#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
KANK4	163782	broad.mit.edu	37	1	62718834	62718834	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:62718834T>C	ENST00000371153.4	-	8	2965	c.2587A>G	c.(2587-2589)Atg>Gtg	p.M863V	KANK4_ENST00000354381.3_Missense_Mutation_p.M235V|KANK4_ENST00000371150.1_Missense_Mutation_p.M219V|KANK4_ENST00000317477.4_Start_Codon_SNP_p.M1V	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	863						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GGAGTGATCATTACGGCAGTG	0.522																																							uc001dah.3		NA																	0				ovary(3)|skin(2)|lung(1)	6						c.(2587-2589)ATG>GTG		ankyrin repeat domain 38							162.0	154.0	157.0					1																	62718834		2203	4300	6503	SO:0001583	missense	163782							g.chr1:62718834T>C	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2587A>G	1.37:g.62718834T>C	ENSP00000360195:p.Met863Val		Somatic				KANK4_uc001dai.3_Missense_Mutation_p.M235V|KANK4_uc001daf.3_Missense_Mutation_p.M1V|KANK4_uc001dag.3_Missense_Mutation_p.M219V	p.M863V	NM_181712	NP_859063	WXS	Illumina HiSeq	Unspecified	Q5T7N3	KANK4_HUMAN			8	2964	-			863			ANK 2.		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.2587A>G	CCDS620.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370580	0.82573	.	.	ENSG00000132854	ENST00000371153;ENST00000317477;ENST00000354381;ENST00000371150	T;T;T;T	0.66099	-0.19;0.84;-0.19;-0.19	5.16	5.16	0.70880	Ankyrin repeat-containing domain (4);	0.000000	0.46442	D	0.000291	T	0.75925	0.3916	L	0.58101	1.795	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.91635	0.994;0.999	T	0.78679	-0.2110	10	0.87932	D	0	-24.3646	15.1628	0.72798	0.0:0.0:0.0:1.0	.	235;863	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	V	863;1;235;219	ENSP00000360195:M863V;ENSP00000321161:M1V;ENSP00000346352:M235V;ENSP00000360192:M219V	ENSP00000321161:M1V	M	-	1	0	KANK4	62491422	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.682000	0.84083	2.177000	0.69029	0.533000	0.62120	ATG		0.522	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		42	68	0	0	0	0.011902	0	42	68				
LPAR3	23566	broad.mit.edu	37	1	85331206	85331206	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:85331206G>C	ENST00000440886.1	-	1	636	c.598C>G	c.(598-600)Ctc>Gtc	p.L200V	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_Missense_Mutation_p.L200V			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	200					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						ACCATGATGAGGAAGGCCATG	0.537																																							uc001dkl.2		NA																	0				lung(3)|ovary(2)	5						c.(598-600)CTC>GTC		lysophosphatidic acid receptor 3							125.0	109.0	115.0					1																	85331206		2203	4300	6503	SO:0001583	missense	23566				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle		g.chr1:85331206G>C	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.598C>G	1.37:g.85331206G>C	ENSP00000395389:p.Leu200Val		Somatic				LPAR3_uc009wcj.1_Missense_Mutation_p.L200V	p.L200V	NM_012152	NP_036284	WXS	Illumina HiSeq	Unspecified	Q9UBY5	LPAR3_HUMAN			1	637	-			200			Helical; Name=5; (Potential).		A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	37	c.598C>G	CCDS700.1	.	.	.	.	.	.	.	.	.	.	A	9.440	1.087805	0.20390	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.38722	1.12;1.12	5.2	4.07	0.47477	GPCR, rhodopsin-like superfamily (1);	0.241291	0.43416	D	0.000574	T	0.09774	0.0240	N	0.25380	0.74	0.18873	N	0.999989	B	0.02656	0.0	B	0.09377	0.004	T	0.32241	-0.9914	10	0.24483	T	0.36	.	5.7421	0.18100	0.7126:0.1412:0.1462:0.0	.	200	Q9UBY5	LPAR3_HUMAN	V	200	ENSP00000395389:L200V;ENSP00000359643:L200V	ENSP00000359643:L200V	L	-	1	0	LPAR3	85103794	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	1.490000	0.35573	0.318000	0.23185	-0.269000	0.10298	CTC		0.537	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152		24	32	0	0	0	0.021523	0	24	32				
CLCA2	9635	broad.mit.edu	37	1	86913287	86913287	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:86913287C>G	ENST00000370565.4	+	11	1972	c.1810C>G	c.(1810-1812)Cca>Gca	p.P604A		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	604					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		AGCTGTGCCCCCAGCCACTGT	0.498																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	uc001dlr.3		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1810-1812)CCA>GCA		chloride channel accessory 2 precursor							133.0	128.0	130.0					1																	86913287		2203	4300	6503	SO:0001583	missense	9635				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:86913287C>G		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1810C>G	1.37:g.86913287C>G	ENSP00000359596:p.Pro604Ala		Somatic					p.P604A	NM_006536	NP_006527	WXS	Illumina HiSeq	Unspecified	Q9UQC9	CLCA2_HUMAN		all cancers(265;0.0233)|Epithelial(280;0.0452)	11	1972	+		Lung NSC(277;0.238)	604			Extracellular (Potential).		A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	c.1810C>G	CCDS708.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631509	0.67015	.	.	ENSG00000137975	ENST00000370565	T	0.34072	1.38	5.71	5.71	0.89125	Domain of unknown function DUF1973 (1);	0.189347	0.45361	D	0.000368	T	0.60625	0.2283	M	0.90082	3.085	0.41541	D	0.988511	D	0.89917	1.0	D	0.74348	0.983	T	0.66783	-0.5836	10	0.54805	T	0.06	-16.3226	15.3815	0.74661	0.1398:0.8602:0.0:0.0	.	604	Q9UQC9	CLCA2_HUMAN	A	604	ENSP00000359596:P604A	ENSP00000359596:P604A	P	+	1	0	CLCA2	86685875	0.435000	0.25577	0.928000	0.36995	0.782000	0.44232	1.434000	0.34958	2.709000	0.92574	0.655000	0.94253	CCA		0.498	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		47	66	0	0	0	0.01441	0	47	66				
GBP4	115361	broad.mit.edu	37	1	89650951	89650951	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:89650951C>T	ENST00000355754.6	-	11	2006	c.1909G>A	c.(1909-1911)Ggc>Agc	p.G637S	GBP4_ENST00000471938.1_5'UTR	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	637						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		ATACGTGAGCCAAGATATTTT	0.348																																							uc001dnb.2		NA																	0					0						c.(1909-1911)GGC>AGC		guanylate binding protein 4							89.0	82.0	84.0					1																	89650951		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89650951C>T	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1909G>A	1.37:g.89650951C>T	ENSP00000359490:p.Gly637Ser		Somatic					p.G637S	NM_052941	NP_443173	WXS	Illumina HiSeq	Unspecified	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	11	2025	-			637					B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.1909G>A	CCDS721.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.212697	0.00289	.	.	ENSG00000162654	ENST00000355754	T	0.55052	0.54	3.11	-6.23	0.02052	.	0.935581	0.08931	N	0.872941	T	0.05593	0.0147	N	0.08118	0	0.09310	N	1	B	0.21688	0.059	B	0.13407	0.009	T	0.10941	-1.0608	10	0.02654	T	1	.	6.4192	0.21734	0.2663:0.526:0.0:0.2078	.	637	Q96PP9	GBP4_HUMAN	S	637	ENSP00000359490:G637S	ENSP00000359490:G637S	G	-	1	0	GBP4	89423539	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.999000	0.00161	-2.889000	0.00316	-2.859000	0.00101	GGC		0.348	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		27	54	0	0	0	0.008361	0	27	54				
RNPC3	55599	broad.mit.edu	37	1	104093592	104093592	+	Missense_Mutation	SNP	G	G	T	rs568519704		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:104093592G>T	ENST00000533099.1	+	14	1627	c.1391G>T	c.(1390-1392)cGt>cTt	p.R464L	RNPC3_ENST00000423855.2_Missense_Mutation_p.R464L|RNPC3_ENST00000524631.1_Missense_Mutation_p.R463L			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	464	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		AAAGAAGGTCGTATGAAAGGA	0.353																																							uc010oul.1		NA																	0					0						c.(1390-1392)CGT>CTT		RNA-binding region (RNP1, RRM) containing 3							84.0	80.0	81.0					1																	104093592		1835	4088	5923	SO:0001583	missense	55599				mRNA processing	U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding	g.chr1:104093592G>T	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.1391G>T	1.37:g.104093592G>T	ENSP00000432886:p.Arg464Leu		Somatic				RNPC3_uc010oum.1_Missense_Mutation_p.R463L|RNPC3_uc010oun.1_Missense_Mutation_p.R464L|AMY2B_uc010ouo.1_RNA	p.R464L	NM_017619	NP_060089	WXS	Illumina HiSeq	Unspecified	Q96LT9	RBM40_HUMAN		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)	13	1506	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	464			RRM 2.		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	ENST00000533099.1	37	c.1391G>T	CCDS781.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.1|29.1	4.977688|4.977688	0.92982|0.92982	.|.	.|.	ENSG00000185946|ENSG00000185946	ENST00000524631;ENST00000533099;ENST00000423855|ENST00000531127	T;T;T|.	0.18657|.	2.2;2.2;2.2|.	5.07|5.07	5.07|5.07	0.68467|0.68467	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	.|.	.|.	.|.	.|.	T|T	0.71804|0.71804	0.3383|0.3383	M|M	0.76727|0.76727	2.345|2.345	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.994;1.0|.	D;D|.	0.91635|.	0.978;0.999|.	T|T	0.71859|0.71859	-0.4465|-0.4465	9|5	0.87932|.	D|.	0|.	-13.6989|-13.6989	18.8117|18.8117	0.92059|0.92059	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	463;464|.	A8K1C9;Q96LT9|.	.;RBM40_HUMAN|.	L|L	463;464;464|75	ENSP00000437278:R463L;ENSP00000432886:R464L;ENSP00000391432:R464L|.	ENSP00000391432:R464L|.	R|V	+|+	2|1	0|0	RNPC3|RNPC3	103895115|103895115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.420000|9.420000	0.97426|0.97426	2.503000|2.503000	0.84419|0.84419	0.591000|0.591000	0.81541|0.81541	CGT|GTA		0.353	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390812.1	NM_017619		18	38	1	0	5.35267e-07	0.007413	9.28052e-07	18	38				
NGF	4803	broad.mit.edu	37	1	115829120	115829120	+	Silent	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:115829120G>A	ENST00000369512.2	-	3	465	c.297C>T	c.(295-297)gaC>gaT	p.D99D	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	99					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	GATCCTGAGTGTCTGCAGCTT	0.582																																							uc001efu.1		NA																	0				upper_aerodigestive_tract(2)	2						c.(295-297)GAC>GAT		nerve growth factor, beta polypeptide precursor	Clenbuterol(DB01407)						45.0	45.0	45.0					1																	115829120		2203	4300	6503	SO:0001819	synonymous_variant	4803				activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding	g.chr1:115829120G>A		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.297C>T	1.37:g.115829120G>A			Somatic					p.D99D	NM_002506	NP_002497	WXS	Illumina HiSeq	Unspecified	P01138	NGF_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	3	466	-	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)	99					A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Silent	SNP	ENST00000369512.2	37	c.297C>T	CCDS882.1																																																																																				0.582	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	NM_002506		11	25	0	0	0	0.013537	0	11	25				
HRNR	388697	broad.mit.edu	37	1	152192466	152192466	+	Nonsense_Mutation	SNP	G	G	A	rs142288299		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:152192466G>A	ENST00000368801.2	-	3	1714	c.1639C>T	c.(1639-1641)Cga>Tga	p.R547*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	547					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R547*(2)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTCATGTCGGCCACGGCTA	0.587																																							uc001ezt.1		NA																	2	Substitution - Nonsense(2)		large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	skin(2)|ovary(1)	3						c.(1639-1641)CGA>TGA		hornerin		G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	147.0	156.0	153.0		1639	1.7	0.0	1	dbSNP_134	153	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	HRNR	NM_001009931.1		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		547/2851	152192466	3,13003	2203	4300	6503	SO:0001587	stop_gained	388697				keratinization		calcium ion binding|protein binding	g.chr1:152192466G>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1639C>T	1.37:g.152192466G>A	ENSP00000357791:p.Arg547*		Somatic					p.R547*	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1715	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		547			5.		Q5DT20|Q5U1F4	Nonsense_Mutation	SNP	ENST00000368801.2	37	c.1639C>T	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648708	0.87958	2.27E-4	2.33E-4	ENSG00000197915	ENST00000368801	.	.	.	2.72	1.73	0.24493	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	6.7027	0.23234	0.0:0.0:0.7188:0.2812	.	.	.	.	X	547	.	ENSP00000357791:R547X	R	-	1	2	HRNR	150459090	0.001000	0.12720	0.002000	0.10522	0.008000	0.06430	0.731000	0.26058	0.440000	0.26502	0.549000	0.68633	CGA		0.587	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		16	342	0	0	0	0.024245	0	16	342				
FCRL2	79368	broad.mit.edu	37	1	157740395	157740395	+	Silent	SNP	G	G	A	rs139205435		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:157740395G>A	ENST00000361516.3	-	3	162	c.114C>T	c.(112-114)tgC>tgT	p.C38C	FCRL2_ENST00000392274.3_Silent_p.C38C|FCRL2_ENST00000469986.1_5'Flank|FCRL2_ENST00000368181.4_Silent_p.C38C	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	38	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTTCTCCCTGGCATTTCAGAA	0.438																																							uc001fre.2		NA																	0				ovary(1)|pancreas(1)	2						c.(112-114)TGC>TGT		Fc receptor-like 2 precursor							57.0	58.0	58.0					1																	157740395		2203	4300	6503	SO:0001819	synonymous_variant	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157740395G>A	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.114C>T	1.37:g.157740395G>A			Somatic				FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Silent_p.C38C|FCRL2_uc009wsp.2_Silent_p.C38C|FCRL2_uc010pia.1_Silent_p.C38C	p.C38C	NM_030764	NP_110391	WXS	Illumina HiSeq	Unspecified	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	173	-	all_hematologic(112;0.0378)		38			Ig-like C2-type 1.|Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Silent	SNP	ENST00000361516.3	37	c.114C>T	CCDS1168.1																																																																																				0.438	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		14	69	0	0	0	0.016723	0	14	69				
OR10K1	391109	broad.mit.edu	37	1	158436014	158436014	+	Silent	SNP	C	C	A	rs151132888		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:158436014C>A	ENST00000289451.2	+	1	743	c.663C>A	c.(661-663)atC>atA	p.I221I		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					ACATCCGCATCATCTCTGCCA	0.473																																							uc010pij.1		NA																	0				ovary(1)	1						c.(661-663)ATC>ATA		olfactory receptor, family 10, subfamily K,							130.0	119.0	122.0					1																	158436014		2203	4300	6503	SO:0001819	synonymous_variant	391109				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158436014C>A	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.663C>A	1.37:g.158436014C>A			Somatic					p.I221I	NM_001004473	NP_001004473	WXS	Illumina HiSeq	Unspecified	Q8NGX5	O10K1_HUMAN			1	663	+	all_hematologic(112;0.0378)		221			Cytoplasmic (Potential).		Q6IFS2	Silent	SNP	ENST00000289451.2	37	c.663C>A	CCDS30897.1																																																																																				0.473	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1			45	140	1	0	1.61572e-30	0.010771	3.74413e-30	45	140				
OR6K3	391114	broad.mit.edu	37	1	158687509	158687509	+	Missense_Mutation	SNP	G	G	T	rs144430951		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:158687509G>T	ENST00000368146.1	-	1	444	c.445C>A	c.(445-447)Caa>Aaa	p.Q149K	OR6K3_ENST00000368145.1_Missense_Mutation_p.Q133K			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					ATGATCATTTGATAGCGAAGA	0.498																																							uc010pip.1		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(445-447)CAA>AAA		olfactory receptor, family 6, subfamily K,							96.0	103.0	101.0					1																	158687509		2203	4300	6503	SO:0001583	missense	391114				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158687509G>T	AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.445C>A	1.37:g.158687509G>T	ENSP00000357128:p.Gln149Lys		Somatic					p.Q149K	NM_001005327	NP_001005327	WXS	Illumina HiSeq	Unspecified	Q8NGY3	OR6K3_HUMAN			1	445	-	all_hematologic(112;0.0378)		149			Cytoplasmic (Potential).		Q5VUV0|Q6IFR5	Missense_Mutation	SNP	ENST00000368146.1	37	c.445C>A		.	.	.	.	.	.	.	.	.	.	G	11.42	1.634898	0.29068	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.00873	5.59;5.59	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00271	0.0008	N	0.03194	-0.395	0.09310	N	1	B	0.25312	0.123	B	0.22753	0.041	T	0.51108	-0.8747	9	0.59425	D	0.04	.	10.5295	0.44969	0.0:0.0:0.806:0.194	.	149	Q8NGY3	OR6K3_HUMAN	K	133;149	ENSP00000357127:Q133K;ENSP00000357128:Q149K	ENSP00000357127:Q133K	Q	-	1	0	OR6K3	156954133	0.000000	0.05858	0.006000	0.13384	0.953000	0.61014	-1.047000	0.03521	2.144000	0.66660	0.411000	0.27672	CAA		0.498	OR6K3-201	KNOWN	basic	protein_coding	protein_coding				30	127	1	0	3.73988e-18	0.00632	7.3878e-18	30	127				
AIM2	9447	broad.mit.edu	37	1	159036024	159036024	+	Silent	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:159036024G>T	ENST00000368130.4	-	4	780	c.492C>A	c.(490-492)ccC>ccA	p.P164P	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	164	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					CAAACGTGAAGGGCTTCTTTG	0.438																																							uc001ftj.1		NA																	0				ovary(2)|pancreas(1)	3						c.(490-492)CCC>CCA		absent in melanoma 2							90.0	92.0	91.0					1																	159036024		2203	4300	6503	SO:0001819	synonymous_variant	9447				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus		g.chr1:159036024G>T	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.492C>A	1.37:g.159036024G>T			Somatic					p.P164P	NM_004833	NP_004824	WXS	Illumina HiSeq	Unspecified	O14862	AIM2_HUMAN			4	737	-	all_hematologic(112;0.0429)		164			HIN-200.		A8K7M7|Q5T3V9|Q96FG9	Silent	SNP	ENST00000368130.4	37	c.492C>A	CCDS1181.1																																																																																				0.438	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833		114	82	1	0	2.5327e-61	0.01441	5.98412e-61	114	82				
USP21	27005	broad.mit.edu	37	1	161130689	161130689	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:161130689G>A	ENST00000289865.8	+	2	480	c.259G>A	c.(259-261)Ggg>Agg	p.G87R	USP21_ENST00000368001.1_Missense_Mutation_p.G87R|RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368002.3_Missense_Mutation_p.G87R	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	87					histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			AGCAGATCATGGGGTTCCCCT	0.637																																							uc010pke.1		NA																	0				ovary(2)|lung(1)|prostate(1)|breast(1)	5						c.(259-261)GGG>AGG		ubiquitin-specific protease 21							67.0	63.0	64.0					1																	161130689		2203	4300	6503	SO:0001583	missense	27005				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:161130689G>A	AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.259G>A	1.37:g.161130689G>A	ENSP00000289865:p.Gly87Arg		Somatic				USP21_uc010pkc.1_Missense_Mutation_p.G87R|USP21_uc010pkd.1_Missense_Mutation_p.G87R|USP21_uc010pkf.1_Missense_Mutation_p.G87R	p.G87R	NM_001014443	NP_001014443	WXS	Illumina HiSeq	Unspecified	Q9UK80	UBP21_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		3	636	+	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		87					Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	c.259G>A	CCDS30920.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047503	0.75846	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.39997	1.05;1.05;1.05	5.14	5.14	0.70334	.	.	.	.	.	T	0.35068	0.0919	N	0.14661	0.345	0.39006	D	0.959444	D	0.64830	0.994	P	0.59221	0.854	T	0.37174	-0.9717	9	0.59425	D	0.04	.	17.538	0.87839	0.0:0.0:1.0:0.0	.	87	Q9UK80	UBP21_HUMAN	R	87	ENSP00000356981:G87R;ENSP00000289865:G87R;ENSP00000356980:G87R	ENSP00000289865:G87R	G	+	1	0	USP21	159397313	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.678000	0.68153	2.666000	0.90696	0.561000	0.74099	GGG		0.637	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1			43	35	0	0	0	0.00874	0	43	35				
ADCY10	55811	broad.mit.edu	37	1	167874234	167874234	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:167874234A>C	ENST00000367851.4	-	2	329	c.145T>G	c.(145-147)Tca>Gca	p.S49A	ADCY10_ENST00000367848.1_5'UTR|ADCY10_ENST00000476818.2_Missense_Mutation_p.S49A|ADCY10_ENST00000545172.1_Intron	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	49	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CACTTGCCTGAAATATCAACA	0.448																																							uc001ger.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(145-147)TCA>GCA		adenylate cyclase 10							97.0	92.0	94.0					1																	167874234		2203	4300	6503	SO:0001583	missense	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167874234A>C	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.145T>G	1.37:g.167874234A>C	ENSP00000356825:p.Ser49Ala		Somatic				ADCY10_uc009wvk.2_5'UTR|ADCY10_uc010plj.1_Intron|ADCY10_uc009wvl.2_Missense_Mutation_p.S49A|ADCY10_uc009wvm.2_RNA	p.S49A	NM_018417	NP_060887	WXS	Illumina HiSeq	Unspecified	Q96PN6	ADCYA_HUMAN			2	443	-			49			Guanylate cyclase 1.		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	c.145T>G	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579629	0.86645	.	.	ENSG00000143199	ENST00000367851	T	0.80480	-1.38	5.57	5.57	0.84162	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.50627	D	0.000110	D	0.83285	0.5221	L	0.58810	1.83	0.30332	N	0.786543	D	0.69078	0.997	D	0.80764	0.994	D	0.85008	0.0904	9	0.46703	T	0.11	.	12.132	0.53948	1.0:0.0:0.0:0.0	.	49	Q96PN6	ADCYA_HUMAN	A	49	ENSP00000356825:S49A	ENSP00000356825:S49A	S	-	1	0	ADCY10	166140858	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.969000	0.63735	2.107000	0.64212	0.528000	0.53228	TCA		0.448	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		15	92	0	0	0	0.007413	0	15	92				
KCNT2	343450	broad.mit.edu	37	1	196311313	196311313	+	Silent	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:196311313T>C	ENST00000294725.9	-	15	2364	c.1449A>G	c.(1447-1449)agA>agG	p.R483R	KCNT2_ENST00000451324.2_Silent_p.R94R|KCNT2_ENST00000367433.5_Silent_p.R483R|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Intron|KCNT2_ENST00000367431.4_Intron			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	483	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCCCGGAGCATCTACCGTACA	0.418																																							uc001gtd.1		NA																	0				ovary(5)|breast(1)|skin(1)	7						c.(1447-1449)AGA>AGG		potassium channel, subfamily T, member 2							136.0	117.0	124.0					1																	196311313		2203	4300	6503	SO:0001819	synonymous_variant	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196311313T>C	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1449A>G	1.37:g.196311313T>C			Somatic				KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Silent_p.R483R|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Silent_p.R483R|KCNT2_uc001gth.1_Silent_p.R4R	p.R483R	NM_198503	NP_940905	WXS	Illumina HiSeq	Unspecified	Q6UVM3	KCNT2_HUMAN			15	1509	-			483			Cytoplasmic (Potential).|RCK N-terminal.		Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	c.1449A>G	CCDS1384.1																																																																																				0.418	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		69	48	0	0	0	0.01441	0	69	48				
CNTN2	6900	broad.mit.edu	37	1	205031637	205031637	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:205031637C>T	ENST00000331830.4	+	10	1464	c.1180C>T	c.(1180-1182)Cag>Tag	p.Q394*	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	394	Ig-like C2-type 4.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGGCATGTACCAGTGTGTGGC	0.622																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	0				ovary(1)	1						c.(1180-1182)CAG>TAG		contactin 2 precursor							94.0	76.0	82.0					1																	205031637		2203	4300	6503	SO:0001587	stop_gained	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205031637C>T	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1180C>T	1.37:g.205031637C>T	ENSP00000330633:p.Gln394*		Somatic				CNTN2_uc001hbq.1_Nonsense_Mutation_p.Q285*|CNTN2_uc001hbs.2_Nonsense_Mutation_p.Q182*	p.Q394*	NM_005076	NP_005067	WXS	Illumina HiSeq	Unspecified	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		10	1449	+	all_cancers(21;0.144)|Breast(84;0.0437)		394			Ig-like C2-type 4.		P78432|Q5T054	Nonsense_Mutation	SNP	ENST00000331830.4	37	c.1180C>T	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	C	41	8.784662	0.98952	.	.	ENSG00000184144	ENST00000331830	.	.	.	5.5	5.5	0.81552	.	0.000000	0.48286	D	0.000182	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9848	0.92765	0.0:1.0:0.0:0.0	.	.	.	.	X	394	.	ENSP00000330633:Q394X	Q	+	1	0	CNTN2	203298260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.285000	0.78660	2.587000	0.87381	0.650000	0.86243	CAG		0.622	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		19	91	0	0	0	0.008871	0	19	91				
OR2W5	441932	broad.mit.edu	37	1	247654619	247654619	+	RNA	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:247654619G>A	ENST00000522351.1	+	0	250							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CTTCTTTCTTGGGAATCTGTC	0.522																																							uc001icz.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(190-192)GGG>AGG		olfactory receptor, family 2, subfamily W,							128.0	117.0	121.0					1																	247654619		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247654619G>A			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654619G>A			Somatic					p.G64R	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	190	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	64			Helical; Name=2; (Potential).		B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.190G>A																																																																																					0.522	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		46	31	0	0	0	0.013114	0	46	31				
FRMD4A	55691	broad.mit.edu	37	10	13735983	13735983	+	Silent	SNP	C	C	A	rs374188244		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:13735983C>A	ENST00000357447.2	-	15	1400	c.1032G>T	c.(1030-1032)acG>acT	p.T344T	FRMD4A_ENST00000358621.4_Silent_p.T329T|FRMD4A_ENST00000492155.1_5'UTR|FRMD4A_ENST00000378503.1_Silent_p.T344T|FRMD4A_ENST00000342409.2_Silent_p.T360T	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	344					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TCAGCGTCCCCGTCTCGGTCA	0.582																																							uc001ims.2		NA																	0				ovary(1)|skin(1)|pancreas(1)	3						c.(1030-1032)ACG>ACT		FERM domain containing 4A							154.0	119.0	131.0					10																	13735983		2203	4300	6503	SO:0001819	synonymous_variant	55691					cytoplasm|cytoskeleton	binding	g.chr10:13735983C>A	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1032G>T	10.37:g.13735983C>A			Somatic				FRMD4A_uc009xjf.1_Silent_p.T344T|FRMD4A_uc001imt.1_Silent_p.T377T|FRMD4A_uc001imu.1_Silent_p.T360T	p.T344T	NM_018027	NP_060497	WXS	Illumina HiSeq	Unspecified	Q9P2Q2	FRM4A_HUMAN			15	1384	-			344					A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	37	c.1032G>T	CCDS7101.1																																																																																				0.582	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027		34	34	1	0	7.04047e-22	0.023175	1.50155e-21	34	34				
