#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HP1BP3	50809	broad.mit.edu	37	1	21074149	21074149	+	Splice_Site	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:21074149C>A	ENST00000312239.5	-	11	1281		c.e11-1		HP1BP3_ENST00000375003.2_Splice_Site	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3						nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		AGCAAATGCACTGAAAAAAAA	0.383																																							uc001bdw.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.e11-1		HP1-BP74							61.0	59.0	59.0					1																	21074149		2203	4300	6503	SO:0001630	splice_region_variant	50809				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:21074149C>A	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1142-1G>T	1.37:g.21074149C>A			Somatic				HP1BP3_uc001bdv.1_Splice_Site_p.M343_splice|HP1BP3_uc010odh.1_Splice_Site_p.M343_splice|HP1BP3_uc001bdy.1_Splice_Site_p.M381_splice|HP1BP3_uc010odf.1_Splice_Site_p.M40_splice|HP1BP3_uc010odg.1_Splice_Site_p.M229_splice	p.M381_splice	NM_016287	NP_057371	WXS	Illumina HiSeq	Unspecified	Q5SSJ5	HP1B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)	11	1282	-		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)						A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Splice_Site	SNP	ENST00000312239.5	37	c.1142_splice	CCDS30621.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.358052	0.61403	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003;ENST00000419948	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1232	0.65203	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HP1BP3	20946736	1.000000	0.71417	0.985000	0.45067	0.817000	0.46193	6.482000	0.73613	2.408000	0.81797	0.591000	0.81541	.		0.383	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2	NM_016287	Intron	18	14	1	0	5.26018e-13	0.00188189	4.44693e-12	18	14				
EIF4G3	8672	broad.mit.edu	37	1	21268753	21268753	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:21268753C>G	ENST00000264211.8	-	8	920	c.726G>C	c.(724-726)gaG>gaC	p.E242D	EIF4G3_ENST00000374937.3_Missense_Mutation_p.E248D|EIF4G3_ENST00000602326.1_Missense_Mutation_p.E248D|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E242D|EIF4G3_ENST00000374933.3_5'Flank|EIF4G3_ENST00000374935.3_Intron|EIF4G3_ENST00000356916.3_Missense_Mutation_p.E253D|EIF4G3_ENST00000544689.1_5'Flank|EIF4G3_ENST00000536266.1_5'UTR|EIF4G3_ENST00000374927.4_Missense_Mutation_p.E242D	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	242					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GTTCTTTCTTCTCTCCACTGA	0.438																																							uc001bec.2		NA																	0				skin(1)	1						c.(724-726)GAG>GAC		eukaryotic translation initiation factor 4							126.0	133.0	131.0					1																	21268753		2203	4300	6503	SO:0001583	missense	8672				interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity	g.chr1:21268753C>G	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.726G>C	1.37:g.21268753C>G	ENSP00000264211:p.Glu242Asp		Somatic				EIF4G3_uc010odi.1_5'UTR|EIF4G3_uc010odj.1_Missense_Mutation_p.E241D|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Missense_Mutation_p.E242D|EIF4G3_uc001bef.2_Missense_Mutation_p.E241D|EIF4G3_uc001bee.2_Missense_Mutation_p.E248D|EIF4G3_uc001beg.2_Missense_Mutation_p.E241D|EIF4G3_uc010odk.1_Missense_Mutation_p.E242D|EIF4G3_uc001beh.2_Missense_Mutation_p.E253D	p.E242D	NM_003760	NP_003751	WXS	Illumina HiSeq	Unspecified	O43432	IF4G3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)	9	982	-		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)	242					B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	c.726G>C	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883846	0.51908	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374937;ENST00000356916;ENST00000374927;ENST00000537059	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.96	2.67	0.31697	.	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	N	0.19112	0.55	0.41124	D	0.985838	D;D;D;D;D	0.69078	0.997;0.993;0.996;0.993;0.994	D;D;D;D;D	0.77557	0.99;0.93;0.987;0.93;0.97	T	0.05500	-1.0881	10	0.45353	T	0.12	-18.2169	11.0663	0.47976	0.0:0.7728:0.0:0.2272	.	242;437;368;248;242	B4DXR2;Q59GJ0;B1AN89;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	D	242;438;242;248;368;242;253	ENSP00000264211:E242D;ENSP00000383274:E242D;ENSP00000364073:E248D;ENSP00000364062:E242D	ENSP00000264211:E242D	E	-	3	2	EIF4G3	21141340	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.426000	0.34870	0.861000	0.35504	0.655000	0.94253	GAG		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760		3	122	0	0	0	6.4e-05	0	3	122				
USP24	23358	broad.mit.edu	37	1	55548983	55548983	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:55548983T>A	ENST00000294383.6	-	58	6936	c.6937A>T	c.(6937-6939)Atc>Ttc	p.I2313F	USP24_ENST00000407756.1_Missense_Mutation_p.I2153F	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2313					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AGGAAGCTGATCATGTGCCGC	0.428																																							uc001cyg.3		NA																	0				ovary(6)|kidney(6)|breast(1)	13						c.(6457-6459)ATC>TTC		ubiquitin specific protease 24							88.0	88.0	88.0					1																	55548983		1936	4154	6090	SO:0001583	missense	23358				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:55548983T>A	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6937A>T	1.37:g.55548983T>A	ENSP00000294383:p.Ile2313Phe		Somatic					p.I2153F	NM_015306	NP_056121	WXS	Illumina HiSeq	Unspecified	Q9UPU5	UBP24_HUMAN			55	6457	-			2313					Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	c.6457A>T	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688378	0.48097	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02837	4.14;4.15	5.84	1.06	0.20224	.	0.270973	0.36628	N	0.002500	T	0.02418	0.0074	N	0.22421	0.69	0.36679	D	0.878964	B	0.19583	0.037	B	0.18263	0.021	T	0.48007	-0.9072	10	0.52906	T	0.07	.	10.3967	0.44205	0.0:0.3215:0.0:0.6785	.	2153	B7WPF4	.	F	2313;2153	ENSP00000294383:I2313F;ENSP00000385700:I2153F	ENSP00000294383:I2313F	I	-	1	0	USP24	55321571	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	1.592000	0.36676	0.139000	0.18822	-0.280000	0.10049	ATC		0.428	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			5	34	0	0	0	0.000602214	0	5	34				
TMEM56	148534	broad.mit.edu	37	1	95615786	95615786	+	Missense_Mutation	SNP	G	G	A	rs147035436		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:95615786G>A	ENST00000370203.4	+	4	559	c.268G>A	c.(268-270)Gtg>Atg	p.V90M	RP11-57H12.6_ENST00000604534.1_Missense_Mutation_p.V90M	NM_001199679.1|NM_152487.2	NP_001186608.1|NP_689700.1	Q96MV1	TMM56_HUMAN	transmembrane protein 56	90	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	12		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.133)		ACTTGCAAACGTGAATATTGC	0.333													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15717	0.0		0.0	False		,,,				2504	0.0						uc001drb.2		NA																	0					0						c.(268-270)GTG>ATG		transmembrane protein 56		G	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	182.0	159.0	167.0		268,268,268	-1.0	0.0	1	dbSNP_134	167	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	TMEM56,TMEM56-RWDD3	NM_001199679.1,NM_001199691.1,NM_152487.2	21,21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	90/264,90/202,90/264	95615786	1,13005	2203	4300	6503	SO:0001583	missense	148534					integral to membrane		g.chr1:95615786G>A		CCDS753.1	1p21.3	2008-02-05			ENSG00000152078	ENSG00000152078			26477	protein-coding gene	gene with protein product							Standard	NM_152487		Approved	FLJ31842	uc001drb.3	Q96MV1	OTTHUMG00000010847	ENST00000370203.4:c.268G>A	1.37:g.95615786G>A	ENSP00000359222:p.Val90Met		Somatic				RWDD3_uc001drd.3_Missense_Mutation_p.V90M|TMEM56_uc001drc.2_Missense_Mutation_p.V90M	p.V90M	NM_152487	NP_689700	WXS	Illumina HiSeq	Unspecified	Q96MV1	TMM56_HUMAN		all cancers(265;0.133)	4	559	+		all_lung(203;0.0232)|Lung NSC(277;0.0739)	90			TLC.|Helical; (Potential).		B2RPI2|D3DT48	Missense_Mutation	SNP	ENST00000370203.4	37	c.268G>A	CCDS753.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454415	0.43634	0.0	1.16E-4	ENSG00000152078	ENST00000370203;ENST00000456991;ENST00000455656	D;D;D	0.85411	-1.98;-1.98;-1.98	5.44	-0.956	0.10353	TRAM/LAG1/CLN8 homology domain (3);	0.382752	0.27227	N	0.020329	T	0.46776	0.1410	N	0.12887	0.27	0.26670	N	0.971749	B;B	0.33964	0.381;0.434	B;B	0.31442	0.129;0.13	T	0.26677	-1.0096	9	0.23302	T	0.38	-0.8119	6.9415	0.24496	0.2825:0.4946:0.2229:0.0	.	90;90	C9JJM2;Q96MV1	.;TMM56_HUMAN	M	90	ENSP00000359222:V90M;ENSP00000395364:V90M;ENSP00000417043:V90M	ENSP00000359222:V90M	V	+	1	0	TMEM56	95388374	0.002000	0.14202	0.045000	0.18777	0.414000	0.31173	-0.058000	0.11750	-0.130000	0.11599	0.591000	0.81541	GTG		0.333	TMEM56-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029935.1	NM_152487		6	33	0	0	0	0.000274275	0	6	33				
PHTF1	10745	broad.mit.edu	37	1	114255907	114255907	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:114255907G>A	ENST00000369604.1	-	8	1260	c.777C>T	c.(775-777)tgC>tgT	p.C259C	PHTF1_ENST00000393357.2_Silent_p.C259C|PHTF1_ENST00000447664.2_Intron|PHTF1_ENST00000369598.1_Silent_p.C214C|PHTF1_ENST00000357783.2_Silent_p.C259C|PHTF1_ENST00000369600.1_Silent_p.C206C|PHTF1_ENST00000369596.2_Silent_p.C206C|PHTF1_ENST00000474926.1_5'UTR			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	259					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTACCCTACGGCACTTTTCTC	0.363																																							uc009wgp.1		NA																	0				ovary(1)	1						c.(775-777)TGC>TGT		putative homeodomain transcription factor 1							152.0	152.0	152.0					1																	114255907		2203	4300	6503	SO:0001819	synonymous_variant	10745					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:114255907G>A	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.777C>T	1.37:g.114255907G>A			Somatic				PHTF1_uc001edn.2_Silent_p.C259C|PHTF1_uc010own.1_Silent_p.C259C|PHTF1_uc001edm.2_Silent_p.C16C|PHTF1_uc001edo.1_Silent_p.C16C	p.C259C	NM_006608	NP_006599	WXS	Illumina HiSeq	Unspecified	Q9UMS5	PHTF1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	7	1229	-	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)	259					Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Silent	SNP	ENST00000369604.1	37	c.777C>T	CCDS861.1	.	.	.	.	.	.	.	.	.	.	G	6.755	0.508227	0.12883	.	.	ENSG00000116793	ENST00000412670	.	.	.	5.55	-2.47	0.06442	.	.	.	.	.	T	0.09379	0.0231	.	.	.	0.19575	N	0.999967	.	.	.	.	.	.	T	0.36432	-0.9748	4	.	.	.	-0.0056	5.6209	0.17457	0.3757:0.0:0.4728:0.1515	.	.	.	.	V	15	.	.	A	-	2	0	PHTF1	114057430	0.001000	0.12720	0.017000	0.16124	0.928000	0.56348	-0.190000	0.09615	-0.282000	0.09128	-0.363000	0.07495	GCC		0.363	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608		30	50	0	0	0	0.000491102	0	30	50				
NBPF10	100132406	broad.mit.edu	37	1	145302714	145302714	+	Silent	SNP	A	A	G	rs9424867	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:145302714A>G	ENST00000369339.3	+	5	592	c.339A>G	c.(337-339)ttA>ttG	p.L113L	NBPF10_ENST00000369338.1_Silent_p.L113L|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000342960.5_Silent_p.L384L			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	384						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L113L(3)|p.L384L(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGAGAAGTTACGGGAAGGGA	0.527																																							uc001end.3		NA																	6	Substitution - coding silent(6)		prostate(2)|kidney(2)|central_nervous_system(2)		0						c.(1150-1152)TTA>TTG		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145302714A>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.339A>G	1.37:g.145302714A>G			Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Silent_p.L113L	p.L384L	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	8	1187	+	all_hematologic(923;0.032)		Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000369339.3	37	c.1152A>G																																																																																					0.527	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		4	64	0	0	0	0.00024832	0	4	64				
C1orf56	54964	broad.mit.edu	37	1	151020753	151020753	+	Missense_Mutation	SNP	C	C	A	rs587603472	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:151020753C>A	ENST00000368926.5	+	1	538	c.430C>A	c.(430-432)Cag>Aag	p.Q144K		NM_017860.3	NP_060330.2	Q9BUN1	MENT_HUMAN	chromosome 1 open reading frame 56	144						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGCCAATAGTCAGGAGCCTGA	0.592											OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(146;891 3320 6873)	GBM(146;891 3320 6873)	uc001ewn.2		NA																	0					0						c.(430-432)CAG>AAG		hypothetical protein LOC54964 precursor							40.0	41.0	41.0					1																	151020753		2203	4300	6503	SO:0001583	missense	54964					extracellular region		g.chr1:151020753C>A	BC002469	CCDS980.1	1q21.2	2013-09-20			ENSG00000143443	ENSG00000143443			26045	protein-coding gene	gene with protein product	"""methylated in normal thymocytes"""					12975309, 22133874	Standard	NM_017860		Approved	FLJ20519, MENT	uc001ewn.3	Q9BUN1	OTTHUMG00000035159	ENST00000368926.5:c.430C>A	1.37:g.151020753C>A	ENSP00000357922:p.Gln144Lys		Somatic	OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1737		p.Q144K	NM_017860	NP_060330	WXS	Illumina HiSeq	Unspecified	Q9BUN1	CA056_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		1	495	+	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		144					B2RDU8|Q9NWZ4	Missense_Mutation	SNP	ENST00000368926.5	37	c.430C>A	CCDS980.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.304315	0.60305	.	.	ENSG00000143443	ENST00000368926;ENST00000433087	.	.	.	4.32	3.39	0.38822	.	0.142709	0.32444	N	0.006096	T	0.15609	0.0376	L	0.34521	1.04	0.09310	N	1	B	0.27882	0.192	B	0.27170	0.077	T	0.12967	-1.0527	9	0.87932	D	0	-31.5579	9.7132	0.40258	0.2065:0.7935:0.0:0.0	.	144	Q9BUN1	CA056_HUMAN	K	144	.	ENSP00000357922:Q144K	Q	+	1	0	C1orf56	149287377	0.866000	0.29940	0.041000	0.18516	0.020000	0.10135	1.931000	0.40134	1.379000	0.46325	-0.188000	0.12872	CAG		0.592	C1orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085101.1	NM_017860		16	38	1	0	3.45872e-05	0.000422831	0.000225607	16	38				
TCHHL1	126637	broad.mit.edu	37	1	152058248	152058248	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:152058248C>A	ENST00000368806.1	-	3	1974	c.1910G>T	c.(1909-1911)gGc>gTc	p.G637V		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	637							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GGTCCCTGGGCCTTGATTCTT	0.542																																							uc001ezo.1		NA																	0				ovary(1)|skin(1)	2						c.(1909-1911)GGC>GTC		trichohyalin-like 1							127.0	119.0	122.0					1																	152058248		2203	4300	6503	SO:0001583	missense	126637						calcium ion binding	g.chr1:152058248C>A		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1910G>T	1.37:g.152058248C>A	ENSP00000357796:p.Gly637Val		Somatic					p.G637V	NM_001008536	NP_001008536	WXS	Illumina HiSeq	Unspecified	Q5QJ38	TCHL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.246)		3	1975	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		637					B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	37	c.1910G>T	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	16.22	3.061067	0.55432	.	.	ENSG00000182898	ENST00000368806	T	0.25085	1.82	4.32	3.4	0.38934	.	0.203061	0.24700	N	0.036302	T	0.25232	0.0613	L	0.55481	1.735	0.34799	D	0.736572	D	0.69078	0.997	D	0.66196	0.942	T	0.04373	-1.0956	10	0.28530	T	0.3	-2.1849	8.8347	0.35104	0.0:0.8912:0.0:0.1088	.	637	Q5QJ38	TCHL1_HUMAN	V	637	ENSP00000357796:G637V	ENSP00000357796:G637V	G	-	2	0	TCHHL1	150324872	0.335000	0.24748	0.185000	0.23176	0.253000	0.25986	0.496000	0.22499	1.141000	0.42275	0.650000	0.86243	GGC		0.542	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104		29	76	1	0	1.12875e-08	0.00106085	8.19461e-08	29	76				
RPTN	126638	broad.mit.edu	37	1	152127903	152127904	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:152127903_152127904GG>TT	ENST00000316073.3	-	3	1735_1736	c.1671_1672CC>AA	c.(1669-1674)tcCCac>tcAAac	p.H558N		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	558	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.S557S(1)|p.H558D(1)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TGACCGTAGTGGGAACTCTGGC	0.51																																							uc001ezs.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(1669-1674)TCCCAC>TCAAAC		repetin																																				SO:0001583	missense	126638					proteinaceous extracellular matrix	calcium ion binding	g.chr1:152127903_152127904GG>TT	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1671_1672delinsTT	1.37:g.152127903_152127904delinsTT	ENSP00000317895:p.His558Asn		Somatic					p.H558N	NM_001122965	NP_001116437	WXS	Illumina HiSeq	Unspecified	Q6XPR3	RPTN_HUMAN			3	1736_1737	-			558			Gln-rich.		B7ZBZ3	Missense_Mutation	DNP	ENST00000316073.3	37	c.1671_1672CC>AA	CCDS41397.1																																																																																				0.510	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312		15	842	0	0	0	6.4e-05	0	15	842				
CRNN	49860	broad.mit.edu	37	1	152382356	152382356	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:152382356C>T	ENST00000271835.3	-	3	1264	c.1202G>A	c.(1201-1203)gGa>gAa	p.G401E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	401					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCTGTCCTCCCGGTACTGT	0.612																																							uc001ezx.2		NA																	0				ovary(2)|skin(1)	3						c.(1201-1203)GGA>GAA		cornulin							97.0	79.0	85.0					1																	152382356		2203	4300	6503	SO:0001583	missense	49860				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding	g.chr1:152382356C>T	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1202G>A	1.37:g.152382356C>T	ENSP00000271835:p.Gly401Glu		Somatic					p.G401E	NM_016190	NP_057274	WXS	Illumina HiSeq	Unspecified	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1276	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		401					B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	c.1202G>A	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	7.096	0.573214	0.13623	.	.	ENSG00000143536	ENST00000271835	T	0.04454	3.62	5.01	-0.419	0.12340	.	0.658669	0.14113	N	0.340595	T	0.01029	0.0034	L	0.37850	1.14	0.09310	N	1	B	0.21606	0.058	B	0.22152	0.038	T	0.47420	-0.9119	10	0.32370	T	0.25	.	0.8839	0.01240	0.1644:0.3987:0.1598:0.2771	.	401	Q9UBG3	CRNN_HUMAN	E	401	ENSP00000271835:G401E	ENSP00000271835:G401E	G	-	2	0	CRNN	150648980	0.000000	0.05858	0.030000	0.17652	0.329000	0.28539	-0.478000	0.06575	0.272000	0.22027	0.585000	0.79938	GGA		0.612	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190		29	58	0	0	0	0.000339439	0	29	58				
NPR1	4881	broad.mit.edu	37	1	153655879	153655879	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:153655879C>A	ENST00000368680.3	+	6	1763	c.1291C>A	c.(1291-1293)Caa>Aaa	p.Q431K		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	431					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TGGGACTTCCCAAGAGCTGGT	0.592																																					Pancreas(141;1349 1870 15144 15830 40702)	Pancreas(141;1349 1870 15144 15830 40702)	uc001fcs.3		NA																	0				ovary(3)|lung(2)|stomach(1)|breast(1)	7						c.(1291-1293)CAA>AAA		natriuretic peptide receptor 1 precursor	Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)						72.0	61.0	65.0					1																	153655879		2203	4300	6503	SO:0001583	missense	4881				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity	g.chr1:153655879C>A	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1291C>A	1.37:g.153655879C>A	ENSP00000357669:p.Gln431Lys		Somatic				NPR1_uc010pdz.1_Missense_Mutation_p.Q177K|NPR1_uc010pea.1_5'Flank	p.Q431K	NM_000906	NP_000897	WXS	Illumina HiSeq	Unspecified	P16066	ANPRA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		6	1712	+	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		431			Extracellular (Potential).		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	c.1291C>A	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	C	5.332	0.246587	0.10130	.	.	ENSG00000169418	ENST00000368680	T	0.73047	-0.71	5.29	2.06	0.26882	.	0.310698	0.29964	N	0.010741	T	0.20373	0.0490	N	0.10733	0.035	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33828	-0.9853	10	0.02654	T	1	.	8.0725	0.30697	0.435:0.4202:0.1448:0.0	.	431	P16066	ANPRA_HUMAN	K	431	ENSP00000357669:Q431K	ENSP00000357669:Q431K	Q	+	1	0	NPR1	151922503	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	1.190000	0.32126	0.658000	0.30925	0.655000	0.94253	CAA		0.592	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906		15	25	1	0	3.45872e-05	0.000422831	0.000225607	15	25				
SYT11	23208	broad.mit.edu	37	1	155838433	155838433	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:155838433C>A	ENST00000368324.4	+	2	965	c.712C>A	c.(712-714)Cag>Aag	p.Q238K	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	238	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CAGCCAGCTGCAGGACCTGGT	0.587																																							uc001fmg.2		NA																	0				ovary(1)|skin(1)	2						c.(712-714)CAG>AAG		synaptotagmin XI							95.0	73.0	81.0					1																	155838433		2203	4300	6503	SO:0001583	missense	23208					cell junction|synaptic vesicle membrane	protein binding|transporter activity	g.chr1:155838433C>A	D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.712C>A	1.37:g.155838433C>A	ENSP00000357307:p.Gln238Lys		Somatic				SYT11_uc010pgq.1_Intron	p.Q238K	NM_152280	NP_689493	WXS	Illumina HiSeq	Unspecified	Q9BT88	SYT11_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.000162)		2	975	+	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		238			Cytoplasmic (Potential).|C2 1.		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	ENST00000368324.4	37	c.712C>A	CCDS1122.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759449	0.69763	.	.	ENSG00000132718	ENST00000368324	T	0.69435	-0.4	5.97	5.97	0.96955	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.132226	0.53938	D	0.000060	T	0.54175	0.1842	L	0.51422	1.61	0.80722	D	1	P	0.37914	0.611	B	0.35182	0.197	T	0.58983	-0.7539	10	0.48119	T	0.1	.	20.0189	0.97489	0.0:1.0:0.0:0.0	.	238	Q9BT88	SYT11_HUMAN	K	238	ENSP00000357307:Q238K	ENSP00000357307:Q238K	Q	+	1	0	SYT11	154105057	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.151000	0.50670	2.828000	0.97474	0.655000	0.94253	CAG		0.587	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280		18	39	1	0	1.67942e-08	0.00074312	1.21239e-07	18	39				
