37:g.150069074G>A			Somatic				REPIN1_uc003whd.2_Silent_p.K237K|REPIN1_uc010lpr.1_Silent_p.K305K|REPIN1_uc003whc.2_Silent_p.K248K|REPIN1_uc003whe.2_Silent_p.K248K	p.K248K	NM_013400	NP_037532	WXS	Illumina HiSeq	Unspecified	Q9BWE0	REPI1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)		4	1233	+	Ovarian(565;0.183)|Melanoma(164;0.226)		248			C2H2-type 6.		C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Silent	SNP	ENST00000425389.2	37	c.744G>A	CCDS43677.1																																																																																				0.701	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374		27	32	0	0	0	0.041601	0	27	32				
GIMAP1	170575	broad.mit.edu	37	7	150417443	150417443	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:150417443G>A	ENST00000307194.5	+	3	491	c.351G>A	c.(349-351)ctG>ctA	p.L117L		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	117	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)	p.L117L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCTGCTCCTGGTGACCCAGT	0.617																																							uc003whq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(349-351)CTG>CTA		GTPase, IMAP family member 1							44.0	43.0	43.0					7																	150417443		2203	4300	6503	SO:0001819	synonymous_variant	170575					endoplasmic reticulum membrane|integral to membrane	GTP binding	g.chr7:150417443G>A	AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.351G>A	7.37:g.150417443G>A			Somatic				GIMAP1_uc003whp.2_Silent_p.L125L	p.L117L	NM_130759	NP_570115	WXS	Illumina HiSeq	Unspecified	Q8WWP7	GIMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	438	+			117			Cytoplasmic (Potential).		B2RCI3|Q8NAZ0	Silent	SNP	ENST00000307194.5	37	c.351G>A	CCDS5906.1																																																																																				0.617	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	NM_130759		24	31	0	0	0	0.076483	0	24	31				
DPP6	1804	broad.mit.edu	37	7	154564630	154564630	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr7:154564630C>A	ENST00000377770.3	+	10	1255	c.1114C>A	c.(1114-1116)Ccg>Acg	p.P372T	DPP6_ENST00000427557.1_Missense_Mutation_p.P265T|DPP6_ENST00000332007.3_Missense_Mutation_p.P310T|DPP6_ENST00000404039.1_Missense_Mutation_p.P308T			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	372					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GGAGATGATGCCGCCTGATGA	0.438																																					NSCLC(125;1384 1783 2490 7422 34254)	NSCLC(125;1384 1783 2490 7422 34254)	uc003wlk.2		NA																	0		p.E372Q(1)		pancreas(3)|breast(1)	4						c.(1114-1116)CCG>ACG		dipeptidyl-peptidase 6 isoform 1							113.0	102.0	106.0					7																	154564630		1937	4147	6084	SO:0001583	missense	1804				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr7:154564630C>A	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1114C>A	7.37:g.154564630C>A	ENSP00000367001:p.Pro372Thr		Somatic				DPP6_uc003wli.2_Missense_Mutation_p.P308T|DPP6_uc003wlm.2_Missense_Mutation_p.P310T|DPP6_uc011kvq.1_Missense_Mutation_p.P265T	p.P372T	NM_130797	NP_570629	WXS	Illumina HiSeq	Unspecified	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)		10	1243	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	372			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000377770.3	37	c.1114C>A		.	.	.	.	.	.	.	.	.	.	C	18.22	3.574646	0.65878	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	4.99	4.99	0.66335	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.181589	0.51477	D	0.000084	T	0.65729	0.2719	M	0.85542	2.76	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.983;0.971;0.971	D;P;P;P	0.76071	0.987;0.839;0.753;0.753	T	0.72616	-0.4239	10	0.72032	D	0.01	-14.9693	18.2931	0.90137	0.0:1.0:0.0:0.0	.	265;310;372;308	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	T	308;372;310;265	ENSP00000385578:P308T;ENSP00000367001:P372T;ENSP00000328226:P310T;ENSP00000397303:P265T	ENSP00000328226:P310T	P	+	1	0	DPP6	154195563	0.968000	0.33430	0.995000	0.50966	0.804000	0.45430	4.266000	0.58871	2.308000	0.77769	0.655000	0.94253	CCG		0.438	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797		7	27	1	0	0.000157383	0.038147	0.000172138	7	27				
GFRA2	2675	broad.mit.edu	37	8	21608281	21608281	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:21608281G>T	ENST00000524240.1	-	4	1263	c.613C>A	c.(613-615)Cgc>Agc	p.R205S	GFRA2_ENST00000400782.4_Missense_Mutation_p.R100S|GFRA2_ENST00000517328.1_Missense_Mutation_p.R205S|GFRA2_ENST00000518077.1_Missense_Mutation_p.R72S	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	205					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		AAGAACTGGCGCAGGGCCTTG	0.637																																							uc003wzu.1		NA																	0					0						c.(613-615)CGC>AGC		GDNF family receptor alpha 2 isoform a							60.0	72.0	68.0					8																	21608281		2194	4294	6488	SO:0001583	missense	2675					anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr8:21608281G>T	AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.613C>A	8.37:g.21608281G>T	ENSP00000428518:p.Arg205Ser		Somatic				GFRA2_uc003wzv.1_Missense_Mutation_p.R100S|GFRA2_uc003wzw.1_Missense_Mutation_p.R72S|DOK2_uc003wzx.1_Intron	p.R205S	NM_001495	NP_001486	WXS	Illumina HiSeq	Unspecified	O00451	GFRA2_HUMAN		Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)	4	1288	-			205					E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Missense_Mutation	SNP	ENST00000524240.1	37	c.613C>A	CCDS47816.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122457	0.77436	.	.	ENSG00000168546	ENST00000524240;ENST00000400782;ENST00000517328;ENST00000518077;ENST00000517892;ENST00000522071;ENST00000520826	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	4.78	4.78	0.61160	GDNF/GAS1 (2);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.82056	2.57	0.58432	D	0.999996	D;D;D	0.76494	0.999;0.994;0.973	D;P;P	0.68621	0.959;0.876;0.793	T	0.81293	-0.0998	10	0.87932	D	0	-24.0894	12.525	0.56081	0.0:0.0:0.833:0.167	.	72;100;205	O00451-2;E9PD47;O00451	.;.;GFRA2_HUMAN	S	205;100;205;72;100;205;197	ENSP00000428518:R205S;ENSP00000383592:R100S;ENSP00000429445:R205S;ENSP00000429206:R72S;ENSP00000429979:R100S;ENSP00000428721:R205S	ENSP00000383592:R100S	R	-	1	0	GFRA2	21652561	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.747000	0.55134	2.199000	0.70637	0.313000	0.20887	CGC		0.637	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376254.3	NM_001495		52	72	1	0	1.57914e-17	0.048971	2.13752e-17	52	72				