STAM	8027	broad.mit.edu	37	10	17746987	17746987	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:17746987G>T	ENST00000377524.3	+	11	1234	c.1019G>T	c.(1018-1020)gGa>gTa	p.G340V	STAM_ENST00000540523.1_Missense_Mutation_p.G229V	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	340					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						CACCAGATGGGACCTCTCATT	0.328																																							uc001ipj.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(1018-1020)GGA>GTA		signal transducing adaptor molecule 1							149.0	140.0	143.0					10																	17746987		2203	4300	6503	SO:0001583	missense	8027				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity	g.chr10:17746987G>T	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.1019G>T	10.37:g.17746987G>T	ENSP00000366746:p.Gly340Val		Somatic				STAM_uc009xjw.1_Intron	p.G340V	NM_003473	NP_003464	WXS	Illumina HiSeq	Unspecified	Q92783	STAM1_HUMAN			11	1235	+			340					B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	37	c.1019G>T	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936507	0.92458	.	.	ENSG00000136738	ENST00000377524;ENST00000540523	T;T	0.42131	1.24;0.98	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58075	-0.7700	10	0.32370	T	0.25	-22.9111	20.0966	0.97849	0.0:0.0:1.0:0.0	.	340	Q92783	STAM1_HUMAN	V	340;229	ENSP00000366746:G340V;ENSP00000438073:G229V	ENSP00000366746:G340V	G	+	2	0	STAM	17786993	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.504000	0.97986	2.751000	0.94390	0.650000	0.86243	GGA		0.328	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473		29	80	1	0	1.99505e-19	0.012213	4.0404e-19	29	80				
ANK3	288	broad.mit.edu	37	10	61946575	61946575	+	Silent	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:61946575G>A	ENST00000280772.2	-	17	2174	c.1983C>T	c.(1981-1983)acC>acT	p.T661T	ANK3_ENST00000503366.1_Silent_p.T644T|ANK3_ENST00000373827.2_Silent_p.T655T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	661					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTCCTTGCCGGGTAACTGCGT	0.522																																							uc001jky.2		NA																	0				skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(1981-1983)ACC>ACT		ankyrin 3 isoform 1							231.0	184.0	200.0					10																	61946575		2203	4300	6503	SO:0001819	synonymous_variant	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:61946575G>A	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1983C>T	10.37:g.61946575G>A			Somatic				ANK3_uc010qih.1_Silent_p.T644T|ANK3_uc001jkz.3_Silent_p.T655T|ANK3_uc001jlb.1_Silent_p.T190T|ANK3_uc001jlc.1_Silent_p.T322T	p.T661T	NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			17	2175	-			661					B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	c.1983C>T	CCDS7258.1																																																																																				0.522	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		27	51	0	0	0	0.007291	0	27	51				
ADAMTS14	140766	broad.mit.edu	37	10	72434362	72434363	+	Missense_Mutation	DNP	AG	AG	TT			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:72434362_72434363AG>TT	ENST00000373207.1	+	2	133_134	c.133_134AG>TT	c.(133-135)AGc>TTc	p.S45F	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.S45F	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	45					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AGTGCCCTGCAGCACAGACTTT	0.564																																							uc001jrh.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(133-135)AGC>TTC		ADAM metallopeptidase with thrombospondin type 1																																				SO:0001583	missense	140766				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr10:72434362_72434363AG>TT	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	Exception_encountered	10.37:g.72434362_72434363delinsTT	ENSP00000362303:p.Ser45Phe		Somatic				ADAMTS14_uc001jrg.2_Missense_Mutation_p.S45F	p.S45F	NM_080722	NP_542453	WXS	Illumina HiSeq	Unspecified	Q8WXS8	ATS14_HUMAN			2	133_134	+			45					Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	DNP	ENST00000373207.1	37	c.133_134AG>TT	CCDS7306.1																																																																																				0.564	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		29	45	0	0	0	0.004672	0	29	45				
CHST3	9469	broad.mit.edu	37	10	73767095	73767095	+	Silent	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:73767095C>T	ENST00000373115.4	+	3	743	c.306C>T	c.(304-306)ggC>ggT	p.G102G		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	102					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						TGCAGCTGGGCGTGGAGCCAG	0.652																																							uc001jsn.2		NA																	0					0						c.(304-306)GGC>GGT		chondroitin 6-sulfotransferase 3							24.0	23.0	23.0					10																	73767095		2203	4300	6503	SO:0001819	synonymous_variant	9469				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity	g.chr10:73767095C>T	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.306C>T	10.37:g.73767095C>T			Somatic					p.G102G	NM_004273	NP_004264	WXS	Illumina HiSeq	Unspecified	Q7LGC8	CHST3_HUMAN			3	746	+			102			Lumenal (Potential).		O75099|Q52M30	Silent	SNP	ENST00000373115.4	37	c.306C>T	CCDS7312.1																																																																																				0.652	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273		7	3	0	0	0	0.001984	0	7	3				
SORCS3	22986	broad.mit.edu	37	10	106974237	106974237	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr10:106974237C>G	ENST00000369701.3	+	18	2640	c.2413C>G	c.(2413-2415)Cta>Gta	p.L805V	SORCS3_ENST00000369699.4_Missense_Mutation_p.L91V	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	805					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CACAGATGGGCTAAGGGAGAA	0.537																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(2413-2415)CTA>GTA		VPS10 domain receptor protein SORCS 3 precursor							118.0	101.0	107.0					10																	106974237		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106974237C>G	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2413C>G	10.37:g.106974237C>G	ENSP00000358715:p.Leu805Val		Somatic				SORCS3_uc010qqz.1_RNA	p.L805V	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	18	2640	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	805			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.2413C>G	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	c	0.989	-0.694463	0.03303	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.67171	-0.25;-0.25	5.89	4.98	0.66077	VPS10 (1);PKD domain (1);	0.353337	0.27100	N	0.020933	T	0.38295	0.1035	N	0.03209	-0.39	0.36413	D	0.863873	B	0.13145	0.007	B	0.14023	0.01	T	0.37103	-0.9720	9	.	.	.	.	7.731	0.28788	0.0:0.712:0.1355:0.1525	.	805	Q9UPU3	SORC3_HUMAN	V	805;91	ENSP00000358715:L805V;ENSP00000358713:L91V	.	L	+	1	2	SORCS3	106964227	0.958000	0.32768	0.186000	0.23195	0.754000	0.42855	1.713000	0.37951	1.468000	0.48064	0.558000	0.71614	CTA		0.537	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		26	41	0	0	0	0.024334	0	26	41				
OR51B2	79345	broad.mit.edu	37	11	5344806	5344806	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:5344806G>C	ENST00000328813.2	-	1	776	c.722C>G	c.(721-723)tCc>tGc	p.S241C	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTAATGTGGGAGATACAGGT	0.398																																							uc001mao.1		NA																	0				ovary(2)|skin(1)	3						c.(721-723)TCC>TGC		olfactory receptor, family 51, subfamily B,							96.0	88.0	91.0					11																	5344806		2201	4297	6498	SO:0001583	missense	79345				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5344806G>C	AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.722C>G	11.37:g.5344806G>C	ENSP00000327540:p.Ser241Cys		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	p.S241C	NM_033180	NP_149420	WXS	Illumina HiSeq	Unspecified	Q9Y5P1	O51B2_HUMAN		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	777	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	241			Helical; Name=6; (Potential).		Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	37	c.722C>G	CCDS31377.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875046	0.51695	.	.	ENSG00000184881	ENST00000328813	T	0.39787	1.06	4.08	4.08	0.47627	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001749	T	0.68366	0.2993	M	0.86343	2.81	0.36119	D	0.845362	D	0.89917	1.0	D	0.97110	1.0	T	0.80381	-0.1406	10	0.72032	D	0.01	.	15.2128	0.73238	0.0:0.0:1.0:0.0	.	241	Q9Y5P1	O51B2_HUMAN	C	241	ENSP00000327540:S241C	ENSP00000327540:S241C	S	-	2	0	OR51B2	5301382	1.000000	0.71417	0.367000	0.25926	0.483000	0.33249	5.569000	0.67391	2.153000	0.67306	0.638000	0.83543	TCC		0.398	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180		23	45	0	0	0	0.012319	0	23	45				
OR2D3	120775	broad.mit.edu	37	11	6942250	6942250	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:6942250G>T	ENST00000317834.3	+	1	46	c.18G>T	c.(16-18)ttG>ttT	p.L6F		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTTTTTCTTGTGCCAAACAG	0.398																																							uc010rav.1		NA																	0					0						c.(16-18)TTG>TTT		olfactory receptor, family 2, subfamily D,							68.0	70.0	69.0					11																	6942250		2201	4296	6497	SO:0001583	missense	120775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6942250G>T	BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.18G>T	11.37:g.6942250G>T	ENSP00000320560:p.Leu6Phe		Somatic					p.L6F	NM_001004684	NP_001004684	WXS	Illumina HiSeq	Unspecified	Q8NGH3	OR2D3_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	18	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	6			Extracellular (Potential).		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	ENST00000317834.3	37	c.18G>T	CCDS31417.1	.	.	.	.	.	.	.	.	.	.	G	1.413	-0.574904	0.03882	.	.	ENSG00000178358	ENST00000317834	T	0.01495	4.83	4.24	-2.5	0.06384	.	.	.	.	.	T	0.01189	0.0039	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45556	-0.9253	9	0.48119	T	0.1	.	5.2207	0.15368	0.4818:0.1583:0.3599:0.0	.	6	Q8NGH3	OR2D3_HUMAN	F	6	ENSP00000320560:L6F	ENSP00000320560:L6F	L	+	3	2	OR2D3	6898826	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.301000	0.08232	-0.463000	0.06973	0.650000	0.86243	TTG		0.398	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385987.1	NM_001004684		22	42	1	0	7.88262e-20	0.01892	1.62369e-19	22	42				
TPH1	7166	broad.mit.edu	37	11	18048162	18048162	+	Silent	SNP	A	A	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:18048162A>T	ENST00000250018.2	-	6	1240	c.678T>A	c.(676-678)ggT>ggA	p.G226G	TPH1_ENST00000341556.2_Silent_p.G226G	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	226					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	GGATGGAAAAACCTGTACGCT	0.418																																							uc001mnp.2		NA																	0					0						c.(676-678)GGT>GGA		tryptophan hydroxylase 1	L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)						71.0	71.0	71.0					11																	18048162		2200	4293	6493	SO:0001819	synonymous_variant	7166				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr11:18048162A>T	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.678T>A	11.37:g.18048162A>T			Somatic				TPH1_uc009yhe.2_RNA	p.G226G	NM_004179	NP_004170	WXS	Illumina HiSeq	Unspecified	P17752	TPH1_HUMAN			6	704	-			226					D3DQX6|O95188|O95189|Q16736|Q3KPG8	Silent	SNP	ENST00000250018.2	37	c.678T>A	CCDS7829.1																																																																																				0.418	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179		23	30	0	0	0	0.021523	0	23	30				
OR4C15	81309	broad.mit.edu	37	11	55322011	55322011	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:55322011G>T	ENST00000314644.2	+	1	229	c.229G>T	c.(229-231)Gaa>Taa	p.E77*		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						AAATGTTCAGGAAATAGTATT	0.418										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(229-231)GAA>TAA		olfactory receptor, family 4, subfamily C,							120.0	121.0	120.0					11																	55322011		2201	4296	6497	SO:0001587	stop_gained	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322011G>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.229G>T	11.37:g.55322011G>T	ENSP00000324958:p.Glu77*	HNSCC(20;0.049)	Somatic					p.E77*	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	229	+			23			Extracellular (Potential).		Q6IFE2	Nonsense_Mutation	SNP	ENST00000314644.2	37	c.229G>T	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.421564	0.25639	.	.	ENSG00000181939	ENST00000314644	.	.	.	5.12	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.336	0.21296	0.8094:0.0:0.1906:0.0	.	.	.	.	X	77	.	ENSP00000324958:E77X	E	+	1	0	OR4C15	55078587	0.000000	0.05858	0.074000	0.20217	0.364000	0.29643	-0.798000	0.04565	0.984000	0.38629	-0.532000	0.04303	GAA		0.418	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		58	88	1	0	3.21867e-24	0.01441	7.24954e-24	58	88				
OR5T2	219464	broad.mit.edu	37	11	55999867	55999867	+	Silent	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:55999867C>T	ENST00000313264.4	-	1	870	c.795G>A	c.(793-795)ctG>ctA	p.L265L		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AATACATCTTCAGAATGGCCA	0.433																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(793-795)CTG>CTA		olfactory receptor, family 5, subfamily T,							135.0	126.0	129.0					11																	55999867		2201	4296	6497	SO:0001819	synonymous_variant	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999867C>T	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.795G>A	11.37:g.55999867C>T			Somatic					p.L265L	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	795	-	Esophageal squamous(21;0.00448)		265			Cytoplasmic (Potential).		B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	37	c.795G>A	CCDS31523.1																																																																																				0.433	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		49	85	0	0	0	0.01441	0	49	85				
OR5T3	390154	broad.mit.edu	37	11	56020505	56020505	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:56020505G>T	ENST00000303059.3	+	1	830	c.830G>T	c.(829-831)gGa>gTa	p.G277V		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CACCTAACTGGAGTGACAATT	0.403																																							uc010rjd.1		NA																	0					0						c.(829-831)GGA>GTA		olfactory receptor, family 5, subfamily T,							193.0	173.0	180.0					11																	56020505		2201	4295	6496	SO:0001583	missense	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56020505G>T	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.830G>T	11.37:g.56020505G>T	ENSP00000305403:p.Gly277Val		Somatic					p.G277V	NM_001004747	NP_001004747	WXS	Illumina HiSeq	Unspecified	Q8NGG3	OR5T3_HUMAN			1	830	+	Esophageal squamous(21;0.00448)		277			Helical; Name=6; (Potential).		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	37	c.830G>T	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	G	9.384	1.073637	0.20147	.	.	ENSG00000172489	ENST00000303059	T	0.00014	9.18	4.46	-0.154	0.13399	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000288	T	0.00039	0.0001	N	0.00143	-2	0.20196	N	0.999925	P	0.40230	0.708	P	0.49477	0.612	T	0.28618	-1.0038	10	0.46703	T	0.11	.	2.9671	0.05911	0.0843:0.2176:0.2363:0.4618	.	277	Q8NGG3	OR5T3_HUMAN	V	277	ENSP00000305403:G277V	ENSP00000305403:G277V	G	+	2	0	OR5T3	55777081	0.000000	0.05858	0.087000	0.20705	0.208000	0.24298	-0.840000	0.04363	0.182000	0.20032	0.643000	0.83706	GGA		0.403	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		54	98	1	0	6.4308e-24	0.01441	1.42186e-23	54	98				
PDE2A	5138	broad.mit.edu	37	11	72291952	72291952	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr11:72291952T>C	ENST00000334456.5	-	24	2356	c.2111A>G	c.(2110-2112)aAc>aGc	p.N704S	PDE2A_ENST00000376450.3_Missense_Mutation_p.N448S|PDE2A_ENST00000540345.1_Missense_Mutation_p.N695S|PDE2A_ENST00000544570.1_Missense_Mutation_p.N697S|PDE2A_ENST00000418754.2_Missense_Mutation_p.N589S|PDE2A_ENST00000444035.2_Missense_Mutation_p.N695S	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	704	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GAAAGAGTTGTTTGTGCCTCT	0.532																																							uc010rrc.1		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(2110-2112)AAC>AGC		phosphodiesterase 2A isoform 1	Sildenafil(DB00203)|Sulindac(DB00605)						133.0	108.0	117.0					11																	72291952		2200	4293	6493	SO:0001583	missense	5138				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr11:72291952T>C	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.2111A>G	11.37:g.72291952T>C	ENSP00000334910:p.Asn704Ser		Somatic				PDE2A_uc001oso.2_Missense_Mutation_p.N683S|PDE2A_uc010rra.1_Missense_Mutation_p.N697S|PDE2A_uc001osn.2_Missense_Mutation_p.N448S|PDE2A_uc010rrb.1_Missense_Mutation_p.N695S|PDE2A_uc010rrd.1_Missense_Mutation_p.N589S	p.N704S	NM_002599	NP_002590	WXS	Illumina HiSeq	Unspecified	O00408	PDE2A_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		24	2354	-			704			Catalytic (By similarity).		B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	ENST00000334456.5	37	c.2111A>G	CCDS8216.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632879	0.87660	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000420501;ENST00000441209;ENST00000542223	T;T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.36	5.36	0.76844	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.82834	0.5123	L	0.45051	1.395	0.53688	D	0.999979	D;P;P;D;P;P	0.76494	0.975;0.7;0.81;0.999;0.937;0.883	P;P;P;D;P;P	0.68192	0.572;0.594;0.594;0.956;0.794;0.594	T	0.83166	-0.0096	10	0.46703	T	0.11	.	14.2263	0.65860	0.0:0.0:0.0:1.0	.	589;704;695;697;704;448	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646;Q6ZMR1	.;PDE2A_HUMAN;.;.;.;.	S	704;448;695;773;697;589;695;83;245;135	ENSP00000334910:N704S;ENSP00000365633:N448S;ENSP00000411657:N695S;ENSP00000442256:N697S;ENSP00000410310:N589S;ENSP00000446399:N695S;ENSP00000388997:N83S;ENSP00000392457:N245S;ENSP00000440834:N135S	ENSP00000334910:N704S	N	-	2	0	PDE2A	71969600	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.479000	0.60236	2.042000	0.60477	0.533000	0.62120	AAC		0.532	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599		15	32	0	0	0	0.008871	0	15	32				
KRT83	3889	broad.mit.edu	37	12	52710805	52710805	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr12:52710805C>A	ENST00000293670.3	-	5	815	c.753G>T	c.(751-753)gaG>gaT	p.E251D		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	251	Coil 1B.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GAATGCGGATCTCCTGCAGGA	0.532																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	uc001saf.2		NA																	0				skin(1)	1						c.(751-753)GAG>GAT		keratin 83							124.0	110.0	115.0					12																	52710805		2203	4300	6503	SO:0001583	missense	3889				epidermis development	keratin filament	structural molecule activity	g.chr12:52710805C>A	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.753G>T	12.37:g.52710805C>A	ENSP00000293670:p.Glu251Asp		Somatic					p.E251D	NM_002282	NP_002273	WXS	Illumina HiSeq	Unspecified	P78385	KRT83_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	5	816	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		251			Rod.|Coil 1B.		A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	37	c.753G>T	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071829	0.55646	.	.	ENSG00000170523	ENST00000293670	D	0.96136	-3.92	3.9	3.0	0.34707	Filament (1);	0.000000	0.41712	U	0.000830	D	0.97235	0.9096	M	0.90198	3.095	0.32240	N	0.572786	P	0.51147	0.942	P	0.62298	0.9	D	0.96535	0.9396	10	0.87932	D	0	.	7.5079	0.27555	0.0:0.6501:0.0:0.3499	.	251	P78385	KRT83_HUMAN	D	251	ENSP00000293670:E251D	ENSP00000293670:E251D	E	-	3	2	KRT83	50997072	1.000000	0.71417	0.997000	0.53966	0.730000	0.41778	1.166000	0.31834	0.763000	0.33175	0.561000	0.74099	GAG		0.532	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282		23	58	1	0	4.26978e-12	0.01892	7.91551e-12	23	58				
NCKAP1L	3071	broad.mit.edu	37	12	54905735	54905735	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr12:54905735G>A	ENST00000293373.6	+	9	866	c.787G>A	c.(787-789)Ggg>Agg	p.G263R	NCKAP1L_ENST00000552211.1_3'UTR|NCKAP1L_ENST00000545638.2_Missense_Mutation_p.G213R	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	263					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						ACCTACAGTTGGGTTTCTTCT	0.463																																							uc001sgc.3		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(787-789)GGG>AGG		NCK-associated protein 1-like							175.0	161.0	166.0					12																	54905735		2203	4300	6503	SO:0001583	missense	3071				actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity	g.chr12:54905735G>A	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.787G>A	12.37:g.54905735G>A	ENSP00000293373:p.Gly263Arg		Somatic				NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Missense_Mutation_p.G213R	p.G263R	NM_005337	NP_005328	WXS	Illumina HiSeq	Unspecified	P55160	NCKPL_HUMAN			9	866	+			263					B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	c.787G>A	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740114	0.89573	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.48836	0.8;0.8	5.09	5.09	0.68999	.	0.167498	0.52532	N	0.000076	T	0.69717	0.3142	M	0.79123	2.44	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.73448	-0.3979	10	0.87932	D	0	-9.6184	16.0811	0.81005	0.0:0.0:1.0:0.0	.	263	P55160	NCKPL_HUMAN	R	263;213	ENSP00000293373:G263R;ENSP00000445596:G213R	ENSP00000293373:G263R	G	+	1	0	NCKAP1L	53192002	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.395000	0.79876	2.665000	0.90641	0.558000	0.71614	GGG		0.463	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337		37	62	0	0	0	0.023175	0	37	62				
CSNK1A1L	122011	broad.mit.edu	37	13	37678501	37678501	+	Missense_Mutation	SNP	C	C	A	rs535577422		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr13:37678501C>A	ENST00000379800.3	-	1	1302	c.893G>T	c.(892-894)tGg>tTg	p.W298L		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	298					cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TAACATCGTCCAATCAAATGT	0.498																																							uc001uwm.1		NA																	0				large_intestine(1)	1						c.(892-894)TGG>TTG		casein kinase 1, alpha 1-like							176.0	161.0	166.0					13																	37678501		2203	4300	6503	SO:0001583	missense	122011				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr13:37678501C>A	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.893G>T	13.37:g.37678501C>A	ENSP00000369126:p.Trp298Leu		Somatic					p.W298L	NM_145203	NP_660204	WXS	Illumina HiSeq	Unspecified	Q8N752	KC1AL_HUMAN		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)	1	1301	-		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)	298					Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	c.893G>T	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370928	0.42003	.	.	ENSG00000180138	ENST00000379800	T	0.25749	1.78	1.01	1.01	0.19927	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.32526	0.0832	L	0.29908	0.895	0.48975	D	0.999734	D	0.89917	1.0	D	0.97110	1.0	T	0.08493	-1.0719	10	0.87932	D	0	.	7.8591	0.29499	0.0:1.0:0.0:0.0	.	298	Q8N752	KC1AL_HUMAN	L	298	ENSP00000369126:W298L	ENSP00000369126:W298L	W	-	2	0	CSNK1A1L	36576501	1.000000	0.71417	0.169000	0.22859	0.436000	0.31835	5.366000	0.66122	0.825000	0.34637	0.561000	0.74099	TGG		0.498	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203		37	86	1	0	2.19358e-23	0.023175	4.80593e-23	37	86				
PCDH17	27253	broad.mit.edu	37	13	58209093	58209093	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr13:58209093C>A	ENST00000377918.3	+	1	2439	c.2413C>A	c.(2413-2415)Ccc>Acc	p.P805T		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	805					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GACCCGCCTGCCCCTCAGCTC	0.642																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(2413-2415)CCC>ACC		protocadherin 17 precursor							42.0	43.0	43.0					13																	58209093		2202	4300	6502	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58209093C>A	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2413C>A	13.37:g.58209093C>A	ENSP00000367151:p.Pro805Thr		Somatic				PCDH17_uc010aec.1_Missense_Mutation_p.P805T	p.P805T	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	3305	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	805			Cytoplasmic (Potential).		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.2413C>A	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	6.848	0.525767	0.13066	.	.	ENSG00000118946	ENST00000377918	T	0.48836	0.8	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	L	0.41824	1.3	0.58432	D	0.999992	D;P	0.63880	0.993;0.952	D;P	0.65874	0.939;0.758	T	0.54490	-0.8286	9	.	.	.	.	20.0349	0.97554	0.0:1.0:0.0:0.0	.	805;805	O14917-2;O14917	.;PCD17_HUMAN	T	805	ENSP00000367151:P805T	.	P	+	1	0	PCDH17	57107094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.999000	0.70665	2.735000	0.93741	0.591000	0.81541	CCC		0.642	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		4	11	1	0	3.59834e-05	0.021553	5.98068e-05	4	11				
SLC7A8	23428	broad.mit.edu	37	14	23598874	23598874	+	Silent	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr14:23598874G>A	ENST00000316902.7	-	9	1973	c.1248C>T	c.(1246-1248)atC>atT	p.I416I	SLC7A8_ENST00000529705.2_Silent_p.I311I|SLC7A8_ENST00000422941.2_Silent_p.I192I|SLC7A8_ENST00000453702.1_Silent_p.I213I|SLC7A8_ENST00000469263.1_Intron	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	416					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TGGGGCGGGGGATATCAGGCT	0.493																																							uc001wiz.2		NA																	0				ovary(1)	1						c.(1246-1248)ATC>ATT		solute carrier family 7 (cationic amino acid	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)						139.0	129.0	132.0					14																	23598874		2203	4300	6503	SO:0001819	synonymous_variant	23428				blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity	g.chr14:23598874G>A	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.1248C>T	14.37:g.23598874G>A			Somatic				SLC7A8_uc001wiw.2_Silent_p.I33I|SLC7A8_uc001wix.2_Silent_p.I213I|SLC7A8_uc010tnk.1_Silent_p.I192I|SLC7A8_uc010tnl.1_Silent_p.I311I|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_Intron	p.I416I	NM_012244	NP_036376	WXS	Illumina HiSeq	Unspecified	Q9UHI5	LAT2_HUMAN		GBM - Glioblastoma multiforme(265;0.00809)	9	1974	-	all_cancers(95;4.6e-05)		416					B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Silent	SNP	ENST00000316902.7	37	c.1248C>T	CCDS9590.1																																																																																				0.493	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3			42	74	0	0	0	0.013114	0	42	74				