PYHIN1	149628	broad.mit.edu	37	1	158914690	158914690	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:158914690G>A	ENST00000368140.1	+	7	1462	c.1217G>A	c.(1216-1218)aGc>aAc	p.S406N	PYHIN1_ENST00000368138.3_Missense_Mutation_p.S397N|PYHIN1_ENST00000392252.3_Missense_Mutation_p.S397N|PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392254.2_Missense_Mutation_p.S406N	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	406					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AACCAGAGAAGCCATGACTCC	0.388																																							uc001ftb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1216-1218)AGC>AAC		pyrin and HIN domain family, member 1 alpha 1							76.0	74.0	75.0					1																	158914690		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158914690G>A	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1217G>A	1.37:g.158914690G>A	ENSP00000357122:p.Ser406Asn		Somatic				PYHIN1_uc001ftc.2_Missense_Mutation_p.S397N|PYHIN1_uc001ftd.2_Missense_Mutation_p.S406N|PYHIN1_uc001fte.2_Missense_Mutation_p.S397N	p.S406N	NM_152501	NP_689714	WXS	Illumina HiSeq	Unspecified	Q6K0P9	IFIX_HUMAN			7	1462	+	all_hematologic(112;0.0378)		406					Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.1217G>A	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.342378	0.00222	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.05139	3.49;3.49;3.51;3.51	2.19	1.04	0.20106	.	.	.	.	.	T	0.00552	0.0018	N	0.04203	-0.255	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.47169	-0.9138	9	0.02654	T	1	.	3.6282	0.08121	0.7816:0.0:0.2184:0.0	.	397;406;397;406	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	N	406;397;406;397	ENSP00000357122:S406N;ENSP00000357120:S397N;ENSP00000376083:S406N;ENSP00000376082:S397N	ENSP00000357120:S397N	S	+	2	0	PYHIN1	157181314	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.162000	0.16501	0.286000	0.22352	-0.350000	0.07774	AGC		0.388	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		6	56	0	0	0	0.00116845	0	6	56				
OR10J3	441911	broad.mit.edu	37	1	159284209	159284209	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:159284209G>T	ENST00000332217.5	-	1	240	c.241C>A	c.(241-243)Cat>Aat	p.H81N		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GAAAGCATATGGGGAATGATG	0.493																																							uc010piu.1		NA																	0				ovary(2)	2						c.(241-243)CAT>AAT		olfactory receptor, family 10, subfamily J,							150.0	143.0	145.0					1																	159284209		2203	4300	6503	SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159284209G>T		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.241C>A	1.37:g.159284209G>T	ENSP00000331789:p.His81Asn		Somatic					p.H81N	NM_001004467	NP_001004467	WXS	Illumina HiSeq	Unspecified	Q5JRS4	O10J3_HUMAN			1	241	-	all_hematologic(112;0.0429)		81			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000332217.5	37	c.241C>A	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	1.835	-0.468881	0.04445	.	.	ENSG00000196266	ENST00000332217	T	0.00382	7.61	5.3	-0.363	0.12556	GPCR, rhodopsin-like superfamily (1);	1.580210	0.04557	U	0.390859	T	0.00039	0.0001	N	0.00483	-1.445	0.09310	N	1	B	0.18741	0.03	B	0.22386	0.039	T	0.19844	-1.0293	10	0.48119	T	0.1	.	5.0202	0.14358	0.2262:0.0:0.4389:0.3349	.	81	Q5JRS4	O10J3_HUMAN	N	81	ENSP00000331789:H81N	ENSP00000331789:H81N	H	-	1	0	OR10J3	157550833	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.393000	0.07305	-0.475000	0.06852	-1.134000	0.01955	CAT		0.493	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			40	84	1	0	9.39024e-22	0.000437636	9.00482e-21	40	84				
DEDD	9191	broad.mit.edu	37	1	161092140	161092140	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:161092140C>T	ENST00000368006.3	-	6	968	c.754G>A	c.(754-756)Gag>Aag	p.E252K	NIT1_ENST00000368008.1_Intron|DEDD_ENST00000392188.1_Missense_Mutation_p.E282K|DEDD_ENST00000545495.1_Missense_Mutation_p.E252K|DEDD_ENST00000368005.1_Missense_Mutation_p.E282K|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000490843.2_Missense_Mutation_p.E252K|DEDD_ENST00000458050.2_Missense_Mutation_p.E252K	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	252					decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TAGGTGAGCTCAGAGAACTTG	0.517																																							uc001fxz.2		NA																	0					0						c.(754-756)GAG>AAG		death effector domain-containing protein							152.0	139.0	144.0					1																	161092140		2203	4300	6503	SO:0001583	missense	9191				apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr1:161092140C>T	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.754G>A	1.37:g.161092140C>T	ENSP00000356985:p.Glu252Lys		Somatic				NIT1_uc001fxw.2_Intron|DEDD_uc009wty.2_Missense_Mutation_p.E282K|DEDD_uc001fya.2_Missense_Mutation_p.E252K|DEDD_uc001fyb.2_Missense_Mutation_p.E252K|DEDD_uc010pkb.1_Missense_Mutation_p.E209K|DEDD_uc001fyc.2_Missense_Mutation_p.E92K	p.E252K	NM_001039712	NP_001034801	WXS	Illumina HiSeq	Unspecified	O75618	DEDD_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00165)		6	927	-	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		252					D3DVF5|O60737	Missense_Mutation	SNP	ENST00000368006.3	37	c.754G>A	CCDS1219.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903414	0.92035	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.72803	0.3506	M	0.66939	2.045	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.993	D;D;D	0.80764	0.994;0.967;0.968	T	0.72789	-0.4187	9	0.51188	T	0.08	.	16.4462	0.83935	0.0:1.0:0.0:0.0	.	209;282;252	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	K	252;282;252;252;252;282;209	.	ENSP00000356984:E282K	E	-	1	0	DEDD	159358764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.647000	0.83462	2.735000	0.93741	0.655000	0.94253	GAG		0.517	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080582.1	NM_004216		10	93	0	0	0	0.00185496	0	10	93				
RASAL2	9462	broad.mit.edu	37	1	178426849	178426849	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:178426849G>T	ENST00000462775.1	+	12	2124	c.1999G>T	c.(1999-2001)Gac>Tac	p.D667Y	RASAL2_ENST00000448150.3_Missense_Mutation_p.D797Y|RASAL2_ENST00000367649.3_Missense_Mutation_p.D808Y	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	667					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TCCAAGCCAGGACAACACAGA	0.408																																							uc001glr.2		NA																	0				ovary(2)|breast(2)|large_intestine(1)	5						c.(1999-2001)GAC>TAC		RAS protein activator like 2 isoform 1							86.0	79.0	81.0					1																	178426849		2203	4300	6503	SO:0001583	missense	9462				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr1:178426849G>T	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1999G>T	1.37:g.178426849G>T	ENSP00000420558:p.Asp667Tyr		Somatic				RASAL2_uc001glq.2_Missense_Mutation_p.D808Y|RASAL2_uc009wxc.2_Missense_Mutation_p.D181Y	p.D667Y	NM_004841	NP_004832	WXS	Illumina HiSeq	Unspecified	Q9UJF2	NGAP_HUMAN			12	2124	+			667					F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	c.1999G>T	CCDS1322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.24|18.24	3.581286|3.581286	0.65992|0.65992	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.12774|.	2.65;2.65;2.65|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.152200|.	0.46145|.	D|.	0.000308|.	T|T	0.59128|0.59128	0.2171|0.2171	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999998|0.999998	P;P;P|.	0.51537|.	0.801;0.797;0.946|.	P;P;P|.	0.53809|.	0.557;0.603;0.735|.	T|T	0.52555|0.52555	-0.8560|-0.8560	10|5	0.66056|.	D|.	0.02|.	.|.	19.5444|19.5444	0.95285|0.95285	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	797;667;808|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	Y|V	797;808;667|217	ENSP00000407768:D797Y;ENSP00000356621:D808Y;ENSP00000420558:D667Y|.	ENSP00000356621:D808Y|.	D|G	+|+	1|2	0|0	RASAL2|RASAL2	176693472|176693472	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.121000|7.121000	0.77160|0.77160	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GAC|GGA		0.408	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		23	51	1	0	1.10923e-09	0.000375601	8.33545e-09	23	51				
HMCN1	83872	broad.mit.edu	37	1	186064585	186064585	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:186064585G>T	ENST00000271588.4	+	68	10734	c.10505G>T	c.(10504-10506)gGa>gTa	p.G3502V	HMCN1_ENST00000367492.2_Missense_Mutation_p.G3502V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3502	Ig-like C2-type 33.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAAGATTCGGGAAAGTACACC	0.478																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(10504-10506)GGA>GTA		hemicentin 1 precursor							98.0	89.0	92.0					1																	186064585		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186064585G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10505G>T	1.37:g.186064585G>T	ENSP00000271588:p.Gly3502Val		Somatic					p.G3502V	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			68	10734	+			3502			Ig-like C2-type 33.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.10505G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295260	0.60086	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.81247	-1.47;-1.47	5.17	5.17	0.71159	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.157611	0.56097	D	0.000026	D	0.93822	0.8024	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95827	0.8855	10	0.72032	D	0.01	.	14.3501	0.66694	0.0:0.1481:0.8519:0.0	.	3502	Q96RW7	HMCN1_HUMAN	V	3502	ENSP00000271588:G3502V;ENSP00000356462:G3502V	ENSP00000271588:G3502V	G	+	2	0	HMCN1	184331208	1.000000	0.71417	0.651000	0.29564	0.545000	0.35147	7.508000	0.81686	2.389000	0.81357	0.555000	0.69702	GGA		0.478	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		26	67	1	0	1.7881e-09	0.001512	1.33588e-08	26	67				
ASPM	259266	broad.mit.edu	37	1	197069976	197069976	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:197069976C>A	ENST00000367409.4	-	18	8661	c.8405G>T	c.(8404-8406)gGc>gTc	p.G2802V	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2802					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACAAGCAAGGCCAGAAGCTTT	0.383																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(8404-8406)GGC>GTC		asp (abnormal spindle)-like, microcephaly							136.0	136.0	136.0					1																	197069976		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197069976C>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8405G>T	1.37:g.197069976C>A	ENSP00000356379:p.Gly2802Val		Somatic				ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Missense_Mutation_p.G650V	p.G2802V	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			18	8662	-			2802					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.8405G>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	1.014	-0.686826	0.03328	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.56444	0.46	3.83	-4.27	0.03744	.	2.202550	0.02189	N	0.061226	T	0.41190	0.1148	N	0.08118	0	0.09310	N	1	D;B	0.69078	0.997;0.243	P;B	0.59288	0.855;0.065	T	0.38134	-0.9675	10	0.16420	T	0.52	.	4.6587	0.12632	0.2904:0.5058:0.0868:0.117	.	788;2802	E7EQ84;Q8IZT6	.;ASPM_HUMAN	V	2802;788	ENSP00000356379:G2802V	ENSP00000356376:G788V	G	-	2	0	ASPM	195336599	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-0.533000	0.06157	-0.491000	0.06697	-0.502000	0.04539	GGC		0.383	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		47	114	1	0	1.81118e-26	0.000781405	1.79028e-25	47	114				
PTPRC	5788	broad.mit.edu	37	1	198685924	198685924	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:198685924C>A	ENST00000367376.2	+	13	1570	c.1399C>A	c.(1399-1401)Cgt>Agt	p.R467S	PTPRC_ENST00000348564.6_Missense_Mutation_p.R308S|PTPRC_ENST00000594404.1_Missense_Mutation_p.R306S|PTPRC_ENST00000442510.2_Missense_Mutation_p.R469S|PTPRC_ENST00000352140.3_Missense_Mutation_p.R419S	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	467	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R467C(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AAAAGTGCAACGTAATGGAAG	0.308																																							uc001gur.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(1399-1401)CGT>AGT		protein tyrosine phosphatase, receptor type, C							86.0	89.0	88.0					1																	198685924		2202	4300	6502	SO:0001583	missense	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198685924C>A	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1399C>A	1.37:g.198685924C>A	ENSP00000356346:p.Arg467Ser		Somatic				PTPRC_uc001gus.1_Missense_Mutation_p.R419S|PTPRC_uc001gut.1_Missense_Mutation_p.R306S|PTPRC_uc009wzf.1_Missense_Mutation_p.R355S|PTPRC_uc010ppg.1_Missense_Mutation_p.R403S	p.R467S	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			13	1579	+			467			Extracellular (Potential).|Fibronectin type-III 1.		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37	c.1399C>A		.	.	.	.	.	.	.	.	.	.	C	15.02	2.709769	0.48517	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.53423	0.62	4.43	3.5	0.40072	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000151	T	0.55273	0.1910	M	0.64404	1.975	0.09310	N	1	D;D;D;D;D	0.61080	0.988;0.977;0.977;0.977;0.989	P;P;P;P;P	0.60286	0.841;0.872;0.629;0.721;0.833	T	0.46119	-0.9214	10	0.14656	T	0.56	.	10.1512	0.42794	0.1974:0.8026:0.0:0.0	.	403;403;308;419;467	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	S	469;403;419;419;353;467;401;306	ENSP00000193532:R419S	ENSP00000306782:R306S	R	+	1	0	PTPRC	196952547	0.350000	0.24878	0.049000	0.19019	0.002000	0.02628	1.667000	0.37471	1.426000	0.47256	0.650000	0.86243	CGT		0.308	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				16	37	1	0	0.000422831	0.000422831	0.00262482	16	37				
CNTN2	6900	broad.mit.edu	37	1	205033553	205033553	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:205033553C>T	ENST00000331830.4	+	11	1628	c.1344C>T	c.(1342-1344)gcC>gcT	p.A448A	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	448	Ig-like C2-type 5.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTCCAAAGGCCGTGGTGCTCT	0.637																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	0				ovary(1)	1						c.(1342-1344)GCC>GCT		contactin 2 precursor							87.0	102.0	97.0					1																	205033553		2203	4300	6503	SO:0001819	synonymous_variant	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205033553C>T	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1344C>T	1.37:g.205033553C>T			Somatic				CNTN2_uc001hbq.1_Silent_p.A339A|CNTN2_uc001hbs.2_Silent_p.A236A	p.A448A	NM_005076	NP_005067	WXS	Illumina HiSeq	Unspecified	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		11	1613	+	all_cancers(21;0.144)|Breast(84;0.0437)		448			Ig-like C2-type 5.		P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	c.1344C>T	CCDS1449.1																																																																																				0.637	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		38	104	0	0	0	0.00170553	0	38	104				
MFSD4	148808	broad.mit.edu	37	1	205550012	205550012	+	Missense_Mutation	SNP	G	G	T	rs200281728		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:205550012G>T	ENST00000367147.4	+	3	746	c.653G>T	c.(652-654)cGa>cTa	p.R218L	MFSD4_ENST00000539267.1_Missense_Mutation_p.R218L|MFSD4_ENST00000536357.1_Intron	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	218					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GCAGGGACCCGAGTGTCCTAT	0.607																																							uc001hcv.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(652-654)CGA>CTA		major facilitator superfamily domain containing							64.0	49.0	54.0					1																	205550012		2203	4300	6503	SO:0001583	missense	148808				transmembrane transport	integral to membrane		g.chr1:205550012G>T	BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.653G>T	1.37:g.205550012G>T	ENSP00000356115:p.Arg218Leu		Somatic				MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_RNA|MFSD4_uc010prm.1_Missense_Mutation_p.R163L	p.R218L	NM_181644	NP_857595	WXS	Illumina HiSeq	Unspecified	Q8N468	MFSD4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0908)		3	739	+	Breast(84;0.07)		218					B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Missense_Mutation	SNP	ENST00000367147.4	37	c.653G>T	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	G	7.409	0.634313	0.14322	.	.	ENSG00000174514	ENST00000367147;ENST00000539267	T;T	0.23348	1.92;1.91	4.87	-2.23	0.06930	Major facilitator superfamily domain, general substrate transporter (1);	0.618756	0.17762	N	0.162866	T	0.15003	0.0362	L	0.36672	1.1	0.09310	N	1	P;B	0.37038	0.579;0.441	B;B	0.32465	0.146;0.133	T	0.24764	-1.0151	10	0.21014	T	0.42	-30.1003	11.2368	0.48944	0.6775:0.0:0.3225:0.0	.	163;218	B7Z8X0;Q8N468	.;MFSD4_HUMAN	L	218	ENSP00000356115:R218L;ENSP00000445329:R218L	ENSP00000356115:R218L	R	+	2	0	MFSD4	203816635	0.001000	0.12720	0.003000	0.11579	0.950000	0.60333	0.134000	0.15932	-0.289000	0.09038	0.637000	0.83480	CGA		0.607	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644		15	23	1	0	4.14922e-12	0.000422831	3.39602e-11	15	23				
CENPF	1063	broad.mit.edu	37	1	214814317	214814317	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:214814317C>A	ENST00000366955.3	+	12	2804	c.2636C>A	c.(2635-2637)gCt>gAt	p.A879D		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGTTTTGTGGCTGAAACAAGT	0.408																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	0				ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(2635-2637)GCT>GAT		centromere protein F							54.0	55.0	55.0					1																	214814317		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214814317C>A	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.2636C>A	1.37:g.214814317C>A	ENSP00000355922:p.Ala879Asp		Somatic					p.A879D	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	12	2810	+			879			Potential.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.2636C>A	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.886345	0.33348	.	.	ENSG00000117724	ENST00000366955	T	0.03441	3.93	5.19	5.19	0.71726	.	0.211750	0.23896	N	0.043491	T	0.02848	0.0085	.	.	.	0.22710	N	0.998823	B	0.26672	0.156	B	0.26202	0.067	T	0.48269	-0.9050	9	0.12766	T	0.61	.	14.76	0.69600	0.1452:0.8548:0.0:0.0	.	879	P49454	CENPF_HUMAN	D	879	ENSP00000355922:A879D	ENSP00000355922:A879D	A	+	2	0	CENPF	212880940	0.987000	0.35691	0.993000	0.49108	0.995000	0.86356	1.651000	0.37302	2.577000	0.86979	0.609000	0.83330	GCT		0.408	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		6	80	1	0	0.00116845	0.00116845	0.00711589	6	80				
CENPF	1063	broad.mit.edu	37	1	214832299	214832299	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:214832299C>T	ENST00000366955.3	+	19	9237	c.9069C>T	c.(9067-9069)tcC>tcT	p.S3023S		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	3119	Sufficient for centromere localization.|Sufficient for nuclear localization.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TAGCGCTATCCCCACTGAGTC	0.522											OREG0014250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	0				ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(9067-9069)TCC>TCT		centromere protein F							107.0	107.0	107.0					1																	214832299		2203	4300	6503	SO:0001819	synonymous_variant	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214832299C>T	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.9069C>T	1.37:g.214832299C>T			Somatic	OREG0014250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2224		p.S3023S	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	19	9243	+			3119					Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	c.9069C>T	CCDS31023.1																																																																																				0.522	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		36	83	0	0	0	0.000814825	0	36	83				
RYR2	6262	broad.mit.edu	37	1	237777844	237777844	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:237777844G>T	ENST00000366574.2	+	37	5733	c.5416G>T	c.(5416-5418)Gcc>Tcc	p.A1806S	RYR2_ENST00000542537.1_Missense_Mutation_p.A1790S|RYR2_ENST00000360064.6_Missense_Mutation_p.A1804S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1806	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGTCTTCATGCCCGGGACCC	0.468																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(5416-5418)GCC>TCC		cardiac muscle ryanodine receptor							186.0	176.0	179.0					1																	237777844		1935	4138	6073	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237777844G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5416G>T	1.37:g.237777844G>T	ENSP00000355533:p.Ala1806Ser		Somatic					p.A1806S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		37	5536	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1806			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.5416G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369125	0.24771	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73469	-0.75;-0.75;-0.75	5.62	5.62	0.85841	.	0.114917	0.37669	N	0.001982	T	0.58694	0.2140	N	0.19112	0.55	0.80722	D	1	B	0.22604	0.072	B	0.17979	0.02	T	0.54302	-0.8314	10	0.20519	T	0.43	.	12.9303	0.58282	0.0738:0.0:0.9262:0.0	.	1806	Q92736	RYR2_HUMAN	S	1806;1804;1790	ENSP00000355533:A1806S;ENSP00000353174:A1804S;ENSP00000443798:A1790S	ENSP00000353174:A1804S	A	+	1	0	RYR2	235844467	1.000000	0.71417	0.791000	0.31998	0.870000	0.49936	4.023000	0.57211	2.665000	0.90641	0.650000	0.86243	GCC		0.468	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		63	157	1	0	6.26901e-30	0.000781405	6.49652e-29	63	157				