SNAI2	6591	broad.mit.edu	37	8	49832880	49832880	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:49832880G>T	ENST00000396822.1	-	3	557	c.200C>A	c.(199-201)gCc>gAc	p.A67D	SNAI2_ENST00000020945.1_Missense_Mutation_p.A67D			O43623	SNAI2_HUMAN	snail family zinc finger 2	67					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GGGTAGCTGGGCGTGGAATGG	0.557																																							uc003xqp.2		NA																	0				ovary(2)	2						c.(199-201)GCC>GAC		snail 2							117.0	121.0	120.0					8																	49832880		2203	4300	6503	SO:0001583	missense	6591				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:49832880G>T	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.200C>A	8.37:g.49832880G>T	ENSP00000380034:p.Ala67Asp		Somatic					p.A67D	NM_003068	NP_003059	WXS	Illumina HiSeq	Unspecified	O43623	SNAI2_HUMAN			2	364	-		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)	67					B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	37	c.200C>A	CCDS6146.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461862	0.43736	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.11385	2.78;2.78	5.59	5.59	0.84812	.	0.305420	0.42172	D	0.000759	T	0.08447	0.0210	N	0.14661	0.345	0.37875	D	0.930185	B	0.10296	0.003	B	0.11329	0.006	T	0.34477	-0.9827	9	.	.	.	-5.2287	19.5783	0.95453	0.0:0.0:1.0:0.0	.	67	O43623	SNAI2_HUMAN	D	67	ENSP00000020945:A67D;ENSP00000380034:A67D	.	A	-	2	0	SNAI2	49995433	1.000000	0.71417	0.992000	0.48379	0.530000	0.34684	5.946000	0.70234	2.626000	0.88956	0.561000	0.74099	GCC		0.557	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068		55	123	1	0	9.52127e-25	0.048971	1.3803e-24	55	123				
DNAJC5B	85479	broad.mit.edu	37	8	67012241	67012241	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:67012241C>G	ENST00000276570.5	+	6	862	c.575C>G	c.(574-576)tCt>tGt	p.S192C	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	192						membrane (GO:0016020)				endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			AAAGAAGGATCTCGAAGTTAT	0.428																																							uc003xvs.1		NA																	0					0						c.(574-576)TCT>TGT		DnaJ (Hsp40) homolog, subfamily C, member 5							121.0	111.0	114.0					8																	67012241		2203	4300	6503	SO:0001583	missense	85479				protein folding	membrane	heat shock protein binding|unfolded protein binding	g.chr8:67012241C>G	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.575C>G	8.37:g.67012241C>G	ENSP00000276570:p.Ser192Cys		Somatic				DNAJC5B_uc003xvt.1_RNA	p.S192C	NM_033105	NP_149096	WXS	Illumina HiSeq	Unspecified	Q9UF47	DNJ5B_HUMAN	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)		6	866	+		Lung NSC(129;0.114)|all_lung(136;0.188)	192					Q969Y8	Missense_Mutation	SNP	ENST00000276570.5	37	c.575C>G	CCDS6183.1	.	.	.	.	.	.	.	.	.	.	C	6.238	0.412110	0.11812	.	.	ENSG00000147570	ENST00000276570	T	0.70749	-0.51	5.54	3.64	0.41730	.	0.502468	0.20063	N	0.100039	T	0.50769	0.1635	N	0.15975	0.35	0.25928	N	0.983036	P	0.35714	0.517	B	0.35899	0.213	T	0.48885	-0.8995	10	0.59425	D	0.04	.	7.2599	0.26197	0.0:0.7391:0.1706:0.0903	.	192	Q9UF47	DNJ5B_HUMAN	C	192	ENSP00000276570:S192C	ENSP00000276570:S192C	S	+	2	0	DNAJC5B	67174795	0.900000	0.30661	0.981000	0.43875	0.036000	0.12997	1.253000	0.32886	1.493000	0.48517	-0.237000	0.12165	TCT		0.428	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378915.1	NM_033105		12	35	0	0	0	0.09319	0	12	35				
DNAJC5B	85479	broad.mit.edu	37	8	67012245	67012245	+	Silent	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:67012245A>G	ENST00000276570.5	+	6	866	c.579A>G	c.(577-579)cgA>cgG	p.R193R	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	193						membrane (GO:0016020)				endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			AAGGATCTCGAAGTTATTGCA	0.438																																							uc003xvs.1		NA																	0					0						c.(577-579)CGA>CGG		DnaJ (Hsp40) homolog, subfamily C, member 5							113.0	104.0	107.0					8																	67012245		2203	4300	6503	SO:0001819	synonymous_variant	85479				protein folding	membrane	heat shock protein binding|unfolded protein binding	g.chr8:67012245A>G	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.579A>G	8.37:g.67012245A>G			Somatic				DNAJC5B_uc003xvt.1_RNA	p.R193R	NM_033105	NP_149096	WXS	Illumina HiSeq	Unspecified	Q9UF47	DNJ5B_HUMAN	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)		6	870	+		Lung NSC(129;0.114)|all_lung(136;0.188)	193					Q969Y8	Silent	SNP	ENST00000276570.5	37	c.579A>G	CCDS6183.1																																																																																				0.438	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378915.1	NM_033105		11	36	0	0	0	0.080935	0	11	36				
ZFHX4	79776	broad.mit.edu	37	8	77619930	77619930	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:77619930T>A	ENST00000521891.2	+	3	3188	c.2740T>A	c.(2740-2742)Tct>Act	p.S914T	ZFHX4_ENST00000518282.1_Missense_Mutation_p.S888T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S888T|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S888T|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	888					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAATTCACCTCTGACAGCCT	0.522										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(2662-2664)TCT>ACT		zinc finger homeodomain 4							76.0	74.0	75.0					8																	77619930		2170	4271	6441	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77619930T>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2740T>A	8.37:g.77619930T>A	ENSP00000430497:p.Ser914Thr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yat.1_Missense_Mutation_p.S888T|ZFHX4_uc003yau.1_Missense_Mutation_p.S914T|ZFHX4_uc003yaw.1_Missense_Mutation_p.S888T	p.S888T	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		3	3049	+			888					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.2662T>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	T	9.753	1.168124	0.21621	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);	0.000000	0.42964	U	0.000631	T	0.15696	0.0378	N	0.03209	-0.39	0.53005	D	0.999968	B;B;B;B	0.24258	0.056;0.1;0.093;0.027	B;B;B;B	0.21151	0.014;0.022;0.033;0.023	T	0.12116	-1.0560	10	0.02654	T	1	.	15.1925	0.73057	0.0:0.0:0.0:1.0	.	888;888;914;888	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	T	914;914;888;888;888	ENSP00000430497:S914T;ENSP00000399605:S888T;ENSP00000050961:S888T;ENSP00000430848:S888T	ENSP00000050961:S888T	S	+	1	0	ZFHX4	77782485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.878000	0.63093	2.183000	0.69458	0.477000	0.44152	TCT		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		15	33	0	0	0	0.038395	0	15	33				