ZBTB1	22890	broad.mit.edu	37	14	64989933	64989933	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr14:64989933G>C	ENST00000554015.1	+	4	2142	c.1711G>C	c.(1711-1713)Gaa>Caa	p.E571Q	ZBTB1_ENST00000358738.3_Missense_Mutation_p.E571Q|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000394712.2_Missense_Mutation_p.E571Q			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	571					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		GGAAGAAAATGAAAGAGATCA	0.358																																							uc001xhh.3		NA																	0				skin(1)	1						c.(1711-1713)GAA>CAA		zinc finger and BTB domain containing 1 isoform							106.0	102.0	103.0					14																	64989933		2203	4300	6503	SO:0001583	missense	22890				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr14:64989933G>C	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1711G>C	14.37:g.64989933G>C	ENSP00000451000:p.Glu571Gln		Somatic				ZBTB1_uc010aqg.2_Missense_Mutation_p.E571Q|ZBTB1_uc001xhi.2_Missense_Mutation_p.E571Q	p.E571Q	NM_001123329	NP_001116801	WXS	Illumina HiSeq	Unspecified	Q9Y2K1	ZBTB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)	4	2142	+		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)	571					A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	c.1711G>C	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991736	0.54041	.	.	ENSG00000126804	ENST00000554015;ENST00000358738;ENST00000394712	T;T;T	0.10477	2.87;3.52;2.87	5.76	5.76	0.90799	.	0.880137	0.10097	N	0.716409	T	0.21062	0.0507	N	0.24115	0.695	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.986	T	0.05084	-1.0907	10	0.02654	T	1	-24.3033	20.021	0.97503	0.0:0.0:1.0:0.0	.	571;571	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	Q	571	ENSP00000451000:E571Q;ENSP00000351587:E571Q;ENSP00000378201:E571Q	ENSP00000351587:E571Q	E	+	1	0	ZBTB1	64059686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.230000	0.95299	2.741000	0.93983	0.555000	0.69702	GAA		0.358	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1			53	88	0	0	0	0.01441	0	53	88				
CCDC88C	440193	broad.mit.edu	37	14	91772124	91772124	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr14:91772124C>A	ENST00000389857.6	-	19	3428	c.3342G>T	c.(3340-3342)caG>caT	p.Q1114H		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1114					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCTTGGCGGTCTGGGTCTGCA	0.597																																							uc010aty.2		NA																	0				ovary(3)	3						c.(3340-3342)CAG>CAT		DVL-binding protein DAPLE							73.0	73.0	73.0					14																	91772124		2100	4217	6317	SO:0001583	missense	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91772124C>A		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3342G>T	14.37:g.91772124C>A	ENSP00000374507:p.Gln1114His		Somatic					p.Q1114H	NM_001080414	NP_001073883	WXS	Illumina HiSeq	Unspecified	Q9P219	DAPLE_HUMAN			19	3441	-		all_cancers(154;0.0468)	1114					Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	c.3342G>T	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687569	0.29962	.	.	ENSG00000015133	ENST00000389857	T	0.16597	2.33	5.14	4.25	0.50352	.	0.000000	0.46145	U	0.000302	T	0.21347	0.0514	M	0.61703	1.905	0.80722	D	1	P	0.42010	0.768	B	0.43386	0.418	T	0.01600	-1.1315	10	0.87932	D	0	-37.3727	8.3005	0.32012	0.0:0.7633:0.0:0.2367	.	1114	Q9P219	DAPLE_HUMAN	H	1114	ENSP00000374507:Q1114H	ENSP00000374507:Q1114H	Q	-	3	2	CCDC88C	90841877	1.000000	0.71417	0.939000	0.37840	0.118000	0.20060	1.500000	0.35682	1.171000	0.42768	-0.339000	0.08088	CAG		0.597	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		6	24	1	0	0.00116845	0.021553	0.0018773	6	24				
ATP10A	57194	broad.mit.edu	37	15	25924557	25924557	+	Silent	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr15:25924557T>C	ENST00000356865.6	-	21	4542	c.4431A>G	c.(4429-4431)tcA>tcG	p.S1477S		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1477					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTGATCGGCCTGAGTGGGGCT	0.532																																							uc010ayu.2		NA																	0				pancreas(2)|ovary(1)|breast(1)|liver(1)	5						c.(4429-4431)TCA>TCG		ATPase, class V, type 10A							55.0	59.0	57.0					15																	25924557		2203	4300	6503	SO:0001819	synonymous_variant	57194				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:25924557T>C	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4431A>G	15.37:g.25924557T>C			Somatic					p.S1477S	NM_024490	NP_077816	WXS	Illumina HiSeq	Unspecified	O60312	AT10A_HUMAN		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)	21	4537	-		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)	1477			Cytoplasmic (Potential).		Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	c.4431A>G	CCDS32178.1																																																																																				0.532	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490		21	44	0	0	0	0.012319	0	21	44				
GABRG3	2567	broad.mit.edu	37	15	27772650	27772650	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr15:27772650G>T	ENST00000333743.6	+	8	1191	c.937G>T	c.(937-939)Gtg>Ttg	p.V313L	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	313					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGTGTCCTACGTGACCGCCAT	0.557																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(937-939)GTG>TTG		gamma-aminobutyric acid (GABA) A receptor, gamma							131.0	125.0	127.0					15																	27772650		2189	4287	6476	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27772650G>T		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.937G>T	15.37:g.27772650G>T	ENSP00000331912:p.Val313Leu		Somatic					p.V313L	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	8	1103	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	313					G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.937G>T	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.625936	0.66901	.	.	ENSG00000182256	ENST00000333743;ENST00000554696	D;D	0.86230	-2.09;-2.09	5.48	3.61	0.41365	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.123149	0.53938	D	0.000045	D	0.84356	0.5454	L	0.39326	1.205	0.80722	D	1	P	0.37594	0.601	B	0.44278	0.445	D	0.84533	0.0634	10	0.66056	D	0.02	.	10.5068	0.44839	0.1552:0.0:0.8448:0.0	.	313	Q99928	GBRG3_HUMAN	L	313;255	ENSP00000331912:V313L;ENSP00000451862:V255L	ENSP00000331912:V313L	V	+	1	0	GABRG3	25446245	1.000000	0.71417	0.922000	0.36590	0.853000	0.48598	6.351000	0.73022	1.309000	0.44985	0.563000	0.77884	GTG		0.557	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			21	35	1	0	1.22574e-08	0.014323	2.18817e-08	21	35				
SPTBN5	51332	broad.mit.edu	37	15	42168845	42168845	+	Splice_Site	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr15:42168845C>A	ENST00000320955.6	-	20	4079	c.3852G>T	c.(3850-3852)acG>acT	p.T1284T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1284					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTCTCTGACCCTGGAGGGCG	0.677																																							uc001zos.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(3745-3747)ACG>ACT		spectrin, beta, non-erythrocytic 5							17.0	20.0	19.0					15																	42168845		1948	4113	6061	SO:0001630	splice_region_variant	51332				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin		g.chr15:42168845C>A	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.3852-1G>T	15.37:g.42168845C>A			Somatic					p.T1249T	NM_016642	NP_057726	WXS	Illumina HiSeq	Unspecified	Q9NRC6	SPTN5_HUMAN		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)	20	4080	-		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	1284			Spectrin 9.			Silent	SNP	ENST00000320955.6	37	c.3747G>T																																																																																					0.677	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	Silent	7	3	1	0	0.00307968	0.00308	0.004851	7	3				
SMAD3	4088	broad.mit.edu	37	15	67473668	67473668	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr15:67473668G>T	ENST00000327367.4	+	6	1058	c.748G>T	c.(748-750)Gcc>Tcc	p.A250S	SMAD3_ENST00000540846.2_Missense_Mutation_p.A145S|SMAD3_ENST00000439724.3_Missense_Mutation_p.A206S|SMAD3_ENST00000537194.2_Missense_Mutation_p.A55S	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	250	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		GACATTCCACGCCTCGCAGCC	0.592																																							uc002aqj.2		NA																	0				large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(748-750)GCC>TCC		mothers against decapentaplegic homolog 3							75.0	64.0	68.0					15																	67473668		2201	4299	6500	SO:0001583	missense	4088				activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding	g.chr15:67473668G>T	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.748G>T	15.37:g.67473668G>T	ENSP00000332973:p.Ala250Ser		Somatic				SMAD3_uc010ujr.1_Missense_Mutation_p.A145S|SMAD3_uc010ujs.1_Missense_Mutation_p.A206S|SMAD3_uc010ujt.1_Missense_Mutation_p.A55S	p.A250S	NM_005902	NP_005893	WXS	Illumina HiSeq	Unspecified	P84022	SMAD3_HUMAN		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)	6	1046	+			250			MH2.		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	c.748G>T	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138431	0.94560	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.97831	-4.56;-4.56;-4.56;-4.56	5.1	5.1	0.69264	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	M	0.86573	2.825	0.80722	D	1	D;P	0.60575	0.988;0.942	D;D	0.70487	0.969;0.949	D	0.99737	1.1014	10	0.72032	D	0.01	.	18.8753	0.92332	0.0:0.0:1.0:0.0	.	206;250	B7Z4Z5;P84022	.;SMAD3_HUMAN	S	250;250;145;206;55	ENSP00000332973:A250S;ENSP00000437757:A145S;ENSP00000401133:A206S;ENSP00000445348:A55S	ENSP00000332973:A250S	A	+	1	0	SMAD3	65260722	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	9.682000	0.98655	2.515000	0.84797	0.555000	0.69702	GCC		0.592	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902		13	27	1	0	5.50884e-06	0.013537	9.34951e-06	13	27				
DNAH3	55567	broad.mit.edu	37	16	20952726	20952726	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:20952726T>C	ENST00000261383.3	-	59	11650	c.11651A>G	c.(11650-11652)aAc>aGc	p.N3884S	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3884					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGCCCACCTGTTGAATCTGAT	0.498																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(11650-11652)AAC>AGC		dynein, axonemal, heavy chain 3							356.0	347.0	350.0					16																	20952726		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20952726T>C	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.11651A>G	16.37:g.20952726T>C	ENSP00000261383:p.Asn3884Ser		Somatic				DNAH3_uc010vbd.1_Missense_Mutation_p.N1319S	p.N3884S	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	59	11651	-			3884					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.11651A>G	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.903747	0.92035	.	.	ENSG00000158486	ENST00000261383	T	0.10382	2.88	5.67	5.67	0.87782	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70745	-0.4788	10	0.87932	D	0	.	15.9173	0.79531	0.0:0.0:0.0:1.0	.	3884	Q8TD57	DYH3_HUMAN	S	3884	ENSP00000261383:N3884S	ENSP00000261383:N3884S	N	-	2	0	DNAH3	20860227	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.978000	0.88095	2.170000	0.68504	0.533000	0.62120	AAC		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		146	295	0	0	0	0.01441	0	146	295				
HSD3B7	80270	broad.mit.edu	37	16	30997441	30997441	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:30997441G>A	ENST00000297679.5	+	3	331	c.238G>A	c.(238-240)Gcc>Acc	p.A80T	HSD3B7_ENST00000262520.6_Missense_Mutation_p.A80T|HSD3B7_ENST00000353250.5_Missense_Mutation_p.A80T|AC135048.1_ENST00000602217.1_Silent_p.G31G	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	80					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TGTGGCCGGAGCCCATGTGGT	0.652																																							uc002eaf.2		NA																	0					0						c.(238-240)GCC>ACC		hydroxy-delta-5-steroid dehydrogenase, 3 beta-							52.0	46.0	48.0					16																	30997441		2197	4300	6497	SO:0001583	missense	80270				bile acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity	g.chr16:30997441G>A	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.238G>A	16.37:g.30997441G>A	ENSP00000297679:p.Ala80Thr		Somatic				HSD3B7_uc010cac.2_Missense_Mutation_p.A80T|HSD3B7_uc002eag.2_Missense_Mutation_p.A80T|HSD3B7_uc002eah.2_Missense_Mutation_p.A80T	p.A80T	NM_025193	NP_079469	WXS	Illumina HiSeq	Unspecified	Q9H2F3	3BHS7_HUMAN			3	344	+			80					Q96M28|Q9BSN9	Missense_Mutation	SNP	ENST00000297679.5	37	c.238G>A	CCDS10698.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205444	0.58234	.	.	ENSG00000099377	ENST00000262520;ENST00000353250;ENST00000297679	D;D;T	0.88664	-2.41;-2.41;-0.08	4.6	2.58	0.30949	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.569447	0.19050	N	0.124075	D	0.86648	0.5983	M	0.76938	2.355	0.27803	N	0.942418	B;B	0.15473	0.013;0.003	B;B	0.23852	0.049;0.019	T	0.78942	-0.2005	10	0.51188	T	0.08	-13.2029	4.8436	0.13503	0.1824:0.0:0.6391:0.1785	.	80;80	Q96M28;Q9H2F3	.;3BHS7_HUMAN	T	80	ENSP00000262520:A80T;ENSP00000370662:A80T;ENSP00000297679:A80T	ENSP00000262520:A80T	A	+	1	0	HSD3B7	30904942	0.524000	0.26282	0.996000	0.52242	0.621000	0.37620	1.095000	0.30964	0.514000	0.28300	0.555000	0.69702	GCC		0.652	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255554.2			4	16	0	0	0	0.009096	0	4	16				
ITGAM	3684	broad.mit.edu	37	16	31341863	31341863	+	Missense_Mutation	SNP	G	G	T	rs140927329	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:31341863G>T	ENST00000287497.8	+	28	3288	c.3213G>T	c.(3211-3213)gaG>gaT	p.E1071D	ITGAM_ENST00000544665.3_Missense_Mutation_p.E1072D			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1071					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GCACAGCTGAGATCTTGTTTA	0.612																																							uc002ebq.2		NA																	0				kidney(1)	1						c.(3211-3213)GAG>GAT		integrin alpha M isoform 2 precursor							67.0	66.0	66.0					16																	31341863		2065	4204	6269	SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31341863G>T	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3213G>T	16.37:g.31341863G>T	ENSP00000287497:p.Glu1071Asp		Somatic				ITGAM_uc002ebr.2_Missense_Mutation_p.E1072D|ITGAM_uc010can.2_Missense_Mutation_p.E477D	p.E1071D	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			28	3311	+			1071			Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	c.3213G>T	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.243236	0.58995	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.53206	0.63;0.63	5.03	1.47	0.22746	.	.	.	.	.	T	0.42086	0.1187	M	0.73598	2.24	0.18873	N	0.999984	P;P	0.39404	0.672;0.672	B;B	0.35655	0.207;0.207	T	0.32903	-0.9889	9	0.44086	T	0.13	.	4.87	0.13627	0.2795:0.1698:0.5507:0.0	.	1071;1071	Q4VAK1;P11215	.;ITAM_HUMAN	D	1072;1071	ENSP00000441691:E1072D;ENSP00000287497:E1071D	ENSP00000287497:E1071D	E	+	3	2	ITGAM	31249364	1.000000	0.71417	0.248000	0.24265	0.699000	0.40488	1.337000	0.33862	0.525000	0.28522	0.453000	0.30009	GAG		0.612	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		9	14	1	0	1.76689e-08	0.006214	3.13104e-08	9	14				
ABCC11	85320	broad.mit.edu	37	16	48234330	48234330	+	Missense_Mutation	SNP	C	C	T	rs200323911	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:48234330C>T	ENST00000394747.1	-	14	2288	c.1939G>A	c.(1939-1941)Gcc>Acc	p.A647T	ABCC11_ENST00000537808.1_Missense_Mutation_p.A647T|ABCC11_ENST00000394748.1_Missense_Mutation_p.A647T|ABCC11_ENST00000353782.5_Missense_Mutation_p.A647T|ABCC11_ENST00000356608.2_Missense_Mutation_p.A647T	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	647	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.A647T(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GAATAGACGGCGCGGGCCAGG	0.582													C|||	5	0.000998403	0.0	0.0	5008	,	,		18036	0.005		0.0	False		,,,				2504	0.0						uc002eff.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1939-1941)GCC>ACC		ATP-binding cassette, sub-family C, member 11							73.0	60.0	65.0					16																	48234330		2201	4300	6501	SO:0001583	missense	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48234330C>T	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1939G>A	16.37:g.48234330C>T	ENSP00000378230:p.Ala647Thr		Somatic				ABCC11_uc002efg.1_Missense_Mutation_p.A647T|ABCC11_uc002efh.1_Missense_Mutation_p.A647T|ABCC11_uc010vgk.1_RNA	p.A647T	NM_033151	NP_149163	WXS	Illumina HiSeq	Unspecified	Q96J66	ABCCB_HUMAN			14	2289	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	647			ABC transporter 1.|Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	c.1939G>A	CCDS10732.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	18.82	3.704309	0.68615	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2	5.7	4.73	0.59995	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.94656	0.8277	M	0.75447	2.3	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.79108	0.942;0.992	D	0.94371	0.7596	10	0.87932	D	0	-16.9203	12.8658	0.57937	0.0:0.9199:0.0:0.08	.	647;647	Q96J66-2;Q96J66	.;ABCCB_HUMAN	T	647	ENSP00000311326:A647T;ENSP00000349017:A647T;ENSP00000378231:A647T;ENSP00000378230:A647T;ENSP00000438530:A647T	ENSP00000311326:A647T	A	-	1	0	ABCC11	46791831	1.000000	0.71417	0.044000	0.18714	0.097000	0.18754	5.701000	0.68325	1.391000	0.46566	0.655000	0.94253	GCC		0.582	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		13	28	0	0	0	0.013537	0	13	28				
JPH3	57338	broad.mit.edu	37	16	87677922	87677922	+	Missense_Mutation	SNP	C	C	G	rs140115944	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:87677922C>G	ENST00000284262.2	+	2	683	c.441C>G	c.(439-441)agC>agG	p.S147R		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	147					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		TCCGGCAGAGCGTCCCGTATG	0.677																																							uc002fkd.2		NA																	0				ovary(1)|pancreas(1)	2						c.(439-441)AGC>AGG		junctophilin 3							51.0	53.0	52.0					16																	87677922		2198	4298	6496	SO:0001583	missense	57338				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	g.chr16:87677922C>G	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.441C>G	16.37:g.87677922C>G	ENSP00000284262:p.Ser147Arg		Somatic				JPH3_uc010vou.1_RNA	p.S147R	NM_020655	NP_065706	WXS	Illumina HiSeq	Unspecified	Q8WXH2	JPH3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0287)	2	695	+			147			MORN 6.|Cytoplasmic (Potential).		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	37	c.441C>G	CCDS10962.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.428831	0.62844	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.55413	0.52	4.73	-3.98	0.04082	.	0.000000	0.85682	D	0.000000	T	0.66839	0.2830	M	0.80422	2.495	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.67098	-0.5756	10	0.59425	D	0.04	.	11.4249	0.50004	0.0:0.365:0.0:0.635	.	147	Q8WXH2	JPH3_HUMAN	R	10;147	ENSP00000284262:S147R	ENSP00000284262:S147R	S	+	3	2	JPH3	86235423	0.001000	0.12720	0.924000	0.36721	0.972000	0.66771	-1.314000	0.02715	-1.112000	0.02984	0.462000	0.41574	AGC		0.677	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			26	46	0	0	0	0.01892	0	26	46				
TUBB3	10381	broad.mit.edu	37	16	90001774	90001774	+	Silent	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr16:90001774G>T	ENST00000315491.7	+	4	1038	c.915G>T	c.(913-915)ccG>ccT	p.P305P	TUBB3_ENST00000554444.1_Silent_p.P233P|TUBB3_ENST00000304984.5_Silent_p.P233P|TUBB3_ENST00000556922.1_Silent_p.P652P|TUBB3_ENST00000555576.1_Intron	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	305					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	CCTGCGACCCGCGCCACGGCC	0.667																																							uc002fph.1		NA																	0				ovary(2)|pancreas(1)	3						c.(913-915)CCG>CCT		tubulin, beta, 4							73.0	77.0	75.0					16																	90001774		2197	4299	6496	SO:0001819	synonymous_variant	10381				'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr16:90001774G>T	BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.915G>T	16.37:g.90001774G>T			Somatic				TUBB3_uc002fpf.2_Silent_p.P652P|TUBB3_uc010ciz.1_Silent_p.P233P|TUBB3_uc002fpg.1_Silent_p.P159P|TUBB3_uc002fpi.1_Silent_p.P233P|TUBB3_uc002fpj.1_Silent_p.P233P|TUBB3_uc010cjb.1_Silent_p.P159P|TUBB3_uc002fpk.1_Silent_p.P159P	p.P305P	NM_006086	NP_006077	WXS	Illumina HiSeq	Unspecified	Q13509	TBB3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0273)	4	980	+		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)	305					A8K854|Q9BTZ0|Q9BW10	Silent	SNP	ENST00000315491.7	37	c.915G>T	CCDS10988.1																																																																																				0.667	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086		33	69	1	0	4.65686e-17	0.017118	9.05084e-17	33	69				
CAMKK1	84254	broad.mit.edu	37	17	3788921	3788922	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:3788921_3788922CC>AA	ENST00000348335.2	-	2	208_209	c.60_61GG>TT	c.(58-63)gtGGca>gtTTca	p.A21S	CAMKK1_ENST00000158166.5_Missense_Mutation_p.A21S|CAMKK1_ENST00000381769.2_Missense_Mutation_p.A48S|CAMKK1_ENST00000381771.2_Missense_Mutation_p.A21S	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	21					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		TCGATGGCTGCCACCCGTTCTA	0.609																																							uc002fwt.2		NA																	0				ovary(1)	1						c.(58-63)GTGGCA>GTTTCA		calcium/calmodulin-dependent protein kinase 1																																				SO:0001583	missense	84254				synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr17:3788921_3788922CC>AA	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.60_61delinsAA	17.37:g.3788921_3788922delinsAA	ENSP00000323118:p.Ala21Ser		Somatic				CAMKK1_uc002fwu.2_Missense_Mutation_p.A21S|CAMKK1_uc002fwv.2_Missense_Mutation_p.A21S	p.A21S	NM_172206	NP_757343	WXS	Illumina HiSeq	Unspecified	Q8N5S9	KKCC1_HUMAN		LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)	2	154_155	-			21					Q9BQH3	Missense_Mutation	DNP	ENST00000348335.2	37	c.60_61GG>TT	CCDS11038.1																																																																																				0.609	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207		12	31	0	0	0	0.004672	0	12	31				
MYH2	4620	broad.mit.edu	37	17	10427914	10427914	+	Missense_Mutation	SNP	G	G	T	rs568249919		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:10427914G>T	ENST00000245503.5	-	35	5428	c.5044C>A	c.(5044-5046)Cgc>Agc	p.R1682S	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.R1682S|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1682					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TTGGCTCTGCGCTCCACCATG	0.567																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5044-5046)CGC>AGC		myosin heavy chain IIa							96.0	86.0	89.0					17																	10427914		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10427914G>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5044C>A	17.37:g.10427914G>T	ENSP00000245503:p.Arg1682Ser		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1682S|MYH2_uc010coj.2_Intron	p.R1682S	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			35	5172	-			1682			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5044C>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173351	0.78452	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.81659	-1.52;-1.52	5.31	5.31	0.75309	Myosin tail (1);	0.000000	0.35646	U	0.003061	D	0.94029	0.8087	H	0.98199	4.17	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.95756	0.8796	10	0.72032	D	0.01	.	19.1555	0.93509	0.0:0.0:1.0:0.0	.	1682	Q9UKX2	MYH2_HUMAN	S	1682	ENSP00000245503:R1682S;ENSP00000380367:R1682S	ENSP00000245503:R1682S	R	-	1	0	MYH2	10368639	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.542000	0.53625	2.755000	0.94549	0.491000	0.48974	CGC		0.567	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		24	43	1	0	2.70639e-06	0.014323	4.65886e-06	24	43				
MYOCD	93649	broad.mit.edu	37	17	12656348	12656348	+	Silent	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:12656348T>C	ENST00000343344.4	+	10	1743	c.1743T>C	c.(1741-1743)ttT>ttC	p.F581F	AC005358.1_ENST00000609971.1_Silent_p.F485F|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Silent_p.F581F			Q8IZQ8	MYCD_HUMAN	myocardin	581					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCTGTCCTTTTGCATCCCAAG	0.512																																							uc002gnn.2		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)	5						c.(1741-1743)TTT>TTC		myocardin isoform 2							67.0	72.0	70.0					17																	12656348		2203	4300	6503	SO:0001819	synonymous_variant	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12656348T>C	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1743T>C	17.37:g.12656348T>C			Somatic				MYOCD_uc002gno.2_Silent_p.F581F|MYOCD_uc002gnp.1_Silent_p.F485F|MYOCD_uc002gnq.2_Silent_p.F300F	p.F581F	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	10	2042	+			581					Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	c.1743T>C	CCDS11163.1																																																																																				0.512	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		29	57	0	0	0	0.007291	0	29	57				
UBBP4	23666	broad.mit.edu	37	17	21730899	21730899	+	Silent	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:21730899G>C	ENST00000578713.1	+	1	205	c.201G>C	c.(199-201)ctG>ctC	p.L67L	UBBP4_ENST00000584398.1_Intron|UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584755.1_Silent_p.L67L					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						AGTCGACCCTGCATCTGGTCC	0.557																																							uc002gyy.3		NA																	0					NA						c.(199-201)CTG>CTC		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001819	synonymous_variant	0							g.chr17:21730899G>C	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.201G>C	17.37:g.21730899G>C			Somatic					p.L67L			WXS	Illumina HiSeq	Unspecified					2	326	+									Silent	SNP	ENST00000578713.1	37	c.201G>C																																																																																					0.557	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			16	42	0	0	0	0.024245	0	16	42				
PSMD12	5718	broad.mit.edu	37	17	65337022	65337022	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:65337022C>T	ENST00000356126.3	-	11	1415	c.1308G>A	c.(1306-1308)atG>atA	p.M436I	PSMD12_ENST00000357146.4_Missense_Mutation_p.M416I	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	436					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TAACCAGAGACATTAATGAGT	0.343																																							uc002jfy.2		NA																	0					0						c.(1306-1308)ATG>ATA		proteasome 26S non-ATPase subunit 12 isoform 1							93.0	92.0	92.0					17																	65337022		2203	4300	6503	SO:0001583	missense	5718				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding	g.chr17:65337022C>T	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1308G>A	17.37:g.65337022C>T	ENSP00000348442:p.Met436Ile		Somatic				PSMD12_uc002jga.2_Missense_Mutation_p.M416I|PSMD12_uc002jfz.2_Missense_Mutation_p.M377I	p.M436I	NM_002816	NP_002807	WXS	Illumina HiSeq	Unspecified	O00232	PSD12_HUMAN			11	1394	-	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)		436					A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	ENST00000356126.3	37	c.1308G>A	CCDS11669.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611016	0.87258	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.43294	0.96;0.95	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	M	0.83223	2.63	0.80722	D	1	P;P	0.51537	0.946;0.946	P;P	0.57620	0.824;0.824	T	0.70781	-0.4779	10	0.59425	D	0.04	-20.8177	17.8938	0.88880	0.0:1.0:0.0:0.0	.	416;436	A6NP15;O00232	.;PSD12_HUMAN	I	436;416	ENSP00000348442:M436I;ENSP00000349667:M416I	ENSP00000348442:M436I	M	-	3	0	PSMD12	62767484	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.435000	0.80391	2.226000	0.72624	0.484000	0.47621	ATG		0.343	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871		24	80	0	0	0	0.027356	0	24	80				