RYR2	6262	broad.mit.edu	37	1	237947592	237947592	+	Nonsense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:237947592G>T	ENST00000366574.2	+	90	12897	c.12580G>T	c.(12580-12582)Gag>Tag	p.E4194*	RYR2_ENST00000542537.1_Nonsense_Mutation_p.E4178*|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Nonsense_Mutation_p.E4200*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4194					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAACTTCTGCGAGGACACCAT	0.512																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12580-12582)GAG>TAG		cardiac muscle ryanodine receptor							81.0	86.0	84.0					1																	237947592		2005	4184	6189	SO:0001587	stop_gained	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947592G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12580G>T	1.37:g.237947592G>T	ENSP00000355533:p.Glu4194*		Somatic				RYR2_uc010pya.1_Nonsense_Mutation_p.E609*	p.E4194*	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12700	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4194					Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	37	c.12580G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	54	22.088583	0.99945	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4843	0.95024	0.0:0.0:1.0:0.0	.	.	.	.	X	4194;4200;4178;1168	.	ENSP00000353174:E4200X	E	+	1	0	RYR2	236014215	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.813000	0.99286	2.610000	0.88304	0.655000	0.94253	GAG		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		35	99	1	0	9.45814e-24	0.000953801	9.13813e-23	35	99				
NLRP3	114548	broad.mit.edu	37	1	247588388	247588388	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:247588388G>T	ENST00000336119.3	+	3	2389	c.1643G>T	c.(1642-1644)gGg>gTg	p.G548V	NLRP3_ENST00000391828.3_Missense_Mutation_p.G548V|NLRP3_ENST00000366496.2_Missense_Mutation_p.G548V|NLRP3_ENST00000366497.2_Missense_Mutation_p.G548V|NLRP3_ENST00000348069.2_Missense_Mutation_p.G548V|NLRP3_ENST00000391827.2_Missense_Mutation_p.G548V|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	548					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.G548E(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AACGTTCCAGGGAGTCGTTTG	0.463																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1642-1644)GGG>GTG		NLR family, pyrin domain containing 3 isoform a							53.0	48.0	50.0					1																	247588388		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588388G>T	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1643G>T	1.37:g.247588388G>T	ENSP00000337383:p.Gly548Val		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.G548V|NLRP3_uc001icu.2_Missense_Mutation_p.G548V|NLRP3_uc001icw.2_Missense_Mutation_p.G548V|NLRP3_uc001icv.2_Missense_Mutation_p.G548V|NLRP3_uc010pyw.1_Missense_Mutation_p.G546V|NLRP3_uc001ict.1_Missense_Mutation_p.G546V	p.G548V	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1781	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	548					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.1643G>T	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	2.909	-0.225877	0.06022	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03	4.17	-8.33	0.00992	.	2.628540	0.00963	N	0.003123	D	0.83732	0.5318	L	0.34521	1.04	0.09310	N	0.999995	B;B;B;B;B	0.31599	0.036;0.142;0.33;0.169;0.005	B;B;B;B;B	0.35813	0.019;0.211;0.086;0.055;0.003	T	0.75972	-0.3129	10	0.23302	T	0.38	.	0.8206	0.01111	0.3154:0.3146:0.1579:0.212	.	548;548;548;548;548	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	V	548	ENSP00000375704:G548V;ENSP00000355453:G548V;ENSP00000337383:G548V;ENSP00000294752:G548V;ENSP00000355452:G548V;ENSP00000375703:G548V	ENSP00000337383:G548V	G	+	2	0	NLRP3	245655011	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.810000	0.00183	-2.010000	0.00953	0.655000	0.94253	GGG		0.463	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		21	38	1	0	1.96292e-10	0.00152264	1.53802e-09	21	38				
OR2T34	127068	broad.mit.edu	37	1	248737440	248737440	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:248737440A>T	ENST00000328782.2	-	1	640	c.619T>A	c.(619-621)Tgc>Agc	p.C207S		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGATGCAGCACAGGTACGTG	0.532																																							uc001iep.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(619-621)TGC>AGC		olfactory receptor, family 2, subfamily T,							199.0	214.0	209.0					1																	248737440		2107	4300	6407	SO:0001583	missense	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737440A>T	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.619T>A	1.37:g.248737440A>T	ENSP00000330904:p.Cys207Ser		Somatic					p.C207S	NM_001001821	NP_001001821	WXS	Illumina HiSeq	Unspecified	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	619	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		207			Helical; Name=5; (Potential).		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	c.619T>A	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	13.11	2.137834	0.37728	.	.	ENSG00000183310	ENST00000328782	T	0.00063	8.78	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.03194	-0.395	0.09310	N	1	P	0.50710	0.938	P	0.55303	0.773	T	0.52815	-0.8525	9	0.28530	T	0.3	.	5.0551	0.14529	0.847:0.0:0.153:0.0	.	207	Q8NGX1	O2T34_HUMAN	S	207	ENSP00000330904:C207S	ENSP00000330904:C207S	C	-	1	0	OR2T34	246804063	0.000000	0.05858	0.915000	0.36163	0.123000	0.20343	-0.484000	0.06528	0.964000	0.38108	0.104000	0.15600	TGC		0.532	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		21	354	0	0	0	0.000295444	0	21	354				
PGBD2	267002	broad.mit.edu	37	1	249211989	249211989	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr1:249211989C>A	ENST00000329291.5	+	3	1353	c.1206C>A	c.(1204-1206)gtC>gtA	p.V402V	PGBD2_ENST00000355360.4_Silent_p.V151V|PGBD2_ENST00000539153.1_Silent_p.V399V	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	402								p.V151V(1)|p.V402V(1)		NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATTACAAAGTCGATGAGAGTG	0.498																																							uc001ifh.2		NA																	2	Substitution - coding silent(2)		endometrium(2)	ovary(1)	1						c.(1204-1206)GTC>GTA		hypothetical protein LOC267002 isoform a							79.0	76.0	77.0					1																	249211989		2203	4300	6503	SO:0001819	synonymous_variant	267002							g.chr1:249211989C>A	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1206C>A	1.37:g.249211989C>A			Somatic				PGBD2_uc001ifg.2_Silent_p.V151V|PGBD2_uc009xhd.2_Silent_p.V399V	p.V402V	NM_170725	NP_733843	WXS	Illumina HiSeq	Unspecified	Q6P3X8	PGBD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		3	1353	+	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	402					B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	c.1206C>A	CCDS31128.1																																																																																				0.498	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			10	67	1	0	7.48243e-07	0.000442599	5.16931e-06	10	67				
FBXO18	84893	broad.mit.edu	37	10	5948591	5948591	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr10:5948591C>A	ENST00000362091.4	+	3	864	c.749C>A	c.(748-750)cCg>cAg	p.P250Q	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.P301Q	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	250					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						ATCAGTGACCCGCTGGTGAGT	0.498																																							uc001iis.2		NA																	0				ovary(2)|skin(1)	3						c.(748-750)CCG>CAG		F-box only protein, helicase, 18 isoform 2							57.0	53.0	54.0					10																	5948591		2203	4300	6503	SO:0001583	missense	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5948591C>A	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.749C>A	10.37:g.5948591C>A	ENSP00000355415:p.Pro250Gln		Somatic				FBXO18_uc001iir.2_Missense_Mutation_p.P176Q|FBXO18_uc009xig.2_Missense_Mutation_p.P176Q|FBXO18_uc001iit.2_Missense_Mutation_p.P301Q	p.P250Q	NM_178150	NP_835363	WXS	Illumina HiSeq	Unspecified	Q8NFZ0	FBX18_HUMAN			3	844	+			250					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	c.749C>A	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790910	0.50102	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	T;T	0.56776	0.44;0.44	5.69	5.69	0.88448	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.102662	0.64402	D	0.000002	T	0.71787	0.3381	M	0.75615	2.305	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74674	0.972;0.984;0.984	T	0.74047	-0.3790	10	0.66056	D	0.02	-16.4224	15.0914	0.72198	0.1423:0.8577:0.0:0.0	.	301;250;176	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	Q	250;301	ENSP00000355415:P250Q;ENSP00000369335:P301Q	ENSP00000355415:P250Q	P	+	2	0	FBXO18	5988597	0.990000	0.36364	0.183000	0.23137	0.091000	0.18340	4.737000	0.62066	2.678000	0.91216	0.655000	0.94253	CCG		0.498	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		4	66	1	0	0.000602214	0.000602214	0.00370261	4	66				
FRMD4A	55691	broad.mit.edu	37	10	13779862	13779862	+	Silent	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr10:13779862A>G	ENST00000357447.2	-	12	1109	c.741T>C	c.(739-741)gaT>gaC	p.D247D	FRMD4A_ENST00000358621.4_Silent_p.D232D|FRMD4A_ENST00000378503.1_Silent_p.D247D|RP11-353M9.1_ENST00000449462.1_RNA|FRMD4A_ENST00000342409.2_Silent_p.D263D	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	247	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GCTTCACTTTATCATGGTAGT	0.458																																							uc001ims.2		NA																	0				ovary(1)|skin(1)|pancreas(1)	3						c.(739-741)GAT>GAC		FERM domain containing 4A							170.0	128.0	142.0					10																	13779862		2203	4300	6503	SO:0001819	synonymous_variant	55691					cytoplasm|cytoskeleton	binding	g.chr10:13779862A>G	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.741T>C	10.37:g.13779862A>G			Somatic				FRMD4A_uc009xjf.1_Silent_p.D247D|FRMD4A_uc001imt.1_Silent_p.D280D|FRMD4A_uc001imu.1_Silent_p.D263D	p.D247D	NM_018027	NP_060497	WXS	Illumina HiSeq	Unspecified	Q9P2Q2	FRM4A_HUMAN			12	1093	-			247			FERM.		A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	37	c.741T>C	CCDS7101.1																																																																																				0.458	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027		6	36	0	0	0	0.000274275	0	6	36				
SLC39A12	221074	broad.mit.edu	37	10	18280116	18280116	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr10:18280116G>T	ENST00000377369.2	+	8	1579	c.1306G>T	c.(1306-1308)Ggg>Tgg	p.G436W	SLC39A12_ENST00000377371.3_Missense_Mutation_p.G436W|SLC39A12_ENST00000377374.4_Missense_Mutation_p.G436W|SLC39A12_ENST00000539911.1_Missense_Mutation_p.G302W	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	436					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CCCAGAATTTGGGCATTTCCA	0.358																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(1306-1308)GGG>TGG		solute carrier family 39 (zinc transporter),							89.0	93.0	92.0					10																	18280116		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18280116G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1306G>T	10.37:g.18280116G>T	ENSP00000366586:p.Gly436Trp		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.G436W|SLC39A12_uc001ipp.2_Missense_Mutation_p.G436W|SLC39A12_uc010qck.1_Missense_Mutation_p.G302W	p.G436W	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			8	1579	+			436			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.1306G>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676041	0.67928	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.88	5.88	0.94601	.	0.602715	0.18714	N	0.133214	T	0.71986	0.3405	M	0.82323	2.585	0.44424	D	0.997346	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.988;0.999	T	0.74100	-0.3774	10	0.72032	D	0.01	-4.7144	15.7499	0.77976	0.0:0.1357:0.8643:0.0	.	436;436;436	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	W	436;436;436;302;356	ENSP00000366586:G436W;ENSP00000366591:G436W;ENSP00000366588:G436W;ENSP00000440445:G302W	ENSP00000366586:G436W	G	+	1	0	SLC39A12	18320122	1.000000	0.71417	0.980000	0.43619	0.958000	0.62258	4.155000	0.58131	2.814000	0.96858	0.650000	0.86243	GGG		0.358	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		48	72	1	0	1.07234e-20	0.000781405	1.01321e-19	48	72				
PTCHD3	374308	broad.mit.edu	37	10	27703133	27703133	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr10:27703133G>T	ENST00000438700.3	-	1	164	c.47C>A	c.(46-48)cCc>cAc	p.P16H		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	16					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GGTGAGCTTGGGCTTCTGCTC	0.642																																							uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(46-48)CCC>CAC		patched domain containing 3							51.0	62.0	58.0					10																	27703133		2203	4299	6502	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27703133G>T	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.47C>A	10.37:g.27703133G>T	ENSP00000417658:p.Pro16His		Somatic					p.P16H	NM_001034842	NP_001030014	WXS	Illumina HiSeq	Unspecified	Q3KNS1	PTHD3_HUMAN			1	165	-			16					I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.47C>A	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531250	0.27387	.	.	ENSG00000182077	ENST00000438700	D	0.90197	-2.63	1.87	-0.227	0.13102	.	.	.	.	.	D	0.82572	0.5066	L	0.36672	1.1	0.09310	N	1	B	0.17268	0.021	B	0.08055	0.003	T	0.69924	-0.5013	9	0.56958	D	0.05	.	3.537	0.07798	0.0:0.3195:0.4291:0.2514	.	16	Q3KNS1	PTHD3_HUMAN	H	16	ENSP00000417658:P16H	ENSP00000417658:P16H	P	-	2	0	PTCHD3	27743139	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.917000	0.04025	-0.056000	0.13221	0.455000	0.32223	CCC		0.642	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		18	68	1	0	7.45023e-12	0.00152264	5.9463e-11	18	68				
PCDH15	65217	broad.mit.edu	37	10	55663078	55663078	+	Silent	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr10:55663078T>C	ENST00000320301.6	-	26	3820	c.3426A>G	c.(3424-3426)ccA>ccG	p.P1142P	PCDH15_ENST00000409834.1_Silent_p.P753P|PCDH15_ENST00000395432.2_Silent_p.P1105P|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Silent_p.P1149P|PCDH15_ENST00000395430.1_Silent_p.P1142P|PCDH15_ENST00000437009.1_Silent_p.P1071P|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Silent_p.P1149P|PCDH15_ENST00000395433.1_Silent_p.P1120P|PCDH15_ENST00000361849.3_Silent_p.P1142P|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000414778.1_Silent_p.P1147P|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395438.1_Silent_p.P1142P|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1142	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTGAAACACTGGGGGATGAT	0.368										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(3424-3426)CCA>CCG		protocadherin 15 isoform CD1-4 precursor							88.0	89.0	89.0					10																	55663078		2202	4300	6502	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55663078T>C	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3426A>G	10.37:g.55663078T>C		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Silent_p.P1147P|PCDH15_uc010qhr.1_Silent_p.P1142P|PCDH15_uc010qhs.1_Silent_p.P1154P|PCDH15_uc010qht.1_Silent_p.P1149P|PCDH15_uc010qhu.1_Silent_p.P1142P|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.P1142P|PCDH15_uc010qhw.1_Silent_p.P1105P|PCDH15_uc010qhx.1_Silent_p.P1071P|PCDH15_uc010qhy.1_Silent_p.P1147P|PCDH15_uc010qhz.1_Silent_p.P1142P|PCDH15_uc010qia.1_Silent_p.P1120P|PCDH15_uc010qib.1_Silent_p.P1120P	p.P1142P	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			26	3821	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1142			Cadherin 10.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	c.3426A>G	CCDS7248.1																																																																																				0.368	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		5	64	0	0	0	0.00116845	0	5	64				
CCKBR	887	broad.mit.edu	37	11	6291510	6291510	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:6291510G>T	ENST00000334619.2	+	3	789	c.596G>T	c.(595-597)gGg>gTg	p.G199V	CCKBR_ENST00000532715.1_Missense_Mutation_p.G115V|CCKBR_ENST00000525462.1_Missense_Mutation_p.G199V	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	199					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CAACCAGTGGGGCCTCGTGTG	0.627																																							uc001mcp.2		NA																	0				lung(5)|ovary(2)|breast(1)	8						c.(595-597)GGG>GTG		cholecystokinin B receptor	Pentagastrin(DB00183)						76.0	69.0	72.0					11																	6291510		2201	4296	6497	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6291510G>T	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.596G>T	11.37:g.6291510G>T	ENSP00000335544:p.Gly199Val		Somatic				CCKBR_uc001mcq.2_Missense_Mutation_p.G127V|CCKBR_uc001mcr.2_Missense_Mutation_p.G199V|CCKBR_uc001mcs.2_Missense_Mutation_p.G199V|CCKBR_uc001mct.1_5'Flank	p.G199V	NM_176875	NP_795344	WXS	Illumina HiSeq	Unspecified	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	3	789	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	199			Extracellular (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.596G>T	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956855	0.34565	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.72051	-0.62;-0.62;-0.62	5.33	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.218239	0.38778	N	0.001574	T	0.68824	0.3043	L	0.53249	1.67	0.23991	N	0.996241	P;P;P	0.47302	0.893;0.696;0.741	B;B;P	0.50708	0.32;0.32;0.648	T	0.58515	-0.7623	10	0.18276	T	0.48	.	8.6255	0.33886	0.1708:0.0:0.8292:0.0	.	199;133;199	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	V	199;115;199	ENSP00000335544:G199V;ENSP00000432079:G115V;ENSP00000435534:G199V	ENSP00000335544:G199V	G	+	2	0	CCKBR	6248086	0.106000	0.21978	0.414000	0.26521	0.335000	0.28730	2.009000	0.40903	2.505000	0.84491	0.655000	0.94253	GGG		0.627	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		35	54	1	0	2.47316e-13	0.00058488	2.1473e-12	35	54				
RRP8	23378	broad.mit.edu	37	11	6622684	6622684	+	Silent	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:6622684T>A	ENST00000254605.6	-	3	729	c.612A>T	c.(610-612)ccA>ccT	p.P204P	ILK_ENST00000537806.1_5'Flank|ILK_ENST00000528995.1_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|RRP8_ENST00000534343.1_Intron|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000396751.2_5'Flank|ILK_ENST00000299421.4_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	204					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GCACCTGAGGTGGCTGAAACT	0.582																																							uc001med.2		NA																	0					0						c.(610-612)CCA>CCT		ribosomal RNA processing 8, methyltransferase,							50.0	52.0	52.0					11																	6622684		2201	4296	6497	SO:0001819	synonymous_variant	23378				chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity	g.chr11:6622684T>A	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.612A>T	11.37:g.6622684T>A			Somatic				ILK_uc001mee.2_5'Flank|ILK_uc001mef.2_5'Flank|ILK_uc010rap.1_5'Flank|ILK_uc010raq.1_5'Flank|ILK_uc001meg.2_5'Flank|ILK_uc001meh.2_5'Flank	p.P204P	NM_015324	NP_056139	WXS	Illumina HiSeq	Unspecified	O43159	RRP8_HUMAN			3	691	-			204					Q7KZ78|Q9BVM6	Silent	SNP	ENST00000254605.6	37	c.612A>T	CCDS31411.1																																																																																				0.582	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324		21	45	0	0	0	0.00152264	0	21	45				
STK33	65975	broad.mit.edu	37	11	8435086	8435086	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:8435086C>T	ENST00000447869.1	-	11	2218	c.1300G>A	c.(1300-1302)Gtc>Atc	p.V434I	STK33_ENST00000534493.1_Missense_Mutation_p.V393I|STK33_ENST00000396672.1_Missense_Mutation_p.V434I|STK33_ENST00000358872.3_Missense_Mutation_p.V247I|STK33_ENST00000315204.1_Missense_Mutation_p.V434I|STK33_ENST00000396673.1_Intron|STK33_ENST00000473980.1_5'UTR			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	434					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		GCATCAGGGACATTTCCCCAG	0.418																																							uc001mgi.1		NA																	0				ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(1300-1302)GTC>ATC		serine/threonine kinase 33							296.0	270.0	279.0					11																	8435086		2201	4296	6497	SO:0001583	missense	65975					Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr11:8435086C>T	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1300G>A	11.37:g.8435086C>T	ENSP00000416750:p.Val434Ile		Somatic				STK33_uc001mgj.1_Missense_Mutation_p.V434I|STK33_uc001mgk.1_Missense_Mutation_p.V434I|STK33_uc010rbn.1_Missense_Mutation_p.V393I|STK33_uc001mgl.3_Missense_Mutation_p.V247I	p.V434I	NM_030906	NP_112168	WXS	Illumina HiSeq	Unspecified	Q9BYT3	STK33_HUMAN		Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)	11	2219	-			434					Q658S6|Q8NEF5	Missense_Mutation	SNP	ENST00000447869.1	37	c.1300G>A	CCDS7789.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.602654	0.28534	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000534493	T;T;T;T;T	0.71103	-0.48;-0.48;-0.48;-0.54;-0.47	4.67	-0.824	0.10812	Protein kinase-like domain (1);	2.158880	0.02026	N	0.048141	T	0.54919	0.1888	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.16129	-1.0413	10	0.20519	T	0.43	.	3.1745	0.06564	0.3136:0.4154:0.0:0.271	.	434	Q9BYT3	STK33_HUMAN	I	434;434;434;247;393	ENSP00000416750:V434I;ENSP00000320754:V434I;ENSP00000379905:V434I;ENSP00000351743:V247I;ENSP00000436418:V393I	ENSP00000320754:V434I	V	-	1	0	STK33	8391662	0.000000	0.05858	0.002000	0.10522	0.034000	0.12701	0.212000	0.17497	-0.225000	0.09913	-0.140000	0.14226	GTC		0.418	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	NM_030906		37	195	0	0	0	0.000781405	0	37	195				
METTL15	196074	broad.mit.edu	37	11	28135017	28135017	+	Missense_Mutation	SNP	C	C	T	rs530544431		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:28135017C>T	ENST00000407364.3	+	3	488	c.136C>T	c.(136-138)Cgg>Tgg	p.R46W	METTL15_ENST00000406787.3_Missense_Mutation_p.R46W|METTL15_ENST00000303459.6_Missense_Mutation_p.R46W|METTL15_ENST00000403099.1_Missense_Mutation_p.R46W|METTL15_ENST00000379199.2_Missense_Mutation_p.R46W|METTL15_ENST00000342303.5_Missense_Mutation_p.R46W			A6NJ78	MET15_HUMAN	methyltransferase like 15	46							methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						ATATGAAGCCCGGGAGCAAAC	0.388													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14089	0.0		0.0	False		,,,				2504	0.0						uc001msh.2		NA																	0					0						c.(136-138)CGG>TGG		methyltransferase 5 domain containing 1 isoform							40.0	49.0	46.0					11																	28135017		2201	4298	6499	SO:0001583	missense	196074						methyltransferase activity	g.chr11:28135017C>T	AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.136C>T	11.37:g.28135017C>T	ENSP00000384369:p.Arg46Trp		Somatic				METT5D1_uc001msg.2_Missense_Mutation_p.R46W|METT5D1_uc001mse.2_Missense_Mutation_p.R46W|METT5D1_uc001msf.1_RNA	p.R46W	NM_001113528	NP_001107000	WXS	Illumina HiSeq	Unspecified	A6NJ78	MET15_HUMAN			3	591	+			46					A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	ENST00000407364.3	37	c.136C>T	CCDS44559.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.678457	0.29783	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000403099;ENST00000407364;ENST00000379199;ENST00000303459	T;T;T;T;T;T	0.47177	1.43;1.45;0.85;1.87;0.85;1.45	5.68	-2.62	0.06152	.	1.368830	0.04587	N	0.395975	T	0.36358	0.0964	N	0.14661	0.345	0.09310	N	1	B;D;D	0.69078	0.0;0.979;0.997	B;B;P	0.49953	0.0;0.292;0.627	T	0.38067	-0.9678	10	0.62326	D	0.03	.	5.883	0.18866	0.2094:0.3105:0.4118:0.0682	.	46;46;46	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	W	46	ENSP00000385507:R46W;ENSP00000342259:R46W;ENSP00000385860:R46W;ENSP00000384369:R46W;ENSP00000368497:R46W;ENSP00000307251:R46W	ENSP00000307251:R46W	R	+	1	2	METTL15	28091593	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.703000	0.05063	-0.087000	0.12528	-1.104000	0.02111	CGG		0.388	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636		18	35	0	0	0	0.000566183	0	18	35				