SLC26A7	115111	broad.mit.edu	37	8	92261960	92261960	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:92261960G>T	ENST00000276609.3	+	2	320	c.81G>T	c.(79-81)tgG>tgT	p.W27C	SLC26A7_ENST00000309536.2_Missense_Mutation_p.W27C|SLC26A7_ENST00000523719.1_Missense_Mutation_p.W27C	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTATACAGTGGTGTAGAAGGC	0.428																																							uc003yex.2		NA																	0				ovary(2)	2						c.(79-81)TGG>TGT		solute carrier family 26, member 7 isoform a							132.0	112.0	119.0					8																	92261960		2203	4300	6503	SO:0001583	missense	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92261960G>T	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.81G>T	8.37:g.92261960G>T	ENSP00000276609:p.Trp27Cys		Somatic				SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.W27C|SLC26A7_uc003yfa.2_Missense_Mutation_p.W27C	p.W27C	NM_052832	NP_439897	WXS	Illumina HiSeq	Unspecified	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		3	359	+			27			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000276609.3	37	c.81G>T	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968760	0.53614	.	.	ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536	D;D;D;D	0.92545	-2.85;-3.06;-3.06;-3.05	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000004	D	0.93835	0.8028	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	D	0.92974	0.6400	10	0.36615	T	0.2	.	19.5123	0.95146	0.0:0.0:1.0:0.0	.	27;27	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	C	27	ENSP00000428881:W27C;ENSP00000428849:W27C;ENSP00000276609:W27C;ENSP00000309504:W27C	ENSP00000276609:W27C	W	+	3	0	SLC26A7	92331136	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	6.379000	0.73154	2.610000	0.88304	0.557000	0.71058	TGG		0.428	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			29	67	1	0	2.12542e-12	0.030593	2.65677e-12	29	67				
CSMD3	114788	broad.mit.edu	37	8	113569034	113569034	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:113569034C>A	ENST00000297405.5	-	25	4436	c.4192G>T	c.(4192-4194)Ggg>Tgg	p.G1398W	CSMD3_ENST00000352409.3_Missense_Mutation_p.G1398W|CSMD3_ENST00000343508.3_Missense_Mutation_p.G1358W|CSMD3_ENST00000455883.2_Missense_Mutation_p.G1294W	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1398	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTCTCTCCCCTGTCATGCAC	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4192-4194)GGG>TGG		CUB and Sushi multiple domains 3 isoform 1							111.0	100.0	104.0					8																	113569034		2203	4299	6502	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113569034C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4192G>T	8.37:g.113569034C>A	ENSP00000297405:p.Gly1398Trp	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.G670W|CSMD3_uc003ynt.2_Missense_Mutation_p.G1358W|CSMD3_uc011lhx.1_Missense_Mutation_p.G1294W	p.G1398W	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			25	4351	-			1398			Extracellular (Potential).|Sushi 7.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4192G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580534	0.86645	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	5.11	5.11	0.69529	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.65333	0.2681	H	0.95816	3.725	0.51767	D	0.99993	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.999;0.977	T	0.76427	-0.2963	10	0.66056	D	0.02	.	18.7287	0.91726	0.0:1.0:0.0:0.0	.	1294;1398;1358	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	W	1358;1398;738;1294;1398	ENSP00000345799:G1358W;ENSP00000297405:G1398W;ENSP00000341558:G738W;ENSP00000412263:G1294W;ENSP00000343124:G1398W	ENSP00000297405:G1398W	G	-	1	0	CSMD3	113638210	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	7.651000	0.83577	2.660000	0.90430	0.655000	0.94253	GGG		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		29	58	1	0	2.14196e-07	0.034045	2.47537e-07	29	58				
TRPS1	7227	broad.mit.edu	37	8	116599310	116599310	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:116599310C>A	ENST00000220888.5	-	4	2738	c.2579G>T	c.(2578-2580)gGa>gTa	p.G860V	TRPS1_ENST00000519674.1_Missense_Mutation_p.G860V|TRPS1_ENST00000519076.1_Missense_Mutation_p.G614V|TRPS1_ENST00000520276.1_Missense_Mutation_p.G864V|TRPS1_ENST00000395715.3_Missense_Mutation_p.G873V			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	860					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G860V(1)|p.G873V(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AGACTTCTCTCCGCCAGCTGG	0.567									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(2578-2580)GGA>GTA		zinc finger transcription factor TRPS1							37.0	39.0	38.0					8																	116599310		1817	4070	5887	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116599310C>A	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2579G>T	8.37:g.116599310C>A	ENSP00000220888:p.Gly860Val		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.G864V|TRPS1_uc003yny.2_Missense_Mutation_p.G873V|TRPS1_uc010mcy.2_Missense_Mutation_p.G860V	p.G860V	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		4	3038	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		860					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.2579G>T		.	.	.	.	.	.	.	.	.	.	C	11.17	1.559011	0.27827	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;D;D;T	0.98567	-5.0;-4.97;-4.98;-4.97;0.83	5.76	5.76	0.90799	.	0.334388	0.31370	N	0.007761	D	0.94791	0.8318	N	0.12182	0.205	0.54753	D	0.999985	B;B;B	0.22414	0.004;0.012;0.069	B;B;B	0.18263	0.008;0.009;0.021	D	0.91695	0.5369	10	0.72032	D	0.01	.	16.4632	0.84070	0.0:0.8604:0.1396:0.0	.	864;860;873	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	V	873;860;614;864;860	ENSP00000379065:G873V;ENSP00000220888:G860V;ENSP00000428910:G614V;ENSP00000428680:G864V;ENSP00000429174:G860V	ENSP00000220888:G860V	G	-	2	0	TRPS1	116668485	0.912000	0.30974	0.895000	0.35142	0.376000	0.30014	2.182000	0.42556	2.726000	0.93360	0.655000	0.94253	GGA		0.567	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		39	67	1	0	4.00102e-26	0.086207	5.90512e-26	39	67				
CYP11B2	1585	broad.mit.edu	37	8	143994294	143994294	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:143994294G>C	ENST00000323110.2	-	7	1131	c.1129C>G	c.(1129-1131)Cct>Gct	p.P377A		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	377					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	AGACCCACAGGGTAGAGCCTG	0.602									Familial Hyperaldosteronism type I																														uc003yxk.1		NA																	0					0						c.(1129-1131)CCT>GCT		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)						50.0	51.0	50.0					8																	143994294		2203	4300	6503	SO:0001583	missense	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143994294G>C	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1129C>G	8.37:g.143994294G>C	ENSP00000325822:p.Pro377Ala		Somatic					p.P377A	NM_000498	NP_000489	WXS	Illumina HiSeq	Unspecified	P19099	C11B2_HUMAN			7	1132	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		377					B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	c.1129C>G	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	17.81	3.479772	0.63849	.	.	ENSG00000179142	ENST00000323110	T	0.75704	-0.96	2.81	2.81	0.32909	.	0.000000	0.50627	D	0.000117	T	0.81837	0.4907	M	0.83953	2.67	0.52501	D	0.999953	P	0.50066	0.931	P	0.53988	0.739	D	0.85199	0.1014	10	0.87932	D	0	.	11.8737	0.52536	0.0:0.0:1.0:0.0	.	377	P19099	C11B2_HUMAN	A	377	ENSP00000325822:P377A	ENSP00000325822:P377A	P	-	1	0	CYP11B2	143991296	1.000000	0.71417	0.962000	0.40283	0.242000	0.25591	7.136000	0.77285	1.874000	0.54306	0.558000	0.71614	CCT		0.602	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			14	19	0	0	0	0.024245	0	14	19				