FBF1	85302	broad.mit.edu	37	17	73915810	73915810	+	Missense_Mutation	SNP	G	G	A	rs370224773		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:73915810G>A	ENST00000586717.1	-	19	2308	c.2035C>T	c.(2035-2037)Cgc>Tgc	p.R679C	FBF1_ENST00000389570.4_Missense_Mutation_p.R679C|FBF1_ENST00000319129.5_Missense_Mutation_p.R678C			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	679					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						GCCGCCAAGCGCCGCTGGTGC	0.672																																							uc002jqc.2		NA																	0					0						c.(2032-2034)CGC>TGC		Fas (TNFRSF6) binding factor 1		G	CYS/ARG	1,4019		0,1,2009	35.0	36.0	36.0		2032	5.2	0.7	17		36	0,8368		0,0,4184	no	missense	FBF1	NM_001080542.1	180	0,1,6193	AA,AG,GG		0.0,0.0249,0.0081	probably-damaging	678/1134	73915810	1,12387	2010	4184	6194	SO:0001583	missense	85302							g.chr17:73915810G>A	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.2035C>T	17.37:g.73915810G>A	ENSP00000465132:p.Arg679Cys		Somatic				FBF1_uc002jqa.1_RNA|FBF1_uc010wsp.1_Missense_Mutation_p.R669C|FBF1_uc002jqd.1_Missense_Mutation_p.R679C|FBF1_uc002jqb.2_RNA|FBF1_uc010dgr.1_5'UTR	p.R678C	NM_001080542	NP_001074011	WXS	Illumina HiSeq	Unspecified	Q8TES7	FBF1_HUMAN			19	2306	-			678					B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37	c.2032C>T		.	.	.	.	.	.	.	.	.	.	G	16.21	3.058229	0.55325	2.49E-4	0.0	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.21361	2.01;2.01	5.15	5.15	0.70609	.	.	.	.	.	T	0.42921	0.1224	M	0.66939	2.045	0.39518	D	0.968478	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.68943	0.897;0.961;0.916	T	0.41342	-0.9514	9	0.72032	D	0.01	-4.9833	13.2331	0.59955	0.0:0.0:0.8409:0.1591	.	693;679;678	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	C	679;679;678;692	ENSP00000374221:R679C;ENSP00000324292:R678C	ENSP00000324292:R678C	R	-	1	0	FBF1	71427405	0.260000	0.24053	0.730000	0.30809	0.203000	0.24098	3.131000	0.50515	2.409000	0.81822	0.655000	0.94253	CGC		0.672	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542		25	16	0	0	0	0.01892	0	25	16				
MC2R	4158	broad.mit.edu	37	18	13885348	13885348	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr18:13885348G>T	ENST00000327606.3	-	2	350	c.170C>A	c.(169-171)gCa>gAa	p.A57E		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	57					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	GTACATGGGTGCCTGGAGATT	0.418																																					Colon(141;1584 1782 35999 48227 48692)	Colon(141;1584 1782 35999 48227 48692)	uc002ksp.1		NA																	0				ovary(4)|skin(1)	5						c.(169-171)GCA>GAA		melanocortin 2 receptor	Corticotropin(DB01285)|Cosyntropin(DB01284)						81.0	78.0	79.0					18																	13885348		2203	4300	6503	SO:0001583	missense	4158				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding	g.chr18:13885348G>T		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.170C>A	18.37:g.13885348G>T	ENSP00000333821:p.Ala57Glu		Somatic					p.A57E	NM_000529	NP_000520	WXS	Illumina HiSeq	Unspecified	Q01718	ACTHR_HUMAN			2	347	-			57			Cytoplasmic (By similarity).		A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	37	c.170C>A	CCDS11869.1	.	.	.	.	.	.	.	.	.	.	G	9.481	1.098133	0.20552	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T;T	0.37058	1.22;1.22	4.13	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.333229	0.28760	N	0.014237	T	0.23806	0.0576	N	0.24115	0.695	0.24520	N	0.994168	B	0.15930	0.015	B	0.21546	0.035	T	0.21177	-1.0253	10	0.87932	D	0	.	7.3684	0.26787	0.2949:0.0:0.7051:0.0	.	57	Q01718	ACTHR_HUMAN	E	57	ENSP00000333821:A57E;ENSP00000382718:A57E	ENSP00000333821:A57E	A	-	2	0	MC2R	13875348	1.000000	0.71417	0.733000	0.30861	0.268000	0.26511	3.328000	0.52052	0.864000	0.35578	-0.142000	0.14014	GCA		0.418	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			26	49	1	0	2.79863e-10	0.024334	5.07121e-10	26	49				
WDR7	23335	broad.mit.edu	37	18	54688052	54688052	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr18:54688052A>G	ENST00000254442.3	+	27	4452	c.4241A>G	c.(4240-4242)aAc>aGc	p.N1414S	WDR7_ENST00000357574.3_Missense_Mutation_p.N1381S|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1414					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		ACCTACTCAAACACTGACAGC	0.428																																							uc002lgk.1		NA																	0				ovary(2)|skin(1)	3						c.(4240-4242)AAC>AGC		rabconnectin-3 beta isoform 1							161.0	138.0	146.0					18																	54688052		2203	4300	6503	SO:0001583	missense	23335							g.chr18:54688052A>G	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.4241A>G	18.37:g.54688052A>G	ENSP00000254442:p.Asn1414Ser		Somatic				WDR7_uc002lgl.1_Missense_Mutation_p.N1381S	p.N1414S	NM_015285	NP_056100	WXS	Illumina HiSeq	Unspecified	Q9Y4E6	WDR7_HUMAN		Lung(128;0.0238)|Colorectal(16;0.0296)	27	4452	+			1414			WD 9.		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	c.4241A>G	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.905171	0.33628	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.61627	0.09;0.09	5.97	5.97	0.96955	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	N	0.00926	-1.1	0.51767	D	0.999936	B;B	0.29301	0.202;0.241	B;B	0.31869	0.084;0.137	T	0.37731	-0.9693	10	0.22109	T	0.4	.	16.1223	0.81369	1.0:0.0:0.0:0.0	.	1381;1414	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	S	1414;1381;739;1381	ENSP00000254442:N1414S;ENSP00000350187:N1381S	ENSP00000254442:N1414S	N	+	2	0	WDR7	52839050	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	6.140000	0.71738	2.288000	0.76882	0.533000	0.62120	AAC		0.428	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			32	64	0	0	0	0.012213	0	32	64				
ALPK2	115701	broad.mit.edu	37	18	56247275	56247275	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr18:56247275C>A	ENST00000361673.3	-	4	946	c.733G>T	c.(733-735)Ggt>Tgt	p.G245C	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	245						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TTCAGGTCACCATCCGTGAAC	0.413																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(733-735)GGT>TGT		heart alpha-kinase							193.0	185.0	188.0					18																	56247275		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56247275C>A	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.733G>T	18.37:g.56247275C>A	ENSP00000354991:p.Gly245Cys		Somatic					p.G245C	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			4	947	-			245					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.733G>T	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912425	0.52439	.	.	ENSG00000198796	ENST00000361673	T	0.50001	0.76	5.65	3.87	0.44632	.	.	.	.	.	T	0.56171	0.1967	L	0.50333	1.59	0.09310	N	1	D	0.76494	0.999	P	0.59703	0.862	T	0.43956	-0.9359	9	0.40728	T	0.16	-0.5776	10.4308	0.44407	0.0:0.8472:0.0:0.1528	.	245	Q86TB3	ALPK2_HUMAN	C	245	ENSP00000354991:G245C	ENSP00000354991:G245C	G	-	1	0	ALPK2	54398255	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.566000	0.23593	0.757000	0.33036	0.563000	0.77884	GGT		0.413	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		61	130	1	0	1.1362e-29	0.01441	2.60784e-29	61	130				
ZNRF4	148066	broad.mit.edu	37	19	5456253	5456253	+	Missense_Mutation	SNP	G	G	C	rs113345491		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:5456253G>C	ENST00000222033.4	+	1	828	c.751G>C	c.(751-753)Gtg>Ctg	p.V251L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	251						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CTGTCACCCCGTGCTGACCGT	0.682																																							uc002mca.3		NA																	0				large_intestine(2)	2						c.(751-753)GTG>CTG		zinc and ring finger 4 precursor							43.0	47.0	46.0					19																	5456253		2169	4265	6434	SO:0001583	missense	148066					integral to membrane	zinc ion binding	g.chr19:5456253G>C	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.751G>C	19.37:g.5456253G>C	ENSP00000222033:p.Val251Leu		Somatic					p.V251L	NM_181710	NP_859061	WXS	Illumina HiSeq	Unspecified	Q8WWF5	ZNRF4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)	1	828	+			251			Helical; (Potential).		A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	37	c.751G>C	CCDS42475.1	.	.	.	.	.	.	.	.	.	.	G	7.586	0.669829	0.14776	.	.	ENSG00000105428	ENST00000222033	T	0.04454	3.62	3.91	1.69	0.24217	.	0.231030	0.35378	U	0.003255	T	0.03348	0.0097	L	0.34521	1.04	0.09310	N	1	B	0.31040	0.305	B	0.19666	0.026	T	0.43909	-0.9362	10	0.30854	T	0.27	.	7.3647	0.26766	0.2153:0.0:0.7847:0.0	.	251	Q8WWF5	ZNRF4_HUMAN	L	251	ENSP00000222033:V251L	ENSP00000222033:V251L	V	+	1	0	ZNRF4	5407253	0.078000	0.21339	0.005000	0.12908	0.124000	0.20399	1.687000	0.37680	0.314000	0.23086	0.491000	0.48974	GTG		0.682	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710		23	17	0	0	0	0.016522	0	23	17				
MUC16	94025	broad.mit.edu	37	19	9090468	9090468	+	Silent	SNP	G	G	T	rs200301454		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:9090468G>T	ENST00000397910.4	-	1	1550	c.1347C>A	c.(1345-1347)tcC>tcA	p.S449S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	449	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTCATTTCGGACTCTTCTC	0.488																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(1345-1347)TCC>TCA		mucin 16							178.0	167.0	170.0					19																	9090468		1950	4139	6089	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9090468G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1347C>A	19.37:g.9090468G>T			Somatic					p.S449S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	1551	-			449			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.1347C>A	CCDS54212.1																																																																																				0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		49	32	1	0	1.07234e-20	0.01441	2.24726e-20	49	32				
KEAP1	9817	broad.mit.edu	37	19	10602581	10602581	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:10602581C>A	ENST00000171111.5	-	3	1544	c.997G>T	c.(997-999)Ggc>Tgc	p.G333C	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.G333C|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	333			G -> C (in a NSCLC cell line; strongly reduces interaction with NFE2L2 and reduces repression of NFE2L2-dependent gene expression). {ECO:0000269|PubMed:17020408}.		cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.G333S(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CGGAAGTAGCCGCCCGCGGTG	0.677																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(997-999)GGC>TGC		kelch-like ECH-associated protein 1							23.0	26.0	25.0					19																	10602581		2201	4298	6499	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602581C>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.997G>T	19.37:g.10602581C>A	ENSP00000171111:p.Gly333Cys		Somatic				KEAP1_uc002mop.1_Missense_Mutation_p.G51C|KEAP1_uc002mor.1_Missense_Mutation_p.G333C	p.G333C	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	1153	-			333		G -> C (in a NSCLC cell line; strongly reduces interaction with NFE2L2 and reduces repression of NFE2L2-dependent gene expression).	Kelch 1.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.997G>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794480	0.90453	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.99494	-6.01;-6.01	5.52	5.52	0.82312	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97380	0.9982	10	0.87932	D	0	.	16.9299	0.86188	0.0:1.0:0.0:0.0	.	333	Q14145	KEAP1_HUMAN	C	333	ENSP00000171111:G333C;ENSP00000377245:G333C	ENSP00000171111:G333C	G	-	1	0	KEAP1	10463581	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.129000	0.77225	2.609000	0.88269	0.561000	0.74099	GGC		0.677	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		9	7	1	0	2.17888e-05	0.006214	3.64659e-05	9	7				
NFIX	4784	broad.mit.edu	37	19	13136190	13136190	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:13136190G>T	ENST00000592199.1	+	2	383	c.383G>T	c.(382-384)cGg>cTg	p.R128L	NFIX_ENST00000360105.4_Missense_Mutation_p.R131L|NFIX_ENST00000587260.1_Missense_Mutation_p.R127L|NFIX_ENST00000588228.1_Missense_Mutation_p.R81L|NFIX_ENST00000585575.1_Missense_Mutation_p.R120L|NFIX_ENST00000397661.2_Missense_Mutation_p.R128L|NFIX_ENST00000587760.1_Missense_Mutation_p.R120L|NFIX_ENST00000358552.3_Missense_Mutation_p.R127L			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)	128					astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			AAGGTGTGGCGGCTGGACCTG	0.617																																							uc010xmx.1		NA																	0				breast(1)|skin(1)	2						c.(406-408)CGG>CTG		RecName: Full=Nuclear factor 1;							42.0	43.0	43.0					19																	13136190		2198	4298	6496	SO:0001583	missense	4784				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr19:13136190G>T	U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.383G>T	19.37:g.13136190G>T	ENSP00000467512:p.Arg128Leu		Somatic				NFIX_uc002mwd.2_Missense_Mutation_p.R128L|NFIX_uc002mwe.2_Missense_Mutation_p.R120L|NFIX_uc002mwf.2_Missense_Mutation_p.R131L|NFIX_uc002mwg.1_Missense_Mutation_p.R127L	p.R136L			WXS	Illumina HiSeq	Unspecified	Q14938	NFIX_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)		2	460	+			128			CTF/NF-I.		B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Missense_Mutation	SNP	ENST00000592199.1	37	c.407G>T		.	.	.	.	.	.	.	.	.	.	g	23.2	4.389010	0.82902	.	.	ENSG00000008441	ENST00000397661;ENST00000360105;ENST00000264825;ENST00000438869;ENST00000358552	D;D	0.82255	-1.59;-1.59	5.26	5.26	0.73747	MAD homology 1, Dwarfin-type (2);CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91429	0.7295	M	0.81341	2.54	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.997;0.998;0.998	D;D;D;D;D	0.80764	0.994;0.991;0.986;0.994;0.991	D	0.92518	0.6022	10	0.87932	D	0	.	17.6227	0.88086	0.0:0.0:1.0:0.0	.	136;127;131;128;128	B4DHW2;Q14938-5;F8W8H9;Q14938;Q14938-3	.;.;.;NFIX_HUMAN;.	L	128;128;131;81;127	ENSP00000380781:R128L;ENSP00000351354:R127L	ENSP00000264825:R131L	R	+	2	0	NFIX	12997190	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.808000	0.99193	2.460000	0.83146	0.651000	0.88453	CGG		0.617	NFIX-013	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000452763.1	NM_002501		18	10	1	0	0.00229938	0.014323	0.00364572	18	10				
ZNF536	9745	broad.mit.edu	37	19	31025796	31025796	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:31025796C>A	ENST00000355537.3	+	3	2360	c.2213C>A	c.(2212-2214)cCa>cAa	p.P738Q		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	738					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GTCCAGCAACCAGCGCTGCTT	0.577																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2212-2214)CCA>CAA		zinc finger protein 536							117.0	118.0	118.0					19																	31025796		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31025796C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2213C>A	19.37:g.31025796C>A	ENSP00000347730:p.Pro738Gln		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.P738Q	p.P738Q	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			3	2351	+	Esophageal squamous(110;0.0834)		738					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2213C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	6.432	0.447904	0.12223	.	.	ENSG00000198597	ENST00000355537	T	0.10960	2.82	5.81	4.76	0.60689	.	0.052805	0.85682	N	0.000000	T	0.05547	0.0146	N	0.08118	0	0.37936	D	0.932169	B;B	0.12630	0.006;0.006	B;B	0.12156	0.007;0.007	T	0.22765	-1.0207	10	0.07990	T	0.79	-26.3709	13.6246	0.62157	0.2907:0.7093:0.0:0.0	.	738;738	A7E228;O15090	.;ZN536_HUMAN	Q	738	ENSP00000347730:P738Q	ENSP00000347730:P738Q	P	+	2	0	ZNF536	35717636	1.000000	0.71417	0.989000	0.46669	0.865000	0.49528	4.553000	0.60753	1.397000	0.46682	0.591000	0.81541	CCA		0.577	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		48	91	1	0	2.24722e-20	0.01441	4.66879e-20	48	91				
RYR1	6261	broad.mit.edu	37	19	38960061	38960061	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:38960061T>C	ENST00000359596.3	+	27	3673	c.3673T>C	c.(3673-3675)Ttt>Ctt	p.F1225L	RYR1_ENST00000360985.3_Missense_Mutation_p.F1225L|RYR1_ENST00000355481.4_Missense_Mutation_p.F1225L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1225	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTTCGAGCCATTTGCCATCAA	0.587																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(3673-3675)TTT>CTT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						151.0	142.0	145.0					19																	38960061		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38960061T>C	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3673T>C	19.37:g.38960061T>C	ENSP00000352608:p.Phe1225Leu		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.F1225L	p.F1225L	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		27	3803	+	all_cancers(60;7.91e-06)		1225			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.3673T>C	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	t	13.86	2.363560	0.41902	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97161	-4.27;-4.27;-4.27	3.48	3.48	0.39840	.	0.000000	0.64402	U	0.000003	D	0.97626	0.9222	M	0.68952	2.095	0.47037	D	0.99929	B;D	0.76494	0.183;0.999	B;D	0.70716	0.069;0.97	D	0.97468	1.0039	10	0.54805	T	0.06	.	11.8931	0.52641	0.0:0.0:0.0:1.0	.	1225;1225	P21817-2;P21817	.;RYR1_HUMAN	L	1225	ENSP00000352608:F1225L;ENSP00000347667:F1225L;ENSP00000354254:F1225L	ENSP00000347667:F1225L	F	+	1	0	RYR1	43651901	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	7.573000	0.82421	1.481000	0.48307	0.357000	0.21978	TTT		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			46	89	0	0	0	0.01441	0	46	89				
PRR12	57479	broad.mit.edu	37	19	50103069	50103069	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:50103069G>A	ENST00000418929.2	+	5	4231	c.4219G>A	c.(4219-4221)Gac>Aac	p.D1407N		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TGCCCTCGATGACCCACCCCT	0.662																																							uc002poo.3		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(4219-4221)GAC>AAC		proline rich 12							73.0	82.0	79.0					19																	50103069		2080	4227	6307	SO:0001583	missense	57479						DNA binding	g.chr19:50103069G>A	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4219G>A	19.37:g.50103069G>A	ENSP00000394510:p.Asp1407Asn		Somatic					p.D1407N	NM_020719	NP_065770	WXS	Illumina HiSeq	Unspecified	Q9ULL5	PRR12_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)	5	4219	+		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)	586			Pro-rich.		E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	c.4219G>A	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499348	0.44455	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.56	4.56	0.56223	.	0.281748	0.25430	N	0.030726	T	0.75140	0.3809	L	0.54323	1.7	0.53688	D	0.999973	D	0.89917	1.0	D	0.87578	0.998	T	0.75578	-0.3269	9	0.49607	T	0.09	-32.5351	16.6332	0.85039	0.0:0.0:1.0:0.0	.	1407	Q9ULL5-3	.	N	1407;587;587	.	ENSP00000246798:D587N	D	+	1	0	PRR12	54794881	1.000000	0.71417	0.968000	0.41197	0.606000	0.37113	8.693000	0.91288	2.542000	0.85734	0.563000	0.77884	GAC		0.662	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719		37	76	0	0	0	0.00874	0	37	76				
TSKS	60385	broad.mit.edu	37	19	50266500	50266500	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:50266500G>T	ENST00000246801.3	-	1	87	c.5C>A	c.(4-6)gCg>gAg	p.A2E	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	2					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CACCACGCTCGCCATGGTGTG	0.632																																							uc002ppm.2		NA																	0				large_intestine(1)|skin(1)	2						c.(4-6)GCG>GAG		testis-specific kinase substrate							48.0	50.0	49.0					19																	50266500		2203	4300	6503	SO:0001583	missense	60385						protein binding	g.chr19:50266500G>T	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.5C>A	19.37:g.50266500G>T	ENSP00000246801:p.Ala2Glu		Somatic					p.A2E	NM_021733	NP_068379	WXS	Illumina HiSeq	Unspecified	Q9UJT2	TSKS_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)	1	16	-		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	2					Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	37	c.5C>A	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366461	0.61513	.	.	ENSG00000126467	ENST00000246801	T	0.39592	1.07	4.73	4.73	0.59995	.	0.000000	0.40385	N	0.001102	T	0.51143	0.1657	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.55945	-0.8060	10	0.72032	D	0.01	-19.8283	14.6269	0.68626	0.0:0.0:1.0:0.0	.	2	Q9UJT2	TSKS_HUMAN	E	2	ENSP00000246801:A2E	ENSP00000246801:A2E	A	-	2	0	TSKS	54958312	1.000000	0.71417	0.996000	0.52242	0.424000	0.31475	5.252000	0.65445	2.192000	0.70111	0.467000	0.42956	GCG		0.632	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733		12	47	1	0	4.93089e-13	0.020292	9.43131e-13	12	47				
VN1R4	317703	broad.mit.edu	37	19	53770889	53770889	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:53770889C>A	ENST00000311170.4	-	1	83	c.30G>T	c.(28-30)atG>atT	p.M10I	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	10					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GTGATAAGATCATTCCCACTG	0.517										HNSCC(26;0.072)																													uc010ydu.1		NA																	0				ovary(2)	2						c.(28-30)ATG>ATT		vomeronasal 1 receptor 4							61.0	64.0	63.0					19																	53770889		2203	4300	6503	SO:0001583	missense	317703				response to pheromone	actin cytoskeleton|cytoplasm|integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:53770889C>A	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.30G>T	19.37:g.53770889C>A	ENSP00000310856:p.Met10Ile	HNSCC(26;0.072)	Somatic					p.M10I	NM_173857	NP_776256	WXS	Illumina HiSeq	Unspecified	Q7Z5H5	VN1R4_HUMAN		GBM - Glioblastoma multiforme(134;0.00294)	1	30	-			10			Helical; Name=1; (Potential).		Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	37	c.30G>T	CCDS33099.1	.	.	.	.	.	.	.	.	.	.	C	0.043	-1.277330	0.01410	.	.	ENSG00000228567	ENST00000311170	T	0.33865	1.39	2.28	1.17	0.20885	.	.	.	.	.	T	0.14227	0.0344	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.32348	-0.9910	9	0.02654	T	1	.	6.8755	0.24145	0.0:0.7092:0.2908:0.0	.	10	Q7Z5H5	VN1R4_HUMAN	I	10	ENSP00000310856:M10I	ENSP00000310856:M10I	M	-	3	0	VN1R4	58462701	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-0.246000	0.08878	0.501000	0.28013	0.545000	0.68477	ATG		0.517	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857		21	53	1	0	1.66031e-10	0.021523	3.03131e-10	21	53				
NCR1	9437	broad.mit.edu	37	19	55417918	55417918	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:55417918T>A	ENST00000291890.4	+	3	146	c.108T>A	c.(106-108)caT>caA	p.H36Q	NCR1_ENST00000598576.1_Missense_Mutation_p.H24Q|NCR1_ENST00000594765.1_Missense_Mutation_p.H36Q|NCR1_ENST00000338835.5_Missense_Mutation_p.H36Q|NCR1_ENST00000357397.5_Intron|NCR1_ENST00000350790.5_Intron|NCR1_ENST00000447255.1_Missense_Mutation_p.H36Q	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	36	Ig-like 1.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CCGAGCCCCATTTCATGGTTC	0.547																																							uc002qib.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(106-108)CAT>CAA		natural cytotoxicity triggering receptor 1							61.0	65.0	64.0					19																	55417918		2203	4300	6503	SO:0001583	missense	9437				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity	g.chr19:55417918T>A	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.108T>A	19.37:g.55417918T>A	ENSP00000291890:p.His36Gln		Somatic				NCR1_uc002qic.2_Missense_Mutation_p.H36Q|NCR1_uc002qie.2_Missense_Mutation_p.H36Q|NCR1_uc002qid.2_Intron|NCR1_uc002qif.2_Intron|NCR1_uc010esj.2_Intron	p.H36Q	NM_004829	NP_004820	WXS	Illumina HiSeq	Unspecified	O76036	NCTR1_HUMAN		GBM - Glioblastoma multiforme(193;0.0449)	3	146	+			36			Ig-like 1.|Extracellular (Potential).		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	ENST00000291890.4	37	c.108T>A	CCDS12911.1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458437	0.26248	.	.	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835	T;T;T	0.09073	3.02;3.02;3.02	3.87	-4.69	0.03299	Immunoglobulin-like fold (1);	1.960880	0.01955	N	0.042881	T	0.06917	0.0176	N	0.14661	0.345	0.09310	N	0.999997	B;B;B	0.18013	0.021;0.011;0.025	B;B;B	0.17098	0.017;0.002;0.003	T	0.39563	-0.9608	10	0.87932	D	0	.	13.3825	0.60775	0.0:0.6809:0.0:0.3191	.	36;36;36	B0V3L5;O76036-6;O76036	.;.;NCTR1_HUMAN	Q	36	ENSP00000291890:H36Q;ENSP00000404434:H36Q;ENSP00000339515:H36Q	ENSP00000291890:H36Q	H	+	3	2	NCR1	60109730	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.126000	0.03254	-1.311000	0.02309	-0.256000	0.11100	CAT		0.547	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1			25	63	0	0	0	0.01892	0	25	63				
TMEM150B	284417	broad.mit.edu	37	19	55831931	55831931	+	Silent	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:55831931G>A	ENST00000326652.4	-	4	305	c.123C>T	c.(121-123)taC>taT	p.Y41Y	TMEM150B_ENST00000438693.1_Silent_p.Y41Y	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	41						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						ATTACCTGATGTAGGGAAAGC	0.537																																							uc010esw.1		NA																	0					0						c.(121-123)TAC>TAT		transmembrane protein 150B precursor							160.0	165.0	163.0					19																	55831931		2143	4259	6402	SO:0001819	synonymous_variant	284417					integral to membrane		g.chr19:55831931G>A	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.123C>T	19.37:g.55831931G>A			Somatic				TMEM150B_uc010yfu.1_Silent_p.Y41Y|TMEM150B_uc010yfv.1_RNA|TMEM150B_uc010yfw.1_RNA|TMEM150B_uc002qki.2_Silent_p.Y41Y	p.Y41Y	NM_001085488	NP_001078957	WXS	Illumina HiSeq	Unspecified	A6NC51	T150B_HUMAN			4	296	-			41			Extracellular (Potential).		B7ZW71	Silent	SNP	ENST00000326652.4	37	c.123C>T	CCDS42629.1																																																																																				0.537	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488		34	64	0	0	0	0.027894	0	34	64				