OR5I1	10798	broad.mit.edu	37	11	55703675	55703675	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:55703675G>A	ENST00000301532.3	-	1	201	c.202C>T	c.(202-204)Cta>Tta	p.L68L		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	68					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ACAAATGATAGGTTGCTAAGG	0.393																																							uc010ris.1		NA																	0				ovary(1)	1						c.(202-204)CTA>TTA		olfactory receptor, family 5, subfamily I,							55.0	56.0	56.0					11																	55703675		2199	4293	6492	SO:0001819	synonymous_variant	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703675G>A	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.202C>T	11.37:g.55703675G>A			Somatic					p.L68L	NM_006637	NP_006628	WXS	Illumina HiSeq	Unspecified	Q13606	OR5I1_HUMAN			1	202	-			68			Helical; Name=2; (Potential).		Q6IEU4	Silent	SNP	ENST00000301532.3	37	c.202C>T	CCDS7949.1																																																																																				0.393	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		9	43	0	0	0	0.000442599	0	9	43				
OR10AG1	282770	broad.mit.edu	37	11	55735562	55735562	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:55735562C>A	ENST00000312345.2	-	1	428	c.378G>T	c.(376-378)gtG>gtT	p.V126V		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TGTGGTTCATCACTAGAGGAT	0.438																																							uc010rit.1		NA																	0				skin(2)	2						c.(376-378)GTG>GTT		olfactory receptor, family 10, subfamily AG,							78.0	76.0	77.0					11																	55735562		2201	4296	6497	SO:0001819	synonymous_variant	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735562C>A	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.378G>T	11.37:g.55735562C>A			Somatic					p.V126V	NM_001005491	NP_001005491	WXS	Illumina HiSeq	Unspecified	Q8NH19	O10AG_HUMAN			1	378	-	Esophageal squamous(21;0.0137)		126			Cytoplasmic (Potential).		B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	c.378G>T	CCDS31514.1																																																																																				0.438	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		13	49	1	0	0.00010058	0.00136819	0.000630464	13	49				
OR5F1	338674	broad.mit.edu	37	11	55761571	55761571	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:55761571G>T	ENST00000278409.1	-	1	530	c.531C>A	c.(529-531)ttC>ttA	p.F177L		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	177					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F177L(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TGTCACAGAAGAAGTGATGGA	0.473																																							uc010riv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(529-531)TTC>TTA		olfactory receptor, family 5, subfamily F,							93.0	88.0	90.0					11																	55761571		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761571G>T	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.531C>A	11.37:g.55761571G>T	ENSP00000278409:p.Phe177Leu		Somatic					p.F177L	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	531	-	Esophageal squamous(21;0.00448)		177			Extracellular (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.531C>A	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146656	0.37923	.	.	ENSG00000149133	ENST00000278409	T	0.00346	8.01	3.03	-0.919	0.10478	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00412	0.0013	M	0.86268	2.805	0.20074	N	0.999939	B	0.32467	0.372	B	0.39531	0.302	T	0.20505	-1.0273	9	0.87932	D	0	.	7.1462	0.25585	0.57:0.0:0.43:0.0	.	177	O95221	OR5F1_HUMAN	L	177	ENSP00000278409:F177L	ENSP00000278409:F177L	F	-	3	2	OR5F1	55518147	0.045000	0.20229	0.919000	0.36401	0.684000	0.39900	-0.511000	0.06321	-0.001000	0.14495	0.297000	0.19635	TTC		0.473	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		23	64	1	0	4.72057e-08	0.000586117	3.33293e-07	23	64				
OR8J3	81168	broad.mit.edu	37	11	55904930	55904930	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:55904930T>C	ENST00000301529.1	-	1	264	c.265A>G	c.(265-267)Aag>Gag	p.K89E		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					GTAGTTTTCTTCTTTACTAAA	0.418																																							uc010riz.1		NA																	0				skin(2)	2						c.(265-267)AAG>GAG		olfactory receptor, family 8, subfamily J,							133.0	132.0	132.0					11																	55904930		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904930T>C		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.265A>G	11.37:g.55904930T>C	ENSP00000301529:p.Lys89Glu		Somatic					p.K89E	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	265	-	Esophageal squamous(21;0.00693)		89			Extracellular (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.265A>G	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	T	1.340	-0.594248	0.03771	.	.	ENSG00000167822	ENST00000301529	T	0.03004	4.08	3.26	-1.24	0.09435	GPCR, rhodopsin-like superfamily (1);	0.471542	0.21556	N	0.072654	T	0.02848	0.0085	L	0.38175	1.15	0.09310	N	1	B	0.10296	0.003	B	0.14578	0.011	T	0.38134	-0.9675	10	0.42905	T	0.14	.	4.8805	0.13677	0.0:0.303:0.2546:0.4424	.	89	Q8NGG0	OR8J3_HUMAN	E	89	ENSP00000301529:K89E	ENSP00000301529:K89E	K	-	1	0	OR8J3	55661506	0.000000	0.05858	0.006000	0.13384	0.584000	0.36387	-1.021000	0.03615	-0.069000	0.12931	0.240000	0.17902	AAG		0.418	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		36	104	0	0	0	0.000692331	0	36	104				
OR5T2	219464	broad.mit.edu	37	11	55999864	55999864	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:55999864C>G	ENST00000313264.4	-	1	873	c.798G>C	c.(796-798)aaG>aaC	p.K266N		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CAGAATACATCTTCAGAATGG	0.433																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(796-798)AAG>AAC		olfactory receptor, family 5, subfamily T,							140.0	129.0	133.0					11																	55999864		2201	4296	6497	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999864C>G	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.798G>C	11.37:g.55999864C>G	ENSP00000323688:p.Lys266Asn		Somatic					p.K266N	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	798	-	Esophageal squamous(21;0.00448)		266			Cytoplasmic (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.798G>C	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	C	5.258	0.233075	0.09969	.	.	ENSG00000181718	ENST00000313264	T	0.00183	8.6	5.07	-1.81	0.07882	GPCR, rhodopsin-like superfamily (1);	0.163975	0.28927	U	0.013700	T	0.00144	0.0004	L	0.58583	1.82	0.19775	N	0.999953	B	0.17465	0.022	B	0.23852	0.049	T	0.50676	-0.8800	10	0.66056	D	0.02	.	1.5893	0.02650	0.1176:0.374:0.2296:0.2788	.	266	Q8NGG2	OR5T2_HUMAN	N	266	ENSP00000323688:K266N	ENSP00000323688:K266N	K	-	3	2	OR5T2	55756440	0.000000	0.05858	0.036000	0.18154	0.070000	0.16714	-0.643000	0.05421	-0.561000	0.06094	-0.362000	0.07510	AAG		0.433	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		26	115	0	0	0	0.00106085	0	26	115				
KLHL35	283212	broad.mit.edu	37	11	75134888	75134888	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:75134888G>T	ENST00000539798.1	-	5	1410	c.1411C>A	c.(1411-1413)Ctg>Atg	p.L471M	KLHL35_ENST00000376292.4_Missense_Mutation_p.L251M	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	471										lung(2)|stomach(1)	3						GGTGACCGCAGGCTCCACCGG	0.602																																					Colon(77;683 1691 18820 23811)	Colon(77;683 1691 18820 23811)	uc001owm.1		NA																	0					0						c.(751-753)CTG>ATG		kelch-like 35							50.0	58.0	56.0					11																	75134888		2034	4198	6232	SO:0001583	missense	283212							g.chr11:75134888G>T		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.1411C>A	11.37:g.75134888G>T	ENSP00000438526:p.Leu471Met		Somatic					p.L251M	NM_001039548	NP_001034637	WXS	Illumina HiSeq	Unspecified	Q6PF15	KLH35_HUMAN			5	970	-			251			Kelch 4.		A2RU06|F5H412|Q86XM7|Q8NBB1	Missense_Mutation	SNP	ENST00000539798.1	37	c.751C>A	CCDS44685.2	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628806	0.67015	.	.	ENSG00000149243	ENST00000376292;ENST00000539798	T;T	0.67865	-0.29;-0.29	5.05	4.14	0.48551	Kelch-type beta propeller (1);	0.184605	0.35936	N	0.002882	T	0.73729	0.3624	L	0.56124	1.755	0.41409	D	0.987727	D	0.67145	0.996	D	0.73380	0.98	T	0.73445	-0.3980	10	0.48119	T	0.1	.	7.535	0.27706	0.1883:0.0:0.8117:0.0	.	251	Q6PF15	KLH35_HUMAN	M	251;471	ENSP00000365469:L251M;ENSP00000438526:L471M	ENSP00000365469:L251M	L	-	1	2	KLHL35	74812536	0.944000	0.32072	1.000000	0.80357	0.970000	0.65996	1.113000	0.31184	1.354000	0.45846	0.603000	0.83216	CTG		0.602	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173583		22	38	1	0	1.50039e-11	0.00188189	1.19012e-10	22	38				
ATM	472	broad.mit.edu	37	11	108236220	108236220	+	Missense_Mutation	SNP	G	G	C	rs587781711		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:108236220G>C	ENST00000452508.2	+	64	9345	c.9156G>C	c.(9154-9156)tgG>tgC	p.W3052C	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.W3052C|ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	3052	FATC. {ECO:0000255|PROSITE- ProRule:PRU00534, ECO:0000255|PROSITE- ProRule:PRU00535}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCCCAGGATGGAAAGCTTGGG	0.408			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(9154-9156)TGG>TGC	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							88.0	84.0	86.0					11																	108236220		2201	4298	6499	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108236220G>C	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.9156G>C	11.37:g.108236220G>C	ENSP00000388058:p.Trp3052Cys	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.W3052C|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.W1704C	p.W3052C	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	63	9541	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	3052			FATC.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.9156G>C	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520641	0.64747	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.98178	-4.77;-4.77	5.09	5.09	0.68999	PIK-related kinase, FATC (2);Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98272	1.0504	10	0.87932	D	0	.	18.7508	0.91814	0.0:0.0:1.0:0.0	.	3052	Q13315	ATM_HUMAN	C	3052	ENSP00000278616:W3052C;ENSP00000388058:W3052C	ENSP00000278616:W3052C	W	+	3	0	ATM	107741430	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	9.405000	0.97313	2.657000	0.90304	0.558000	0.71614	TGG		0.408	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		11	17	0	0	0	0.00136819	0	11	17				
OR8B3	390271	broad.mit.edu	37	11	124266588	124266588	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:124266588G>A	ENST00000354597.3	-	1	676	c.660C>T	c.(658-660)ttC>ttT	p.F220F		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TAGTGACAATGAAAACATAAG	0.403																																							uc010saj.1		NA																	0				ovary(1)|skin(1)	2						c.(658-660)TTC>TTT		olfactory receptor, family 8, subfamily B,							107.0	117.0	113.0					11																	124266588		2201	4299	6500	SO:0001819	synonymous_variant	390271				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124266588G>A	AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.660C>T	11.37:g.124266588G>A			Somatic				OR8B2_uc001qab.3_Intron	p.F220F	NM_001005467	NP_001005467	WXS	Illumina HiSeq	Unspecified	Q8NGG8	OR8B3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	660	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	220			Cytoplasmic (Potential).		Q6IFQ8|Q8NGH1	Silent	SNP	ENST00000354597.3	37	c.660C>T	CCDS31709.1																																																																																				0.403	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387291.1	NM_001005467		39	137	0	0	0	0.000781405	0	39	137				
ARHGAP32	9743	broad.mit.edu	37	11	128840287	128840287	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:128840287C>A	ENST00000310343.9	-	22	4778	c.4779G>T	c.(4777-4779)atG>atT	p.M1593I	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.M1244I|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.M1244I	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1593	Interaction with GAB2.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CAGAGCGAATCATGGAAGACG	0.532																																							uc009zcp.2		NA																	0				lung(3)|ovary(2)	5						c.(4777-4779)ATG>ATT		Rho GTPase-activating protein isoform 1							89.0	82.0	84.0					11																	128840287		2201	4297	6498	SO:0001583	missense	9743				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding	g.chr11:128840287C>A	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4779G>T	11.37:g.128840287C>A	ENSP00000310561:p.Met1593Ile		Somatic				ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.M552I|ARHGAP32_uc001qez.2_Missense_Mutation_p.M1244I	p.M1593I	NM_001142685	NP_001136157	WXS	Illumina HiSeq	Unspecified	A7KAX9	RHG32_HUMAN			22	4779	-			1593			Interaction with GAB2.		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	c.4779G>T	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070361	0.36566	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.08008	3.14;3.14;3.14	5.87	5.87	0.94306	.	0.290140	0.37669	N	0.001993	T	0.10508	0.0257	L	0.57536	1.79	0.27468	N	0.95295	B	0.26318	0.146	B	0.19148	0.024	T	0.07927	-1.0747	10	0.56958	D	0.05	.	11.66	0.51341	0.1292:0.7302:0.1405:0.0	.	1593	A7KAX9	RHG32_HUMAN	I	1593;1244;1244	ENSP00000310561:M1593I;ENSP00000376425:M1244I;ENSP00000432862:M1244I	ENSP00000310561:M1593I	M	-	3	0	ARHGAP32	128345497	0.981000	0.34729	1.000000	0.80357	0.981000	0.71138	0.311000	0.19380	2.779000	0.95612	0.655000	0.94253	ATG		0.532	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715		6	37	1	0	6.5536e-12	0.000157383	5.29646e-11	6	37				
B3GAT1	27087	broad.mit.edu	37	11	134253972	134253972	+	Silent	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:134253972G>T	ENST00000524765.1	-	3	4767	c.223C>A	c.(223-225)Cgg>Agg	p.R75R	B3GAT1_ENST00000392580.1_Silent_p.R75R|B3GAT1_ENST00000312527.4_Silent_p.R75R|B3GAT1_ENST00000537389.1_Silent_p.R88R|B3GAT1_ENST00000531510.1_5'UTR			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	75					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GGCGGGGGCCGCGTGTACACG	0.701																																							uc001qhq.2		NA																	0				ovary(1)	1						c.(223-225)CGG>AGG		beta-1,3-glucuronyltransferase 1							38.0	24.0	29.0					11																	134253972		2199	4294	6493	SO:0001819	synonymous_variant	27087				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding	g.chr11:134253972G>T	AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.223C>A	11.37:g.134253972G>T			Somatic				B3GAT1_uc001qhr.2_Silent_p.R75R|B3GAT1_uc010scv.1_Silent_p.R88R	p.R75R	NM_018644	NP_061114	WXS	Illumina HiSeq	Unspecified	Q9P2W7	B3GA1_HUMAN		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)	4	484	-	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)	75			Lumenal (Potential).		Q96FS7	Silent	SNP	ENST00000524765.1	37	c.223C>A	CCDS8500.1																																																																																				0.701	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1	NM_018644		5	5	1	0	1.23904e-05	0.000602214	8.24957e-05	5	5				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A|KRAS_ENST00000556131.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GCT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12A|KRAS_uc001rgr.2_RNA	p.G12A	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>C	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		14	14	0	0	0	0.000308642	0	14	14				
ITPR2	3709	broad.mit.edu	37	12	26868257	26868257	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:26868257C>A	ENST00000381340.3	-	8	1246	c.830G>T	c.(829-831)aGt>aTt	p.S277I		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	277	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGCTTTAGAACTAGTAGCAGA	0.358																																							uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(829-831)AGT>ATT		inositol 1,4,5-triphosphate receptor, type 2							137.0	133.0	134.0					12																	26868257		1845	4101	5946	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26868257C>A	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.830G>T	12.37:g.26868257C>A	ENSP00000370744:p.Ser277Ile		Somatic					p.S277I	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			8	1247	-	Colorectal(261;0.0847)		277			Cytoplasmic (Potential).|MIR 3.		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.830G>T	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797330	0.90538	.	.	ENSG00000123104	ENST00000381340	D	0.92699	-3.09	4.75	4.75	0.60458	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	D	0.96510	0.8861	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.97238	0.9889	10	0.87932	D	0	.	17.9466	0.89040	0.0:1.0:0.0:0.0	.	277	Q14571	ITPR2_HUMAN	I	277	ENSP00000370744:S277I	ENSP00000370744:S277I	S	-	2	0	ITPR2	26759524	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	7.372000	0.79612	2.464000	0.83262	0.650000	0.86243	AGT		0.358	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		14	146	1	0	1.37285e-15	0.000422831	1.22508e-14	14	146				
NACA	4666	broad.mit.edu	37	12	57108218	57108218	+	Silent	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:57108218C>G	ENST00000454682.1	-	5	6032	c.5751G>C	c.(5749-5751)gcG>gcC	p.A1917A	NACA_ENST00000551793.1_5'UTR|NACA_ENST00000548563.1_5'UTR|NACA_ENST00000393891.4_Silent_p.A54A|NACA_ENST00000552540.1_Silent_p.A54A|NACA_ENST00000356769.3_Silent_p.A54A|NACA_ENST00000546392.1_Silent_p.A54A|NACA_ENST00000550952.1_Silent_p.A764A	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1917					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CAGCTGCTGCCGCCAGCTAAG	0.408			T	BCL6	NHL																																		uc001slz.2		NA		Dom	yes		12	12q23-q24.1	4666	T	nascent-polypeptide-associated complex alpha polypeptide			L	BCL6		NHL		0				ovary(1)	1						c.(160-162)GCG>GCC		nascent polypeptide-associated complex alpha							90.0	81.0	84.0					12																	57108218		2203	4300	6503	SO:0001819	synonymous_variant	4666				interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding	g.chr12:57108218C>G	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5751G>C	12.37:g.57108218C>G			Somatic				NACA_uc001sly.2_Silent_p.A54A|NACA_uc009zoy.1_Silent_p.A1917A|NACA_uc001smc.2_Silent_p.A54A|NACA_uc001sma.2_Silent_p.A764A|NACA_uc001smb.2_Silent_p.A54A|NACA_uc010squ.1_RNA	p.A54A	NM_001113201	NP_001106672	WXS	Illumina HiSeq	Unspecified	Q13765	NACA_HUMAN			4	511	-			54						Silent	SNP	ENST00000454682.1	37	c.162G>C																																																																																					0.408	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594		17	50	0	0	0	0.000958276	0	17	50				
PPM1H	57460	broad.mit.edu	37	12	63225927	63225927	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:63225927G>A	ENST00000228705.6	-	2	678	c.378C>T	c.(376-378)ccC>ccT	p.P126P		NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	126							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CTTCCCCATTGGGAAGGGAGG	0.552																																							uc001srk.3		NA																	0				lung(3)|ovary(1)	4						c.(376-378)CCC>CCT		protein phosphatase 1H (PP2C domain containing)							87.0	85.0	86.0					12																	63225927		1922	4127	6049	SO:0001819	synonymous_variant	57460						phosphoprotein phosphatase activity	g.chr12:63225927G>A	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.378C>T	12.37:g.63225927G>A			Somatic					p.P126P	NM_020700	NP_065751	WXS	Illumina HiSeq	Unspecified	Q9ULR3	PPM1H_HUMAN	GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)	2	527	-			126					B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	37	c.378C>T	CCDS44934.1																																																																																				0.552	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700		7	18	0	0	0	8.12818e-05	0	7	18				
AVPR1A	552	broad.mit.edu	37	12	63541299	63541299	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:63541299C>A	ENST00000299178.2	-	2	1202	c.1097G>T	c.(1096-1098)tGc>tTc	p.C366F		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	366					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CATGTTTTGGCAGCATGGGAA	0.403																																							uc001sro.1		NA																	0					0						c.(1096-1098)TGC>TTC		arginine vasopressin receptor 1A	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)						184.0	175.0	178.0					12																	63541299		2203	4300	6503	SO:0001583	missense	552				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity	g.chr12:63541299C>A	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.1097G>T	12.37:g.63541299C>A	ENSP00000299178:p.Cys366Phe		Somatic					p.C366F	NM_000706	NP_000697	WXS	Illumina HiSeq	Unspecified	P37288	V1AR_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	2	3071	-			366			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000299178.2	37	c.1097G>T	CCDS8965.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357426	0.24598	.	.	ENSG00000166148	ENST00000550940;ENST00000299178	T;T	0.38240	1.15;1.15	5.82	5.82	0.92795	.	0.093311	0.85682	D	0.000000	T	0.44519	0.1297	M	0.82433	2.59	0.80722	D	1	B	0.32781	0.384	B	0.34301	0.179	T	0.38735	-0.9647	9	.	.	.	-43.6609	13.98	0.64299	0.1512:0.8487:0.0:0.0	.	366	P37288	V1AR_HUMAN	F	147;366	ENSP00000449822:C147F;ENSP00000299178:C366F	.	C	-	2	0	AVPR1A	61827566	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	4.153000	0.58118	2.767000	0.95098	0.655000	0.94253	TGC		0.403	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1			34	86	1	0	2.08457e-15	0.000339439	1.84736e-14	34	86				