TSTA3	7264	broad.mit.edu	37	8	144696379	144696379	+	Silent	SNP	C	C	A	rs144331064	byFrequency	TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:144696379C>A	ENST00000425753.2	-	7	721	c.618G>T	c.(616-618)acG>acT	p.T206T	TSTA3_ENST00000529064.1_Silent_p.T206T	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	206					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TACCCCACACCGTCAGGGCCG	0.642																																							uc003yza.2		NA																	0				pancreas(1)	1						c.(616-618)ACG>ACT		tissue specific transplantation antigen P35B	NADH(DB00157)						56.0	54.0	55.0					8																	144696379		2203	4300	6503	SO:0001819	synonymous_variant	7264				'de novo' GDP-L-fucose biosynthetic process|leukocyte cell-cell adhesion		coenzyme binding|electron carrier activity|GDP-4-dehydro-D-rhamnose reductase activity|GDP-L-fucose synthase activity|isomerase activity	g.chr8:144696379C>A	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.618G>T	8.37:g.144696379C>A			Somatic				TSTA3_uc003yzb.2_Silent_p.T206T	p.T206T	NM_003313	NP_003304	WXS	Illumina HiSeq	Unspecified	Q13630	FCL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		7	654	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		206					B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	ENST00000425753.2	37	c.618G>T	CCDS6408.1																																																																																				0.642	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313		23	65	1	0	6.32553e-13	0.099896	8.07164e-13	23	65				
SCRT1	83482	broad.mit.edu	37	8	145557006	145557006	+	Silent	SNP	C	C	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:145557006C>T	ENST00000332135.4	-	2	999	c.888G>A	c.(886-888)caG>caA	p.Q296Q		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	296					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CCGAATGCGTCTGCATGTGCG	0.627																																							uc003zbw.1		NA																	0					0						c.(886-888)CAG>CAA		scratch							24.0	25.0	25.0					8																	145557006		2202	4296	6498	SO:0001819	synonymous_variant	83482					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:145557006C>T	BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.888G>A	8.37:g.145557006C>T			Somatic					p.Q296Q	NM_031309	NP_112599	WXS	Illumina HiSeq	Unspecified	Q9BWW7	SCRT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)		2	1000	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		296			C2H2-type 4.		A8MX66|Q96C52	Silent	SNP	ENST00000332135.4	37	c.888G>A	CCDS6421.1																																																																																				0.627	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382800.2	NM_031309		9	16	0	0	0	0.058154	0	9	16				
TONSL	4796	broad.mit.edu	37	8	145659566	145659566	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr8:145659566G>A	ENST00000409379.3	-	21	3211	c.3182C>T	c.(3181-3183)cCc>cTc	p.P1061L	AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1061					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCGCAGCAGGGGTGTAAGCTG	0.697																																							uc011llg.1		NA																	0					0						c.(3181-3183)CCC>CTC		NF-kappa-B inhibitor-like protein 2							17.0	19.0	18.0					8																	145659566		2202	4293	6495	SO:0001583	missense	4796				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity	g.chr8:145659566G>A		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3182C>T	8.37:g.145659566G>A	ENSP00000386239:p.Pro1061Leu		Somatic				uc011llh.1_5'Flank	p.P1061L	NM_013432	NP_038460	WXS	Illumina HiSeq	Unspecified	Q96HA7	TONSL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)		21	3197	-	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		1061					B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	c.3182C>T	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952988	0.92660	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.49720	0.77	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.65365	0.2684	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.68526	-0.5385	10	0.87932	D	0	-35.9592	15.9642	0.79952	0.0:0.0:1.0:0.0	.	1061	Q96HA7	TONSL_HUMAN	L	1061;1060	ENSP00000386239:P1061L	ENSP00000386239:P1061L	P	-	2	0	TONSL	145630374	1.000000	0.71417	0.925000	0.36789	0.966000	0.64601	8.797000	0.91882	2.368000	0.80403	0.462000	0.41574	CCC		0.697	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432		8	12	0	0	0	0.058154	0	8	12				
FRMPD1	22844	broad.mit.edu	37	9	37740869	37740869	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:37740869G>T	ENST00000539465.1	+	15	2937	c.2344G>T	c.(2344-2346)Ggc>Tgc	p.G782C	FRMPD1_ENST00000377765.3_Missense_Mutation_p.G782C|FRMPD1_ENST00000536622.1_Missense_Mutation_p.G604C|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000541302.1_Missense_Mutation_p.G651C			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	782						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CACTCCCCCAGGCCCCCCGTC	0.632																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(2344-2346)GGC>TGC		FERM and PDZ domain containing 1							34.0	35.0	35.0					9																	37740869		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37740869G>T	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2344G>T	9.37:g.37740869G>T	ENSP00000444411:p.Gly782Cys		Somatic				FRMPD1_uc004aah.1_Missense_Mutation_p.G782C|FRMPD1_uc011lqm.1_Missense_Mutation_p.G604C|FRMPD1_uc011lqn.1_Missense_Mutation_p.G651C	p.G782C	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	15	2388	+			782					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.2344G>T	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429987	0.43122	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.17854	3.24;3.24;2.25;2.25	5.27	4.37	0.52481	.	0.534882	0.20977	N	0.082286	T	0.08044	0.0201	N	0.08118	0	0.28748	N	0.901601	P;P	0.49358	0.89;0.923	B;B	0.40101	0.221;0.319	T	0.06197	-1.0840	10	0.72032	D	0.01	-15.4545	6.6862	0.23146	0.094:0.182:0.7239:0.0	.	651;782	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	C	782;782;604;651	ENSP00000366995:G782C;ENSP00000444411:G782C;ENSP00000437762:G604C;ENSP00000444804:G651C	ENSP00000366995:G782C	G	+	1	0	FRMPD1	37730869	0.622000	0.27085	0.313000	0.25210	0.857000	0.48899	2.518000	0.45537	2.457000	0.83068	0.655000	0.94253	GGC		0.632	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		18	14	1	0	3.51602e-12	0.049695	4.32876e-12	18	14				