IL11	3589	broad.mit.edu	37	19	55879690	55879690	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr19:55879690C>T	ENST00000264563.2	-	4	379	c.317G>A	c.(316-318)cGg>cAg	p.R106Q	IL11_ENST00000590625.1_Missense_Mutation_p.R27Q|IL11_ENST00000585513.1_Missense_Mutation_p.R106Q	NM_000641.3	NP_000632.1	P20809	IL11_HUMAN	interleukin 11	106					B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|fat cell differentiation (GO:0045444)|megakaryocyte differentiation (GO:0030219)|negative regulation of hormone secretion (GO:0046888)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-11 receptor binding (GO:0005142)			large_intestine(1)|skin(1)	2	Breast(117;0.191)	Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTGCACGTGCCGCAGGTAGGA	0.687																																							uc002qks.1		NA																	0					0						c.(316-318)CGG>CAG		interleukin 11 precursor	Oprelvekin(DB00038)						20.0	22.0	21.0					19																	55879690		2197	4297	6494	SO:0001583	missense	3589				B cell differentiation|fat cell differentiation|megakaryocyte differentiation|negative regulation of hormone secretion|platelet activation|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	extracellular space	cytokine activity|growth factor activity|interleukin-11 receptor binding	g.chr19:55879690C>T	X58377	CCDS12923.1, CCDS59423.1	19q13.3-q13.4	2014-01-30			ENSG00000095752	ENSG00000095752		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5966	protein-coding gene	gene with protein product	"""adipogenesis inhibitory factor"", ""oprelvekin"""	147681				1386338	Standard	NM_001267718		Approved	IL-11, AGIF	uc002qks.2	P20809		ENST00000264563.2:c.317G>A	19.37:g.55879690C>T	ENSP00000264563:p.Arg106Gln		Somatic				IL11_uc010yfx.1_Missense_Mutation_p.R27Q	p.R106Q	NM_000641	NP_000632	WXS	Illumina HiSeq	Unspecified	P20809	IL11_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)	4	453	-	Breast(117;0.191)	Renal(1328;0.245)	106					B4DQV5|Q96EB4	Missense_Mutation	SNP	ENST00000264563.2	37	c.317G>A	CCDS12923.1	.	.	.	.	.	.	.	.	.	.	c	15.35	2.807374	0.50421	.	.	ENSG00000095752	ENST00000264563	T	0.39787	1.06	3.87	2.83	0.33086	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.294708	0.30473	N	0.009542	T	0.21590	0.0520	N	0.14661	0.345	0.27399	N	0.954917	B	0.25743	0.133	B	0.16722	0.016	T	0.10965	-1.0607	10	0.30078	T	0.28	-18.4538	7.5086	0.27560	0.0:0.8806:0.0:0.1194	.	106	P20809	IL11_HUMAN	Q	106	ENSP00000264563:R106Q	ENSP00000264563:R106Q	R	-	2	0	IL11	60571502	0.001000	0.12720	0.939000	0.37840	0.102000	0.19082	0.857000	0.27831	1.002000	0.39104	-0.259000	0.10710	CGG		0.687	IL11-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453027.1	NM_000641		4	10	0	0	0	0.021553	0	4	10				
IFT172	26160	broad.mit.edu	37	2	27700939	27700939	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:27700939C>T	ENST00000260570.3	-	11	1193	c.1090G>A	c.(1090-1092)Gga>Aga	p.G364R	IFT172_ENST00000416524.2_Missense_Mutation_p.G343R|IFT172_ENST00000359466.6_Missense_Mutation_p.G364R|RNU6-986P_ENST00000363133.1_RNA	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	364					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CGTTCCTTTCCTAGGATTTTC	0.483																																							uc002rku.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1090-1092)GGA>AGA		selective LIM binding factor homolog							270.0	234.0	246.0					2																	27700939		2203	4300	6503	SO:0001583	missense	26160				cilium assembly	cilium	binding	g.chr2:27700939C>T	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.1090G>A	2.37:g.27700939C>T	ENSP00000260570:p.Gly364Arg		Somatic				IFT172_uc002rkw.2_Missense_Mutation_p.G364R|IFT172_uc010yls.1_Missense_Mutation_p.G343R|IFT172_uc010ezc.2_Missense_Mutation_p.G364R|IFT172_uc002rkv.2_Missense_Mutation_p.G338R	p.G364R	NM_015662	NP_056477	WXS	Illumina HiSeq	Unspecified	Q9UG01	IF172_HUMAN			11	1141	-	Acute lymphoblastic leukemia(172;0.155)		364					A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	37	c.1090G>A	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598630	0.87055	.	.	ENSG00000138002	ENST00000260570;ENST00000359466;ENST00000416524	T;D;D	0.95788	3.46;-3.81;-3.81	5.98	5.98	0.97165	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.98074	0.9365	M	0.88105	2.93	0.80722	D	1	B;D;D;P	0.89917	0.312;0.995;1.0;0.812	B;P;D;P	0.71414	0.175;0.885;0.973;0.577	D	0.98419	1.0576	10	0.72032	D	0.01	-14.9119	18.993	0.92801	0.0:1.0:0.0:0.0	.	364;364;338;364	A5PKZ0;Q9UG01-2;E7EP25;Q9UG01	.;.;.;IF172_HUMAN	R	364;364;343	ENSP00000260570:G364R;ENSP00000352443:G364R;ENSP00000407408:G343R	ENSP00000260570:G364R	G	-	1	0	IFT172	27554443	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.437000	0.80417	2.839000	0.97877	0.650000	0.86243	GGA		0.483	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662		77	196	0	0	0	0.01441	0	77	196				
ARHGAP15	55843	broad.mit.edu	37	2	144245031	144245031	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:144245031C>G	ENST00000295095.6	+	9	960	c.793C>G	c.(793-795)Ctg>Gtg	p.L265V	RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	265					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAGACCTTCCCTGAAAACTCT	0.358																																							uc002tvm.3		NA																	0				ovary(1)|skin(1)	2						c.(793-795)CTG>GTG		ARHGAP15							86.0	93.0	91.0					2																	144245031		2203	4300	6503	SO:0001583	missense	55843				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity	g.chr2:144245031C>G	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.793C>G	2.37:g.144245031C>G	ENSP00000295095:p.Leu265Val		Somatic				ARHGAP15_uc002tvn.2_Missense_Mutation_p.L31V	p.L265V	NM_018460	NP_060930	WXS	Illumina HiSeq	Unspecified	Q53QZ3	RHG15_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.151)	9	944	+			265					Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	c.793C>G	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350515	0.41599	.	.	ENSG00000075884	ENST00000295095	T	0.08458	3.09	5.43	4.55	0.56014	Rho GTPase-activating protein domain (1);	0.063724	0.64402	D	0.000007	T	0.09818	0.0241	L	0.48986	1.54	0.41630	D	0.98901	B	0.22541	0.071	B	0.24006	0.05	T	0.05500	-1.0881	10	0.72032	D	0.01	.	9.4838	0.38917	0.0:0.8246:0.0:0.1754	.	265	Q53QZ3	RHG15_HUMAN	V	265	ENSP00000295095:L265V	ENSP00000295095:L265V	L	+	1	2	ARHGAP15	143961501	0.554000	0.26522	0.999000	0.59377	0.998000	0.95712	1.034000	0.30204	1.274000	0.44362	0.655000	0.94253	CTG		0.358	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460		95	76	0	0	0	0.01441	0	95	76				
RBMS1	5937	broad.mit.edu	37	2	161137837	161137837	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:161137837A>C	ENST00000348849.3	-	10	1369	c.939T>G	c.(937-939)atT>atG	p.I313M	RBMS1_ENST00000392753.3_Missense_Mutation_p.I326M|RBMS1_ENST00000409075.1_Missense_Mutation_p.I277M|RBMS1_ENST00000409972.1_Missense_Mutation_p.I277M|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000409289.2_Missense_Mutation_p.I277M	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	313					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								GGTGCTGTAGAATATATGGTT	0.338																																							uc002ubo.2		NA																	0					0						c.(937-939)ATT>ATG		RNA binding motif, single stranded interacting							74.0	80.0	78.0					2																	161137837		2203	4298	6501	SO:0001583	missense	5937				DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding	g.chr2:161137837A>C	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.939T>G	2.37:g.161137837A>C	ENSP00000294904:p.Ile313Met		Somatic				RBMS1_uc002ubj.2_Missense_Mutation_p.I293M|RBMS1_uc002ubk.2_Missense_Mutation_p.I277M|RBMS1_uc002ubl.2_Missense_Mutation_p.I308M|RBMS1_uc002ubn.2_Missense_Mutation_p.I310M|RBMS1_uc002ubi.3_Missense_Mutation_p.I326M|RBMS1_uc002ubm.2_Missense_Mutation_p.I296M|RBMS1_uc002ubp.2_Missense_Mutation_p.I329M|RBMS1_uc010fox.2_3'UTR	p.I313M	NM_016836	NP_058520	WXS	Illumina HiSeq	Unspecified	P29558	RBMS1_HUMAN			10	1383	-			313					Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	ENST00000348849.3	37	c.939T>G	CCDS2213.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629492	0.46944	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972	T;T;T;T;T	0.22743	1.95;2.19;2.19;1.94;2.19	5.74	0.29	0.15728	.	0.000000	0.85682	D	0.000000	T	0.17195	0.0413	L	0.29908	0.895	0.52099	D	0.999945	P;P;D;P;P;P	0.53745	0.69;0.69;0.962;0.834;0.913;0.69	P;P;P;P;P;P	0.51355	0.56;0.458;0.667;0.66;0.56;0.56	T	0.11743	-1.0575	10	0.21540	T	0.41	.	6.22	0.20675	0.3608:0.0:0.5035:0.1357	.	192;313;310;195;277;326	Q5CZ65;P29558;P29558-2;Q5CZ66;E7ETU5;B4DN88	.;RBMS1_HUMAN;.;.;.;.	M	313;277;277;326;277	ENSP00000294904:I313M;ENSP00000386347:I277M;ENSP00000386571:I277M;ENSP00000376508:I326M;ENSP00000387280:I277M	ENSP00000294904:I313M	I	-	3	3	RBMS1	160846083	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	0.900000	0.28431	-0.204000	0.10235	-0.468000	0.05107	ATT		0.338	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255043.4	NM_016836		55	64	0	0	0	0.01441	0	55	64				
IKZF2	22807	broad.mit.edu	37	2	213872195	213872195	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:213872195C>A	ENST00000434687.1	-	9	1779	c.1470G>T	c.(1468-1470)atG>atT	p.M490I	IKZF2_ENST00000457361.1_Missense_Mutation_p.M490I|IKZF2_ENST00000374327.4_Missense_Mutation_p.M345I|IKZF2_ENST00000421754.2_Missense_Mutation_p.M416I|IKZF2_ENST00000342002.2_Missense_Mutation_p.M496I|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000451136.2_Missense_Mutation_p.M418I|IKZF2_ENST00000374319.4_Missense_Mutation_p.M464I|IKZF2_ENST00000413091.3_3'UTR			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	490					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CATGGCAACCCATGTGAATGG	0.498																																							uc002vem.2		NA																	0					0						c.(1468-1470)ATG>ATT		helios isoform 1							154.0	142.0	146.0					2																	213872195		2203	4300	6503	SO:0001583	missense	22807				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:213872195C>A	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1470G>T	2.37:g.213872195C>A	ENSP00000412869:p.Met490Ile		Somatic				IKZF2_uc010fuu.2_Missense_Mutation_p.M345I|IKZF2_uc002vej.2_Missense_Mutation_p.M437I|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.M416I|IKZF2_uc002vel.2_Missense_Mutation_p.M411I|IKZF2_uc010fuw.2_Missense_Mutation_p.M264I|IKZF2_uc010fux.2_Missense_Mutation_p.M264I|IKZF2_uc010fuy.2_Missense_Mutation_p.M418I|IKZF2_uc002ven.2_Missense_Mutation_p.M464I|IKZF2_uc002vei.2_Missense_Mutation_p.M268I	p.M490I	NM_016260	NP_057344	WXS	Illumina HiSeq	Unspecified	Q9UKS7	IKZF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)	8	1639	-		Esophageal squamous(248;0.0559)|Renal(323;0.218)	490			C2H2-type 5.		Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	c.1470G>T	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032279	0.75504	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.64080	0.2566	L	0.58669	1.825	0.80722	D	1	D;D;D;D;D;D	0.89917	0.97;0.962;0.96;1.0;0.962;0.989	D;D;P;D;P;D	0.79108	0.961;0.946;0.648;0.992;0.53;0.969	T	0.64183	-0.6467	10	0.87932	D	0	-8.8098	20.1124	0.97915	0.0:1.0:0.0:0.0	.	418;416;345;464;490;268	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	I	490;496;490;464;418;416;345;194	ENSP00000410447:M490I;ENSP00000342876:M496I;ENSP00000412869:M490I;ENSP00000363439:M464I;ENSP00000395203:M418I;ENSP00000399574:M416I;ENSP00000363447:M345I	ENSP00000342876:M496I	M	-	3	0	IKZF2	213580440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.749000	0.94314	0.655000	0.94253	ATG		0.498	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260		105	80	1	0	9.98844e-40	0.01441	2.3371e-39	105	80				
ABCA12	26154	broad.mit.edu	37	2	215820069	215820069	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:215820069A>T	ENST00000272895.7	-	43	6469	c.6250T>A	c.(6250-6252)Tgg>Agg	p.W2084R	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.W1766R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2084					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAGTACATCCAGGAAAATGTT	0.438																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(6250-6252)TGG>AGG		ATP-binding cassette, sub-family A, member 12							76.0	71.0	73.0					2																	215820069		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215820069A>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6250T>A	2.37:g.215820069A>T	ENSP00000272895:p.Trp2084Arg		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.W1766R|ABCA12_uc010zjn.1_Missense_Mutation_p.W1011R	p.W2084R	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	43	6470	-		Renal(323;0.127)	2084			Helical; (Potential).		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.6250T>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463354	0.84425	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87029	-2.2;-2.2	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000003	D	0.93380	0.7889	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94102	0.7363	10	0.87932	D	0	.	16.2002	0.82067	1.0:0.0:0.0:0.0	.	2084;1766	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	R	2084;1766	ENSP00000272895:W2084R;ENSP00000374312:W1766R	ENSP00000272895:W2084R	W	-	1	0	ABCA12	215528314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.333000	0.79214	2.285000	0.76669	0.528000	0.53228	TGG		0.438	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		47	59	0	0	0	0.01441	0	47	59				
SP100	6672	broad.mit.edu	37	2	231372747	231372747	+	Splice_Site	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr2:231372747G>T	ENST00000264052.5	+	23	2407		c.e23+1		RN7SL834P_ENST00000461450.2_RNA|SP100_ENST00000340126.4_Splice_Site|SP100_ENST00000409112.1_Missense_Mutation_p.V685L	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AAGAAAAAAGGTGATGATCAA	0.333																																							uc002vqt.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.e23+1		nuclear antigen Sp100 isoform 2							130.0	133.0	132.0					2																	231372747		2203	4300	6503	SO:0001630	splice_region_variant	6672				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding	g.chr2:231372747G>T	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.2052+1G>T	2.37:g.231372747G>T			Somatic				SP100_uc002vqs.2_Missense_Mutation_p.V685L|SP100_uc002vqu.1_Splice_Site_p.K684_splice|SP100_uc010fxp.1_Intron	p.K684_splice	NM_003113	NP_003104	WXS	Illumina HiSeq	Unspecified	P23497	SP100_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	23	2193	+		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)						B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Splice_Site	SNP	ENST00000264052.5	37	c.2052_splice	CCDS2477.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.56|11.56	1.676289|1.676289	0.29783|0.29783	.|.	.|.	ENSG00000067066|ENSG00000067066	ENST00000264052;ENST00000340126|ENST00000409112	.|T	.|0.79247	.|-1.25	4.42|4.42	4.42|4.42	0.53409|0.53409	.|.	.|.	.|.	.|.	.|.	.|T	.|0.76550	.|0.4003	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.76071	.|0.987	.|T	.|0.73717	.|-0.3895	.|8	.|.	.|.	.|.	.|.	12.8319|12.8319	0.57750|0.57750	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|685	.|E7EUA7	.|.	.|L	-1|685	.|ENSP00000386427:V685L	.|.	.|V	+|+	.|1	.|0	SP100|SP100	231080991|231080991	0.996000|0.996000	0.38824|0.38824	0.964000|0.964000	0.40570|0.40570	0.014000|0.014000	0.08584|0.08584	3.575000|3.575000	0.53870|0.53870	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	.|GTG		0.333	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	Intron	32	44	1	0	1.60099e-16	0.021022	3.0867e-16	32	44				
KRTAP13-1	140258	broad.mit.edu	37	21	31768808	31768808	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr21:31768808G>C	ENST00000355459.2	+	1	417	c.404G>C	c.(403-405)tGt>tCt	p.C135S		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	135						intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TATGGAGGCTGTGGCTTCCCT	0.577																																							uc002yoa.2		NA																	0				ovary(1)	1						c.(403-405)TGT>TCT		keratin associated protein 13-1							63.0	61.0	62.0					21																	31768808		2203	4300	6503	SO:0001583	missense	140258					intermediate filament		g.chr21:31768808G>C	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.404G>C	21.37:g.31768808G>C	ENSP00000347635:p.Cys135Ser		Somatic					p.C135S	NM_181599	NP_853630	WXS	Illumina HiSeq	Unspecified	Q8IUC0	KR131_HUMAN			1	417	+			135					Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	c.404G>C	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	G	4.622	0.115695	0.08831	.	.	ENSG00000198390	ENST00000355459	T	0.02763	4.17	3.58	-4.09	0.03951	.	1.593970	0.04788	U	0.431189	T	0.02767	0.0083	L	0.41573	1.285	0.09310	N	1	B	0.19445	0.036	B	0.20184	0.028	T	0.47275	-0.9130	10	0.17369	T	0.5	.	6.7716	0.23596	0.623:0.0:0.2412:0.1358	.	135	Q8IUC0	KR131_HUMAN	S	135	ENSP00000347635:C135S	ENSP00000347635:C135S	C	+	2	0	KRTAP13-1	30690679	0.000000	0.05858	0.000000	0.03702	0.194000	0.23727	-1.168000	0.03123	-1.096000	0.03046	-0.142000	0.14014	TGT		0.577	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3			14	35	0	0	0	0.024245	0	14	35				
KRTAP19-5	337972	broad.mit.edu	37	21	31874303	31874303	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr21:31874303C>A	ENST00000334151.2	-	1	132	c.106G>T	c.(106-108)Ggc>Tgc	p.G36C		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	36						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CCGCCATAGCCCAGTCTGCGG	0.587																																							uc011ada.1		NA																	0					0						c.(106-108)GGC>TGC		keratin associated protein 19-5							132.0	123.0	126.0					21																	31874303		2203	4300	6503	SO:0001583	missense	337972					intermediate filament	protein binding	g.chr21:31874303C>A	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.106G>T	21.37:g.31874303C>A	ENSP00000334985:p.Gly36Cys		Somatic					p.G36C	NM_181611	NP_853642	WXS	Illumina HiSeq	Unspecified	Q3LI72	KR195_HUMAN			1	106	-			36					A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	c.106G>T	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058117	0.36277	.	.	ENSG00000186977	ENST00000334151	T	0.43688	0.94	4.87	4.87	0.63330	.	.	.	.	.	T	0.64800	0.2631	.	.	.	0.42479	D	0.992855	D	0.89917	1.0	D	0.97110	1.0	T	0.69866	-0.5029	8	0.87932	D	0	.	13.8558	0.63527	0.0:1.0:0.0:0.0	.	36	Q3LI72	KR195_HUMAN	C	36	ENSP00000334985:G36C	ENSP00000334985:G36C	G	-	1	0	KRTAP19-5	30796174	0.103000	0.21917	0.912000	0.35992	0.741000	0.42261	1.759000	0.38420	2.405000	0.81733	0.591000	0.81541	GGC		0.587	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2			56	109	1	0	3.37043e-27	0.01441	7.66296e-27	56	109				
IFNAR1	3454	broad.mit.edu	37	21	34721527	34721527	+	Missense_Mutation	SNP	G	G	A	rs17875833	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr21:34721527G>A	ENST00000270139.3	+	7	1071	c.919G>A	c.(919-921)Gta>Ata	p.V307I	IFNAR1_ENST00000442357.2_Missense_Mutation_p.V307I|IFNAR1_ENST00000416947.2_Missense_Mutation_p.V238I	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	307	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.		V -> I (in dbSNP:rs17875833). {ECO:0000269|Ref.5}.		cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	CCTTCTCCGCGTACAAGCATC	0.348													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16449	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(73;817 1211 32990 35667 42746)	Esophageal Squamous(73;817 1211 32990 35667 42746)	uc002yrn.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(919-921)GTA>ATA		interferon-alpha receptor 1 precursor	Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	G	ILE/VAL	6,4400	11.4+/-27.6	0,6,2197	111.0	113.0	112.0		919	3.8	0.2	21	dbSNP_124	112	4,8596	3.7+/-12.6	0,4,4296	yes	missense	IFNAR1	NM_000629.2	29	0,10,6493	AA,AG,GG		0.0465,0.1362,0.0769	benign	307/558	34721527	10,12996	2203	4300	6503	SO:0001583	missense	3454				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity	g.chr21:34721527G>A		CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.919G>A	21.37:g.34721527G>A	ENSP00000270139:p.Val307Ile		Somatic				IFNAR1_uc011adv.1_Missense_Mutation_p.V238I	p.V307I	NM_000629	NP_000620	WXS	Illumina HiSeq	Unspecified	P17181	INAR1_HUMAN			7	1066	+			307			Fibronectin type-III 2.|Extracellular (Potential).		B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	ENST00000270139.3	37	c.919G>A	CCDS13624.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	17.56	3.420995	0.62622	0.001362	4.65E-4	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	D;D;D	0.86562	-2.14;-2.14;-2.14	5.56	3.75	0.43078	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.109289	0.40385	N	0.001109	T	0.77791	0.4183	L	0.41236	1.265	0.36787	D	0.884652	P	0.40731	0.728	B	0.31946	0.138	T	0.78897	-0.2023	10	0.59425	D	0.04	-20.7836	8.2492	0.31706	0.084:0.1565:0.7595:0.0	rs17875833	307	P17181	INAR1_HUMAN	I	238;307;307	ENSP00000395606:V238I;ENSP00000270139:V307I;ENSP00000407406:V307I	ENSP00000270139:V307I	V	+	1	0	IFNAR1	33643397	0.979000	0.34478	0.210000	0.23637	0.681000	0.39784	1.636000	0.37144	0.823000	0.34589	-0.156000	0.13503	GTA		0.348	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139823.4			29	72	0	0	0	0.007291	0	29	72				
DSCAM	1826	broad.mit.edu	37	21	42080524	42080524	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr21:42080524G>T	ENST00000400454.1	-	2	694	c.217C>A	c.(217-219)Cgc>Agc	p.R73S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	73	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGACGTGGCGGATCCCGGGG	0.552																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(217-219)CGC>AGC		Down syndrome cell adhesion molecule isoform							91.0	94.0	93.0					21																	42080524		1969	4157	6126	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:42080524G>T	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.217C>A	21.37:g.42080524G>T	ENSP00000383303:p.Arg73Ser		Somatic				DSCAM_uc002yyr.1_RNA	p.R73S	NM_001389	NP_001380	WXS	Illumina HiSeq	Unspecified	O60469	DSCAM_HUMAN			2	669	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	73			Extracellular (Potential).|Ig-like C2-type 1.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.217C>A	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813401	0.90790	.	.	ENSG00000171587	ENST00000400454	T	0.39056	1.1	5.1	5.1	0.69264	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67144	0.2862	M	0.79693	2.465	0.51767	D	0.999939	D	0.64830	0.994	D	0.76575	0.988	T	0.71024	-0.4712	10	0.62326	D	0.03	.	17.0669	0.86561	0.0:0.0:1.0:0.0	.	73	O60469	DSCAM_HUMAN	S	73	ENSP00000383303:R73S	ENSP00000383303:R73S	R	-	1	0	DSCAM	41002394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.302000	0.96175	2.547000	0.85894	0.585000	0.79938	CGC		0.552	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		23	56	1	0	5.26018e-13	0.012319	9.98191e-13	23	56				
TCF20	6942	broad.mit.edu	37	22	42575679	42575679	+	Silent	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr22:42575679G>T	ENST00000359486.3	-	2	5821	c.5685C>A	c.(5683-5685)gcC>gcA	p.A1895A	TCF20_ENST00000404876.1_Silent_p.A196A|TCF20_ENST00000335626.4_Silent_p.A1895A	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1895					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						AGCCCAAGGTGGCGCCTGCCT	0.557																																							uc003bcj.1		NA																	0				ovary(4)|skin(1)	5						c.(5683-5685)GCC>GCA		transcription factor 20 isoform 1							169.0	138.0	148.0					22																	42575679		2203	4300	6503	SO:0001819	synonymous_variant	6942				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr22:42575679G>T	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.5685C>A	22.37:g.42575679G>T			Somatic				TCF20_uc003bck.1_Silent_p.A1895A|TCF20_uc003bnt.2_Silent_p.A1895A	p.A1895A	NM_005650	NP_005641	WXS	Illumina HiSeq	Unspecified	Q9UGU0	TCF20_HUMAN			2	5819	-			1895			PHD-type; atypical.		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	37	c.5685C>A	CCDS14033.1																																																																																				0.557	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		49	85	1	0	3.4597e-24	0.01441	7.72026e-24	49	85				
ZIC4	84107	broad.mit.edu	37	3	147108894	147108894	+	Silent	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr3:147108894C>A	ENST00000383075.3	-	4	1340	c.828G>T	c.(826-828)acG>acT	p.T276T	ZIC4_ENST00000484399.1_Silent_p.T276T|ZIC4_ENST00000491672.1_Silent_p.T70T|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000425731.3_Silent_p.T314T|ZIC4_ENST00000473123.1_Silent_p.T276T|ZIC4_ENST00000525172.2_Silent_p.T326T	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	276						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AGCTGGGGTGCGTGTAGCACT	0.642																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(826-828)ACG>ACT		zinc finger protein of the cerebellum 4							42.0	48.0	46.0					3																	147108894		2202	4300	6502	SO:0001819	synonymous_variant	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108894C>A	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.828G>T	3.37:g.147108894C>A			Somatic				ZIC4_uc003ewc.1_Silent_p.T206T|ZIC4_uc011bno.1_Silent_p.T326T	p.T276T	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			4	1101	-			276			C2H2-type 5.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Silent	SNP	ENST00000383075.3	37	c.828G>T	CCDS43160.1																																																																																				0.642	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			7	27	1	0	0.000157383	0.00308	0.00025979	7	27				
SMC4	10051	broad.mit.edu	37	3	160146643	160146643	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr3:160146643A>T	ENST00000357388.3	+	18	3159	c.2708A>T	c.(2707-2709)cAa>cTa	p.Q903L	SMC4_ENST00000462787.1_Missense_Mutation_p.Q903L|SMC4_ENST00000469762.1_Missense_Mutation_p.Q878L|SMC4_ENST00000360111.2_Missense_Mutation_p.Q903L|SMC4_ENST00000344722.5_Missense_Mutation_p.Q903L|RP11-432B6.3_ENST00000483754.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	903					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGGCCCAACAAGACAAACTT	0.373																																							uc003fdh.2		NA																	0				ovary(1)|breast(1)	2						c.(2707-2709)CAA>CTA		SMC4 structural maintenance of chromosomes							125.0	119.0	121.0					3																	160146643		2203	4300	6503	SO:0001583	missense	10051				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity	g.chr3:160146643A>T	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2708A>T	3.37:g.160146643A>T	ENSP00000349961:p.Gln903Leu		Somatic				IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Missense_Mutation_p.Q878L|SMC4_uc003fdj.2_Missense_Mutation_p.Q903L|SMC4_uc010hwd.2_Missense_Mutation_p.Q903L|SMC4_uc003fdl.2_Missense_Mutation_p.Q606L	p.Q903L	NM_001002800	NP_001002800	WXS	Illumina HiSeq	Unspecified	Q9NTJ3	SMC4_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		18	2821	+			903			Potential.		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	c.2708A>T	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	A	32	5.142978	0.94560	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	T;T;T;T;T	0.79352	-1.26;-1.26;-0.96;-1.26;-1.26	6.07	6.07	0.98685	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.89887	0.6845	M	0.88704	2.975	0.80722	D	1	D;D;D;D	0.89917	1.0;0.983;0.997;0.999	D;D;D;D	0.80764	0.983;0.954;0.994;0.984	D	0.91055	0.4881	10	0.56958	D	0.05	-27.2126	16.6406	0.85098	1.0:0.0:0.0:0.0	.	903;878;878;903	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	L	903;903;878;903;903;497	ENSP00000349961:Q903L;ENSP00000353225:Q903L;ENSP00000417964:Q878L;ENSP00000420734:Q903L;ENSP00000341382:Q903L	ENSP00000341382:Q903L	Q	+	2	0	SMC4	161629337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.329000	0.79170	2.326000	0.78906	0.533000	0.62120	CAA		0.373	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1			30	39	0	0	0	0.009535	0	30	39				