FAM216A	29902	broad.mit.edu	37	12	110925706	110925706	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr12:110925706C>T	ENST00000377673.5	+	6	1173	c.661C>T	c.(661-663)Ctg>Ttg	p.L221L		NM_013300.2	NP_037432.2	Q8WUB2	F216A_HUMAN	family with sequence similarity 216, member A	221																	ATGTAAGTCACTGAAGATTTT	0.333																																							uc001tqu.3		NA																	0					0						c.(661-663)CTG>TTG		hypothetical protein LOC29902							84.0	88.0	87.0					12																	110925706		2203	4300	6503	SO:0001819	synonymous_variant	29902							g.chr12:110925706C>T	U79274	CCDS31899.1	12q24.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000204856	ENSG00000204856			30180	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 24"""	C12orf24			Standard	NM_013300		Approved	HSU79274	uc001tqu.4	Q8WUB2	OTTHUMG00000169526	ENST00000377673.5:c.661C>T	12.37:g.110925706C>T			Somatic				C12orf24_uc001tqt.2_RNA|C12orf24_uc001tqv.3_RNA|C12orf24_uc009zvp.2_RNA	p.L221L	NM_013300	NP_037432	WXS	Illumina HiSeq	Unspecified	Q8WUB2	CL024_HUMAN			6	1110	+			221					A6NH30|Q99776	Silent	SNP	ENST00000377673.5	37	c.661C>T	CCDS31899.1																																																																																				0.333	FAM216A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404616.1	NM_013300		22	84	0	0	0	0.001512	0	22	84				
VWA8	23078	broad.mit.edu	37	13	42273408	42273408	+	Splice_Site	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr13:42273408T>A	ENST00000379310.3	-	29	3433		c.e29-2			NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8							extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GCTCATTTTCTGAAATGACAA	0.383																																							uc001uyj.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6						c.e29-1		hypothetical protein LOC23078 isoform a							61.0	59.0	59.0					13																	42273408		1837	4086	5923	SO:0001630	splice_region_variant	23078					extracellular region	ATP binding|ATPase activity	g.chr13:42273408T>A	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3365-2A>T	13.37:g.42273408T>A			Somatic					p.E1122_splice	NM_015058	NP_055873	WXS	Illumina HiSeq	Unspecified	A3KMH1	K0564_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)	29	3435	-		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)						O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Splice_Site	SNP	ENST00000379310.3	37	c.3365_splice	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.900713	0.72754	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8986	0.79356	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0564	41171408	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.098000	0.57748	2.223000	0.72356	0.477000	0.44152	.		0.383	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	Intron	48	36	0	0	0	0.000781405	0	48	36				
RNASE4	6038	broad.mit.edu	37	14	21167901	21167901	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr14:21167901C>G	ENST00000555835.1	+	2	1047	c.371C>G	c.(370-372)gCc>gGc	p.A124G	RNASE4_ENST00000555597.1_Missense_Mutation_p.A124G|RNASE4_ENST00000304704.4_Missense_Mutation_p.A124G|RNASE4_ENST00000397995.2_Missense_Mutation_p.A124G|RP11-903H12.3_ENST00000554286.1_RNA|AL163636.6_ENST00000553909.1_3'UTR	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	124					cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		AGATATCGGGCCATAGCGAGC	0.532																																					Esophageal Squamous(59;1059 1362 26290 51151)	Esophageal Squamous(59;1059 1362 26290 51151)	uc001vxy.3		NA																	0				central_nervous_system(1)	1						c.(370-372)GCC>GGC		ribonuclease, RNase A family, 4 precursor							135.0	119.0	125.0					14																	21167901		2203	4300	6503	SO:0001583	missense	6038				mRNA cleavage	extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21167901C>G	U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.371C>G	14.37:g.21167901C>G	ENSP00000452245:p.Ala124Gly		Somatic				RNASE4_uc001vxx.3_RNA|RNASE4_uc001vya.2_Missense_Mutation_p.A124G	p.A124G	NM_002937	NP_002928	WXS	Illumina HiSeq	Unspecified	P34096	RNAS4_HUMAN	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)	2	934	+	all_cancers(95;0.00304)		124						Missense_Mutation	SNP	ENST00000555835.1	37	c.371C>G	CCDS9555.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731357	0.30684	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.8	5.8	0.92144	Ribonuclease A, domain (4);	0.220504	0.40554	N	0.001064	T	0.67477	0.2897	L	0.49350	1.555	0.38202	D	0.940214	B	0.12013	0.005	B	0.18561	0.022	T	0.66256	-0.5969	10	0.66056	D	0.02	-16.5049	15.9084	0.79447	0.0:1.0:0.0:0.0	.	124	P34096	RNAS4_HUMAN	G	124	ENSP00000452245:A124G;ENSP00000381081:A124G;ENSP00000451624:A124G;ENSP00000381087:A124G;ENSP00000307096:A124G;ENSP00000381085:A124G	ENSP00000307096:A124G	A	+	2	0	AL163636.2;RNASE4	20237741	0.763000	0.28462	0.182000	0.23118	0.199000	0.23934	1.075000	0.30716	2.902000	0.99343	0.650000	0.86243	GCC		0.532	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073729.3			4	148	0	0	0	0.00024832	0	4	148				
DACT1	51339	broad.mit.edu	37	14	59113448	59113448	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr14:59113448G>C	ENST00000335867.4	+	4	2131	c.2107G>C	c.(2107-2109)Ggg>Cgg	p.G703R	DACT1_ENST00000541264.2_Missense_Mutation_p.G422R|DACT1_ENST00000556859.1_Missense_Mutation_p.G422R|DACT1_ENST00000395153.3_Missense_Mutation_p.G666R			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	703					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GGAGAATGTGGGGCTGTACCC	0.662																																							uc001xdw.2		NA																	0				large_intestine(2)|lung(2)|ovary(1)	5						c.(2107-2109)GGG>CGG		dapper 1 isoform 1							24.0	28.0	27.0					14																	59113448		2201	4297	6498	SO:0001583	missense	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59113448G>C	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2107G>C	14.37:g.59113448G>C	ENSP00000337439:p.Gly703Arg		Somatic				DACT1_uc010trv.1_Missense_Mutation_p.G422R|DACT1_uc001xdx.2_Missense_Mutation_p.G666R|DACT1_uc010trw.1_Missense_Mutation_p.G422R	p.G703R	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			4	2271	+			703					A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	c.2107G>C	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.385103	0.42308	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.63	4.72	0.59763	.	0.272836	0.32563	N	0.005932	T	0.56645	0.1999	M	0.71036	2.16	0.29346	N	0.865696	D;D	0.57257	0.979;0.979	P;P	0.56042	0.79;0.79	T	0.57510	-0.7799	10	0.25106	T	0.35	-13.7664	16.3451	0.83120	0.0:0.1323:0.8677:0.0	.	666;703	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	R	422;422;666;703;422	ENSP00000451598:G422R;ENSP00000378581:G422R;ENSP00000378582:G666R;ENSP00000337439:G703R;ENSP00000442850:G422R	ENSP00000337439:G703R	G	+	1	0	DACT1	58183201	1.000000	0.71417	0.120000	0.21714	0.484000	0.33280	3.632000	0.54287	1.340000	0.45581	0.563000	0.77884	GGG		0.662	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		9	26	0	0	0	0.000442599	0	9	26				
SEL1L	6400	broad.mit.edu	37	14	81950604	81950604	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr14:81950604C>A	ENST00000336735.4	-	19	2127	c.2011G>T	c.(2011-2013)Gga>Tga	p.G671*		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	671	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TGCATATATCCCAGATTAAAC	0.403																																							uc010tvv.1		NA																	0				ovary(1)	1						c.(2011-2013)GGA>TGA		sel-1 suppressor of lin-12-like precursor							327.0	320.0	323.0					14																	81950604		2203	4300	6503	SO:0001587	stop_gained	6400				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr14:81950604C>A		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.2011G>T	14.37:g.81950604C>A	ENSP00000337053:p.Gly671*		Somatic					p.G671*	NM_005065	NP_005056	WXS	Illumina HiSeq	Unspecified	Q9UBV2	SE1L1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0299)	19	2128	-			671			Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.|Sel1-like 11.		Q6UWT6|Q9P1T9|Q9UHK7	Nonsense_Mutation	SNP	ENST00000336735.4	37	c.2011G>T	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	C	42	9.328381	0.99138	.	.	ENSG00000071537	ENST00000336735;ENST00000261258	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1178	0.97943	0.0:1.0:0.0:0.0	.	.	.	.	X	671;32	.	ENSP00000261258:G32X	G	-	1	0	SEL1L	81020357	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	7.379000	0.79691	2.759000	0.94783	0.557000	0.71058	GGA		0.403	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065		158	322	1	0	5.63857e-76	0.000781405	6.08871e-75	158	322				
SERPINA3	12	broad.mit.edu	37	14	95081183	95081183	+	Silent	SNP	G	G	A	rs377149330		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr14:95081183G>A	ENST00000467132.1	+	2	1553	c.405G>A	c.(403-405)ctG>ctA	p.L135L	RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000482740.1_5'Flank|SERPINA3_ENST00000393078.3_Silent_p.L135L|SERPINA3_ENST00000393080.4_Silent_p.L135L			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	135					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		AGCTGCAGCTGAGTATGGGAA	0.547																																							uc001ydp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6						c.(403-405)CTG>CTA		serpin peptidase inhibitor, clade A, member 3		G		0,4406		0,0,2203	64.0	59.0	60.0		405	1.1	0.4	14		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SERPINA3	NM_001085.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		135/424	95081183	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	12				acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	g.chr14:95081183G>A	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.405G>A	14.37:g.95081183G>A			Somatic				SERPINA3_uc001ydo.3_Silent_p.L160L|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Silent_p.L135L|SERPINA3_uc001yds.2_Silent_p.L135L|SERPINA3_uc010avg.2_Silent_p.L135L	p.L135L	NM_001085	NP_001076	WXS	Illumina HiSeq	Unspecified	P01011	AACT_HUMAN		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)	2	484	+		all_cancers(154;0.0525)|all_epithelial(191;0.179)	135					B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Silent	SNP	ENST00000467132.1	37	c.405G>A	CCDS32150.1																																																																																				0.547	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085		9	62	0	0	0	0.000274275	0	9	62				
MAGEL2	54551	broad.mit.edu	37	15	23890281	23890281	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr15:23890281T>A	ENST00000532292.1	-	1	894	c.800A>T	c.(799-801)gAg>gTg	p.E267V		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	150					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTTGGAGGCCTCTTGAGTGGT	0.632																																							uc001ywj.3		NA																	0					0						c.(799-801)GAG>GTG		MAGE-like protein 2							34.0	43.0	40.0					15																	23890281		2175	4284	6459	SO:0001583	missense	54551							g.chr15:23890281T>A	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.800A>T	15.37:g.23890281T>A	ENSP00000433433:p.Glu267Val		Somatic					p.E267V	NM_019066	NP_061939	WXS	Illumina HiSeq	Unspecified				all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)	1	895	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)							Missense_Mutation	SNP	ENST00000532292.1	37	c.800A>T		.	.	.	.	.	.	.	.	.	.	T	10.69	1.420028	0.25552	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.22	0.501	0.16925	.	.	.	.	.	T	0.19248	0.0462	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.21552	-1.0242	5	.	.	.	.	0.7122	0.00926	0.169:0.1728:0.1743:0.4839	.	.	.	.	W	299	.	.	R	-	1	2	MAGEL2	21441374	0.783000	0.28701	0.017000	0.16124	0.139000	0.21198	0.209000	0.17435	0.064000	0.16427	0.533000	0.62120	AGG		0.632	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066		22	37	0	0	0	0.000295444	0	22	37				
NPAP1	23742	broad.mit.edu	37	15	24924005	24924005	+	Silent	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr15:24924005G>C	ENST00000329468.2	+	1	3465	c.2991G>C	c.(2989-2991)ctG>ctC	p.L997L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	997					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GTACCTTACTGGTTGGAAATA	0.522																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2989-2991)CTG>CTC		hypothetical protein LOC23742							63.0	61.0	62.0					15																	24924005		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24924005G>C	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2991G>C	15.37:g.24924005G>C			Somatic					p.L997L	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3465	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	997						Silent	SNP	ENST00000329468.2	37	c.2991G>C	CCDS10015.1																																																																																				0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		3	46	0	0	0	6.4e-05	0	3	46				
ACTC1	70	broad.mit.edu	37	15	35084734	35084734	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr15:35084734T>C	ENST00000290378.4	-	4	1146	c.491A>G	c.(490-492)aAt>aGt	p.N164S	RP11-814P5.1_ENST00000558707.1_RNA|ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	164					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GATGGGGACATTGTGAGTTAC	0.537																																							uc001ziu.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(490-492)AAT>AGT		cardiac muscle alpha actin 1 proprotein							139.0	125.0	130.0					15																	35084734		2201	4298	6499	SO:0001583	missense	70				apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding	g.chr15:35084734T>C	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.491A>G	15.37:g.35084734T>C	ENSP00000290378:p.Asn164Ser		Somatic				uc001zit.1_Intron	p.N164S	NM_005159	NP_005150	WXS	Illumina HiSeq	Unspecified	P68032	ACTC_HUMAN		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)	4	734	-		all_lung(180;2.3e-08)	164					P04270	Missense_Mutation	SNP	ENST00000290378.4	37	c.491A>G	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.010510	0.35511	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.97352	-4.35	4.99	4.99	0.66335	.	0.000000	0.56097	U	0.000037	D	0.87688	0.6240	N	0.00329	-1.635	0.50467	D	0.999874	B	0.02656	0.0	B	0.04013	0.001	D	0.84488	0.0609	10	0.87932	D	0	.	15.142	0.72618	0.0:0.0:0.0:1.0	.	164	P68032	ACTC_HUMAN	S	164;129	ENSP00000290378:N164S	ENSP00000290378:N164S	N	-	2	0	ACTC1	32872026	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	4.901000	0.63259	2.223000	0.72356	0.482000	0.46254	AAT		0.537	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159		19	46	0	0	0	0.000375601	0	19	46				
ATP8B4	79895	broad.mit.edu	37	15	50168722	50168722	+	Splice_Site	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr15:50168722T>A	ENST00000284509.6	-	25	2923		c.e25-2		ATP8B4_ENST00000559829.1_Splice_Site	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4							Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ACTCACATCCTGTAAACAGAG	0.418																																							uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.e25-1		ATPase class I type 8B member 4							75.0	76.0	76.0					15																	50168722		2196	4295	6491	SO:0001630	splice_region_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50168722T>A	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.2782-2A>T	15.37:g.50168722T>A			Somatic				ATP8B4_uc010ber.2_Splice_Site_p.D801_splice|ATP8B4_uc010ufd.1_Splice_Site_p.D738_splice|ATP8B4_uc010ufe.1_Splice_Site|ATP8B4_uc001zxt.2_5'UTR	p.D928_splice	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	25	2924	-		all_lung(180;0.00183)						Q9H727	Splice_Site	SNP	ENST00000284509.6	37	c.2782_splice	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.176248	0.78564	.	.	ENSG00000104043	ENST00000284509	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2189	0.65812	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP8B4	47956014	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.991000	0.88244	2.240000	0.73641	0.533000	0.62120	.		0.418	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837	Intron	9	32	0	0	0	0.000978159	0	9	32				
RPL3L	6123	broad.mit.edu	37	16	1995903	1995903	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:1995903T>A	ENST00000268661.7	-	8	1074	c.980A>T	c.(979-981)aAc>aTc	p.N327I	MSRB1_ENST00000564908.1_5'Flank|MSRB1_ENST00000361871.3_5'Flank|MSRB1_ENST00000399753.2_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	327					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						GAAGTCGTTGTTCACTTCCCC	0.602																																							uc002cnh.2		NA																	0					0						c.(979-981)AAC>ATC		ribosomal protein L3-like							137.0	116.0	123.0					16																	1995903		2198	4300	6498	SO:0001583	missense	6123				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome	g.chr16:1995903T>A	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.980A>T	16.37:g.1995903T>A	ENSP00000268661:p.Asn327Ile		Somatic				SEPX1_uc010uvs.1_5'Flank	p.N327I	NM_005061	NP_005052	WXS	Illumina HiSeq	Unspecified	Q92901	RL3L_HUMAN			8	1027	-			327						Missense_Mutation	SNP	ENST00000268661.7	37	c.980A>T	CCDS10450.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.709741	0.30322	.	.	ENSG00000140986	ENST00000268661	T	0.43688	0.94	4.25	3.13	0.36017	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	M	0.85542	2.76	0.54753	D	0.999989	D	0.56746	0.977	P	0.59357	0.856	T	0.65261	-0.6211	10	0.87932	D	0	-7.2233	10.072	0.42339	0.0:0.0:0.1697:0.8303	.	327	Q92901	RL3L_HUMAN	I	327	ENSP00000268661:N327I	ENSP00000268661:N327I	N	-	2	0	RPL3L	1935904	1.000000	0.71417	0.998000	0.56505	0.030000	0.12068	2.990000	0.49401	0.746000	0.32786	-0.460000	0.05396	AAC		0.602	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2	NM_005061		20	54	0	0	0	0.000586117	0	20	54				
CASKIN1	57524	broad.mit.edu	37	16	2239268	2239268	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:2239268C>A	ENST00000343516.6	-	5	549	c.457G>T	c.(457-459)Gac>Tac	p.D153Y		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	153					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CAGGCCAGGTCCAGGGGCGTC	0.672																																							uc010bsg.1		NA																	0				skin(2)	2						c.(457-459)GAC>TAC		CASK interacting protein 1							40.0	51.0	47.0					16																	2239268		2073	4191	6264	SO:0001583	missense	57524				signal transduction	cytoplasm		g.chr16:2239268C>A	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.457G>T	16.37:g.2239268C>A	ENSP00000345436:p.Asp153Tyr		Somatic					p.D153Y	NM_020764	NP_065815	WXS	Illumina HiSeq	Unspecified	Q8WXD9	CSKI1_HUMAN			5	489	-			153			ANK 4.		Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	37	c.457G>T	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109061	0.56398	.	.	ENSG00000167971	ENST00000343516	T	0.63913	-0.07	3.46	3.46	0.39613	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.65048	0.2654	N	0.17564	0.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71297	-0.4635	9	0.87932	D	0	-30.0785	14.0324	0.64624	0.0:1.0:0.0:0.0	.	153	Q8WXD9	CSKI1_HUMAN	Y	153	ENSP00000345436:D153Y	ENSP00000345436:D153Y	D	-	1	0	CASKIN1	2179269	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	7.477000	0.81069	1.954000	0.56735	0.561000	0.74099	GAC		0.672	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764		9	15	1	0	2.17888e-05	0.000442599	0.000144323	9	15				
ACSM2B	348158	broad.mit.edu	37	16	20565132	20565132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:20565132G>T	ENST00000329697.6	-	5	875	c.707C>A	c.(706-708)tCg>tAg	p.S236*	ACSM2B_ENST00000565232.1_Nonsense_Mutation_p.S236*|ACSM2B_ENST00000565322.1_Nonsense_Mutation_p.S157*|ACSM2B_ENST00000567001.1_Nonsense_Mutation_p.S236*|ACSM2B_ENST00000567288.1_5'UTR	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	236					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						GCCCAGGCTCGAGTAGGAATG	0.507																																							uc002dhj.3		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(706-708)TCG>TAG		acyl-CoA synthetase medium-chain family member							89.0	84.0	86.0					16																	20565132		2201	4297	6498	SO:0001587	stop_gained	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20565132G>T	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.707C>A	16.37:g.20565132G>T	ENSP00000327453:p.Ser236*		Somatic				ACSM2B_uc002dhk.3_Nonsense_Mutation_p.S236*|ACSM2B_uc010bwf.1_Nonsense_Mutation_p.S236*	p.S236*	NM_182617	NP_872423	WXS	Illumina HiSeq	Unspecified	Q68CK6	ACS2B_HUMAN			6	917	-			236					Q86YT1	Nonsense_Mutation	SNP	ENST00000329697.6	37	c.707C>A	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954274	0.92726	.	.	ENSG00000066813	ENST00000329697	.	.	.	3.36	1.03	0.20045	.	2.210360	0.02346	N	0.075401	.	.	.	.	.	.	0.19575	N	0.999969	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.2976	9.93	0.41517	0.0:0.5736:0.4264:0.0	.	.	.	.	X	236	.	ENSP00000327453:S236X	S	-	2	0	ACSM2B	20472633	0.127000	0.22367	0.005000	0.12908	0.003000	0.03518	1.027000	0.30115	0.700000	0.31782	0.609000	0.83330	TCG		0.507	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		31	69	1	0	9.04072e-19	0.00058488	8.35779e-18	31	69				