KLF4	9314	broad.mit.edu	37	9	110248154	110248154	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:110248154A>C	ENST00000374672.4	-	5	1791	c.1318T>G	c.(1318-1320)Tca>Gca	p.S440A		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	474					cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						AGTTCATCTGAGCGGGCGAAT	0.498																																							uc004bdh.2		NA																	0				central_nervous_system(2)|lung(1)	3						c.(1393-1395)TCA>GCA		Kruppel-like factor 4 (gut)							101.0	94.0	96.0					9																	110248154		2203	4300	6503	SO:0001583	missense	9314				fat cell differentiation|mesodermal cell fate determination|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|stem cell maintenance|transcription from RNA polymerase II promoter	nucleus	RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor recruiting transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr9:110248154A>C	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.1318T>G	9.37:g.110248154A>C	ENSP00000363804:p.Ser440Ala		Somatic				KLF4_uc004bdf.1_Missense_Mutation_p.S390A|KLF4_uc004bdg.2_Missense_Mutation_p.S440A	p.S465A	NM_004235	NP_004226	WXS	Illumina HiSeq	Unspecified	O43474	KLF4_HUMAN			4	2014	-			474			Interaction with target DNA (By similarity).|C2H2-type 2.		B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Missense_Mutation	SNP	ENST00000374672.4	37	c.1393T>G	CCDS6770.2	.	.	.	.	.	.	.	.	.	.	A	18.19	3.569610	0.65765	.	.	ENSG00000136826	ENST00000374672	T	0.35236	1.32	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35585	N	0.003102	T	0.53626	0.1808	L	0.42744	1.35	0.80722	D	1	D;D	0.89917	0.982;1.0	D;D	0.91635	0.952;0.999	T	0.55515	-0.8129	10	0.87932	D	0	.	15.8634	0.79043	1.0:0.0:0.0:0.0	.	474;440	O43474;O43474-1	KLF4_HUMAN;.	A	440	ENSP00000363804:S440A	ENSP00000363804:S440A	S	-	1	0	KLF4	109287975	1.000000	0.71417	0.998000	0.56505	0.422000	0.31414	9.339000	0.96797	2.225000	0.72522	0.460000	0.39030	TCA		0.498	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	NM_004235		17	86	0	0	0	0.038395	0	17	86				
ASTN2	23245	broad.mit.edu	37	9	119188208	119188208	+	Silent	SNP	G	G	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:119188208G>T	ENST00000313400.4	-	23	4042	c.3942C>A	c.(3940-3942)ctC>ctA	p.L1314L	ASTN2_ENST00000288520.5_Silent_p.L415L|ASTN2_ENST00000341734.4_Silent_p.L366L|ASTN2_ENST00000361209.2_Silent_p.L1263L|ASTN2_ENST00000373996.3_Silent_p.L1310L|ASTN2_ENST00000361477.3_Silent_p.L366L			O75129	ASTN2_HUMAN	astrotactin 2	1314					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TGGTGTCCTTGAGGATGCTAT	0.587																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(3940-3942)CTC>CTA		astrotactin 2 isoform c							128.0	103.0	112.0					9																	119188208		2203	4300	6503	SO:0001819	synonymous_variant	23245					integral to membrane		g.chr9:119188208G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3942C>A	9.37:g.119188208G>T			Somatic				ASTN2_uc004bjr.1_Silent_p.L1310L|ASTN2_uc004bjt.1_Silent_p.L1263L|ASTN2_uc004bjp.1_Silent_p.L407L|ASTN2_uc004bjq.1_Silent_p.L366L|ASTN2_uc011lxr.1_Silent_p.L366L|ASTN2_uc011lxs.1_Silent_p.L366L|ASTN2_uc011lxt.1_Silent_p.L366L|ASTN2_uc004bjo.1_Silent_p.L95L	p.L1314L	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			23	4043	-			1314			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37	c.3942C>A																																																																																					0.587	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		17	37	1	0	3.52763e-06	0.0333	3.98281e-06	17	37				
OR1N1	138883	broad.mit.edu	37	9	125288754	125288754	+	Silent	SNP	A	A	T			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:125288754A>T	ENST00000304880.2	-	1	818	c.819T>A	c.(817-819)gcT>gcA	p.A273A		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TGTACATTGCAGCTGCTGCAA	0.507																																							uc004bmn.1		NA																	0				upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						c.(817-819)GCT>GCA		olfactory receptor, family 1, subfamily N,							110.0	100.0	104.0					9																	125288754		2203	4300	6503	SO:0001819	synonymous_variant	138883				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125288754A>T	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.819T>A	9.37:g.125288754A>T			Somatic					p.A273A	NM_012363	NP_036495	WXS	Illumina HiSeq	Unspecified	Q8NGS0	OR1N1_HUMAN			1	819	-			273			Helical; Name=7; (Potential).		A3KFM1|O43870|Q6IF16|Q96R93	Silent	SNP	ENST00000304880.2	37	c.819T>A	CCDS6844.1																																																																																				0.507	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1			24	59	0	0	0	0.069288	0	24	59				
FAM129B	64855	broad.mit.edu	37	9	130285969	130285969	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:130285969T>C	ENST00000373312.3	-	5	791	c.578A>G	c.(577-579)cAc>cGc	p.H193R	FAM129B_ENST00000373314.3_Missense_Mutation_p.H180R|FAM129B_ENST00000468379.1_Intron	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	193					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						ATTGTTGCAGTGCCGGATGCA	0.577											OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004brh.2		NA																	0					0						c.(577-579)CAC>CGC		hypothetical protein LOC64855 isoform 1							72.0	57.0	62.0					9																	130285969		2203	4300	6503	SO:0001583	missense	64855						protein binding	g.chr9:130285969T>C	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.578A>G	9.37:g.130285969T>C	ENSP00000362409:p.His193Arg		Somatic	OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1579	FAM129B_uc004bri.2_Missense_Mutation_p.H180R|FAM129B_uc004brj.3_Missense_Mutation_p.H193R	p.H193R	NM_022833	NP_073744	WXS	Illumina HiSeq	Unspecified	Q96TA1	NIBL1_HUMAN			5	780	-			193					Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	c.578A>G	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320754	0.81469	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.16073	2.37;2.37	5.24	5.24	0.73138	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.40979	0.1139	M	0.74647	2.275	0.50171	D	0.999854	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.20974	-1.0259	10	0.41790	T	0.15	-40.4937	13.1052	0.59244	0.0:0.0:0.0:1.0	.	180;193	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	R	180;193	ENSP00000362411:H180R;ENSP00000362409:H193R	ENSP00000362409:H193R	H	-	2	0	FAM129B	129325790	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.580000	0.82523	1.983000	0.57843	0.459000	0.35465	CAC		0.577	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833		10	44	0	0	0	0.069234	0	10	44				
DOLK	22845	broad.mit.edu	37	9	131708329	131708329	+	Silent	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr9:131708329G>A	ENST00000372586.3	-	1	1569	c.1254C>T	c.(1252-1254)ccC>ccT	p.P418P	NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	418					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						TCAGCCAGATGGGAAGAGACA	0.582																																							uc004bwr.2		NA																	0					0						c.(1252-1254)CCC>CCT		dolichol kinase							92.0	92.0	92.0					9																	131708329		2203	4300	6503	SO:0001819	synonymous_variant	22845				dolichyl diphosphate biosynthetic process|dolichyl monophosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to endoplasmic reticulum membrane|membrane fraction	dolichol kinase activity	g.chr9:131708329G>A	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1254C>T	9.37:g.131708329G>A			Somatic				NUP188_uc004bws.1_5'Flank|NUP188_uc004bwq.1_Intron	p.P418P	NM_014908	NP_055723	WXS	Illumina HiSeq	Unspecified	Q9UPQ8	DOLK_HUMAN			1	1684	-			418			Helical; (Potential).		Q5SRE6	Silent	SNP	ENST00000372586.3	37	c.1254C>T	CCDS6915.1																																																																																				0.582	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908		17	62	0	0	0	0.0333	0	17	62				