NCEH1	57552	broad.mit.edu	37	3	172353764	172353764	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr3:172353764C>A	ENST00000475381.1	-	4	784	c.551G>T	c.(550-552)aGa>aTa	p.R184I	NCEH1_ENST00000543711.1_Missense_Mutation_p.R51I|NCEH1_ENST00000538775.1_Missense_Mutation_p.R224I|NCEH1_ENST00000273512.3_Missense_Mutation_p.R216I			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	184					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						AATGCAAATTCTGCCTGGATC	0.468																																							uc011bpx.1		NA																	0					0						c.(670-672)AGA>ATA		arylacetamide deacetylase-like 1 isoform a							166.0	148.0	154.0					3																	172353764		2203	4300	6503	SO:0001583	missense	57552				lipid catabolic process	endoplasmic reticulum|integral to membrane|microsome	carboxylesterase activity	g.chr3:172353764C>A	AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.551G>T	3.37:g.172353764C>A	ENSP00000418571:p.Arg184Ile		Somatic				NCEH1_uc003fig.2_Missense_Mutation_p.R216I|NCEH1_uc011bpw.1_Missense_Mutation_p.R51I|NCEH1_uc011bpy.1_Missense_Mutation_p.R51I	p.R224I	NM_001146276	NP_001139748	WXS	Illumina HiSeq	Unspecified	Q6PIU2	NCEH1_HUMAN			4	809	-			184			Lumenal (Potential).		B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	ENST00000475381.1	37	c.671G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.245506|5.245506	0.95272|0.95272	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000424772|ENST00000475381;ENST00000538775;ENST00000273512;ENST00000543711	.|T;T;T;T	.|0.65549	.|-0.16;-0.16;-0.16;-0.16	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Alpha/beta hydrolase fold-3 (1);	.|0.049119	.|0.85682	.|N	.|0.000000	.|D	.|0.87346	.|0.6154	H|H	0.97540|0.97540	4.025|4.025	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.995	.|D	.|0.91259	.|0.5035	.|10	.|0.87932	.|D	.|0	-19.1372|-19.1372	19.4084|19.4084	0.94658|0.94658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|224;184	.|F5H7K4;Q6PIU2	.|.;NCEH1_HUMAN	X|I	215|184;224;216;51	.|ENSP00000418571:R184I;ENSP00000442464:R224I;ENSP00000273512:R216I;ENSP00000443227:R51I	.|ENSP00000273512:R216I	E|R	-|-	1|2	0|0	NCEH1|NCEH1	173836458|173836458	0.988000|0.988000	0.35896|0.35896	0.978000|0.978000	0.43139|0.43139	0.993000|0.993000	0.82548|0.82548	7.073000|7.073000	0.76784|0.76784	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	GAA|AGA		0.468	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792		40	91	1	0	4.67007e-22	0.00874	1.0049e-21	40	91				
EVC2	132884	broad.mit.edu	37	4	5696066	5696067	+	Missense_Mutation	DNP	CG	CG	AT	rs202198132|rs148388393		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr4:5696066_5696067CG>AT	ENST00000344408.5	-	3	498_499	c.445_446CG>AT	c.(445-447)CGc>ATc	p.R149I	EVC2_ENST00000310917.2_Missense_Mutation_p.R69I|EVC2_ENST00000344938.1_Missense_Mutation_p.R149I	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	149					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R149S(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						ACTTACCAGGCGGTGTGTTATA	0.391																																							uc003gij.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)	5						c.(445-447)CGC>ATC		limbin																																				SO:0001583	missense	132884					integral to membrane		g.chr4:5696066_5696067CG>AT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.445_446delinsAT	4.37:g.5696066_5696067delinsAT	ENSP00000342144:p.Arg149Ile		Somatic				EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.R69I	p.R149I	NM_147127	NP_667338	WXS	Illumina HiSeq	Unspecified	Q86UK5	LBN_HUMAN			3	499_500	-			149					Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	DNP	ENST00000344408.5	37	c.445_446CG>AT	CCDS3382.2																																																																																				0.391	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		21	49	0	0	0	0.004672	0	21	49				
ATP10D	57205	broad.mit.edu	37	4	47514700	47514700	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr4:47514700G>T	ENST00000273859.3	+	2	412	c.143G>T	c.(142-144)gGa>gTa	p.G48V	ATP10D_ENST00000504445.1_Missense_Mutation_p.G48V	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	48					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						AAACTGTCAGGAAGGCACCGG	0.507																																							uc003gxk.1		NA																	0				ovary(2)|pancreas(1)	3						c.(142-144)GGA>GTA		ATPase, class V, type 10D							93.0	88.0	90.0					4																	47514700		2203	4300	6503	SO:0001583	missense	57205				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr4:47514700G>T	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.143G>T	4.37:g.47514700G>T	ENSP00000273859:p.Gly48Val		Somatic				ATP10D_uc003gxj.3_Missense_Mutation_p.G48V	p.G48V	NM_020453	NP_065186	WXS	Illumina HiSeq	Unspecified	Q9P241	AT10D_HUMAN			2	307	+			48			Cytoplasmic (Potential).		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	c.143G>T	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376183	0.24857	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.40476	1.03;3.93	5.1	4.25	0.50352	.	0.138925	0.47852	D	0.000206	T	0.43411	0.1246	M	0.64567	1.98	0.52501	D	0.999958	P;P	0.35481	0.504;0.504	B;B	0.36719	0.231;0.231	T	0.48175	-0.9058	10	0.72032	D	0.01	-8.2507	13.6416	0.62255	0.0:0.2958:0.7042:0.0	.	48;48	Q9P241;Q6PEW3	AT10D_HUMAN;.	V	48	ENSP00000273859:G48V;ENSP00000420909:G48V	ENSP00000273859:G48V	G	+	2	0	ATP10D	47209457	1.000000	0.71417	0.949000	0.38748	0.004000	0.04260	3.860000	0.55995	1.252000	0.44001	0.557000	0.71058	GGA		0.507	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453		28	42	1	0	1.32181e-22	0.007291	2.86987e-22	28	42				
PCDH10	57575	broad.mit.edu	37	4	134071419	134071419	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr4:134071419G>T	ENST00000264360.5	+	1	950	c.124G>T	c.(124-126)Ggt>Tgt	p.G42C	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	42	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGAAGATCTGGGTCTGGACAT	0.532																																							uc003iha.2		NA																	0				ovary(2)	2						c.(124-126)GGT>TGT		protocadherin 10 isoform 1 precursor							123.0	119.0	120.0					4																	134071419		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134071419G>T	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.124G>T	4.37:g.134071419G>T	ENSP00000264360:p.Gly42Cys		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.G42C	p.G42C	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	950	+			42			Cadherin 1.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.124G>T	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757300	0.69648	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.39787	1.06	4.77	4.77	0.60923	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.46145	D	0.000307	T	0.76097	0.3940	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84861	0.0819	10	0.87932	D	0	.	17.5654	0.87918	0.0:0.0:1.0:0.0	.	42;42	Q9P2E7;Q96SF0	PCD10_HUMAN;.	C	42	ENSP00000264360:G42C	ENSP00000264360:G42C	G	+	1	0	PCDH10	134290869	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.657000	0.98554	2.462000	0.83206	0.555000	0.69702	GGT		0.532	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		33	83	1	0	1.99505e-19	0.012213	4.0404e-19	33	83				
PLEKHG4B	153478	broad.mit.edu	37	5	163446	163446	+	Missense_Mutation	SNP	G	G	A	rs143360196		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:163446G>A	ENST00000283426.6	+	11	2241	c.2191G>A	c.(2191-2193)Gag>Aag	p.E731K		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	731							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GCAAAGTTTCGAGATACCTCA	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17748	0.0		0.0	False		,,,				2504	0.001						uc003jak.2		NA																	0				skin(2)	2						c.(2191-2193)GAG>AAG		pleckstrin homology domain containing, family G																																				SO:0001583	missense	153478				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr5:163446G>A	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.2191G>A	5.37:g.163446G>A	ENSP00000283426:p.Glu731Lys		Somatic					p.E731K	NM_052909	NP_443141	WXS	Illumina HiSeq	Unspecified	Q96PX9	PKH4B_HUMAN	all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)	11	2241	+			731						Missense_Mutation	SNP	ENST00000283426.6	37	c.2191G>A	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368585	0.42003	.	.	ENSG00000153404	ENST00000283426	T	0.35605	1.3	3.13	2.22	0.28083	.	.	.	.	.	T	0.36331	0.0963	L	0.27053	0.805	0.20764	N	0.999853	D	0.76494	0.999	P	0.60415	0.874	T	0.18398	-1.0338	9	0.19147	T	0.46	.	7.9957	0.30267	0.0:0.2541:0.7459:0.0	.	731	Q96PX9	PKH4B_HUMAN	K	731	ENSP00000283426:E731K	ENSP00000283426:E731K	E	+	1	0	PLEKHG4B	216446	1.000000	0.71417	0.003000	0.11579	0.033000	0.12548	5.483000	0.66838	0.278000	0.22164	0.460000	0.39030	GAG		0.572	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909		74	99	0	0	0	0.01441	0	74	99				
PRDM9	56979	broad.mit.edu	37	5	23509089	23509089	+	5'UTR	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:23509089G>T	ENST00000296682.3	+	0	129					NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9						meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGAGACTCAGGGCCCTTCTC	0.572										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(-55--51)CAGGG>CATGG		PR domain containing 9							43.0	51.0	49.0					5																	23509089		692	1591	2283	SO:0001623	5_prime_UTR_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23509089G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.-54G>T	5.37:g.23509089G>T		HNSCC(3;0.000094)	Somatic						NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			2	129	+								B4DX22|Q27Q50	Translation_Start_Site	SNP	ENST00000296682.3	37	c.-53G>T	CCDS43307.1																																																																																				0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		16	13	1	0	6.31663e-08	0.024245	1.10312e-07	16	13				
PDZD2	23037	broad.mit.edu	37	5	32059357	32059357	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:32059357G>A	ENST00000438447.1	+	13	2601	c.2213G>A	c.(2212-2214)gGa>gAa	p.G738E	PDZD2_ENST00000282493.3_Missense_Mutation_p.G738E			O15018	PDZD2_HUMAN	PDZ domain containing 2	738	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G738V(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCAAGAGTTGGATTAGGCATT	0.418																																							uc003jhl.2		NA																	1	Substitution - Missense(1)		kidney(1)	central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(2212-2214)GGA>GAA		PDZ domain containing 2							74.0	64.0	67.0					5																	32059357		2203	4300	6503	SO:0001583	missense	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32059357G>A	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2213G>A	5.37:g.32059357G>A	ENSP00000402033:p.Gly738Glu		Somatic				PDZD2_uc003jhm.2_Missense_Mutation_p.G738E|PDZD2_uc011cnx.1_Missense_Mutation_p.G564E	p.G738E	NM_178140	NP_835260	WXS	Illumina HiSeq	Unspecified	O15018	PDZD2_HUMAN			13	2601	+			738			PDZ 4.		Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	c.2213G>A	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454775	0.84209	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.25912	1.77;1.77	5.69	5.69	0.88448	PDZ/DHR/GLGF (3);	0.000000	0.44483	D	0.000459	T	0.60209	0.2251	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.988;1.0	T	0.66937	-0.5797	10	0.62326	D	0.03	.	17.3087	0.87202	0.0:0.0:1.0:0.0	.	564;738	B4E3P2;O15018	.;PDZD2_HUMAN	E	738;557;738	ENSP00000402033:G738E;ENSP00000282493:G738E	ENSP00000282493:G738E	G	+	2	0	PDZD2	32095114	1.000000	0.71417	0.962000	0.40283	0.769000	0.43574	9.283000	0.95860	2.679000	0.91253	0.591000	0.81541	GGA		0.418	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			16	38	0	0	0	0.00499	0	16	38				
IQGAP2	10788	broad.mit.edu	37	5	75858378	75858378	+	Splice_Site	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:75858378G>A	ENST00000274364.6	+	3	600		c.e3+1		IQGAP2_ENST00000379730.3_Splice_Site	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ACGTTATAAGGTAACCAAGAT	0.383																																							uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.e3+1		IQ motif containing GTPase activating protein 2							80.0	76.0	77.0					5																	75858378		2203	4300	6503	SO:0001630	splice_region_variant	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75858378G>A	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.303+1G>A	5.37:g.75858378G>A			Somatic					p.K101_splice	NM_006633	NP_006624	WXS	Illumina HiSeq	Unspecified	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	3	525	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)						A8K4V1|B7Z8A4|J3KR91	Splice_Site	SNP	ENST00000274364.6	37	c.303_splice	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901202	0.92035	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5471	0.99284	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IQGAP2	75894134	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.857000	0.99534	2.941000	0.99782	0.655000	0.94253	.		0.383	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	Intron	60	50	0	0	0	0.01441	0	60	50				
PSD2	84249	broad.mit.edu	37	5	139193133	139193133	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:139193133C>T	ENST00000274710.3	+	3	816	c.611C>T	c.(610-612)gCg>gTg	p.A204V		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	204					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGACATGGCGTTTGAGGGG	0.687																																							uc003leu.1		NA																	0				ovary(1)	1						c.(610-612)GCG>GTG		pleckstrin and Sec7 domain containing 2							33.0	39.0	37.0					5																	139193133		2202	4299	6501	SO:0001583	missense	84249				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr5:139193133C>T	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.611C>T	5.37:g.139193133C>T	ENSP00000274710:p.Ala204Val		Somatic					p.A204V	NM_032289	NP_115665	WXS	Illumina HiSeq	Unspecified	Q9BQI7	PSD2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	816	+			204					D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	c.611C>T	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	7.055	0.565297	0.13498	.	.	ENSG00000146005	ENST00000274710	T	0.11930	2.73	4.52	1.13	0.20643	.	0.604985	0.16432	N	0.214661	T	0.04861	0.0131	N	0.08118	0	0.09310	N	0.999997	B	0.06786	0.001	B	0.01281	0.0	T	0.34502	-0.9826	10	0.27082	T	0.32	.	0.559	0.00676	0.221:0.2797:0.2694:0.2299	.	204	Q9BQI7	PSD2_HUMAN	V	204	ENSP00000274710:A204V	ENSP00000274710:A204V	A	+	2	0	PSD2	139173317	0.017000	0.18338	0.681000	0.30009	0.168000	0.22595	0.917000	0.28665	0.451000	0.26802	-0.384000	0.06662	GCG		0.687	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289		28	33	0	0	0	0.009535	0	28	33				
HARS2	23438	broad.mit.edu	37	5	140076937	140076937	+	Silent	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:140076937G>T	ENST00000230771.3	+	10	1366	c.1143G>T	c.(1141-1143)gtG>gtT	p.V381V	ZMAT2_ENST00000274712.3_5'Flank|HARS2_ENST00000448069.2_Silent_p.V209V|HARS2_ENST00000432671.2_Silent_p.V267V|HARS2_ENST00000508522.1_Silent_p.V356V|HARS2_ENST00000437649.2_Silent_p.V307V|HARS2_ENST00000435019.2_Silent_p.V341V	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	381					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCATGTGTGGGACTCAGCA	0.577																																							uc003lgx.2		NA																	0					0						c.(1141-1143)GTG>GTT		histidyl-tRNA synthetase 2 precursor							71.0	68.0	69.0					5																	140076937		2203	4300	6503	SO:0001819	synonymous_variant	23438				histidyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|histidine-tRNA ligase activity	g.chr5:140076937G>T	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.1143G>T	5.37:g.140076937G>T			Somatic				HARS2_uc011czr.1_Silent_p.V356V|HARS2_uc011czs.1_Silent_p.V237V|HARS2_uc011czt.1_Silent_p.V209V|HARS2_uc011czu.1_Silent_p.V207V	p.V381V	NM_012208	NP_036340	WXS	Illumina HiSeq	Unspecified	P49590	SYHM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		10	1359	+			381					B4DDY8	Silent	SNP	ENST00000230771.3	37	c.1143G>T	CCDS4238.1																																																																																				0.577	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208		12	61	1	0	3.07112e-06	0.010729	5.24921e-06	12	61				
PCDHA3	56145	broad.mit.edu	37	5	140182996	140182996	+	Silent	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:140182996G>T	ENST00000522353.2	+	1	2214	c.2214G>T	c.(2212-2214)acG>acT	p.T738T	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Silent_p.T738T|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	738	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAAGCCCACGCTGGTGTGCT	0.652																																							uc003lhf.2		NA																	0				ovary(6)|skin(2)	8						c.(2212-2214)ACG>ACT		protocadherin alpha 3 isoform 1 precursor							79.0	85.0	83.0					5																	140182996		2203	4300	6503	SO:0001819	synonymous_variant	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140182996G>T	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.2214G>T	5.37:g.140182996G>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.T738T	p.T738T	NM_018906	NP_061729	WXS	Illumina HiSeq	Unspecified	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2214	+			738			Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.		O75286	Silent	SNP	ENST00000522353.2	37	c.2214G>T	CCDS54915.1																																																																																				0.652	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		39	131	1	0	3.09479e-21	0.027894	6.54249e-21	39	131				
PCDHB18	54660	broad.mit.edu	37	5	140615600	140615600	+	RNA	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:140615600C>G	ENST00000526308.1	+	0	1663					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CTCGCTGCTGCCGCCCCAGGA	0.652																																							uc003ljc.1		NA																	0				ovary(1)	1						c.(1315-1317)CCG>GCG		SubName: Full=Similar to protocadherin-3 (Pcdh3);																																						54660							g.chr5:140615600C>G	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615600C>G			Somatic					p.P439A	NR_001281		WXS	Illumina HiSeq	Unspecified					1	1663	+								B3KTF8	Missense_Mutation	SNP	ENST00000526308.1	37	c.1315C>G																																																																																					0.652	PCDHB18-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000394776.1			58	223	0	0	0	0.01441	0	58	223				
TIMD4	91937	broad.mit.edu	37	5	156375427	156375427	+	Splice_Site	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:156375427C>A	ENST00000274532.2	-	5	900	c.844G>T	c.(844-846)Gca>Tca	p.A282S	TIMD4_ENST00000407087.3_Intron	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	282						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCCCCCCTACCTCCAGGCTGA	0.338																																							uc003lwh.2		NA																	0		p.A282E(1)		ovary(2)	2						c.(844-846)GCA>TCA		T-cell immunoglobulin and mucin domain							53.0	46.0	48.0					5																	156375427		2203	4300	6503	SO:0001630	splice_region_variant	91937					integral to membrane		g.chr5:156375427C>A	BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.844+1G>T	5.37:g.156375427C>A			Somatic				TIMD4_uc010jii.2_Intron	p.A282S	NM_138379	NP_612388	WXS	Illumina HiSeq	Unspecified	Q96H15	TIMD4_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		5	901	-	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	282			Extracellular (Potential).		B5MCL9	Missense_Mutation	SNP	ENST00000274532.2	37	c.844G>T	CCDS4332.1	.	.	.	.	.	.	.	.	.	.	C	2.263	-0.368895	0.05069	.	.	ENSG00000145850	ENST00000274532	T	0.18338	2.22	3.27	3.27	0.37495	.	2.124380	0.02595	N	0.100386	T	0.09468	0.0233	N	0.08118	0	0.40748	D	0.982898	P	0.43750	0.816	B	0.34180	0.177	T	0.35992	-0.9766	9	.	.	.	.	10.3089	0.43697	0.0:1.0:0.0:0.0	.	282	Q96H15	TIMD4_HUMAN	S	282	ENSP00000274532:A282S	.	A	-	1	0	TIMD4	156308005	0.004000	0.15560	0.179000	0.23059	0.049000	0.14656	0.830000	0.27462	2.131000	0.65755	0.655000	0.94253	GCA		0.338	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	Missense_Mutation	19	17	1	0	1.56452e-12	0.007413	2.92287e-12	19	17				
SLIT3	6586	broad.mit.edu	37	5	168096868	168096868	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:168096868T>C	ENST00000519560.1	-	35	4675	c.4256A>G	c.(4255-4257)cAt>cGt	p.H1419R	CTC-558O2.2_ENST00000520041.1_RNA|SLIT3_ENST00000332966.8_Missense_Mutation_p.H1426R|SLIT3_ENST00000404867.3_Missense_Mutation_p.H1419R	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1419	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCACTGCCCATGGTGACACTT	0.582																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	0				ovary(3)|skin(1)	4						c.(4255-4257)CAT>CGT		slit homolog 3 precursor							139.0	103.0	115.0					5																	168096868		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168096868T>C	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.4256A>G	5.37:g.168096868T>C	ENSP00000430333:p.His1419Arg		Somatic				SLIT3_uc010jjg.2_Missense_Mutation_p.H1426R	p.H1419R	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		35	4676	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1419			EGF-like 9.		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.4256A>G	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211264	0.58343	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.75821	-0.97;-0.96;-0.94	5.13	5.13	0.70059	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.319390	0.37623	N	0.002006	T	0.71837	0.3387	L	0.56124	1.755	0.50632	D	0.999884	B	0.13145	0.007	B	0.23275	0.045	T	0.70641	-0.4816	10	0.72032	D	0.01	.	14.9461	0.71032	0.0:0.0:0.0:1.0	.	1419	O75094	SLIT3_HUMAN	R	1419;1426;1419	ENSP00000430333:H1419R;ENSP00000332164:H1426R;ENSP00000384890:H1419R	ENSP00000332164:H1426R	H	-	2	0	SLIT3	168029446	1.000000	0.71417	0.956000	0.39512	0.996000	0.88848	5.139000	0.64801	1.908000	0.55244	0.459000	0.35465	CAT		0.582	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		15	42	0	0	0	0.028581	0	15	42				
TBC1D9B	23061	broad.mit.edu	37	5	179297292	179297292	+	Missense_Mutation	SNP	G	G	C	rs148980801	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr5:179297292G>C	ENST00000356834.3	-	16	2725	c.2688C>G	c.(2686-2688)gaC>gaG	p.D896E	TBC1D9B_ENST00000444477.2_Missense_Mutation_p.D54E|TBC1D9B_ENST00000519746.1_Missense_Mutation_p.D72E|TBC1D9B_ENST00000355235.3_Missense_Mutation_p.D896E	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	896	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGATCAGCGAGTCCTTGTTTT	0.602													G|||	11	0.00219649	0.0083	0.0	5008	,	,		19170	0.0		0.0	False		,,,				2504	0.0						uc003mlh.2		NA																	0				breast(1)|skin(1)	2						c.(2686-2688)GAC>GAG		TBC1 domain family, member 9B (with GRAM domain)		G	GLU/ASP,GLU/ASP	54,4352	53.6+/-89.4	1,52,2150	114.0	119.0	117.0		2688,2688	4.1	0.9	5	dbSNP_134	117	0,8600		0,0,4300	yes	missense,missense	TBC1D9B	NM_015043.3,NM_198868.2	45,45	1,52,6450	CC,CG,GG		0.0,1.2256,0.4152	possibly-damaging,possibly-damaging	896/1234,896/1251	179297292	54,12952	2203	4300	6503	SO:0001583	missense	23061					integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity	g.chr5:179297292G>C	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.2688C>G	5.37:g.179297292G>C	ENSP00000349291:p.Asp896Glu		Somatic				TBC1D9B_uc003mli.2_Missense_Mutation_p.D896E|TBC1D9B_uc003mlj.2_Missense_Mutation_p.D896E|TBC1D9B_uc003mlg.2_Missense_Mutation_p.D72E|TBC1D9B_uc011dgv.1_Missense_Mutation_p.D72E|TBC1D9B_uc011dgw.1_Missense_Mutation_p.D72E|TBC1D9B_uc003mlk.1_Missense_Mutation_p.D54E	p.D896E	NM_198868	NP_942568	WXS	Illumina HiSeq	Unspecified	Q66K14	TBC9B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		16	2725	-	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	896			EF-hand.		D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	c.2688C>G	CCDS43408.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	13.54	2.269098	0.40095	0.012256	0.0	ENSG00000197226	ENST00000356834;ENST00000355235;ENST00000519746;ENST00000444477	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	4.93	4.07	0.47477	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	M	0.88310	2.945	0.50313	D	0.999864	D;D;D;D;P;D	0.89917	1.0;1.0;1.0;1.0;0.942;1.0	D;D;D;D;P;D	0.97110	0.999;0.996;0.999;1.0;0.562;0.998	T	0.76236	-0.3033	10	0.40728	T	0.16	-36.8694	8.3715	0.32419	0.23:0.0:0.77:0.0	.	72;240;896;896;896;112	B4E3K0;B3KQE0;A1L3A9;Q66K14-2;Q66K14;B3KM54	.;.;.;.;TBC9B_HUMAN;.	E	896;896;72;54	ENSP00000349291:D896E;ENSP00000347375:D896E;ENSP00000430293:D72E;ENSP00000401585:D54E	ENSP00000347375:D896E	D	-	3	2	TBC1D9B	179229898	1.000000	0.71417	0.857000	0.33713	0.011000	0.07611	1.658000	0.37376	1.082000	0.41137	0.555000	0.69702	GAC		0.602	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043		6	149	0	0	0	0.001984	0	6	149				
BTN2A2	10385	broad.mit.edu	37	6	26385353	26385353	+	Missense_Mutation	SNP	C	C	T	rs375285642	byFrequency	TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:26385353C>T	ENST00000356709.4	+	3	316	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	BTN2A2_ENST00000432533.2_Missense_Mutation_p.R69W|BTN2A2_ENST00000416795.2_Missense_Mutation_p.R69W|BTN2A2_ENST00000352867.2_Intron|BTN2A2_ENST00000482536.1_Intron|BTN2A2_ENST00000469230.1_Missense_Mutation_p.R69W	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	69	Ig-like V-type.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						CATGGAGGTGCGGTGGTTCCG	0.547													C|||	2	0.000399361	0.0	0.0	5008	,	,		19130	0.0		0.0	False		,,,				2504	0.002						uc003nhq.2		NA																	0					0						c.(205-207)CGG>TGG		butyrophilin, subfamily 2, member A2 isoform a		C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,,	1,4405	2.1+/-5.4	0,1,2202	155.0	129.0	138.0		205,205,205,205,,	1.6	1.0	6		138	0,8596		0,0,4298	no	missense,missense,missense,missense,intron,intron	BTN2A2	NM_001197237.1,NM_001197238.1,NM_001197240.1,NM_006995.4,NM_001197239.1,NM_181531.2	101,101,101,101,,	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,,	69/524,69/337,69/257,69/524,,	26385353	1,13001	2203	4298	6501	SO:0001583	missense	10385				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane		g.chr6:26385353C>T	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.205C>T	6.37:g.26385353C>T	ENSP00000349143:p.Arg69Trp		Somatic				BTN2A2_uc011dkf.1_Intron|BTN2A2_uc011dkg.1_Missense_Mutation_p.R69W|BTN2A2_uc003nhr.2_Intron|BTN2A2_uc011dkh.1_Intron|BTN2A2_uc003nhs.2_Missense_Mutation_p.R69W|BTN2A2_uc003nht.2_Missense_Mutation_p.R69W	p.R69W	NM_006995	NP_008926	WXS	Illumina HiSeq	Unspecified	Q8WVV5	BT2A2_HUMAN			3	291	+			69			Extracellular (Potential).|Ig-like V-type.		A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	c.205C>T	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	c	17.95	3.514427	0.64522	2.27E-4	0.0	ENSG00000124508	ENST00000469230;ENST00000356709;ENST00000493275;ENST00000432533;ENST00000416795;ENST00000494184	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;4.13	3.75	1.59	0.23543	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47455	D	0.000233	T	0.74427	0.3715	M	0.89968	3.075	0.33948	D	0.644131	P;D;D	0.89917	0.614;1.0;0.998	B;D;D	0.83275	0.127;0.996;0.95	T	0.73754	-0.3883	10	0.87932	D	0	.	5.5764	0.17225	0.2374:0.6357:0.0:0.1269	.	69;69;69	B4DQ01;Q8WVV5-2;Q8WVV5	.;.;BT2A2_HUMAN	W	69	ENSP00000417472:R69W;ENSP00000349143:R69W;ENSP00000418857:R69W;ENSP00000394241:R69W;ENSP00000399308:R69W;ENSP00000417511:R69W	ENSP00000349143:R69W	R	+	1	2	BTN2A2	26493332	0.519000	0.26242	0.999000	0.59377	0.989000	0.77384	0.256000	0.18351	0.561000	0.29186	0.449000	0.29647	CGG		0.547	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1			23	81	0	0	0	0.016522	0	23	81				