SULT1A2	6799	broad.mit.edu	37	16	28606736	28606736	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:28606736G>C	ENST00000395630.1	-	4	674	c.324C>G	c.(322-324)caC>caG	p.H108Q	SULT1A2_ENST00000335715.4_Missense_Mutation_p.H108Q|SULT1A2_ENST00000533150.1_Missense_Mutation_p.P137A	NM_177528.2	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2	108	Substrate binding. {ECO:0000250}.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine biosynthetic process (GO:0009309)|catecholamine metabolic process (GO:0006584)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|sulfotransferase activity (GO:0008146)			NS(2)|breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|skin(2)	14						CCAGGGGCAGGTGTGTCTTCA	0.582																																							uc002dqg.1		NA																	0					0						c.(322-324)CAC>CAG		sulfotransferase family, cytosolic, 1A,							125.0	120.0	122.0					16																	28606736		2197	4300	6497	SO:0001583	missense	6799				3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity	g.chr16:28606736G>C	U34804	CCDS10636.1	16p12.1	2008-02-05			ENSG00000197165	ENSG00000197165	2.8.2.1	"""Sulfotransferases, cytosolic"""	11454	protein-coding gene	gene with protein product		601292		STP2		8661000, 8912648	Standard	NM_001054		Approved	HAST4	uc002dqh.2	P50226	OTTHUMG00000048082	ENST00000395630.1:c.324C>G	16.37:g.28606736G>C	ENSP00000378992:p.His108Gln		Somatic				uc010vct.1_Intron|SULT1A2_uc002dqh.1_Missense_Mutation_p.H108Q	p.H108Q	NM_177528	NP_803564	WXS	Illumina HiSeq	Unspecified	P50226	ST1A2_HUMAN			4	675	-			108				Proton acceptor (By similarity).	A9QY25|P78393|Q14CJ7	Missense_Mutation	SNP	ENST00000395630.1	37	c.324C>G	CCDS10636.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.85|11.85	1.762700|1.762700	0.31228|0.31228	.|.	.|.	ENSG00000197165|ENSG00000197165	ENST00000335715;ENST00000395630;ENST00000526384|ENST00000533150	D;D;D|T	0.98120|0.01947	-4.73;-4.73;-4.73|4.54	4.7|4.7	2.21|2.21	0.28008|0.28008	Sulfotransferase domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.18002|0.18002	0.0432|0.0432	H|H	0.98833|0.98833	4.345|4.345	0.42524|0.42524	D|D	0.993014|0.993014	D|.	0.76494|.	0.999|.	D|.	0.74348|.	0.983|.	T|T	0.00945|0.00945	-1.1505|-1.1505	10|7	0.87932|0.52906	D|T	0|0.07	.|.	6.5907|6.5907	0.22646|0.22646	0.3878:0.0:0.6122:0.0|0.3878:0.0:0.6122:0.0	.|.	108|.	P50226|.	ST1A2_HUMAN|.	Q|A	108|137	ENSP00000338742:H108Q;ENSP00000378992:H108Q;ENSP00000435358:H108Q|ENSP00000435271:P137A	ENSP00000338742:H108Q|ENSP00000435271:P137A	H|P	-|-	3|1	2|0	SULT1A2|SULT1A2	28514237|28514237	0.475000|0.475000	0.25894|0.25894	0.960000|0.960000	0.40013|0.40013	0.101000|0.101000	0.19017|0.19017	0.464000|0.464000	0.21988|0.21988	0.638000|0.638000	0.30545|0.30545	0.556000|0.556000	0.70494|0.70494	CAC|CCT		0.582	SULT1A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109415.2	NM_001054		19	87	0	0	0	0.00152264	0	19	87				
SLC12A3	6559	broad.mit.edu	37	16	56928501	56928501	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:56928501G>T	ENST00000563236.1	+	22	2605	c.2580G>T	c.(2578-2580)aaG>aaT	p.K860N	SLC12A3_ENST00000262502.5_Missense_Mutation_p.K859N|SLC12A3_ENST00000566786.1_Missense_Mutation_p.K868N|SLC12A3_ENST00000438926.2_Missense_Mutation_p.K869N			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	860					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.K869K(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GCAAATGCAAGATCCGTGTGT	0.572																																							uc010ccm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(2578-2580)AAG>AAT		solute carrier family 12, member 3 isoform 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)						142.0	109.0	120.0					16																	56928501		2198	4300	6498	SO:0001583	missense	6559				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity	g.chr16:56928501G>T		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2580G>T	16.37:g.56928501G>T	ENSP00000456149:p.Lys860Asn		Somatic				SLC12A3_uc002ekd.3_Missense_Mutation_p.K869N|SLC12A3_uc010ccn.2_Missense_Mutation_p.K868N	p.K860N	NM_001126108	NP_001119580	WXS	Illumina HiSeq	Unspecified	P55017	S12A3_HUMAN			22	2609	+			860			Cytoplasmic (Potential).		A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	c.2580G>T	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551035	0.65311	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.76	2.79	0.32731	.	0.265582	0.41294	D	0.000901	T	0.76601	0.4010	M	0.91140	3.18	0.49213	D	0.999762	B;P;P	0.42039	0.24;0.659;0.769	B;P;P	0.53988	0.366;0.553;0.739	T	0.76764	-0.2839	9	0.87932	D	0	.	7.7065	0.28653	0.2672:0.0:0.7328:0.0	.	868;860;869	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	N	868;869	.	ENSP00000262502:K869N	K	+	3	2	SLC12A3	55486002	0.984000	0.35163	0.626000	0.29213	0.812000	0.45895	1.798000	0.38814	0.536000	0.28733	0.561000	0.74099	AAG		0.572	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			11	22	1	0	1.11149e-13	0.000673444	9.71609e-13	11	22				
CNOT1	23019	broad.mit.edu	37	16	58590826	58590826	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:58590826C>A	ENST00000317147.5	-	19	2736	c.2404G>T	c.(2404-2406)Gac>Tac	p.D802Y	CNOT1_ENST00000569240.1_Missense_Mutation_p.D802Y|CNOT1_ENST00000441024.2_Missense_Mutation_p.D802Y|CNOT1_ENST00000569732.1_5'UTR|SNORA50_ENST00000384225.2_RNA	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	802	Interaction with ZFP36.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ACAAAAGGGTCGTTATTCACT	0.493																																							uc002env.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(2404-2406)GAC>TAC		CCR4-NOT transcription complex, subunit 1							104.0	93.0	96.0					16																	58590826		2198	4300	6498	SO:0001583	missense	23019				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol		g.chr16:58590826C>A	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2404G>T	16.37:g.58590826C>A	ENSP00000320949:p.Asp802Tyr		Somatic				CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.D802Y|CNOT1_uc002enx.2_Missense_Mutation_p.D802Y|CNOT1_uc002enz.1_Missense_Mutation_p.D231Y	p.D802Y	NM_016284	NP_057368	WXS	Illumina HiSeq	Unspecified	A5YKK6	CNOT1_HUMAN		Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)	19	2697	-			802					Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	c.2404G>T	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616389	0.46736	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.45276	0.92;0.9	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.47673	0.1458	N	0.08118	0	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.306	D;D;B	0.87578	0.998;0.995;0.095	T	0.57323	-0.7831	10	0.49607	T	0.09	.	19.5796	0.95461	0.0:1.0:0.0:0.0	.	802;802;802	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	Y	802;231;802;802	ENSP00000320949:D802Y;ENSP00000413113:D802Y	ENSP00000320949:D802Y	D	-	1	0	CNOT1	57148327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.624000	0.88883	0.655000	0.94253	GAC		0.493	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		7	48	1	0	2.0095e-06	8.12818e-05	1.37351e-05	7	48				
CDH8	1006	broad.mit.edu	37	16	61935283	61935284	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:61935283_61935284CC>AA	ENST00000577390.1	-	3	1300_1301	c.346_347GG>TT	c.(346-348)GGa>TTa	p.G116L	CDH8_ENST00000584337.1_Missense_Mutation_p.G116L|CDH8_ENST00000577730.1_Missense_Mutation_p.G116L|CDH8_ENST00000299345.6_Missense_Mutation_p.G116L	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	116	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATGGATATCTCCAGTTACATCA	0.441																																							uc002eog.1		NA																	0				ovary(6)|skin(2)|breast(1)	9						c.(346-348)GGA>TTA		cadherin 8, type 2 preproprotein																																				SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61935283_61935284CC>AA	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.346_347delinsAA	16.37:g.61935283_61935284delinsAA	ENSP00000462701:p.Gly116Leu		Somatic					p.G116L	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	3	598_599	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	116			Extracellular (Potential).|Cadherin 1.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	DNP	ENST00000577390.1	37	c.346_347GG>TT	CCDS10802.1																																																																																				0.441	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		18	72	0	0	0	6.4e-05	0	18	72				
ZNF23	7571	broad.mit.edu	37	16	71483658	71483658	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:71483658C>G	ENST00000393539.2	-	6	1083	c.270G>C	c.(268-270)caG>caC	p.Q90H	ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000417828.1_Missense_Mutation_p.Q90H|ZNF23_ENST00000357254.4_Missense_Mutation_p.Q90H|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000564528.1_Missense_Mutation_p.Q32H|ZNF23_ENST00000428724.2_Missense_Mutation_p.Q32H	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		AGTGGACTTCCTGTTGTTTCT	0.403																																							uc002faf.2		NA																	0					0						c.(268-270)CAG>CAC		zinc finger protein 23							131.0	138.0	136.0					16																	71483658		2198	4300	6498	SO:0001583	missense	7571				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:71483658C>G	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.270G>C	16.37:g.71483658C>G	ENSP00000377171:p.Gln90His		Somatic				ZNF23_uc002fad.2_Missense_Mutation_p.Q32H|ZNF23_uc002fae.2_Missense_Mutation_p.Q32H|ZNF23_uc010vmf.1_Missense_Mutation_p.Q32H|ZNF23_uc002fag.2_Missense_Mutation_p.Q32H|ZNF23_uc002fah.2_Missense_Mutation_p.Q90H|ZNF23_uc002fai.2_Missense_Mutation_p.Q129H	p.Q90H	NM_145911	NP_666016	WXS	Illumina HiSeq	Unspecified	P17027	ZNF23_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0686)	6	1084	-		Ovarian(137;0.00768)	90					Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	37	c.270G>C	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	C	0.734	-0.778730	0.02929	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	3.76	-0.369	0.12534	.	0.174511	0.27841	N	0.017631	T	0.29749	0.0743	L	0.43646	1.37	0.09310	N	1	D;P	0.57257	0.979;0.61	P;B	0.51101	0.659;0.191	T	0.15093	-1.0449	10	0.54805	T	0.06	-7.1294	7.6064	0.28105	0.0:0.5999:0.0:0.4001	.	90;90	B3KR55;P17027	.;ZNF23_HUMAN	H	90;90;90;32;32	ENSP00000377171:Q90H;ENSP00000349796:Q90H;ENSP00000395712:Q90H;ENSP00000387673:Q32H	ENSP00000349796:Q90H	Q	-	3	2	ZNF23	70041159	0.007000	0.16637	0.005000	0.12908	0.042000	0.13812	0.257000	0.18369	-0.022000	0.13986	-0.291000	0.09656	CAG		0.403	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911		46	112	0	0	0	0.000589545	0	46	112				
PMFBP1	83449	broad.mit.edu	37	16	72159967	72159967	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr16:72159967T>A	ENST00000237353.10	-	15	2414	c.2153A>T	c.(2152-2154)gAg>gTg	p.E718V	PMFBP1_ENST00000355636.6_Missense_Mutation_p.E573V|PMFBP1_ENST00000537792.1_5'Flank|PMFBP1_ENST00000537465.1_Missense_Mutation_p.E723V	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	723						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				ATAGTGCTTCTCCTTCTGCAG	0.537																																							uc002fcc.3		NA																	0				ovary(2)	2						c.(2167-2169)GAG>GTG		polyamine modulated factor 1 binding protein 1							204.0	195.0	198.0					16																	72159967		2198	4300	6498	SO:0001583	missense	83449							g.chr16:72159967T>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.2153A>T	16.37:g.72159967T>A	ENSP00000237353:p.Glu718Val		Somatic				PMFBP1_uc002fcd.2_Missense_Mutation_p.E718V|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Missense_Mutation_p.E573V|PMFBP1_uc010cgo.1_Missense_Mutation_p.E14V	p.E723V	NM_031293	NP_112583	WXS	Illumina HiSeq	Unspecified	Q8TBY8	PMFBP_HUMAN			15	2340	-		Ovarian(137;0.179)	723			Potential.		B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	c.2168A>T	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.701837	0.48307	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.13538	2.58;2.59;2.58	3.65	3.65	0.41850	.	0.000000	0.43919	D	0.000504	T	0.28566	0.0707	M	0.68317	2.08	0.34398	D	0.694902	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.994;0.996;0.994	T	0.30592	-0.9973	10	0.16896	T	0.51	-25.0456	8.993	0.36035	0.0:0.0:0.0:1.0	.	723;718;723	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	V	723;718;573	ENSP00000443817:E723V;ENSP00000237353:E718V;ENSP00000347854:E573V	ENSP00000237353:E718V	E	-	2	0	PMFBP1	70717468	1.000000	0.71417	0.960000	0.40013	0.401000	0.30781	3.383000	0.52471	1.896000	0.54893	0.528000	0.53228	GAG		0.537	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		34	185	0	0	0	0.000491102	0	34	185				
OR1D2	4991	broad.mit.edu	37	17	2996216	2996216	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:2996216C>A	ENST00000331459.1	-	1	74	c.75G>T	c.(73-75)cgG>cgT	p.R25R		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	25			R -> Q (in dbSNP:rs769423). {ECO:0000269|PubMed:10673334, ECO:0000269|PubMed:8097991}.		cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						AAAACAGGATCCGCTGCTGCT	0.532																																							uc010vrb.1		NA																	0				ovary(1)	1						c.(73-75)CAG>CAT		olfactory receptor, family 1, subfamily D,							100.0	96.0	97.0					17																	2996216		2203	4300	6503	SO:0001819	synonymous_variant	4991				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity	g.chr17:2996216C>A	U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.75G>T	17.37:g.2996216C>A			Somatic					p.Q25H	NM_002548	NP_002539	WXS	Illumina HiSeq	Unspecified	P34982	OR1D2_HUMAN			1	75	-			25			Extracellular (Potential).		Q6IFL8|Q96RA4|Q9UM78	Missense_Mutation	SNP	ENST00000331459.1	37	c.75G>T	CCDS11019.1																																																																																				0.532	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1	NM_002548		22	80	1	0	5.26018e-13	0.00188189	4.44693e-12	22	80				
MYH8	4626	broad.mit.edu	37	17	10301845	10301845	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:10301845G>T	ENST00000403437.2	-	30	4188	c.4094C>A	c.(4093-4095)tCc>tAc	p.S1365Y	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1365					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GTTGGCCTTGGACAGCGCCCT	0.597									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(4093-4095)TCC>TAC		myosin, heavy chain 8, skeletal muscle,							203.0	184.0	190.0					17																	10301845		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10301845G>T		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4094C>A	17.37:g.10301845G>T	ENSP00000384330:p.Ser1365Tyr		Somatic				uc002gml.1_Intron	p.S1365Y	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			30	4189	-			1365			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.4094C>A	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936278	0.92458	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.80393	-1.37	5.35	5.35	0.76521	Myosin tail (1);	0.000000	0.41500	U	0.000868	D	0.93393	0.7893	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94940	0.8090	10	0.87932	D	0	.	19.2529	0.93932	0.0:0.0:1.0:0.0	.	1365	P13535	MYH8_HUMAN	Y	1365	ENSP00000384330:S1365Y	ENSP00000252173:S1365Y	S	-	2	0	MYH8	10242570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.503000	0.97984	2.785000	0.95823	0.655000	0.94253	TCC		0.597	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		60	94	1	0	3.37043e-27	0.000781405	3.35737e-26	60	94				
HS3ST3A1	9955	broad.mit.edu	37	17	13400014	13400014	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:13400014C>G	ENST00000284110.1	-	2	1518	c.721G>C	c.(721-723)Gtg>Ctg	p.V241L	HS3ST3A1_ENST00000578576.1_Missense_Mutation_p.V39L	NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	241					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCCCGCACCACCACGATGAGC	0.632																																							uc002gob.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(721-723)GTG>CTG		heparan sulfate D-glucosaminyl							39.0	53.0	48.0					17																	13400014		2203	4298	6501	SO:0001583	missense	9955					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity	g.chr17:13400014C>G	AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.721G>C	17.37:g.13400014C>G	ENSP00000284110:p.Val241Leu		Somatic					p.V241L	NM_006042	NP_006033	WXS	Illumina HiSeq	Unspecified	Q9Y663	HS3SA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	2	1519	-		all_lung(20;0.114)	241			Lumenal (Potential).		A8K7N2	Missense_Mutation	SNP	ENST00000284110.1	37	c.721G>C	CCDS11165.1	.	.	.	.	.	.	.	.	.	.	C	36	5.630607	0.96682	.	.	ENSG00000153976	ENST00000284110	T	0.81415	-1.49	5.32	5.32	0.75619	Sulfotransferase domain (1);	0.000000	0.64402	U	0.000002	D	0.86719	0.6000	M	0.67700	2.07	0.80722	D	1	P	0.39862	0.692	P	0.51016	0.656	D	0.86976	0.2101	10	0.72032	D	0.01	.	19.4836	0.95020	0.0:1.0:0.0:0.0	.	241	Q9Y663	HS3SA_HUMAN	L	241	ENSP00000284110:V241L	ENSP00000284110:V241L	V	-	1	0	HS3ST3A1	13340739	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.699000	0.84547	2.873000	0.98535	0.563000	0.77884	GTG		0.632	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129952.1	NM_006042		10	36	0	0	0	0.000566183	0	10	36				
RAI1	10743	broad.mit.edu	37	17	17707136	17707136	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:17707136T>A	ENST00000353383.1	+	4	6101	c.5632T>A	c.(5632-5634)Tac>Aac	p.Y1878N	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1878					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCTCCACACCTACCACTACCC	0.612																																							uc002grm.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(5632-5634)TAC>AAC		retinoic acid induced 1							96.0	78.0	84.0					17																	17707136		2203	4300	6503	SO:0001583	missense	10743					cytoplasm|nucleus	zinc ion binding	g.chr17:17707136T>A	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5632T>A	17.37:g.17707136T>A	ENSP00000323074:p.Tyr1878Asn		Somatic					p.Y1878N	NM_030665	NP_109590	WXS	Illumina HiSeq	Unspecified	Q7Z5J4	RAI1_HUMAN		READ - Rectum adenocarcinoma(1115;0.0276)	4	6101	+			1878			PHD-type.		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	c.5632T>A	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.805032	0.50315	.	.	ENSG00000108557	ENST00000353383	T	0.74947	-0.89	5.46	5.46	0.80206	Zinc finger, PHD-type (1);	.	.	.	.	D	0.87943	0.6305	M	0.91090	3.175	0.80722	D	1	D	0.53885	0.963	P	0.62298	0.9	D	0.90673	0.4599	9	0.87932	D	0	.	15.1982	0.73112	0.0:0.0:0.0:1.0	.	1878	Q7Z5J4	RAI1_HUMAN	N	1878	ENSP00000323074:Y1878N	ENSP00000323074:Y1878N	Y	+	1	0	RAI1	17647861	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.474000	0.81024	2.077000	0.62373	0.533000	0.62120	TAC		0.612	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		24	27	0	0	0	0.000586117	0	24	27				
EPN2	22905	broad.mit.edu	37	17	19186773	19186773	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:19186773G>A	ENST00000314728.5	+	3	825	c.341G>A	c.(340-342)cGa>cAa	p.R114Q	EPN2_ENST00000395618.3_Intron|EPN2_ENST00000395626.1_Missense_Mutation_p.R114Q|EPN2_ENST00000347697.2_Missense_Mutation_p.R114Q|EPN2_ENST00000575595.1_Intron|EPN2_ENST00000571254.1_Missense_Mutation_p.R114Q|EPN2_ENST00000395620.2_Missense_Mutation_p.R114Q	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	114	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TACATTGACCGAGATGGCAAG	0.572																																							uc002gvd.3		NA																	0				skin(1)	1						c.(340-342)CGA>CAA		epsin 2 isoform b							84.0	72.0	76.0					17																	19186773		2203	4300	6503	SO:0001583	missense	22905				endocytosis		lipid binding	g.chr17:19186773G>A	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.341G>A	17.37:g.19186773G>A	ENSP00000320543:p.Arg114Gln		Somatic				EPN2_uc002gvc.2_Missense_Mutation_p.R114Q|EPN2_uc010vyn.1_Missense_Mutation_p.R114Q|EPN2_uc010cql.1_Intron|EPN2_uc002gve.3_Missense_Mutation_p.R114Q|EPN2_uc002gvf.3_Intron|EPN2_uc010vyo.1_Intron|EPN2_uc002gvg.1_Missense_Mutation_p.R114Q|EPN2_uc010vyp.1_Missense_Mutation_p.R114Q|EPN2_uc010vyq.1_Missense_Mutation_p.R114Q|EPN2_uc002gvh.1_Missense_Mutation_p.R114Q	p.R114Q	NM_014964	NP_055779	WXS	Illumina HiSeq	Unspecified	O95208	EPN2_HUMAN			3	789	+	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)		114			ENTH.		A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	c.341G>A	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	G	35	5.429694	0.96131	.	.	ENSG00000072134	ENST00000347697;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	4.98	4.98	0.66077	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.054419	0.64402	D	0.000001	T	0.59756	0.2217	L	0.47016	1.485	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.99;0.999;1.0;0.99	D;D;P;D;D;P	0.80764	0.994;0.978;0.817;0.983;0.994;0.807	T	0.62599	-0.6820	10	0.72032	D	0.01	-8.9697	18.5914	0.91214	0.0:0.0:1.0:0.0	.	114;114;114;114;114;114	Q52LD0;B7ZKM5;E9PBC1;E7EMC3;E9PBC2;O95208	.;.;.;.;.;EPN2_HUMAN	Q	114	ENSP00000261495:R114Q;ENSP00000320543:R114Q;ENSP00000378990:R114Q;ENSP00000378982:R114Q;ENSP00000378988:R114Q	ENSP00000320543:R114Q	R	+	2	0	EPN2	19127366	1.000000	0.71417	0.942000	0.38095	0.933000	0.57130	7.893000	0.87330	2.457000	0.83068	0.561000	0.74099	CGA		0.572	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964		18	25	0	0	0	0.000566183	0	18	25				
VTN	7448	broad.mit.edu	37	17	26695960	26695960	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:26695960G>T	ENST00000226218.4	-	5	1377	c.759C>A	c.(757-759)aaC>aaA	p.N253K	SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|CTB-96E2.2_ENST00000555059.2_5'Flank|VTN_ENST00000536498.1_5'UTR|VTN_ENST00000438614.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	253					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.N253N(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CTGCATCCACGTTGTCCGGGA	0.592																																							uc002hbc.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(1)|kidney(1)	2						c.(757-759)AAC>AAA		vitronectin precursor	Urokinase(DB00013)						96.0	92.0	93.0					17																	26695960		2203	4300	6503	SO:0001583	missense	7448				cell adhesion mediated by integrin|immune response|negative regulation of endopeptidase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein binding|positive regulation of receptor-mediated endocytosis|positive regulation of smooth muscle cell migration|positive regulation of vascular endothelial growth factor receptor signaling pathway|smooth muscle cell-matrix adhesion	alphav-beta3 integrin-vitronectin complex|extracellular space	heparin binding|integrin binding|scavenger receptor activity	g.chr17:26695960G>T	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.759C>A	17.37:g.26695960G>T	ENSP00000226218:p.Asn253Lys		Somatic				SARM1_uc010wah.1_Intron|SEBOX_uc010crk.1_5'Flank|SARM1_uc010waj.1_Intron	p.N253K	NM_000638	NP_000629	WXS	Illumina HiSeq	Unspecified	P04004	VTNC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	5	908	-	all_lung(13;0.000533)|Lung NSC(42;0.00171)		253					B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	c.759C>A	CCDS11229.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996558	0.35226	.	.	ENSG00000255604	ENST00000226218	T	0.06849	3.25	5.92	-8.29	0.01009	Hemopexin/matrixin (2);	0.368951	0.36167	N	0.002757	T	0.10423	0.0255	L	0.28776	0.89	0.19300	N	0.99998	D	0.60575	0.988	P	0.57425	0.82	T	0.04440	-1.0951	10	0.25106	T	0.35	-14.1232	18.5526	0.91071	0.7601:0.0:0.2399:0.0	.	253	P04004	VTNC_HUMAN	K	253	ENSP00000226218:N253K	ENSP00000226218:N253K	N	-	3	2	AC002094.1	23720087	0.000000	0.05858	0.003000	0.11579	0.029000	0.11900	-0.745000	0.04834	-1.446000	0.01945	-0.122000	0.15005	AAC		0.592	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638		10	87	1	0	4.3838e-07	0.00185496	3.04496e-06	10	87				