XG	7499	broad.mit.edu	37	X	2729460	2729460	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:2729460C>G	ENST00000381174.5	+	9	718	c.493C>G	c.(493-495)Cta>Gta	p.L165V	XG_ENST00000419513.2_Missense_Mutation_p.L180V|snoU13_ENST00000516039.1_RNA|XG_ENST00000426774.1_Missense_Mutation_p.L166V			P55808	XG_HUMAN	Xg blood group	165						integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTATTTCAAACTAAACAATAG	0.403																																							uc011mhg.1		NA																	0				ovary(1)	1						c.(493-495)CTA>GTA		XG glycoprotein isoform 1 precursor							69.0	64.0	66.0					X																	2729460		2203	4299	6502	SO:0001583	missense	7499					integral to membrane|plasma membrane		g.chrX:2729460C>G	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.493C>G	X.37:g.2729460C>G	ENSP00000370566:p.Leu165Val		Somatic				XG_uc004cqp.2_Missense_Mutation_p.L180V	p.L165V	NM_175569	NP_780778	WXS	Illumina HiSeq	Unspecified	P55808	XG_HUMAN			9	716	+		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	165			Cytoplasmic (Potential).		E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	c.493C>G	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	C	4.530	0.098399	0.08681	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484;ENST00000533923	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	3.6	-7.19	0.01500	.	0.758458	0.11640	U	0.543914	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B;B	0.22983	0.078;0.063	B;B	0.19666	0.026;0.015	T	0.20438	-1.0275	10	0.62326	D	0.03	.	4.4127	0.11441	0.2365:0.1958:0.0:0.5677	.	165;180	P55808;P55808-3	XG_HUMAN;.	V	165;180;166;143;27	ENSP00000370566:L165V;ENSP00000411004:L180V;ENSP00000398503:L166V;ENSP00000430005:L143V	ENSP00000370566:L165V	L	+	1	2	XG	2739460	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.548000	0.06048	-2.419000	0.00565	-0.776000	0.03382	CTA		0.403	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569		7	5	0	0	0	0.038147	0	7	5				
FAM47C	442444	broad.mit.edu	37	X	37027350	37027350	+	Silent	SNP	T	T	C			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:37027350T>C	ENST00000358047.3	+	1	919	c.867T>C	c.(865-867)acT>acC	p.T289T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	289										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CTCCCAAGACTCGCGTATCTC	0.607																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(865-867)ACT>ACC		hypothetical protein LOC442444							74.0	65.0	68.0					X																	37027350		2202	4300	6502	SO:0001819	synonymous_variant	442444							g.chrX:37027350T>C	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.867T>C	X.37:g.37027350T>C			Somatic					p.T289T	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	881	+			289					Q6ZU46	Silent	SNP	ENST00000358047.3	37	c.867T>C	CCDS35227.1																																																																																				0.607	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		4	71	0	0	0	0.009096	0	4	71				
DGKK	139189	broad.mit.edu	37	X	50113550	50113550	+	RNA	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:50113550T>A	ENST00000376025.2	-	0	3671							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					AGATTTTTCCTGAGAAACCAC	0.403																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.e28-1		diacylglycerol kinase kappa							51.0	47.0	49.0					X																	50113550		1841	4078	5919			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50113550T>A	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50113550T>A			Somatic					p.E1205_splice	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			28	3673	-	Ovarian(276;0.236)							B2RP91	Splice_Site	SNP	ENST00000376025.2	37	c.3613_splice																																																																																					0.403	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		5	3	0	0	0	0.014758	0	5	3				
PABPC5	140886	broad.mit.edu	37	X	90691565	90691565	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:90691565G>A	ENST00000312600.3	+	2	1203	c.989G>A	c.(988-990)cGg>cAg	p.R330Q	PABPC5_ENST00000373105.1_Missense_Mutation_p.R166Q|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	330	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R330L(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						TCAATTAGTCGGGCCAAAGTG	0.458																																							uc004efg.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(988-990)CGG>CAG		poly(A) binding protein, cytoplasmic 5							64.0	63.0	63.0					X																	90691565		2203	4300	6503	SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90691565G>A	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.989G>A	X.37:g.90691565G>A	ENSP00000308012:p.Arg330Gln		Somatic				PABPC5_uc004eff.1_Missense_Mutation_p.R166Q	p.R330Q	NM_080832	NP_543022	WXS	Illumina HiSeq	Unspecified	Q96DU9	PABP5_HUMAN			2	1429	+			330			RRM 4.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	c.989G>A	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.792282	0.70452	.	.	ENSG00000174740	ENST00000373105;ENST00000312600;ENST00000402906	T;T	0.16597	2.33;2.33	4.14	4.14	0.48551	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049047	0.85682	D	0.000000	T	0.26448	0.0646	N	0.25332	0.735	0.40653	D	0.982056	D	0.76494	0.999	D	0.65573	0.936	T	0.04767	-1.0928	10	0.87932	D	0	.	13.362	0.60661	0.0:0.0:1.0:0.0	.	330	Q96DU9	PABP5_HUMAN	Q	166;330;298	ENSP00000362197:R166Q;ENSP00000308012:R330Q	ENSP00000308012:R330Q	R	+	2	0	PABPC5	90578221	1.000000	0.71417	0.455000	0.27031	0.888000	0.51559	7.036000	0.76524	2.318000	0.78349	0.529000	0.55759	CGG		0.458	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		42	19	0	0	0	0.042209	0	42	19				
COL4A5	1287	broad.mit.edu	37	X	107846235	107846235	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:107846235C>A	ENST00000361603.2	+	28	2432	c.2188C>A	c.(2188-2190)Cct>Act	p.P730T	COL4A5_ENST00000328300.6_Missense_Mutation_p.P730T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	730	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ACCTGGGACACCTGGAAGAAT	0.443									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(2188-2190)CCT>ACT		type IV collagen alpha 5 isoform 2 precursor							18.0	16.0	17.0					X																	107846235		2201	4299	6500	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107846235C>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.2188C>A	X.37:g.107846235C>A	ENSP00000354505:p.Pro730Thr		Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.P730T|COL4A5_uc004eob.1_Missense_Mutation_p.P338T	p.P730T	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			28	2390	+			730			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.2188C>A	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524383	0.64747	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96651	-3.4;-4.08	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.97942	0.9323	M	0.76170	2.325	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98789	1.0735	10	0.87932	D	0	.	17.205	0.86915	0.0:1.0:0.0:0.0	.	730;338;730	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	T	730	ENSP00000331902:P730T;ENSP00000354505:P730T	ENSP00000331902:P730T	P	+	1	0	COL4A5	107732891	0.983000	0.35010	0.998000	0.56505	0.933000	0.57130	2.553000	0.45837	2.444000	0.82710	0.600000	0.82982	CCT		0.443	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			4	2	1	0	1.23904e-05	0.014758	1.37984e-05	4	2				