CFB	629	broad.mit.edu	37	6	31914202	31914202	+	Silent	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:31914202G>C	ENST00000425368.2	+	2	630	c.117G>C	c.(115-117)ctG>ctC	p.L39L	CFB_ENST00000477310.1_Intron|CFB_ENST00000456570.1_Silent_p.L541L|CFB_ENST00000556679.1_Silent_p.L541L	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	39	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						CCTGCTCTCTGGAGGGGGTAG	0.597																																							uc003nyj.3		NA																	0				skin(1)	1						c.(115-117)CTG>CTC		complement factor B preproprotein							68.0	70.0	69.0					6																	31914202		1509	2708	4217	SO:0001819	synonymous_variant	629				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity	g.chr6:31914202G>C	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.117G>C	6.37:g.31914202G>C			Somatic				CFB_uc011dor.1_Silent_p.L541L|CFB_uc011dos.1_Silent_p.L39L|CFB_uc003nyi.2_Silent_p.L39L	p.L39L	NM_001710	NP_001701	WXS	Illumina HiSeq	Unspecified	P00751	CFAB_HUMAN			2	395	+			39			Sushi 1.		B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	ENST00000425368.2	37	c.117G>C	CCDS4729.1																																																																																				0.597	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710		15	63	0	0	0	0.028581	0	15	63				
KCNK16	83795	broad.mit.edu	37	6	39284685	39284685	+	Silent	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:39284685C>G	ENST00000373229.5	-	4	547	c.534G>C	c.(532-534)ctG>ctC	p.L178L	KCNK16_ENST00000373227.4_Silent_p.L178L|KCNK16_ENST00000507712.1_Silent_p.L113L|KCNK17_ENST00000373231.4_5'Flank|KCNK16_ENST00000437525.2_Silent_p.L178L|KCNK16_ENST00000425054.2_Silent_p.L178L|KCNK17_ENST00000453413.2_5'Flank	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	178					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CCAGCGTCCCCAGGGTCAGGA	0.557																																							uc003ooq.2		NA																	0				ovary(2)|skin(1)	3						c.(532-534)CTG>CTC		potassium channel, subfamily K, member 16							93.0	93.0	93.0					6																	39284685		2203	4300	6503	SO:0001819	synonymous_variant	83795					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr6:39284685C>G	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.534G>C	6.37:g.39284685C>G			Somatic				KCNK17_uc003ooo.2_5'Flank|KCNK17_uc003oop.2_5'Flank|KCNK16_uc003oor.3_Silent_p.L178L|KCNK16_uc010jwy.2_Silent_p.L178L|KCNK16_uc011dtz.1_Silent_p.L178L	p.L178L	NM_032115	NP_115491	WXS	Illumina HiSeq	Unspecified	Q96T55	KCNKG_HUMAN			4	548	-			178			Helical; (Potential).		B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Silent	SNP	ENST00000373229.5	37	c.534G>C	CCDS4843.1																																																																																				0.557	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115		32	105	0	0	0	0.012213	0	32	105				
COL21A1	81578	broad.mit.edu	37	6	55990417	55990417	+	Splice_Site	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:55990417C>A	ENST00000244728.5	-	14	1995	c.1598G>T	c.(1597-1599)gGt>gTt	p.G533V	COL21A1_ENST00000370819.1_Splice_Site_p.G530V|COL21A1_ENST00000535941.1_Splice_Site_p.G533V	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	533	Collagen-like 2.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACCCATTTCACCCTAAAAGAC	0.274																																							uc003pcs.2		NA																	0				ovary(2)	2						c.(1597-1599)GGT>GTT		collagen, type XXI, alpha 1 precursor							75.0	65.0	68.0					6																	55990417		1792	4064	5856	SO:0001630	splice_region_variant	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:55990417C>A	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1597-1G>T	6.37:g.55990417C>A			Somatic				COL21A1_uc010jzz.2_5'Flank|COL21A1_uc011dxg.1_5'Flank|COL21A1_uc011dxh.1_5'Flank|COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.G533V|COL21A1_uc003pcu.1_Missense_Mutation_p.G530V	p.G533V	NM_030820	NP_110447	WXS	Illumina HiSeq	Unspecified	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		14	1830	-	Lung NSC(77;0.0483)		533					A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	c.1598G>T	CCDS55025.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.80|11.80	1.746304|1.746304	0.30955|0.30955	.|.	.|.	ENSG00000124749|ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811|ENST00000456983	D;D;D|.	0.99532|.	-6.1;-6.1;-6.1|.	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	0.000000|.	0.53938|.	D|.	0.000047|.	D|D	0.86049|0.86049	0.5840|0.5840	H|H	0.97896|0.97896	4.1|4.1	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.90454|0.90454	0.4441|0.4441	10|5	0.59425|.	D|.	0.04|.	.|.	13.0683|13.0683	0.59046|0.59046	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	530;533|.	Q96P44-3;Q96P44|.	.;COLA1_HUMAN|.	V|L	533;530;533;530|97	ENSP00000244728:G533V;ENSP00000359855:G530V;ENSP00000444384:G533V|.	ENSP00000244728:G533V|.	G|V	-|-	2|1	0|0	COL21A1|COL21A1	56098376|56098376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.584000|0.584000	0.36387|0.36387	3.876000|3.876000	0.56115|0.56115	2.231000|2.231000	0.72958|0.72958	0.585000|0.585000	0.79938|0.79938	GGT|GTG		0.274	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		Missense_Mutation	7	13	1	0	1.12685e-05	0.004482	1.8991e-05	7	13				
PRIM2	5558	broad.mit.edu	37	6	57512584	57512584	+	3'UTR	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:57512584C>A	ENST00000389488.2	+	0	1499				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CCAGAAACTCCTCAACCCAAA	0.403																																							uc003pdx.2		NA																	0					0						c.(1411-1413)CCT>CAT		DNA primase polypeptide 2							384.0	360.0	367.0					6																	57512584		1959	4152	6111	SO:0001624	3_prime_UTR_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57512584C>A		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1496C>A	6.37:g.57512584C>A			Somatic					p.P471H	NM_000947	NP_000938	WXS	Illumina HiSeq	Unspecified	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	15	1499	+			471					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000389488.2	37	c.1412C>A																																																																																					0.403	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947		17	377	1	0	0.000422831	0.028581	0.00068853	17	377				
BMPER	168667	broad.mit.edu	37	7	34192754	34192754	+	Missense_Mutation	SNP	A	A	T	rs528093648		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:34192754A>T	ENST00000297161.2	+	16	2301	c.1927A>T	c.(1927-1929)Atc>Ttc	p.I643F	BMPER_ENST00000426693.1_Missense_Mutation_p.I643F	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	643	TIL.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TCCGGGATGTATCAAGACGTG	0.502													a|||	1	0.000199681	0.0	0.0	5008	,	,		17758	0.0		0.001	False		,,,				2504	0.0						uc011kap.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1927-1929)ATC>TTC		BMP-binding endothelial regulator precursor							231.0	198.0	209.0					7																	34192754		2203	4300	6503	SO:0001583	missense	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34192754A>T		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1927A>T	7.37:g.34192754A>T	ENSP00000297161:p.Ile643Phe		Somatic					p.I643F	NM_133468	NP_597725	WXS	Illumina HiSeq	Unspecified	Q8N8U9	BMPER_HUMAN			15	2041	+			643			TIL.		A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	c.1927A>T	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.113609	0.37339	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	D;D	0.90620	-2.7;-2.7	5.92	-1.16	0.09678	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.695254	0.15397	N	0.264488	T	0.76478	0.3993	N	0.12961	0.28	0.25661	N	0.986006	B	0.20164	0.042	B	0.20955	0.032	T	0.61950	-0.6957	10	0.24483	T	0.36	.	3.4643	0.07544	0.301:0.1078:0.4822:0.109	.	643	Q8N8U9	BMPER_HUMAN	F	643	ENSP00000297161:I643F;ENSP00000393950:I643F	ENSP00000297161:I643F	I	+	1	0	BMPER	34159279	1.000000	0.71417	0.980000	0.43619	0.642000	0.38348	1.181000	0.32017	-0.140000	0.11394	-0.456000	0.05471	ATC		0.502	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		40	84	0	0	0	0.011902	0	40	84				
ZNF479	90827	broad.mit.edu	37	7	57200007	57200007	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:57200007C>A	ENST00000331162.4	-	2	295	c.25G>T	c.(25-27)Gga>Tga	p.G9*		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TCTCGGCTTCCAGGGGGTCCT	0.547																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(25-27)GGA>TGA		zinc finger protein 479							56.0	55.0	56.0					7																	57200007		2027	4216	6243	SO:0001587	stop_gained	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57200007C>A	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.25G>T	7.37:g.57200007C>A	ENSP00000333776:p.Gly9*		Somatic					p.G9*	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		2	296	-			9						Nonsense_Mutation	SNP	ENST00000331162.4	37	c.25G>T	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	c	17.45	3.392691	0.62066	.	.	ENSG00000185177	ENST00000331162	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	.	.	.	.	.	.	.	X	9	.	ENSP00000333776:G9X	G	-	1	0	ZNF479	57203949	0.034000	0.19679	0.097000	0.21041	0.099000	0.18886	0.197000	0.17197	0.181000	0.19994	0.184000	0.17185	GGA		0.547	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		23	42	1	0	1.17739e-12	0.027356	2.21681e-12	23	42				
ANKIB1	54467	broad.mit.edu	37	7	91972523	91972523	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:91972523C>T	ENST00000265742.3	+	6	1349	c.973C>T	c.(973-975)Cct>Tct	p.P325S		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	325							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CAGCTTATCTCCTGGGGATTT	0.423																																							uc003ulw.2		NA																	0				lung(1)	1						c.(973-975)CCT>TCT		ankyrin repeat and IBR domain containing 1							109.0	99.0	102.0					7																	91972523		1917	4133	6050	SO:0001583	missense	54467						protein binding|zinc ion binding	g.chr7:91972523C>T	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.973C>T	7.37:g.91972523C>T	ENSP00000265742:p.Pro325Ser		Somatic					p.P325S	NM_019004	NP_061877	WXS	Illumina HiSeq	Unspecified	Q9P2G1	AKIB1_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		6	1349	+	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		325					Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	c.973C>T	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234083	0.79688	.	.	ENSG00000001629	ENST00000265742	T	0.11169	2.8	5.55	5.55	0.83447	.	0.056069	0.64402	D	0.000001	T	0.13329	0.0323	L	0.45285	1.41	0.80722	D	1	B	0.15719	0.014	B	0.09377	0.004	T	0.04216	-1.0968	10	0.39692	T	0.17	.	19.5099	0.95137	0.0:1.0:0.0:0.0	.	325	Q9P2G1	AKIB1_HUMAN	S	325	ENSP00000265742:P325S	ENSP00000265742:P325S	P	+	1	0	ANKIB1	91810459	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.726000	0.68515	2.627000	0.88993	0.561000	0.74099	CCT		0.423	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1			16	23	0	0	0	0.028581	0	16	23				
TRRAP	8295	broad.mit.edu	37	7	98535407	98535407	+	Silent	SNP	A	A	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:98535407A>G	ENST00000359863.4	+	30	4577	c.4368A>G	c.(4366-4368)ccA>ccG	p.P1456P	TRRAP_ENST00000446306.3_Silent_p.P1455P|TRRAP_ENST00000355540.3_Silent_p.P1456P	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1456					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGCTCTTCCCAAATTCCTTCA	0.383																																							uc003upp.2		NA																	0				ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(4366-4368)CCA>CCG		transformation/transcription domain-associated							64.0	51.0	55.0					7																	98535407		2203	4300	6503	SO:0001819	synonymous_variant	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98535407A>G	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.4368A>G	7.37:g.98535407A>G			Somatic				TRRAP_uc011kis.1_Silent_p.P1456P|TRRAP_uc003upr.2_Silent_p.P1148P	p.P1456P	NM_003496	NP_003487	WXS	Illumina HiSeq	Unspecified	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		30	4577	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		1456					A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	c.4368A>G	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450538	0.26074	.	.	ENSG00000196367	ENST00000456197	.	.	.	6.08	4.93	0.64822	.	.	.	.	.	T	0.64046	0.2563	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61749	-0.6999	4	.	.	.	.	12.2179	0.54416	0.9339:0.0:0.0661:0.0	.	.	.	.	R	1171	.	.	Q	+	2	0	TRRAP	98373343	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.442000	0.35046	1.128000	0.42052	0.533000	0.62120	CAA		0.383	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		16	22	0	0	0	0.00499	0	16	22				
ZNF277	11179	broad.mit.edu	37	7	111977846	111977846	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:111977846G>A	ENST00000361822.3	+	9	1060	c.931G>A	c.(931-933)Gca>Aca	p.A311T	AC004112.4_ENST00000411413.1_RNA|AC004112.4_ENST00000431064.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	311					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						TGAAAAGCAAGCAGAAACAAT	0.383																																							uc003vge.2		NA																	0				ovary(2)|breast(2)	4						c.(931-933)GCA>ACA		zinc finger protein (C2H2 type) 277							136.0	137.0	136.0					7																	111977846		2203	4300	6503	SO:0001583	missense	11179					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:111977846G>A	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.931G>A	7.37:g.111977846G>A	ENSP00000354501:p.Ala311Thr		Somatic				ZNF277_uc003vgf.2_Missense_Mutation_p.A233T|ZNF277_uc003vgg.2_Missense_Mutation_p.A136T	p.A311T	NM_021994	NP_068834	WXS	Illumina HiSeq	Unspecified	Q9NRM2	ZN277_HUMAN			9	1060	+			311					Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	ENST00000361822.3	37	c.931G>A	CCDS5755.2	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065693	0.36470	.	.	ENSG00000198839	ENST00000361822;ENST00000421864	T;T	0.42513	0.97;0.97	5.83	4.95	0.65309	Zinc finger, C2H2-like (1);	0.226096	0.44902	D	0.000412	T	0.36908	0.0984	L	0.49350	1.555	0.80722	D	1	B	0.20164	0.042	B	0.21708	0.036	T	0.13791	-1.0496	10	0.22109	T	0.4	-4.5229	12.114	0.53856	0.1379:0.0:0.8621:0.0	.	311	Q9NRM2	ZN277_HUMAN	T	311;22	ENSP00000354501:A311T;ENSP00000415735:A22T	ENSP00000354501:A311T	A	+	1	0	ZNF277	111765082	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.379000	0.52440	1.468000	0.48064	0.655000	0.94253	GCA		0.383	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	NM_021994		22	62	0	0	0	0.01892	0	22	62				
BRAF	673	broad.mit.edu	37	7	140481402	140481403	+	Missense_Mutation	DNP	CC	CC	AA	rs121913358|rs397516890|rs121913355|rs121913357		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr7:140481402_140481403CC>AA	ENST00000288602.6	-	11	1465_1466	c.1405_1406GG>TT	c.(1405-1407)GGa>TTa	p.G469L		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	469	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		G -> A (in NHL; also in a lung adenocarcinoma sample; somatic mutation; elevated kinase activity; efficiently induces cell transformation). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:14612909, ECO:0000269|PubMed:17344846}.|G -> E (in CFC1 and colon cancer). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404, ECO:0000269|PubMed:18042262, ECO:0000269|PubMed:19206169}.|G -> R (in NHL). {ECO:0000269|PubMed:14612909}.|G -> V (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G469A(19)|p.G469V(13)|p.G469R(6)|p.G469S(5)|p.G469E(5)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	GTAGACTGTTCCAAATGATCCA	0.371	G469A(NCIH1395_LUNG)|G469A(NCIH1755_LUNG)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3	G469A(NCIH1395_LUNG)|G469A(NCIH1755_LUNG)	61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	48	Substitution - Missense(48)	p.G469A(19)|p.G469V(12)|p.G469S(6)|p.G469R(6)|p.G469E(5)	lung(14)|large_intestine(9)|skin(9)|haematopoietic_and_lymphoid_tissue(7)|biliary_tract(2)|NS(2)|upper_aerodigestive_tract(1)|cervix(1)|small_intestine(1)|oesophagus(1)|thyroid(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	GRCh37	CM060876	BRAF	M	rs121913355	c.(1405-1407)GGA>TTA		B-Raf	Sorafenib(DB00398)																																			SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140481402_140481403CC>AA	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1405_1406delinsAA	7.37:g.140481402_140481403delinsAA	ENSP00000288602:p.Gly469Leu		Somatic					p.G469L	NM_004333	NP_004324	WXS	Illumina HiSeq	Unspecified	P15056	BRAF_HUMAN			11	1466_1467	-	Melanoma(164;0.00956)		469		G -> A (in NHL; also in a lung adenocarcinoma sample; somatic mutation; elevated kinase activity; efficiently induces cell transformation).|G -> E (in CFC syndrome and colon cancer).|G -> R (in NHL).|G -> V (in a colorectal adenocarcinoma sample; somatic mutation).	ATP (By similarity).|Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	DNP	ENST00000288602.6	37	c.1405_1406GG>TT	CCDS5863.1																																																																																				0.371	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		32	59	0	0	0	0.004672	0	32	59				
SDR16C5	195814	broad.mit.edu	37	8	57228804	57228804	+	Missense_Mutation	SNP	G	G	A	rs116944947		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:57228804G>A	ENST00000303749.3	-	2	740	c.103C>T	c.(103-105)Cgg>Tgg	p.R35W	SDR16C5_ENST00000522671.1_Missense_Mutation_p.R35W|SDR16C5_ENST00000396721.2_Missense_Mutation_p.R35W	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	35					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						ACGTTCTTCCGTGGCTTTGGG	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		22032	0.0		0.001	False		,,,				2504	0.0						uc003xsy.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(103-105)CGG>TGG		epidermal retinal dehydrogenase 2		G	TRP/ARG	0,4406		0,0,2203	87.0	80.0	82.0		103	3.3	0.4	8	dbSNP_132	82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SDR16C5	NM_138969.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	35/310	57228804	1,13005	2203	4300	6503	SO:0001583	missense	195814				detection of light stimulus involved in visual perception|keratinocyte proliferation|retinal metabolic process|retinol metabolic process	endoplasmic reticulum membrane|integral to membrane|integral to membrane of membrane fraction	binding|retinol dehydrogenase activity	g.chr8:57228804G>A		CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.103C>T	8.37:g.57228804G>A	ENSP00000307607:p.Arg35Trp		Somatic				SDR16C5_uc010lyk.1_Missense_Mutation_p.R35W|SDR16C5_uc010lyl.1_Missense_Mutation_p.R35W	p.R35W	NM_138969	NP_620419	WXS	Illumina HiSeq	Unspecified	Q8N3Y7	RDHE2_HUMAN			2	741	-			35					B4DGK2|Q330K3|Q8TDV9|Q96LX1	Missense_Mutation	SNP	ENST00000303749.3	37	c.103C>T	CCDS6167.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	14.55	2.569874	0.45798	0.0	1.16E-4	ENSG00000170786	ENST00000396721;ENST00000303749;ENST00000522671;ENST00000538514	T;D;T	0.82984	-1.39;-1.67;0.69	5.25	3.26	0.37387	.	0.270973	0.41194	D	0.000928	D	0.85609	0.5736	M	0.68593	2.085	0.32415	N	0.550152	D;D;D	0.67145	0.996;0.996;0.989	P;P;P	0.57846	0.742;0.828;0.656	D	0.86202	0.1619	10	0.72032	D	0.01	.	6.823	0.23866	0.0961:0.0:0.3768:0.5271	.	35;35;35	Q8N3Y7-2;G3V145;Q8N3Y7	.;.;RDHE2_HUMAN	W	35	ENSP00000379947:R35W;ENSP00000307607:R35W;ENSP00000431010:R35W	ENSP00000307607:R35W	R	-	1	2	SDR16C5	57391358	0.005000	0.15991	0.357000	0.25798	0.016000	0.09150	1.075000	0.30716	0.582000	0.29556	0.563000	0.77884	CGG		0.458	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378235.1	NM_138969		24	46	0	0	0	0.021523	0	24	46				
TRPA1	8989	broad.mit.edu	37	8	72952008	72952008	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:72952008C>G	ENST00000262209.4	-	18	2293	c.2086G>C	c.(2086-2088)Gag>Cag	p.E696Q	TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	696					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TTGAGAAGCTCTATGCGGTTA	0.299																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(2086-2088)GAG>CAG		ankyrin-like protein 1	Menthol(DB00825)						99.0	102.0	101.0					8																	72952008		2203	4292	6495	SO:0001583	missense	8989					integral to plasma membrane		g.chr8:72952008C>G	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2086G>C	8.37:g.72952008C>G	ENSP00000262209:p.Glu696Gln		Somatic				uc011lff.1_Intron|uc003xyy.2_Intron	p.E696Q	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		18	2261	-			696			Cytoplasmic (Potential).		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.2086G>C	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331357	0.81690	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.79033	-1.23;-1.23	5.22	5.22	0.72569	.	0.094804	0.64402	D	0.000001	D	0.86502	0.5948	M	0.76002	2.32	0.48571	D	0.999677	D	0.64830	0.994	P	0.58820	0.846	D	0.88109	0.2824	10	0.72032	D	0.01	-23.2216	18.7659	0.91873	0.0:1.0:0.0:0.0	.	696	O75762	TRPA1_HUMAN	Q	548;696	ENSP00000428151:E548Q;ENSP00000262209:E696Q	ENSP00000262209:E696Q	E	-	1	0	TRPA1	73114562	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.132000	0.71676	2.439000	0.82584	0.591000	0.81541	GAG		0.299	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		28	58	0	0	0	0.012213	0	28	58				
PSKH2	85481	broad.mit.edu	37	8	87060816	87060816	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:87060816A>T	ENST00000276616.2	-	3	1107	c.1033T>A	c.(1033-1035)Tct>Act	p.S345T		NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	345							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			GAGTGGGGAGAGGCCCTCTGC	0.517																																							uc011lfy.1		NA																	0				stomach(2)|lung(2)|ovary(1)	5						c.(1033-1035)TCT>ACT		protein serine kinase H2							111.0	115.0	114.0					8																	87060816		2203	4300	6503	SO:0001583	missense	85481						ATP binding|protein serine/threonine kinase activity	g.chr8:87060816A>T	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.1033T>A	8.37:g.87060816A>T	ENSP00000276616:p.Ser345Thr		Somatic					p.S345T	NM_033126	NP_149117	WXS	Illumina HiSeq	Unspecified	Q96QS6	KPSH2_HUMAN	STAD - Stomach adenocarcinoma(118;0.129)		3	1033	-			345					A0AV22	Missense_Mutation	SNP	ENST00000276616.2	37	c.1033T>A	CCDS6240.1	.	.	.	.	.	.	.	.	.	.	A	8.816	0.936337	0.18206	.	.	ENSG00000147613	ENST00000276616	T	0.38240	1.15	4.98	-0.245	0.13027	Protein kinase-like domain (1);	.	.	.	.	T	0.28499	0.0705	M	0.64404	1.975	0.09310	N	1	B	0.31318	0.319	B	0.30105	0.111	T	0.22906	-1.0203	9	0.20519	T	0.43	.	4.854	0.13550	0.5254:0.3044:0.1703:0.0	.	345	Q96QS6	KPSH2_HUMAN	T	345	ENSP00000276616:S345T	ENSP00000276616:S345T	S	-	1	0	PSKH2	87129932	0.929000	0.31497	0.002000	0.10522	0.028000	0.11728	2.157000	0.42320	-0.047000	0.13423	-0.323000	0.08544	TCT		0.517	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126		34	58	0	0	0	0.017118	0	34	58				
CSMD3	114788	broad.mit.edu	37	8	113314030	113314030	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:113314030C>G	ENST00000297405.5	-	53	8676	c.8432G>C	c.(8431-8433)aGa>aCa	p.R2811T	CSMD3_ENST00000343508.3_Missense_Mutation_p.R2771T|CSMD3_ENST00000455883.2_Missense_Mutation_p.R2642T|CSMD3_ENST00000352409.3_Missense_Mutation_p.R2741T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2811	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACCTAGGCATCTGGTTTCAGA	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8431-8433)AGA>ACA		CUB and Sushi multiple domains 3 isoform 1							103.0	108.0	106.0					8																	113314030		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113314030C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8432G>C	8.37:g.113314030C>G	ENSP00000297405:p.Arg2811Thr	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.R2013T|CSMD3_uc003ynt.2_Missense_Mutation_p.R2771T|CSMD3_uc011lhx.1_Missense_Mutation_p.R2642T	p.R2811T	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			53	8591	-			2811			Extracellular (Potential).|Sushi 17.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.8432G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728046	0.69074	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02	5.62	4.75	0.60458	Complement control module (2);Sushi/SCR/CCP (3);	0.073733	0.52532	D	0.000078	T	0.39253	0.1071	N	0.04260	-0.245	0.42975	D	0.994443	B;B;P	0.37824	0.27;0.154;0.609	B;B;B	0.39876	0.302;0.312;0.258	T	0.31971	-0.9924	10	0.15499	T	0.54	.	11.7677	0.51941	0.0:0.8584:0.0:0.1416	.	2642;2811;2771	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	T	2771;2811;2081;2642;2741	ENSP00000345799:R2771T;ENSP00000297405:R2811T;ENSP00000341558:R2081T;ENSP00000412263:R2642T;ENSP00000343124:R2741T	ENSP00000297405:R2811T	R	-	2	0	CSMD3	113383206	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.613000	0.46351	1.513000	0.48852	0.655000	0.94253	AGA		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		19	38	0	0	0	0.010504	0	19	38				
ATAD2	29028	broad.mit.edu	37	8	124340444	124340444	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:124340444T>A	ENST00000287394.5	-	25	3961	c.3854A>T	c.(3853-3855)gAa>gTa	p.E1285V	ATAD2_ENST00000521903.1_Missense_Mutation_p.E603V	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1285					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCCTTCATTTTCATCAGAAAT	0.308																																							uc003yqh.3		NA																	0				ovary(2)	2						c.(3853-3855)GAA>GTA		ATPase family, AAA domain containing 2							49.0	46.0	47.0					8																	124340444		2202	4299	6501	SO:0001583	missense	29028				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity	g.chr8:124340444T>A	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3854A>T	8.37:g.124340444T>A	ENSP00000287394:p.Glu1285Val		Somatic				ATAD2_uc011lii.1_Missense_Mutation_p.E1076V|ATAD2_uc003yqi.3_RNA	p.E1285V	NM_014109	NP_054828	WXS	Illumina HiSeq	Unspecified	Q6PL18	ATAD2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		25	3962	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		1285					Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	c.3854A>T	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	T	9.969	1.225048	0.22457	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;T	0.93307	-3.2;1.24	5.23	4.09	0.47781	.	0.873704	0.10253	N	0.696965	D	0.89283	0.6671	L	0.43152	1.355	0.33271	D	0.560955	B	0.27625	0.183	B	0.18871	0.023	D	0.86915	0.2063	10	0.49607	T	0.09	-2.6344	8.4951	0.33123	0.0:0.0893:0.0:0.9107	.	1285	Q6PL18	ATAD2_HUMAN	V	1285;603	ENSP00000287394:E1285V;ENSP00000429213:E603V	ENSP00000287394:E1285V	E	-	2	0	ATAD2	124409625	1.000000	0.71417	0.996000	0.52242	0.285000	0.27093	2.824000	0.48088	0.952000	0.37798	0.528000	0.53228	GAA		0.308	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109		12	21	0	0	0	0.010729	0	12	21				