ERBB2	2064	broad.mit.edu	37	17	37871593	37871593	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:37871593G>A	ENST00000269571.5	+	10	1362	c.1203G>A	c.(1201-1203)gaG>gaA	p.E401E	ERBB2_ENST00000540042.1_Silent_p.E371E|ERBB2_ENST00000578199.1_Silent_p.E371E|ERBB2_ENST00000584450.1_Silent_p.E401E|ERBB2_ENST00000541774.1_Silent_p.E386E|ERBB2_ENST00000445658.2_Silent_p.E125E|ERBB2_ENST00000584601.1_Silent_p.E371E|ERBB2_ENST00000540147.1_Silent_p.E371E|ERBB2_ENST00000406381.2_Silent_p.E371E			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	401					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AAGTGTTTGAGACTCTGGAAG	0.607		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													uc002hso.2		1		Dom	yes		17	17q21.1	2064	A|Mis|O	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""			E			breast|ovarian|other tumour types|NSCLC|gastric		0				lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143						c.(1201-1203)GAG>GAA		erbB-2 isoform a	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)						85.0	77.0	79.0					17																	37871593		2203	4300	6503	SO:0001819	synonymous_variant	2064				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr17:37871593G>A	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1203G>A	17.37:g.37871593G>A		TCGA GBM(5;<1E-08)	Somatic				ERBB2_uc002hsm.2_Silent_p.E371E|ERBB2_uc010cwa.2_Silent_p.E386E|ERBB2_uc002hsp.2_Silent_p.E204E|ERBB2_uc010cwb.2_Silent_p.E401E|ERBB2_uc010wek.1_Silent_p.E125E|ERBB2_uc002hsl.2_Silent_p.E371E	p.E401E	NM_004448	NP_004439	WXS	Illumina HiSeq	Unspecified	P04626	ERBB2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	10	1441	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	401			Extracellular (Potential).		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	37	c.1203G>A	CCDS32642.1																																																																																				0.607	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			9	20	0	0	0	0.000673444	0	9	20				
KRT20	54474	broad.mit.edu	37	17	39036991	39036991	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:39036991C>A	ENST00000167588.3	-	3	546	c.505G>T	c.(505-507)Gtg>Ttg	p.V169L		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	169	Coil 1B.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				TCAGCTTCCACTGTTAGACGT	0.378																																							uc002hvl.2		NA																	0				large_intestine(1)|kidney(1)|skin(1)	3						c.(505-507)GTG>TTG		keratin 20							158.0	146.0	150.0					17																	39036991		2203	4300	6503	SO:0001583	missense	54474				apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39036991C>A	BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.505G>T	17.37:g.39036991C>A	ENSP00000167588:p.Val169Leu		Somatic					p.V169L	NM_019010	NP_061883	WXS	Illumina HiSeq	Unspecified	P35900	K1C20_HUMAN			3	547	-		Breast(137;0.000301)|Ovarian(249;0.15)	169			Coil 1B.|Rod.		B2R6W7	Missense_Mutation	SNP	ENST00000167588.3	37	c.505G>T	CCDS11379.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062808	0.76187	.	.	ENSG00000171431	ENST00000167588	D	0.88586	-2.4	5.45	3.43	0.39272	Filament (1);	0.113671	0.38837	N	0.001554	D	0.92169	0.7517	M	0.74467	2.265	0.42723	D	0.993683	D	0.63046	0.992	P	0.59546	0.859	D	0.91826	0.5471	10	0.72032	D	0.01	.	11.1203	0.48287	0.0:0.801:0.1289:0.0701	.	169	P35900	K1C20_HUMAN	L	169	ENSP00000167588:V169L	ENSP00000167588:V169L	V	-	1	0	KRT20	36290517	0.996000	0.38824	0.066000	0.19879	0.002000	0.02628	3.487000	0.53222	0.660000	0.30964	-0.282000	0.10007	GTG		0.378	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257202.2			44	64	1	0	3.7052e-28	0.000680045	3.71968e-27	44	64				
B4GALNT2	124872	broad.mit.edu	37	17	47219396	47219396	+	Splice_Site	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr17:47219396G>T	ENST00000300404.2	+	3	454		c.e3-1		B4GALNT2_ENST00000504681.1_Splice_Site|B4GALNT2_ENST00000393354.2_Splice_Site	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.?(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GCTTGTTTCAGGCTGTTCCCG	0.498																																					GBM(124;244 1635 8663 18097 33175)	GBM(124;244 1635 8663 18097 33175)	uc002ion.2		NA																	1	Unknown(1)		stomach(1)	large_intestine(1)|ovary(1)	2						c.e3-1		beta-1,4-N-acetyl-galactosaminyl transferase 2							94.0	84.0	87.0					17																	47219396		2203	4300	6503	SO:0001630	splice_region_variant	124872				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity	g.chr17:47219396G>T	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.396-1G>T	17.37:g.47219396G>T			Somatic				B4GALNT2_uc010wlt.1_Splice_Site_p.W46_splice|B4GALNT2_uc010wlu.1_Splice_Site_p.W72_splice	p.W132_splice	NM_153446	NP_703147	WXS	Illumina HiSeq	Unspecified	Q8NHY0	B4GN2_HUMAN	all cancers(6;0.000316)		3	455	+								B4DZE4|Q14CP1|Q86Y40	Splice_Site	SNP	ENST00000300404.2	37	c.396_splice	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561765	0.45590	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	.	.	.	5.59	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7775	0.29046	0.0886:0.1626:0.7488:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	B4GALNT2	44574395	1.000000	0.71417	0.983000	0.44433	0.717000	0.41224	2.851000	0.48302	1.346000	0.45694	0.650000	0.86243	.		0.498	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	Intron	29	54	1	0	1.38854e-25	0.001512	1.36204e-24	29	54				
CTAGE1	64693	broad.mit.edu	37	18	19996316	19996316	+	5'Flank	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr18:19996316G>C	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.P487A			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GGACCATATGGGGAATGCTGT	0.403																																							uc002ktv.1		NA																	0				ovary(1)	1						c.(1459-1461)CCA>GCA		cutaneous T-cell lymphoma-associated antigen 1							109.0	110.0	110.0					18																	19996316		2202	4300	6502	SO:0001631	upstream_gene_variant	64693					integral to membrane		g.chr18:19996316G>C	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19996316G>C	Exception_encountered		Somatic					p.P487A	NM_172241	NP_758441	WXS	Illumina HiSeq	Unspecified	Q96RT6	CTGE2_HUMAN			1	1563	-	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)		487					B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	37	c.1459C>G		.	.	.	.	.	.	.	.	.	.	G	7.691	0.691142	0.15039	.	.	ENSG00000212710	ENST00000391403	T	0.48522	0.81	0.779	0.779	0.18550	.	.	.	.	.	T	0.61825	0.2378	M	0.82923	2.615	0.09310	N	0.999992	D	0.63880	0.993	P	0.61592	0.891	T	0.49273	-0.8957	8	.	.	.	.	4.8937	0.13740	0.0:0.0:1.0:0.0	.	487	Q96RT6	CTGE2_HUMAN	A	487	ENSP00000375220:P487A	.	P	-	1	0	CTAGE1	18250314	1.000000	0.71417	0.110000	0.21437	0.045000	0.14185	3.717000	0.54911	0.697000	0.31718	0.479000	0.44913	CCA		0.403	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		57	94	0	0	0	0.000781405	0	57	94				
ASXL3	80816	broad.mit.edu	37	18	31323160	31323160	+	Silent	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr18:31323160T>A	ENST00000269197.5	+	12	3348	c.3348T>A	c.(3346-3348)gcT>gcA	p.A1116A		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGCATCAAGCTCGAGCCCATC	0.522																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3346-3348)GCT>GCA		additional sex combs like 3							39.0	40.0	40.0					18																	31323160		1918	4136	6054	SO:0001819	synonymous_variant	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323160T>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3348T>A	18.37:g.31323160T>A			Somatic				ASXL3_uc002kxq.2_Silent_p.A823A	p.A1116A	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	3403	+			1116					Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	c.3348T>A	CCDS45847.1																																																																																				0.522	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			7	28	0	0	0	8.12818e-05	0	7	28				
FECH	2235	broad.mit.edu	37	18	55247425	55247425	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr18:55247425G>C	ENST00000262093.5	-	2	225	c.74C>G	c.(73-75)tCc>tGc	p.S25C	FECH_ENST00000382873.3_Missense_Mutation_p.S25C|FECH_ENST00000585699.1_Intron	NM_000140.3|NM_001012515.2	NP_000131.2|NP_001012533.1	P22830	HEMH_HUMAN	ferrochelatase	25					cellular response to dexamethasone stimulus (GO:0071549)|cholesterol metabolic process (GO:0008203)|detection of UV (GO:0009589)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|iron ion homeostasis (GO:0055072)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|regulation of gene expression (GO:0010468)|regulation of hemoglobin biosynthetic process (GO:0046984)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insecticide (GO:0017085)|response to lead ion (GO:0010288)|response to light stimulus (GO:0009416)|response to methylmercury (GO:0051597)|response to platinum ion (GO:0070541)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle assembly (GO:0034379)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferrochelatase activity (GO:0004325)|ferrous iron binding (GO:0008198)|heme binding (GO:0020037)|iron-responsive element binding (GO:0030350)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	15		Colorectal(73;0.227)				CCAGCTGCTGGATGCCACTGT	0.488																																							uc002lgq.3		NA																	0				central_nervous_system(1)	1						c.(73-75)TCC>TGC		ferrochelatase isoform b precursor							68.0	63.0	65.0					18																	55247425		2203	4300	6503	SO:0001583	missense	2235				generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding	g.chr18:55247425G>C	D00726	CCDS11964.1, CCDS32836.1	18q21.2-q21.3	2010-05-11	2010-05-11		ENSG00000066926	ENSG00000066926	4.99.1.1		3647	protein-coding gene	gene with protein product	"""protoporphyria"""	612386	"""ferrochelatase (protoporphyria)"""			1838349	Standard	NM_001012515		Approved		uc002lgp.4	P22830	OTTHUMG00000132740	ENST00000262093.5:c.74C>G	18.37:g.55247425G>C	ENSP00000262093:p.Ser25Cys		Somatic				FECH_uc002lgp.3_Missense_Mutation_p.S25C|FECH_uc002lgr.3_Translation_Start_Site	p.S25C	NM_000140	NP_000131	WXS	Illumina HiSeq	Unspecified	P22830	HEMH_HUMAN			2	191	-		Colorectal(73;0.227)	25					A8KA72|Q8IXN1|Q8NAN0	Missense_Mutation	SNP	ENST00000262093.5	37	c.74C>G	CCDS11964.1	.	.	.	.	.	.	.	.	.	.	G	3.931	-0.016206	0.07681	.	.	ENSG00000066926	ENST00000262093;ENST00000382873	D;D	0.97752	-4.52;-4.52	5.41	-3.48	0.04739	.	2.084970	0.01747	N	0.029716	D	0.93106	0.7805	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	D	0.86194	0.1614	10	0.39692	T	0.17	4.6242	12.6437	0.56723	0.0:0.0692:0.6728:0.258	.	25;25	P22830;P22830-2	HEMH_HUMAN;.	C	25	ENSP00000262093:S25C;ENSP00000372326:S25C	ENSP00000262093:S25C	S	-	2	0	FECH	53398423	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.796000	0.04575	-0.809000	0.04381	-0.274000	0.10170	TCC		0.488	FECH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256098.1			4	58	0	0	0	0.00024832	0	4	58				
ZNF532	55205	broad.mit.edu	37	18	56646334	56646334	+	Silent	SNP	G	G	A	rs199973703	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr18:56646334G>A	ENST00000336078.4	+	9	3974	c.3198G>A	c.(3196-3198)tcG>tcA	p.S1066S	ZNF532_ENST00000591083.1_Silent_p.S1066S|ZNF532_ENST00000591230.1_Silent_p.S1066S|ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000591808.1_Silent_p.S1066S|ZNF532_ENST00000589288.1_Silent_p.S1066S	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1066					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CTTTCAGCTCGTCCCACAGCC	0.507													G|||	2	0.000399361	0.0	0.0	5008	,	,		16735	0.002		0.0	False		,,,				2504	0.0						uc002lho.2		NA																	0				breast(1)|skin(1)	2						c.(3196-3198)TCG>TCA		zinc finger protein 532							118.0	118.0	118.0					18																	56646334		2203	4300	6503	SO:0001819	synonymous_variant	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56646334G>A	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3198G>A	18.37:g.56646334G>A			Somatic				ZNF532_uc002lhp.2_Silent_p.S1064S|ZNF532_uc010xeg.1_Silent_p.S1064S|ZNF532_uc002lhr.2_Silent_p.S1064S|ZNF532_uc002lhs.2_Silent_p.S1064S|ZNF532_uc010xeh.1_Silent_p.S158S	p.S1066S	NM_018181	NP_060651	WXS	Illumina HiSeq	Unspecified	Q9HCE3	ZN532_HUMAN			9	3745	+			1066			C2H2-type 9.		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	ENST00000336078.4	37	c.3198G>A	CCDS11969.1																																																																																				0.507	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		26	136	0	0	0	0.001512	0	26	136				
CBLN2	147381	broad.mit.edu	37	18	70209322	70209322	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr18:70209322G>T	ENST00000269503.4	-	3	847	c.74C>A	c.(73-75)cCg>cAg	p.P25Q	CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000585159.1_Missense_Mutation_p.P25Q|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				GCAgccgcccggctcgcgcag	0.786																																							uc002lku.2		NA																	0					0						c.(73-75)CCG>CAG		cerebellin 2 precursor							5.0	7.0	6.0					18																	70209322		2014	3965	5979	SO:0001583	missense	147381					integral to membrane		g.chr18:70209322G>T	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.74C>A	18.37:g.70209322G>T	ENSP00000269503:p.Pro25Gln		Somatic				CBLN2_uc002lkv.2_Missense_Mutation_p.P25Q	p.P25Q	NM_182511	NP_872317	WXS	Illumina HiSeq	Unspecified	Q8IUK8	CBLN2_HUMAN			2	309	-		Esophageal squamous(42;0.131)	25					Q53Z56	Missense_Mutation	SNP	ENST00000269503.4	37	c.74C>A	CCDS11999.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868512	0.32977	.	.	ENSG00000141668	ENST00000269503	T	0.81247	-1.47	3.65	1.71	0.24356	.	1.518430	0.03808	N	0.265443	T	0.70298	0.3208	L	0.29908	0.895	0.80722	D	1	B	0.28324	0.207	B	0.18263	0.021	T	0.54820	-0.8236	10	0.51188	T	0.08	-7.0492	6.466	0.21981	0.1042:0.3516:0.5442:0.0	.	25	Q8IUK8	CBLN2_HUMAN	Q	25	ENSP00000269503:P25Q	ENSP00000269503:P25Q	P	-	2	0	CBLN2	68360302	0.911000	0.30947	0.975000	0.42487	0.812000	0.45895	2.131000	0.42074	0.147000	0.19030	0.462000	0.41574	CCG		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511		8	7	1	0	2.74318e-10	0.000442599	2.12349e-09	8	7				
STK11	6794	broad.mit.edu	37	19	1207096	1207096	+	Nonsense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:1207096A>T	ENST00000326873.7	+	1	1357	c.184A>T	c.(184-186)Aag>Tag	p.K62*	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTTACGGCAAGGTGAAGGA	0.617		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(3)|p.G52_P179del(1)	cervix(15)|lung(3)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(184-186)AAG>TAG		serine/threonine protein kinase 11							43.0	46.0	45.0					19																	1207096		2085	4201	6286	SO:0001587	stop_gained	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1207096A>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.184A>T	19.37:g.1207096A>T	ENSP00000324856:p.Lys62*	TSP Lung(3;<1E-08)	Somatic					p.K62*	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	1	1299	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	62			ATP (By similarity).|Protein kinase.		B2RBX7|E7EW76	Nonsense_Mutation	SNP	ENST00000326873.7	37	c.184A>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	48	14.727142	0.99807	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	3.9	3.9	0.45041	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.9919	11.9419	0.52905	1.0:0.0:0.0:0.0	.	.	.	.	X	62	.	ENSP00000324856:K62X	K	+	1	0	STK11	1158096	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.835000	0.92100	1.416000	0.47057	0.379000	0.24179	AAG		0.617	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		9	12	0	0	0	0.00136819	0	9	12				
ZNF227	7770	broad.mit.edu	37	19	44739842	44739842	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:44739842C>A	ENST00000313040.7	+	6	1464	c.1259C>A	c.(1258-1260)gCt>gAt	p.A420D	ZNF227_ENST00000391961.2_Missense_Mutation_p.A369D|ZNF227_ENST00000589005.1_Missense_Mutation_p.A369D	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				TTCACTCAGGCTGCACATTTT	0.488																																							uc002oyu.2		NA																	0				ovary(1)	1						c.(1258-1260)GCT>GAT		zinc finger protein 227							85.0	88.0	87.0					19																	44739842		2203	4300	6503	SO:0001583	missense	7770				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44739842C>A	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1259C>A	19.37:g.44739842C>A	ENSP00000321049:p.Ala420Asp		Somatic				ZNF227_uc010xwu.1_Missense_Mutation_p.A369D|ZNF227_uc002oyv.2_Missense_Mutation_p.A420D|ZNF227_uc010xwv.1_Missense_Mutation_p.A369D|ZNF227_uc010xww.1_Missense_Mutation_p.A341D|ZNF227_uc002oyw.2_Missense_Mutation_p.A392D|ZNF227_uc010ejh.2_Missense_Mutation_p.A413D|ZNF235_uc002oyx.1_Intron	p.A420D	NM_182490	NP_872296	WXS	Illumina HiSeq	Unspecified	Q86WZ6	ZN227_HUMAN			6	1464	+		Prostate(69;0.0435)	420			C2H2-type 6.		B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	c.1259C>A	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494730	0.44352	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.00832	5.64;5.64	4.55	0.932	0.19466	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01353	0.0044	L	0.37750	1.13	0.09310	N	1	P;D;P;P	0.67145	0.956;0.996;0.956;0.956	P;P;B;P	0.53006	0.527;0.715;0.366;0.527	T	0.53676	-0.8405	9	0.42905	T	0.14	.	2.5647	0.04780	0.1634:0.5146:0.1595:0.1625	.	341;399;372;420	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	D	420;377;369;399;121	ENSP00000321049:A420D;ENSP00000375823:A369D	ENSP00000321049:A420D	A	+	2	0	ZNF227	49431682	0.000000	0.05858	0.900000	0.35374	0.984000	0.73092	-2.475000	0.00987	0.991000	0.38814	0.563000	0.77884	GCT		0.488	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		10	48	1	0	3.86212e-05	0.000673444	0.000248141	10	48				
GYS1	2997	broad.mit.edu	37	19	49485991	49485991	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:49485991C>A	ENST00000323798.3	-	6	1123	c.927G>T	c.(925-927)cgG>cgT	p.R309R	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000541188.1_Silent_p.R229R|GYS1_ENST00000263276.6_Silent_p.R245R|GYS1_ENST00000540532.1_Intron	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	309					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAAAATGGCCCCGCACAAACT	0.552																																							uc002plp.2		NA																	0				ovary(2)	2						c.(925-927)CGG>CGT		glycogen synthase 1 (muscle) isoform 1							96.0	101.0	99.0					19																	49485991		2203	4300	6503	SO:0001819	synonymous_variant	2997				glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding	g.chr19:49485991C>A		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.927G>T	19.37:g.49485991C>A			Somatic				GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Silent_p.R245R|GYS1_uc010xzz.1_Silent_p.R229R|GYS1_uc010yaa.1_Intron	p.R309R	NM_002103	NP_002094	WXS	Illumina HiSeq	Unspecified	P13807	GYS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)	6	1168	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)	309					Q9BTT9	Silent	SNP	ENST00000323798.3	37	c.927G>T	CCDS12747.1																																																																																				0.552	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103		37	72	1	0	1.59361e-14	0.00148497	1.40259e-13	37	72				
ZNF71	58491	broad.mit.edu	37	19	57133759	57133759	+	Silent	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:57133759G>C	ENST00000328070.6	+	3	1338	c.1104G>C	c.(1102-1104)tcG>tcC	p.S368S		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		AGAACTCCTCGCTCACGCAGC	0.617																																							uc002qnm.3		NA																	0				skin(1)	1						c.(1102-1104)TCG>TCC		zinc finger protein 71							99.0	84.0	89.0					19																	57133759		2203	4300	6503	SO:0001819	synonymous_variant	58491					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57133759G>C	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1104G>C	19.37:g.57133759G>C			Somatic					p.S368S	NM_021216	NP_067039	WXS	Illumina HiSeq	Unspecified	Q9NQZ8	ZNF71_HUMAN		GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)	3	1342	+			368			C2H2-type 9.		Q15919|Q9UC09|Q9UQD3	Silent	SNP	ENST00000328070.6	37	c.1104G>C	CCDS12947.1																																																																																				0.617	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216		22	41	0	0	0	0.000720815	0	22	41				
VN1R1	57191	broad.mit.edu	37	19	57967590	57967590	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:57967590G>T	ENST00000321039.3	-	1	264	c.265C>A	c.(265-267)Caa>Aaa	p.Q89K	AC004076.9_ENST00000415705.3_Intron|AC004076.9_ENST00000596831.1_Intron	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	89					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		AAGGCCAGTTGGCTGAGAATC	0.423																																							uc002qos.1		NA																	0				ovary(1)	1						c.(265-267)CAA>AAA		vomeronasal 1 receptor 1							48.0	44.0	46.0					19																	57967590		2203	4300	6503	SO:0001583	missense	57191				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:57967590G>T	AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.265C>A	19.37:g.57967590G>T	ENSP00000322339:p.Gln89Lys		Somatic				ZNF547_uc002qpm.3_Intron	p.Q89K	NM_020633	NP_065684	WXS	Illumina HiSeq	Unspecified	Q9GZP7	VN1R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)	1	265	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)	89			Helical; Name=2; (Potential).		B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	ENST00000321039.3	37	c.265C>A	CCDS12951.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887637	0.52014	.	.	ENSG00000178201	ENST00000321039	T	0.37584	1.19	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.59307	0.2184	M	0.85197	2.74	0.09310	N	1	D	0.61080	0.989	P	0.61874	0.895	T	0.52495	-0.8568	9	0.87932	D	0	.	10.4229	0.44361	0.0:0.1987:0.8013:0.0	.	89	Q9GZP7	VN1R1_HUMAN	K	89	ENSP00000322339:Q89K	ENSP00000322339:Q89K	Q	-	1	0	VN1R1	62659402	1.000000	0.71417	0.015000	0.15790	0.001000	0.01503	2.698000	0.47068	2.362000	0.80069	0.638000	0.83543	CAA		0.423	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466464.1	NM_020633		16	40	1	0	2.32078e-09	0.000308642	1.72382e-08	16	40				