COL4A5	1287	broad.mit.edu	37	X	107930878	107930878	+	Silent	SNP	T	T	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:107930878T>A	ENST00000361603.2	+	47	4708	c.4464T>A	c.(4462-4464)tcT>tcA	p.S1488S	COL4A5_ENST00000328300.6_Silent_p.S1494S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1488	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.		S -> F (in APSX).		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AAGGCTTTTCTCTCCTGTATG	0.433									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(4480-4482)TCT>TCA		type IV collagen alpha 5 isoform 2 precursor							119.0	114.0	115.0					X																	107930878		2203	4300	6503	SO:0001819	synonymous_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107930878T>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4464T>A	X.37:g.107930878T>A			Somatic				COL4A5_uc011mso.1_Silent_p.S1491S|COL4A5_uc011msp.1_Silent_p.S170S	p.S1494S	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			48	4684	+			1488		S -> F (in APSX).	Collagen IV NC1.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	c.4482T>A	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.388969	0.25118	.	.	ENSG00000188153	ENST00000515658	.	.	.	5.58	4.42	0.53409	.	.	.	.	.	T	0.55305	0.1912	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54282	-0.8317	4	.	.	.	.	5.6016	0.17357	0.154:0.0805:0.0:0.7655	.	.	.	.	H	93	.	.	L	+	2	0	COL4A5	107817534	0.990000	0.36364	1.000000	0.80357	0.988000	0.76386	0.202000	0.17295	1.875000	0.54330	0.486000	0.48141	CTC		0.433	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			30	102	0	0	0	0.050027	0	30	102				
ATP1B4	23439	broad.mit.edu	37	X	119500506	119500506	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:119500506G>A	ENST00000218008.3	+	2	247	c.190G>A	c.(190-192)Gaa>Aaa	p.E64K	ATP1B4_ENST00000361319.3_Missense_Mutation_p.E64K|ATP1B4_ENST00000539306.1_Missense_Mutation_p.E64K	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	64	Glu-rich.				monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						agaagaggaggaagaggagga	0.527																																							uc004esr.2		NA																	0				ovary(1)|skin(1)	2						c.(190-192)GAA>AAA		ATPase, (Na+)/K+ transporting, beta 4							94.0	82.0	86.0					X																	119500506		2203	4300	6503	SO:0001583	missense	23439				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity	g.chrX:119500506G>A	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.190G>A	X.37:g.119500506G>A	ENSP00000218008:p.Glu64Lys		Somatic				ATP1B4_uc004esq.2_Missense_Mutation_p.E64K|ATP1B4_uc011mtx.1_Missense_Mutation_p.E64K|ATP1B4_uc011mty.1_Missense_Mutation_p.E64K	p.E64K	NM_001142447	NP_001135919	WXS	Illumina HiSeq	Unspecified	Q9UN42	AT1B4_HUMAN			2	274	+			64			Glu-rich.|Nuclear (Potential).		Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	c.190G>A	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	G	6.874	0.530687	0.13127	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.07567	3.18;3.18;3.18	4.36	2.6	0.31112	.	0.600073	0.20168	N	0.097796	T	0.06872	0.0175	L	0.44542	1.39	0.41768	D	0.989753	B;B;B;B	0.11235	0.001;0.001;0.003;0.004	B;B;B;B	0.14023	0.002;0.002;0.01;0.006	T	0.25222	-1.0138	10	0.36615	T	0.2	-9.2124	4.1876	0.10405	0.2109:0.1866:0.6025:0.0	.	64;64;64;64	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	K	64	ENSP00000218008:E64K;ENSP00000355346:E64K;ENSP00000443334:E64K	ENSP00000218008:E64K	E	+	1	0	ATP1B4	119384534	1.000000	0.71417	0.883000	0.34634	0.014000	0.08584	5.556000	0.67307	0.576000	0.29452	-1.071000	0.02255	GAA		0.527	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447		34	6	0	0	0	0.050027	0	34	6				
FLNA	2316	broad.mit.edu	37	X	153593558	153593558	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chrX:153593558A>G	ENST00000369850.3	-	11	1873	c.1637T>C	c.(1636-1638)gTc>gCc	p.V546A	FLNA_ENST00000422373.1_Missense_Mutation_p.V546A|FLNA_ENST00000360319.4_Missense_Mutation_p.V546A|FLNA_ENST00000344736.4_Missense_Mutation_p.V546A	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	546					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTTCCAGGGACCATGGGGTA	0.622																																							uc004fkk.2		NA																	0				breast(6)	6						c.(1636-1638)GTC>GCC		filamin A, alpha isoform 2							100.0	107.0	105.0					X																	153593558		2097	4176	6273	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153593558A>G	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1637T>C	X.37:g.153593558A>G	ENSP00000358866:p.Val546Ala		Somatic				FLNA_uc010nuu.1_Missense_Mutation_p.V546A	p.V546A	NM_001110556	NP_001104026	WXS	Illumina HiSeq	Unspecified	P21333	FLNA_HUMAN			11	1886	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		546			Filamin 3.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.1637T>C	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.496622	0.01001	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	4.17	0.387	0.16259	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.594264	0.14280	U	0.329579	T	0.66867	0.2833	N	0.21373	0.66	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.10450	0.003;0.005	T	0.48019	-0.9071	10	0.12103	T	0.63	.	8.1762	0.31283	0.499:0.0:0.501:0.0	.	546;546	P21333-2;P21333	.;FLNA_HUMAN	A	546;519;546;546;546	ENSP00000353467:V546A;ENSP00000416926:V546A;ENSP00000358866:V546A;ENSP00000358863:V546A	ENSP00000358863:V546A	V	-	2	0	FLNA	153246752	0.000000	0.05858	0.004000	0.12327	0.176000	0.22953	-0.082000	0.11304	0.040000	0.15660	0.372000	0.22366	GTC		0.622	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			69	23	0	0	0	0.048971	0	69	23				