KIF24	347240	broad.mit.edu	37	9	34255920	34255920	+	Missense_Mutation	SNP	T	T	C	rs144702014		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr9:34255920T>C	ENST00000402558.2	-	10	3709	c.3685A>G	c.(3685-3687)Agg>Ggg	p.R1229G	KIF24_ENST00000345050.2_Missense_Mutation_p.R1095G|KIF24_ENST00000379174.3_Missense_Mutation_p.R1095G|KIF24_ENST00000379166.2_Missense_Mutation_p.R1229G			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1229					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CAACCAAGCCTTGTAGGATGT	0.532											OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	1	0.000199681	0.0008	0.0	5008	,	,		21582	0.0		0.0	False		,,,				2504	0.0						uc003zua.3		NA																	0				central_nervous_system(1)	1						c.(3685-3687)AGG>GGG		kinesin family member 24		T	GLY/ARG	2,4404	4.2+/-10.8	0,2,2201	92.0	84.0	87.0		3685	1.7	0.0	9	dbSNP_134	87	0,8600		0,0,4300	no	missense	KIF24	NM_194313.2	125	0,2,6501	CC,CT,TT		0.0,0.0454,0.0154	benign	1229/1369	34255920	2,13004	2203	4300	6503	SO:0001583	missense	347240				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:34255920T>C	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3685A>G	9.37:g.34255920T>C	ENSP00000384433:p.Arg1229Gly		Somatic	OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	846	KIF24_uc010mkb.2_Intron	p.R1229G	NM_194313	NP_919289	WXS	Illumina HiSeq	Unspecified	Q5T7B8	KIF24_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)		11	3805	-			1229					Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	c.3685A>G	CCDS6551.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.006|0.006	-2.057751|-2.057751	0.00390|0.00390	4.54E-4|4.54E-4	0.0|0.0	ENSG00000186638|ENSG00000186638	ENST00000443226;ENST00000420188|ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050	.|T;T;T;T	.|0.67865	.|-0.13;-0.29;-0.13;-0.29	3.87|3.87	1.72|1.72	0.24424|0.24424	.|.	.|0.645256	.|0.13767	.|N	.|0.364160	T|T	0.25494|0.25494	0.0620|0.0620	N|N	0.00707|0.00707	-1.245|-1.245	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.35425|0.35425	-0.9789|-0.9789	6|10	0.22706|0.02654	T|T	0.39|1	.|.	5.6394|5.6394	0.17554|0.17554	0.0:0.6715:0.0:0.3285|0.0:0.6715:0.0:0.3285	.|.	.|1229	.|Q5T7B8	.|KIF24_HUMAN	R|G	180;1139|1229;1095;1229;1095	.|ENSP00000384433:R1229G;ENSP00000368472:R1095G;ENSP00000368464:R1229G;ENSP00000340179:R1095G	ENSP00000412650:K1139R|ENSP00000340179:R1095G	K|R	-|-	2|1	0|2	KIF24|KIF24	34245920|34245920	0.003000|0.003000	0.15002|0.15002	0.001000|0.001000	0.08648|0.08648	0.412000|0.412000	0.31113|0.31113	0.539000|0.539000	0.23175|0.23175	0.453000|0.453000	0.26858|0.26858	0.528000|0.528000	0.53228|0.53228	AAG|AGG		0.532	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			3	39	0	0	0	0.004672	0	3	39				
MRPL50	54534	broad.mit.edu	37	9	104153117	104153117	+	Silent	SNP	T	T	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr9:104153117T>C	ENST00000374865.4	-	2	129	c.108A>G	c.(106-108)ccA>ccG	p.P36P	MRPL50_ENST00000539624.1_Silent_p.P36P	NM_019051.2	NP_061924.1	Q8N5N7	RM50_HUMAN	mitochondrial ribosomal protein L50	36						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(2)|prostate(2)	5		Acute lymphoblastic leukemia(62;0.0559)				CAACAACCACTGGCTCTTTCT	0.413																																							uc004bbe.2		NA																	0					0						c.(106-108)CCA>CCG		mitochondrial ribosomal protein L50							117.0	116.0	117.0					9																	104153117		2203	4300	6503	SO:0001819	synonymous_variant	54534					mitochondrion|ribosome		g.chr9:104153117T>C	AK000500	CCDS6753.1	9q31.1	2012-11-14			ENSG00000136897	ENSG00000136897		"""Mitochondrial ribosomal proteins / large subunits"""	16654	protein-coding gene	gene with protein product	"""mitochondrial 39S ribosomal protein L50"""	611854					Standard	NM_019051		Approved	FLJ20493, MRP-L50	uc004bbe.2	Q8N5N7	OTTHUMG00000020384	ENST00000374865.4:c.108A>G	9.37:g.104153117T>C			Somatic				MRPL50_uc011lvj.1_Silent_p.P36P	p.P36P	NM_019051	NP_061924	WXS	Illumina HiSeq	Unspecified	Q8N5N7	RM50_HUMAN			2	153	-		Acute lymphoblastic leukemia(62;0.0559)	36					B7Z358|Q5T7E0|Q9NX15	Silent	SNP	ENST00000374865.4	37	c.108A>G	CCDS6753.1																																																																																				0.413	MRPL50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053450.1	NM_019051		38	45	0	0	0	0.021022	0	38	45				
TLR4	7099	broad.mit.edu	37	9	120474686	120474686	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr9:120474686G>T	ENST00000355622.6	+	3	381	c.280G>T	c.(280-282)Gaa>Taa	p.E94*	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Nonsense_Mutation_p.E54*	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	94					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CCAGACAATTGAAGATGGGGC	0.388																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(280-282)GAA>TAA		toll-like receptor 4 precursor							41.0	41.0	41.0					9																	120474686		2203	4299	6502	SO:0001587	stop_gained	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120474686G>T	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.280G>T	9.37:g.120474686G>T	ENSP00000363089:p.Glu94*		Somatic				TLR4_uc004bka.2_Nonsense_Mutation_p.E54*|TLR4_uc004bkb.2_5'UTR	p.E94*	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	571	+			94			LRR 2.|Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Nonsense_Mutation	SNP	ENST00000355622.6	37	c.280G>T	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871913	0.72180	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	.	.	.	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.6898	0.95996	0.0:0.0:1.0:0.0	.	.	.	.	X	54;94	.	ENSP00000363089:E94X	E	+	1	0	TLR4	119514507	1.000000	0.71417	0.999000	0.59377	0.058000	0.15608	4.276000	0.58933	2.669000	0.90835	0.655000	0.94253	GAA		0.388	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		13	28	1	0	0.00185496	0.016723	0.00296056	13	28				
CSF2RA	1438	broad.mit.edu	37	X	1419396	1419396	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chrX:1419396G>T	ENST00000381524.3	+	10	1009	c.823G>T	c.(823-825)Ggt>Tgt	p.G275C	CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Missense_Mutation_p.G275C|CSF2RA_ENST00000501036.2_Missense_Mutation_p.G142C|CSF2RA_ENST00000355432.3_Missense_Mutation_p.G275C|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000417535.2_Missense_Mutation_p.G275C|CSF2RA_ENST00000432318.2_Missense_Mutation_p.G275C|CSF2RA_ENST00000361536.3_Missense_Mutation_p.G275C|CSF2RA_ENST00000381529.3_Missense_Mutation_p.G275C|CSF2RA_ENST00000381509.3_Missense_Mutation_p.G275C|RNA5SP498_ENST00000411342.1_RNA|CSF2RA_ENST00000355805.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	275	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TAATGTTTCTGGTGATTTGGA	0.403																																					Esophageal Squamous(131;723 1707 25334 40494 41806)	Esophageal Squamous(131;723 1707 25334 40494 41806)	uc010nct.2		NA																	0				ovary(2)	2						c.(823-825)GGT>TGT		colony stimulating factor 2 receptor alpha chain	Sargramostim(DB00020)						112.0	116.0	115.0					X																	1419396		2203	4296	6499	SO:0001583	missense	1438					extracellular region|integral to plasma membrane	cytokine receptor activity	g.chrX:1419396G>T	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.823G>T	X.37:g.1419396G>T	ENSP00000370935:p.Gly275Cys		Somatic				CSF2RA_uc011mhb.1_Missense_Mutation_p.G275C|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Missense_Mutation_p.G275C|CSF2RA_uc004cpo.2_Missense_Mutation_p.G275C|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Missense_Mutation_p.G142C|CSF2RA_uc004cpp.2_Missense_Mutation_p.G275C|CSF2RA_uc010ncv.2_Missense_Mutation_p.G275C|CSF2RA_uc004cpr.2_Missense_Mutation_p.G275C	p.G275C	NM_001161529	NP_001155001	WXS	Illumina HiSeq	Unspecified	P15509	CSF2R_HUMAN			11	1145	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	275			Extracellular (Potential).		A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	ENST00000381524.3	37	c.823G>T	CCDS35191.1	.	.	.	.	.	.	.	.	.	.	.	8.599	0.886394	0.17540	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000501036;ENST00000381524;ENST00000381509;ENST00000355432;ENST00000417535;ENST00000381500	D;D;D;D;D;D;D;D;D	0.95885	-3.84;-3.84;-2.11;-2.11;-3.84;-3.84;-2.11;-3.84;-2.11	0.798	0.798	0.18660	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.571617	0.13656	U	0.371934	D	0.96119	0.8735	.	.	.	0.09310	N	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999	D;D;D;D;D	0.68192	0.935;0.956;0.939;0.935;0.921	D	0.88654	0.3184	9	0.62326	D	0.03	.	4.9167	0.13849	0.0:0.0:1.0:0.0	.	275;275;275;275;275	P15509-2;A7J003;P15509-3;P15509-5;P15509	.;.;.;.;CSF2R_HUMAN	C	275;275;275;142;275;275;275;275;275	ENSP00000370940:G275C;ENSP00000416437:G275C;ENSP00000354836:G275C;ENSP00000440491:G142C;ENSP00000370935:G275C;ENSP00000370920:G275C;ENSP00000347606:G275C;ENSP00000394227:G275C;ENSP00000370911:G275C	ENSP00000347606:G275C	G	+	1	0	CSF2RA	1379396	0.005000	0.15991	0.003000	0.11579	0.163000	0.22366	1.222000	0.32515	0.745000	0.32763	0.100000	0.15512	GGT		0.403	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2			39	68	1	0	2.40579e-17	0.025465	4.71379e-17	39	68				
GDPD2	54857	broad.mit.edu	37	X	69647191	69647191	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chrX:69647191G>C	ENST00000374382.3	+	10	1065	c.814G>C	c.(814-816)Gat>Cat	p.D272H	GDPD2_ENST00000538649.1_Missense_Mutation_p.D193H|GDPD2_ENST00000536730.1_Missense_Mutation_p.D193H|GDPD2_ENST00000453994.2_Missense_Mutation_p.D272H|GDPD2_ENST00000472623.1_3'UTR	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	272	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					CCTCATGCATGATGAGCACCT	0.577																																							uc004dyh.2		NA																	0				ovary(2)	2						c.(814-816)GAT>CAT		osteoblast differentiation promoting factor							90.0	65.0	73.0					X																	69647191		2203	4300	6503	SO:0001583	missense	54857				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding	g.chrX:69647191G>C	AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.814G>C	X.37:g.69647191G>C	ENSP00000363503:p.Asp272His		Somatic				GDPD2_uc010nkx.1_Intron|GDPD2_uc010nky.1_Missense_Mutation_p.D58H|GDPD2_uc011mpk.1_Missense_Mutation_p.D272H|GDPD2_uc011mpl.1_Missense_Mutation_p.D193H|GDPD2_uc011mpm.1_Missense_Mutation_p.D193H	p.D272H	NM_017711	NP_060181	WXS	Illumina HiSeq	Unspecified	Q9HCC8	GDPD2_HUMAN			10	1065	+	Renal(35;0.156)		272			GDPD.|Extracellular (Potential).		B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	c.814G>C	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173412	0.78452	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.26	5.26	0.73747	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	D	0.87394	0.6166	H	0.98612	4.28	0.50467	D	0.999879	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92273	0.5827	9	.	.	.	-11.4688	16.3252	0.82977	0.0:0.0:1.0:0.0	.	272;58;272	B4DVC9;B3KUI6;Q9HCC8	.;.;GDPD2_HUMAN	H	272;193;193;272	ENSP00000414019:D272H;ENSP00000445982:D193H;ENSP00000444601:D193H;ENSP00000363503:D272H	.	D	+	1	0	GDPD2	69563916	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	8.795000	0.91872	2.422000	0.82143	0.544000	0.68410	GAT		0.577	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711		10	7	0	0	0	0.006214	0	10	7				
KDM5D	8284	broad.mit.edu	37	Y	21870790	21870790	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chrY:21870790C>G	ENST00000317961.4	-	21	3323	c.3052G>C	c.(3052-3054)Gct>Cct	p.A1018P	KDM5D_ENST00000382806.2_Missense_Mutation_p.A961P|KDM5D_ENST00000541639.1_Missense_Mutation_p.A1049P	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	1018					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	GCAATCCAAGCTTGTGCCTTA	0.448																																							uc004fug.2		NA																	0				skin(1)	1						c.(3052-3054)GCT>CCT		jumonji, AT rich interactive domain 1D isoform	Vitamin C(DB00126)						81.0	84.0	83.0					Y																	21870790		602	1940	2542	SO:0001583	missense	8284				chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrY:21870790C>G	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.3052G>C	Y.37:g.21870790C>G	ENSP00000322408:p.Ala1018Pro		Somatic				KDM5D_uc011naz.1_Missense_Mutation_p.A1049P|KDM5D_uc010nwy.2_Missense_Mutation_p.A961P|KDM5D_uc004fuf.2_Missense_Mutation_p.A193P	p.A1018P	NM_004653	NP_004644	WXS	Illumina HiSeq	Unspecified	Q9BY66	KDM5D_HUMAN			21	3340	-			1018					A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	37	c.3052G>C	CCDS14794.1	.	.	.	.	.	.	.	.	.	.	.	10.18	1.279121	0.23307	.	.	ENSG00000012817	ENST00000415360	T	0.44083	0.93	1.17	1.17	0.20885	Lysine-specific demethylase-like domain (1);	0.070053	0.56097	U	0.000033	T	0.50034	0.1592	M	0.76574	2.34	0.32203	N	0.57751	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.985;1.0;1.0;0.995	T	0.56251	-0.8010	7	.	.	.	-13.7602	.	.	.	.	1049;961;1018;977	B7ZLX1;Q9BY66-2;Q9BY66;E9PFH2	.;.;KDM5D_HUMAN;.	P	16	ENSP00000389433:A16P	.	A	-	1	0	KDM5D	20330178	0.490000	0.26012	0.955000	0.39395	0.327000	0.28475	6.105000	0.71505	0.983000	0.38602	0.064000	0.15345	GCT		0.448	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653		20	11	0	0	0	0.01892	0	20	11				
ZMYM1	79830	broad.mit.edu	37	1	35578842	35578842	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:35578842delA	ENST00000373330.1	+	11	1585	c.1411delA	c.(1411-1413)aaafs	p.K472fs	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Frame_Shift_Del_p.K472fs			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	472						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGAAAACAGTAAAAAAGATGT	0.343																																							uc001bym.2		NA																	0					0						c.(1411-1413)AAAfs		zinc finger, MYM domain containing 1							47.0	47.0	47.0					1																	35578842		1826	4071	5897	SO:0001589	frameshift_variant	79830					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding	g.chr1:35578842delA	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1411delA	1.37:g.35578842delA	ENSP00000362427:p.Lys472fs		Somatic				ZMYM1_uc001byn.2_Frame_Shift_Del_p.K471fs|ZMYM1_uc010ohu.1_Frame_Shift_Del_p.K452fs|ZMYM1_uc001byo.2_Frame_Shift_Del_p.K111fs|ZMYM1_uc009vut.2_Frame_Shift_Del_p.K396fs	p.K471fs	NM_024772	NP_079048	WXS	Illumina HiSeq	Unspecified	Q5SVZ6	ZMYM1_HUMAN			11	1559	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	471			TTF-type.		D3DPR7|Q7Z3Q4	Frame_Shift_Del	DEL	ENST00000373330.1	37	c.1411delA	CCDS41302.1																																																																																				0.343	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772		7	68	NA	NA	NA	NA	NA	7	68	---	---	---	---
KIAA0907	22889	broad.mit.edu	37	1	155886422	155886423	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr1:155886422_155886423delCT	ENST00000368321.3	-	12	1569_1570	c.1546_1547delAG	c.(1546-1548)aggfs	p.R516fs	KIAA0907_ENST00000368320.3_Frame_Shift_Del_p.R516fs	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	516							RNA binding (GO:0003723)	p.R516fs*21(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TTACCTGTCCCTCTCTCTCTCT	0.396																																							uc001fmi.1		NA																	1	Deletion - Frameshift(1)		large_intestine(1)		0						c.(1546-1548)AGGfs		hypothetical protein LOC22889																																				SO:0001589	frameshift_variant	22889							g.chr1:155886422_155886423delCT	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1546_1547delAG	1.37:g.155886432_155886433delCT	ENSP00000357304:p.Arg516fs		Somatic				KIAA0907_uc001fmj.1_Frame_Shift_Del_p.R516fs|KIAA0907_uc009wrk.1_Frame_Shift_Del_p.R373fs|KIAA0907_uc009wrl.1_RNA	p.R516fs	NM_014949	NP_055764	WXS	Illumina HiSeq	Unspecified	Q7Z7F0	K0907_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)		12	1570_1571	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		516					O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Frame_Shift_Del	DEL	ENST00000368321.3	37	c.1546_1547delAG	CCDS30885.1																																																																																				0.396	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949		7	350	NA	NA	NA	NA	NA	7	350	---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46215214	46215214	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr12:46215214delT	ENST00000334344.6	+	6	821	c.649delT	c.(649-651)tttfs	p.F217fs	ARID2_ENST00000422737.1_Frame_Shift_Del_p.F68fs	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	217				F -> L (in Ref. 3; CAD91164). {ECO:0000305}.	chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTTAGGATCCTTTTCCACTGT	0.259			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					0				ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(649-651)TTTfs		AT rich interactive domain 2 (ARID, RFX-like)							60.0	66.0	64.0					12																	46215214		2203	4288	6491	SO:0001589	frameshift_variant	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46215214delT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.649delT	12.37:g.46215214delT	ENSP00000335044:p.Phe217fs		Somatic				ARID2_uc001ror.2_Frame_Shift_Del_p.F217fs	p.F217fs	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	6	649	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	217	F -> L (in Ref. 4; CAD91164).				Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	37	c.649delT	CCDS31783.1																																																																																				0.259	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		8	100	NA	NA	NA	NA	NA	8	100	---	---	---	---
ELL3	80237	broad.mit.edu	37	15	44066401	44066409	+	In_Frame_Del	DEL	CCGAACTCT	CCGAACTCT	-	rs147224616		TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CCGAACTCT	CCGAACTCT	-	-	CCGAACTCT	CCGAACTCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr15:44066401_44066409delCCGAACTCT	ENST00000319359.3	-	9	1650_1658	c.1009_1017delAGAGTTCGG	c.(1009-1017)agagttcggdel	p.RVR337del	RP11-296A16.1_ENST00000417761.2_3'UTR|ELL3_ENST00000497465.1_5'UTR|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	337					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)	p.R339W(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		GAGTTCCTCGCCGAACTCTTTTAATCTCT	0.502																																							uc001zsw.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)	1						c.(1009-1017)AGAGTTCGGdel		elongation factor RNA polymerase II-like 3																																				SO:0001651	inframe_deletion	80237				positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex		g.chr15:44066401_44066409delCCGAACTCT	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.1009_1017delAGAGTTCGG	15.37:g.44066401_44066409delCCGAACTCT	ENSP00000320346:p.Arg337_Arg339del		Somatic				ELL3_uc001zsv.1_In_Frame_Del_p.RVR291del|ELL3_uc001zsx.1_In_Frame_Del_p.RVR222del|uc001zsy.2_5'Flank	p.RVR337del	NM_025165	NP_079441	WXS	Illumina HiSeq	Unspecified	Q9HB65	ELL3_HUMAN		GBM - Glioblastoma multiforme(94;7.81e-07)	9	1412_1420	-		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	337_339					B3KQ66|B3KX08|Q6I9Z7|Q9H634	In_Frame_Del	DEL	ENST00000319359.3	37	c.1009_1017delAGAGTTCGG	CCDS10102.1																																																																																				0.502	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133236.2	NM_025165		18	42	NA	NA	NA	NA	NA	18	42	---	---	---	---
CACNA1G	8913	broad.mit.edu	37	17	48653249	48653251	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	CAC	CAC	-	-	CAC	CAC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr17:48653249_48653251delCAC	ENST00000359106.5	+	8	1486_1488	c.1486_1488delCAC	c.(1486-1488)cacdel	p.H504del	CACNA1G_ENST00000358244.5_In_Frame_Del_p.H504del|CACNA1G_ENST00000515765.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000416767.4_In_Frame_Del_p.H504del|CACNA1G_ENST00000510366.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000360761.4_In_Frame_Del_p.H504del|CACNA1G_ENST00000515411.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000507896.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000352832.5_In_Frame_Del_p.H504del|CACNA1G_ENST00000514181.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000514079.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000512389.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000513964.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000507609.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000513689.2_In_Frame_Del_p.H504del|CACNA1G_ENST00000505165.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000507336.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000515165.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000429973.2_In_Frame_Del_p.H504del|CACNA1G_ENST00000354983.4_In_Frame_Del_p.H504del|CACNA1G_ENST00000507510.2_In_Frame_Del_p.H504del|CACNA1G_ENST00000502264.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000442258.2_In_Frame_Del_p.H504del|CACNA1G_ENST00000514717.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000503485.1_In_Frame_Del_p.H504del|CACNA1G_ENST00000510115.1_In_Frame_Del_p.H504del	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	504	Poly-His.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CCACCTGGTGcaccaccaccacc	0.7																																							uc002irk.1		NA																	0				breast(1)	1						c.(1486-1488)CACdel		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)		,,,,,,,,,,,,,,	41,3783		2,37,1873					,,,,,,,,,,,,,,	-8.2	0.7			15	139,7763		4,131,3816	no	coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding	CACNA1G	NM_198397.1,NM_198396.1,NM_198388.1,NM_198387.1,NM_198386.1,NM_198385.1,NM_198384.1,NM_198383.1,NM_198382.1,NM_198380.1,NM_198379.1,NM_198378.1,NM_198377.1,NM_198376.1,NM_018896.3	,,,,,,,,,,,,,,	6,168,5689	A1A1,A1R,RR		1.759,1.0722,1.5351	,,,,,,,,,,,,,,	,,,,,,,,,,,,,,		180,11546				SO:0001651	inframe_deletion	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48653249_48653251delCAC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1486_1488delCAC	17.37:g.48653258_48653260delCAC	ENSP00000352011:p.His504del		Somatic				CACNA1G_uc002iri.1_In_Frame_Del_p.H504del|CACNA1G_uc002irj.1_In_Frame_Del_p.H504del|CACNA1G_uc002irl.1_In_Frame_Del_p.H504del|CACNA1G_uc002irm.1_In_Frame_Del_p.H504del|CACNA1G_uc002irn.1_In_Frame_Del_p.H504del|CACNA1G_uc002iro.1_In_Frame_Del_p.H504del|CACNA1G_uc002irp.1_In_Frame_Del_p.H504del|CACNA1G_uc002irq.1_In_Frame_Del_p.H504del|CACNA1G_uc002irr.1_In_Frame_Del_p.H504del|CACNA1G_uc002irs.1_In_Frame_Del_p.H504del|CACNA1G_uc002irt.1_In_Frame_Del_p.H504del|CACNA1G_uc002irv.1_In_Frame_Del_p.H504del|CACNA1G_uc002irw.1_In_Frame_Del_p.H504del|CACNA1G_uc002iru.1_In_Frame_Del_p.H504del|CACNA1G_uc002irx.1_In_Frame_Del_p.H417del|CACNA1G_uc002iry.1_In_Frame_Del_p.H417del|CACNA1G_uc002irz.1_In_Frame_Del_p.H417del|CACNA1G_uc002isa.1_In_Frame_Del_p.H417del|CACNA1G_uc002isb.1_In_Frame_Del_p.H417del|CACNA1G_uc002isc.1_In_Frame_Del_p.H417del|CACNA1G_uc002isd.1_In_Frame_Del_p.H417del|CACNA1G_uc002ise.1_In_Frame_Del_p.H417del|CACNA1G_uc002isf.1_In_Frame_Del_p.H417del|CACNA1G_uc002isg.1_In_Frame_Del_p.H417del|CACNA1G_uc002ish.1_In_Frame_Del_p.H417del|CACNA1G_uc002isi.1_In_Frame_Del_p.H417del	p.H504del	NM_018896	NP_061496	WXS	Illumina HiSeq	Unspecified	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		8	1858_1860	+	Breast(11;6.7e-17)		504			Cytoplasmic (Potential).|Poly-His.		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	In_Frame_Del	DEL	ENST00000359106.5	37	c.1486_1488delCAC	CCDS45730.1																																																																																				0.700	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
NSUN7	79730	broad.mit.edu	37	4	40778252	40778253	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr4:40778252_40778253insT	ENST00000381782.2	+	7	1507_1508	c.1012_1013insT	c.(1012-1014)cttfs	p.L338fs	NSUN7_ENST00000316607.5_Frame_Shift_Ins_p.L338fs	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	338							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CTTGAAGACCCTTTTCACAAAA	0.287																																							uc003gvj.3		NA																	0					0						c.(1012-1014)CTTfs		NOL1/NOP2/Sun domain family, member 7																																				SO:0001589	frameshift_variant	79730							g.chr4:40778252_40778253insT	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1016dupT	4.37:g.40778256_40778256dupT	ENSP00000371201:p.Leu338fs		Somatic				NSUN7_uc003gvi.3_Frame_Shift_Ins_p.L338fs	p.L338fs	NM_024677	NP_078953	WXS	Illumina HiSeq	Unspecified					7	1507_1508	+								C9JI19|Q8N9K8|Q9H815	Frame_Shift_Ins	INS	ENST00000381782.2	37	c.1012_1013insT	CCDS3461.2																																																																																				0.287	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677		32	72	NA	NA	NA	NA	NA	32	72	---	---	---	---
UBA6	55236	broad.mit.edu	37	4	68501182	68501182	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr4:68501182delA	ENST00000322244.5	-	20	1890	c.1831delT	c.(1831-1833)tacfs	p.Y611fs		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	611					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TGACTATTGTAAGACTCAGTC	0.323																																							uc003hdg.3		NA																	0					0						c.(1831-1833)TACfs		ubiquitin-activating enzyme E1-like 2							110.0	101.0	104.0					4																	68501182		2203	4300	6503	SO:0001589	frameshift_variant	55236				protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding	g.chr4:68501182delA	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1831delT	4.37:g.68501182delA	ENSP00000313454:p.Tyr611fs		Somatic				UBA6_uc003hdh.1_Frame_Shift_Del_p.Y137fs	p.Y611fs	NM_018227	NP_060697	WXS	Illumina HiSeq	Unspecified	A0AVT1	UBA6_HUMAN			20	1883	-			611					A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Frame_Shift_Del	DEL	ENST00000322244.5	37	c.1831delT	CCDS3516.1																																																																																				0.323	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227		25	31	NA	NA	NA	NA	NA	25	31	---	---	---	---
ICK	22858	broad.mit.edu	37	6	52883129	52883129	+	Splice_Site	DEL	T	T	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr6:52883129delT	ENST00000350082.5	-	7	1008	c.662delA	c.(661-663)aag>ag	p.K221fs	ICK_ENST00000356971.3_Splice_Site_p.K221fs	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					TATCATTACCTTTTTTGGTGT	0.502																																							uc003pbh.2		NA																	0				ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5						c.(661-663)AAGfs		intestinal cell kinase							184.0	185.0	184.0					6																	52883129		2203	4300	6503	SO:0001630	splice_region_variant	22858				intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding	g.chr6:52883129delT	AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.663+1A>-	6.37:g.52883129delT			Somatic				ICK_uc003pbi.2_Frame_Shift_Del_p.K221fs|ICK_uc003pbj.2_Frame_Shift_Del_p.K221fs	p.K221fs	NM_016513	NP_057597	WXS	Illumina HiSeq	Unspecified	Q9UPZ9	ICK_HUMAN			8	1152	-	Lung NSC(77;0.103)		221			Protein kinase.		A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Frame_Shift_Del	DEL	ENST00000350082.5	37	c.662delA	CCDS4949.1																																																																																				0.502	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	Frame_Shift_Del	7	325	NA	NA	NA	NA	NA	7	325	---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56436672	56436672	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7633-01A-11D-2063-08	TCGA-78-7633-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aea06070-5a30-4f58-8117-68f669dbe7bf	35b3b1be-aabe-461a-b26a-44c7c39542c3	g.chr8:56436672delC	ENST00000327381.6	+	3	1939	c.1839delC	c.(1837-1839)gacfs	p.D613fs		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	613						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			ATGTTTTGGACCGAAGCCTCC	0.478																																							uc003xsf.2		NA																	0				pancreas(2)	2						c.(1837-1839)GACfs		XK, Kell blood group complex subunit-related							124.0	115.0	118.0					8																	56436672		2203	4300	6503	SO:0001589	frameshift_variant	114786					integral to membrane		g.chr8:56436672delC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1839delC	8.37:g.56436672delC	ENSP00000328326:p.Asp613fs		Somatic					p.D613fs	NM_052898	NP_443130	WXS	Illumina HiSeq	Unspecified	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)		3	1871	+			613					Q96PZ8	Frame_Shift_Del	DEL	ENST00000327381.6	37	c.1839delC	CCDS34893.1																																																																																				0.478	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898		27	61	NA	NA	NA	NA	NA	27	61	---	---	---	---