KIAA1522	57648	broad.mit.edu	37	1	33237139	33237139	+	Frame_Shift_Del	DEL	T	T	-	rs537207440		TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr1:33237139delT	ENST00000373480.1	+	6	2285	c.2182delT	c.(2182-2184)ttcfs	p.F728fs	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000373481.3_Frame_Shift_Del_p.F739fs|KIAA1522_ENST00000401073.2_Frame_Shift_Del_p.F787fs	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	728	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CATGGCTGACTTCCCCCCACC	0.652																																							uc001bvv.2		NA																	0					0						c.(2182-2184)TTCfs		hypothetical protein LOC57648							27.0	28.0	28.0					1																	33237139		1832	4063	5895	SO:0001589	frameshift_variant	57648							g.chr1:33237139delT	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2182delT	1.37:g.33237139delT	ENSP00000362579:p.Phe728fs		Somatic				KIAA1522_uc001bvu.1_Frame_Shift_Del_p.F787fs|KIAA1522_uc010ohm.1_Frame_Shift_Del_p.F739fs|KIAA1522_uc010ohn.1_Intron	p.F728fs	NM_020888	NP_065939	WXS	Illumina HiSeq	Unspecified	Q9P206	K1522_HUMAN			6	2318	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	728			Pro-rich.		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Frame_Shift_Del	DEL	ENST00000373480.1	37	c.2182delT	CCDS55588.1																																																																																				0.652	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1			30	76	NA	NA	NA	NA	NA	30	76	---	---	---	---
C14orf39	317761	broad.mit.edu	37	14	60935256	60935257	+	Splice_Site	INS	-	-	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr14:60935256_60935257insA	ENST00000321731.3	-	9	835		c.e9-2			NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39						multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AGATATCTGCTAAAAAGACAAT	0.282																																							uc001xez.3		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.e9-1		hypothetical protein LOC317761																																				SO:0001630	splice_region_variant	317761							g.chr14:60935256_60935257insA	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.676-2->T	14.37:g.60935261_60935261dupA			Somatic				C14orf39_uc010apo.2_Intron	p.Q226_splice	NM_174978	NP_777638	WXS	Illumina HiSeq	Unspecified	Q08AQ4	Q08AQ4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0448)	9	786	-								Q08AQ4	Splice_Site	INS	ENST00000321731.3	37	c.676_splice	CCDS9746.1																																																																																				0.282	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	Intron	31	26	NA	NA	NA	NA	NA	31	26	---	---	---	---
RAI1	10743	broad.mit.edu	37	17	17696953	17696954	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:17696953_17696954insA	ENST00000353383.1	+	3	1160_1161	c.691_692insA	c.(691-693)cagfs	p.Q231fs	RAI1_ENST00000261641.6_Frame_Shift_Ins_p.Q231fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	231	Gln-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGGTGGTGGGCAGGGGGCCCAC	0.668																																							uc002grm.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(691-693)CAGfs		retinoic acid induced 1																																				SO:0001589	frameshift_variant	10743					cytoplasm|nucleus	zinc ion binding	g.chr17:17696953_17696954insA	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.692dupA	17.37:g.17696954_17696954dupA	ENSP00000323074:p.Gln231fs		Somatic				RAI1_uc002grn.1_Frame_Shift_Ins_p.Q231fs	p.Q231fs	NM_030665	NP_109590	WXS	Illumina HiSeq	Unspecified	Q7Z5J4	RAI1_HUMAN		READ - Rectum adenocarcinoma(1115;0.0276)	3	1160_1161	+			231			Gln-rich.		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Ins	INS	ENST00000353383.1	37	c.691_692insA	CCDS11188.1																																																																																				0.668	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		20	72	NA	NA	NA	NA	NA	20	72	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29490318	29490321	+	Frame_Shift_Del	DEL	CGGA	CGGA	-			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	CGGA	CGGA	-	-	CGGA	CGGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr17:29490318_29490321delCGGA	ENST00000358273.4	+	4	786_789	c.403_406delCGGA	c.(403-408)cggaatfs	p.RN135fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.RN135fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.RN135fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	135					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.L134fs*19(1)|p.R135fs*30(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGCTGAACTTCGGAATTCTGCCTC	0.436			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		14	Whole gene deletion(8)|Unknown(4)|Deletion - Frameshift(2)	p.0?(5)|p.?(4)|p.L134fs*19(1)|p.R135fs*30(1)	soft_tissue(9)|autonomic_ganglia(3)|central_nervous_system(2)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(403-408)CGGAATfs		neurofibromin isoform 1																																				SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29490318_29490321delCGGA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.403_406delCGGA	17.37:g.29490318_29490321delCGGA	ENSP00000351015:p.Arg135fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hge.1_Frame_Shift_Del_p.R135fs|NF1_uc002hgf.1_Frame_Shift_Del_p.R135fs|NF1_uc002hgh.2_Frame_Shift_Del_p.R135fs|NF1_uc010csn.1_Frame_Shift_Del_p.F30fs	p.R135fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	4	736_739	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	135_136					O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	c.403_406delCGGA	CCDS42292.1																																																																																				0.436	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		19	28	NA	NA	NA	NA	NA	19	28	---	---	---	---
PRLR	5618	broad.mit.edu	37	5	35066004	35066004	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7535-01A-11D-2063-08	TCGA-78-7535-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fa8844f8-c4b6-487a-8187-e30c12a7a453	fc832d25-7dca-4b87-8df0-0fe45ca2c0fe	g.chr5:35066004delC	ENST00000382002.5	-	10	1482	c.1056delG	c.(1054-1056)gggfs	p.G352fs	PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000342362.5_Frame_Shift_Del_p.G251fs|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Intron|PRLR_ENST00000511486.1_Frame_Shift_Del_p.G251fs|PRLR_ENST00000231423.3_Intron	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	352					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	TGTCACAGCTCCCCCGGCCTG	0.498																																							uc003jjm.2		NA																	0				ovary(2)|skin(1)	3						c.(1054-1056)GGGfs		prolactin receptor precursor	Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)						85.0	87.0	87.0					5																	35066004		2203	4300	6503	SO:0001589	frameshift_variant	5618				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity	g.chr5:35066004delC		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.1056delG	5.37:g.35066004delC	ENSP00000371432:p.Gly352fs		Somatic				PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Frame_Shift_Del_p.G251fs	p.G352fs	NM_000949	NP_000940	WXS	Illumina HiSeq	Unspecified	P16471	PRLR_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		10	1586	-	all_lung(31;3.83e-05)		352			Cytoplasmic (Potential).		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Frame_Shift_Del	DEL	ENST00000382002.5	37	c.1056delG	CCDS3909.1																																																																																				0.498	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			35	52	NA	NA	NA	NA	NA	35	52	---	---	---	---