ZBTB45	84878	broad.mit.edu	37	19	59028204	59028204	+	Silent	SNP	A	A	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr19:59028204A>C	ENST00000594051.1	-	2	1317	c.837T>G	c.(835-837)gcT>gcG	p.A279A	ZBTB45_ENST00000600990.1_Silent_p.A279A|ZBTB45_ENST00000354590.3_Silent_p.A279A			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		ATACGTCCTCAGCTGACCCAG	0.627											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(164;1383 2017 5233 27540 46677)	NSCLC(164;1383 2017 5233 27540 46677)	uc002qtd.2		NA																	0					0						c.(835-837)GCT>GCG		zinc finger and BTB domain containing 45							41.0	46.0	44.0					19																	59028204		2202	4298	6500	SO:0001819	synonymous_variant	84878				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:59028204A>C	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.837T>G	19.37:g.59028204A>C			Somatic	OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1035	ZBTB45_uc002qte.2_Silent_p.A279A|ZBTB45_uc002qtf.2_Silent_p.A279A	p.A279A	NM_032792	NP_116181	WXS	Illumina HiSeq	Unspecified	Q96K62	ZBT45_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)	2	1129	-		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)	279						Silent	SNP	ENST00000594051.1	37	c.837T>G	CCDS12984.1																																																																																				0.627	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792		21	31	0	0	0	0.00152264	0	21	31				
KIDINS220	57498	broad.mit.edu	37	2	8940623	8940623	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:8940623C>A	ENST00000256707.3	-	9	988	c.807G>T	c.(805-807)ggG>ggT	p.G269G	KIDINS220_ENST00000319688.5_Silent_p.G270G|KIDINS220_ENST00000473731.1_Silent_p.G269G|KIDINS220_ENST00000427284.1_Silent_p.G269G|KIDINS220_ENST00000418530.1_Silent_p.G227G	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	269					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACACAGTATCCCCACTCTAAG	0.343																																							uc002qzc.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(805-807)GGG>GGT		kinase D-interacting substrate of 220 kDa							154.0	157.0	156.0					2																	8940623		1888	4101	5989	SO:0001819	synonymous_variant	57498				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane		g.chr2:8940623C>A	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.807G>T	2.37:g.8940623C>A			Somatic				KIDINS220_uc010yiv.1_Silent_p.G35G|KIDINS220_uc002qzd.2_Silent_p.G227G|KIDINS220_uc010yiw.1_Silent_p.G270G	p.G269G	NM_020738	NP_065789	WXS	Illumina HiSeq	Unspecified	Q9ULH0	KDIS_HUMAN			9	989	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		269			Cytoplasmic (Potential).|ANK 9.		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	c.807G>T	CCDS42650.1																																																																																				0.343	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738		79	136	1	0	7.14593e-30	0.000781405	7.34601e-29	79	136				
SLC8A1	6546	broad.mit.edu	37	2	40342578	40342578	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:40342578G>T	ENST00000403092.1	-	11	2770	c.2737C>A	c.(2737-2739)Ctc>Atc	p.L913I	SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1_ENST00000542024.1_Missense_Mutation_p.L877I|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000406785.2_Missense_Mutation_p.L877I|SLC8A1_ENST00000542756.1_Missense_Mutation_p.L908I|SLC8A1_ENST00000406391.2_Missense_Mutation_p.L877I|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.L877I|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000405269.1_Missense_Mutation_p.L877I|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.L905I|SLC8A1_ENST00000405901.3_Missense_Mutation_p.L908I|SLC8A1_ENST00000332839.4_Missense_Mutation_p.L913I|SLC8A1-AS1_ENST00000599268.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	913					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ATGGTGAAGAGAGTGACAGAG	0.577																																							uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2737-2739)CTC>ATC		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						108.0	88.0	95.0					2																	40342578		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40342578G>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2737C>A	2.37:g.40342578G>T	ENSP00000384763:p.Leu913Ile		Somatic				uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.L908I|SLC8A1_uc002rrz.2_Missense_Mutation_p.L900I|SLC8A1_uc002rsa.2_Missense_Mutation_p.L877I|SLC8A1_uc002rsd.3_Missense_Mutation_p.L877I	p.L913I	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			10	2761	-			913			Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.2737C>A	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853404	0.51270	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.94	5.94	0.96194	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.68393	0.2996	L	0.28458	0.855	0.80722	D	1	P;B;B;P	0.43578	0.811;0.226;0.429;0.51	P;B;B;B	0.60173	0.87;0.103;0.263;0.388	T	0.61686	-0.7012	10	0.26408	T	0.33	.	17.8596	0.88777	0.0:0.0:1.0:0.0	.	877;900;908;913	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	I	877;913;908;913;908;877;877;913;905;900;877;877	ENSP00000383886:L877I;ENSP00000440727:L908I;ENSP00000384763:L913I;ENSP00000385678:L908I;ENSP00000385188:L877I;ENSP00000385535:L877I;ENSP00000332931:L913I;ENSP00000384908:L905I;ENSP00000385811:L877I;ENSP00000443515:L877I	ENSP00000332931:L913I	L	-	1	0	SLC8A1	40196082	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.762000	0.85270	2.820000	0.97059	0.650000	0.86243	CTC		0.577	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		11	42	1	0	5.50884e-06	0.00136819	3.74543e-05	11	42				
VPS54	51542	broad.mit.edu	37	2	64208813	64208813	+	Silent	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:64208813T>C	ENST00000272322.4	-	3	499	c.345A>G	c.(343-345)gaA>gaG	p.E115E	VPS54_ENST00000409558.4_Silent_p.E103E			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	115					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						CTGTAAAATGTTCCTTGCTGA	0.353																																							uc002scq.2		NA																	0					0						c.(343-345)GAA>GAG		vacuolar protein sorting 54 isoform 1							157.0	149.0	152.0					2																	64208813		2203	4300	6503	SO:0001819	synonymous_variant	51542				protein transport|retrograde transport, endosome to Golgi			g.chr2:64208813T>C	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.345A>G	2.37:g.64208813T>C			Somatic				VPS54_uc002scp.2_Silent_p.E103E	p.E115E	NM_016516	NP_057600	WXS	Illumina HiSeq	Unspecified	Q9P1Q0	VPS54_HUMAN			3	508	-			115					Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Silent	SNP	ENST00000272322.4	37	c.345A>G	CCDS33208.1																																																																																				0.353	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516		41	90	0	0	0	0.000437636	0	41	90				
ALMS1	7840	broad.mit.edu	37	2	73653584	73653584	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:73653584G>T	ENST00000264448.6	+	6	1352	c.1241G>T	c.(1240-1242)gGc>gTc	p.G414V	ALMS1_ENST00000409009.1_Missense_Mutation_p.G372V|ALMS1_ENST00000377715.1_Missense_Mutation_p.G414V	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	414					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TTTGTAGAGGGCCTGCAGGGG	0.428																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(1243-1245)GGC>GTC		Alstrom syndrome 1							226.0	217.0	220.0					2																	73653584		1942	4140	6082	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73653584G>T	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.1241G>T	2.37:g.73653584G>T	ENSP00000264448:p.Gly414Val		Somatic				ALMS1_uc002sjf.1_Missense_Mutation_p.G372V	p.G415V	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			7	1355	+			414					Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.1244G>T	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867320	0.51588	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.34072	2.26;2.25;1.38	5.2	-1.84	0.07809	.	0.641007	0.13896	N	0.355229	T	0.38957	0.1060	L	0.36672	1.1	0.32506	N	0.538232	D;D	0.59767	0.986;0.986	P;P	0.57720	0.826;0.826	T	0.52290	-0.8595	10	0.62326	D	0.03	.	9.6067	0.39637	0.606:0.0:0.394:0.0	.	372;414	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	V	372;414;414	ENSP00000386627:G372V;ENSP00000264448:G414V;ENSP00000366944:G414V	ENSP00000264448:G414V	G	+	2	0	ALMS1	73507092	0.011000	0.17503	0.947000	0.38551	0.792000	0.44763	-0.009000	0.12765	-0.244000	0.09639	-0.140000	0.14226	GGC		0.428	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		84	203	1	0	1.40082e-25	0.000781405	1.36367e-24	84	203				
KIAA1211L	343990	broad.mit.edu	37	2	99448925	99448925	+	Silent	SNP	C	C	A	rs200144604		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:99448925C>A	ENST00000397899.2	-	5	757	c.426G>T	c.(424-426)ggG>ggT	p.G142G	KIAA1211L_ENST00000462314.1_5'UTR	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	142																	TGGCAGGAAGCCCCCCTGGAG	0.522																																							uc002szf.1		NA																	0					0						c.(424-426)GGG>GGT		hypothetical protein LOC343990							59.0	67.0	65.0					2																	99448925		1899	4119	6018	SO:0001819	synonymous_variant	343990							g.chr2:99448925C>A	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.426G>T	2.37:g.99448925C>A			Somatic					p.G142G	NM_207362	NP_997245	WXS	Illumina HiSeq	Unspecified	Q6NV74	CB055_HUMAN			5	720	-			142						Silent	SNP	ENST00000397899.2	37	c.426G>T	CCDS42720.1																																																																																				0.522	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362		16	53	1	0	4.7546e-09	0.000422831	3.4714e-08	16	53				
UXS1	80146	broad.mit.edu	37	2	106715213	106715213	+	Missense_Mutation	SNP	T	T	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:106715213T>G	ENST00000409501.3	-	13	1043	c.986A>C	c.(985-987)cAc>cCc	p.H329P	UXS1_ENST00000409032.1_Missense_Mutation_p.H161P|UXS1_ENST00000283148.7_Missense_Mutation_p.H334P|UXS1_ENST00000540130.1_Missense_Mutation_p.H272P			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	329					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						TAGGATTGTGTGTTCTTCTGG	0.433																																							uc002tdm.2		NA																	0				ovary(2)	2						c.(985-987)CAC>CCC		UDP-glucuronate decarboxylase 1							82.0	79.0	80.0					2																	106715213		1947	4149	6096	SO:0001583	missense	80146				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity	g.chr2:106715213T>G	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.986A>C	2.37:g.106715213T>G	ENSP00000387019:p.His329Pro		Somatic				UXS1_uc002tdk.2_5'Flank|UXS1_uc002tdl.2_Missense_Mutation_p.H161P|UXS1_uc002tdn.2_Missense_Mutation_p.H334P|UXS1_uc002tdo.2_Missense_Mutation_p.H272P	p.H329P	NM_025076	NP_079352	WXS	Illumina HiSeq	Unspecified	Q8NBZ7	UXS1_HUMAN			13	1084	-			329			Lumenal (Potential).		Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	c.986A>C	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.272825	0.59649	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000409032	D;D;D	0.96073	-3.9;-3.88;-3.9	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.93906	0.8050	L	0.55103	1.725	0.80722	D	1	B;B	0.20550	0.046;0.027	B;B	0.23716	0.048;0.022	D	0.91823	0.5469	10	0.72032	D	0.01	-13.0319	15.5345	0.75993	0.0:0.0:0.0:1.0	.	334;329	Q8NBZ7-2;Q8NBZ7	.;UXS1_HUMAN	P	334;272;329;161	ENSP00000283148:H334P;ENSP00000438265:H272P;ENSP00000387019:H329P	ENSP00000283148:H334P	H	-	2	0	UXS1	106081645	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	7.647000	0.83462	2.078000	0.62432	0.533000	0.62120	CAC		0.433	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3		14	19	0	0	0	0.000308642	0	14	19				
GLI2	2736	broad.mit.edu	37	2	121728152	121728152	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:121728152C>A	ENST00000452319.1	+	7	1089	c.1029C>A	c.(1027-1029)agC>agA	p.S343R	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.S343R|GLI2_ENST00000314490.11_Missense_Mutation_p.S15R					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				AGCTCAGCAGCAGCAGCAACT	0.617																																							uc010flp.2		NA																	0				ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13						c.(1027-1029)AGC>AGA		GLI-Kruppel family member GLI2							80.0	66.0	71.0					2																	121728152		2203	4300	6503	SO:0001583	missense	2736				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:121728152C>A		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1029C>A	2.37:g.121728152C>A	ENSP00000390436:p.Ser343Arg		Somatic				GLI2_uc002tmq.1_Missense_Mutation_p.S15R|GLI2_uc002tmr.1_Missense_Mutation_p.S15R|GLI2_uc002tmt.3_Missense_Mutation_p.S15R|GLI2_uc002tmu.3_Missense_Mutation_p.S15R|GLI2_uc002tmv.1_Missense_Mutation_p.Q214K|GLI2_uc010flo.1_Missense_Mutation_p.S218R|GLI2_uc002tmw.1_Missense_Mutation_p.S343R	p.S343R	NM_005270	NP_005261	WXS	Illumina HiSeq	Unspecified	P10070	GLI2_HUMAN			6	1059	+	Renal(3;0.0496)	Prostate(154;0.0623)	343						Missense_Mutation	SNP	ENST00000452319.1	37	c.1029C>A	CCDS33283.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.71|14.71	2.615343|2.615343	0.46631|0.46631	.|.	.|.	ENSG00000074047|ENSG00000074047	ENST00000440937|ENST00000452319;ENST00000361492;ENST00000314490	.|T;T;T	.|0.69561	.|-0.41;-0.41;2.36	4.65|4.65	3.77|3.77	0.43336|0.43336	.|.	.|0.414282	.|0.27526	.|N	.|0.018974	T|T	0.67163|0.67163	0.2864|0.2864	M|M	0.68952|0.68952	2.095|2.095	0.37864|0.37864	D|D	0.929812|0.929812	P|P;B;P;P;P	0.42908|0.46512	0.793|0.808;0.232;0.879;0.682;0.879	B|B;B;P;B;B	0.37692|0.45829	0.256|0.299;0.082;0.494;0.361;0.295	T|T	0.74290|0.74290	-0.3713|-0.3713	8|10	0.87932|0.87932	D|D	0|0	.|.	10.4675|10.4675	0.44616|0.44616	0.0:0.8422:0.0:0.1578|0.0:0.8422:0.0:0.1578	.|.	214|343;343;15;15;15	F5H4D9|P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	.|GLI2_HUMAN;.;.;.;.	K|R	214|343;343;15	.|ENSP00000390436:S343R;ENSP00000354586:S343R;ENSP00000312694:S15R	ENSP00000395688:Q214K|ENSP00000312694:S15R	Q|S	+|+	1|3	0|2	GLI2|GLI2	121444622|121444622	0.958000|0.958000	0.32768|0.32768	0.997000|0.997000	0.53966|0.53966	0.865000|0.865000	0.49528|0.49528	0.653000|0.653000	0.24902|0.24902	1.309000|1.309000	0.44985|0.44985	-0.258000|-0.258000	0.10820|0.10820	CAG|AGC		0.617	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		16	31	1	0	2.31682e-05	0.000308642	0.000152673	16	31				
CNTNAP5	129684	broad.mit.edu	37	2	125261952	125261952	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:125261952C>T	ENST00000431078.1	+	8	1507	c.1143C>T	c.(1141-1143)ccC>ccT	p.P381P		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	381	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGCTGCTGCCCGGCACCCCCC	0.512																																							uc002tno.2		NA																	0				ovary(10)	10						c.(1141-1143)CCC>CCT		contactin associated protein-like 5 precursor							77.0	72.0	74.0					2																	125261952		1865	4111	5976	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125261952C>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1143C>T	2.37:g.125261952C>T			Somatic				CNTNAP5_uc010flu.2_Silent_p.P382P	p.P381P	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	8	1507	+			381			Laminin G-like 2.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.1143C>T	CCDS46401.1																																																																																				0.512	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			25	55	0	0	0	0.00047179	0	25	55				
YWHAEP5	440917	broad.mit.edu	37	2	139046051	139046051	+	IGR	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:139046051C>A								AC069394.1 (182576 upstream) : AC097721.2 (129802 downstream)																							AGATGTTTGTCCAGTACATCC	0.413																																							uc010zbk.1		NA																	0					NA						c.(247-249)GAC>TAC		SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																																				SO:0001628	intergenic_variant	0							g.chr2:139046051C>A																													2.37:g.139046051C>A			Somatic					p.D83Y			WXS	Illumina HiSeq	Unspecified					1	390	-									Missense_Mutation	SNP		37	c.247G>T																																																																																				0	0.413									23	58	1	0	6.44725e-10	0.000295444	4.96091e-09	23	58				
SPOPL	339745	broad.mit.edu	37	2	139322544	139322544	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:139322544G>T	ENST00000280098.4	+	10	1394	c.1015G>T	c.(1015-1017)Ggg>Tgg	p.G339W		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	339					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GTGTAAAGATGGGAAAAACTG	0.363																																							uc002tvh.2		NA																	0				skin(2)|breast(1)	3						c.(1015-1017)GGG>TGG		speckle-type POZ protein-like							126.0	118.0	121.0					2																	139322544		2203	4300	6503	SO:0001583	missense	339745					nucleus		g.chr2:139322544G>T		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.1015G>T	2.37:g.139322544G>T	ENSP00000280098:p.Gly339Trp		Somatic					p.G339W	NM_001001664	NP_001001664	WXS	Illumina HiSeq	Unspecified	Q6IQ16	SPOPL_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0296)	10	1415	+			339						Missense_Mutation	SNP	ENST00000280098.4	37	c.1015G>T	CCDS33298.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687353	0.68157	.	.	ENSG00000144228	ENST00000280098	T	0.72615	-0.67	5.18	4.31	0.51392	.	0.156795	0.64402	D	0.000017	T	0.68915	0.3053	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70114	-0.4961	9	.	.	.	-3.4544	15.5866	0.76489	0.0:0.0:0.8609:0.1391	.	339	Q6IQ16	SPOPL_HUMAN	W	339	ENSP00000280098:G339W	.	G	+	1	0	SPOPL	139039014	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.174000	0.94824	1.329000	0.45376	-0.122000	0.15005	GGG		0.363	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1			12	52	1	0	0.00010058	0.00136819	0.000630464	12	52				
LRP1B	53353	broad.mit.edu	37	2	141081590	141081590	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:141081590T>C	ENST00000389484.3	-	81	13357	c.12386A>G	c.(12385-12387)tAt>tGt	p.Y4129C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4129					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCTGCTCCATATATATAATC	0.299										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12385-12387)TAT>TGT		low density lipoprotein-related protein 1B							57.0	64.0	61.0					2																	141081590		2203	4287	6490	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141081590T>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12386A>G	2.37:g.141081590T>C	ENSP00000374135:p.Tyr4129Cys	TSP Lung(27;0.18)	Somatic					p.Y4129C	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	81	13358	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4129			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12386A>G	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.8|24.8	4.565756|4.565756	0.86439|0.86439	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977|ENST00000389484;ENST00000544579	.|D	.|0.93763	.|-3.28	5.82|5.82	5.82|5.82	0.92795|0.92795	.|Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.|0.173558	.|0.39274	.|N	.|0.001409	D|D	0.97492|0.97492	0.9179|0.9179	M|M	0.92738|0.92738	3.34|3.34	0.50632|0.50632	D|D	0.999883|0.999883	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	D|D	0.98442|0.98442	1.0587|1.0587	5|10	.|0.87932	.|D	.|0	.|.	16.1875|16.1875	0.81962|0.81962	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|4129	.|Q9NZR2	.|LRP1B_HUMAN	V|C	361|4129;4067	.|ENSP00000374135:Y4129C	.|ENSP00000374135:Y4129C	M|Y	-|-	1|2	0|0	LRP1B|LRP1B	140798060|140798060	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	7.679000|7.679000	0.84048|0.84048	2.225000|2.225000	0.72522|0.72522	0.533000|0.533000	0.62120|0.62120	ATG|TAT		0.299	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		30	88	0	0	0	0.00178596	0	30	88				
RND3	390	broad.mit.edu	37	2	151343252	151343252	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:151343252T>A	ENST00000375734.2	-	2	443	c.194A>T	c.(193-195)gAa>gTa	p.E65V	RND3_ENST00000472416.1_5'UTR|RND3_ENST00000263895.4_Missense_Mutation_p.E65V|RND3_ENST00000409557.1_5'Flank	NM_001254738.1	NP_001241667.1	P61587	RND3_HUMAN	Rho family GTPase 3	65					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.106)		TGTGTCGATTTCAAAACTGGC	0.498																																							uc002txe.2		NA																	0				lung(2)	2						c.(193-195)GAA>GTA		ras homolog gene family, member E precursor							178.0	179.0	179.0					2																	151343252		2203	4300	6503	SO:0001583	missense	390				actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity	g.chr2:151343252T>A		CCDS2190.1	2q23.3	2008-02-05	2005-01-24	2005-01-27	ENSG00000115963	ENSG00000115963			671	protein-coding gene	gene with protein product		602924	"""ras homolog gene family, member E"""	ARHE		8649376	Standard	NM_001254738		Approved	RhoE, Rho8	uc002txe.3	P61587	OTTHUMG00000131859	ENST00000375734.2:c.194A>T	2.37:g.151343252T>A	ENSP00000364886:p.Glu65Val		Somatic				RND3_uc002txf.2_Missense_Mutation_p.E65V|RND3_uc002txg.2_Missense_Mutation_p.E65V|RND3_uc010zbv.1_Missense_Mutation_p.E65V|RND3_uc010zbw.1_5'UTR	p.E65V	NM_005168	NP_005159	WXS	Illumina HiSeq	Unspecified	P61587	RND3_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.106)	2	438	-			65					D3DP95|P52199	Missense_Mutation	SNP	ENST00000375734.2	37	c.194A>T	CCDS2190.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.938132	0.73557	.	.	ENSG00000115963	ENST00000375734;ENST00000263895;ENST00000439275;ENST00000454202	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.39	5.39	0.77823	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80314	0.4600	L	0.48362	1.52	0.80722	D	1	B;B;B	0.32338	0.365;0.098;0.098	P;B;B	0.45610	0.487;0.115;0.115	T	0.81558	-0.0878	10	0.87932	D	0	-1.815	14.5863	0.68328	0.0:0.0:0.0:1.0	.	65;65;65	B2R838;D3DP96;P61587	.;.;RND3_HUMAN	V	65	ENSP00000364886:E65V;ENSP00000263895:E65V;ENSP00000395997:E65V;ENSP00000411950:E65V	ENSP00000263895:E65V	E	-	2	0	RND3	151051498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.827000	0.86722	2.033000	0.60031	0.533000	0.62120	GAA		0.498	RND3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254809.1	NM_005168		23	189	0	0	0	0.001512	0	23	189				
GPD2	2820	broad.mit.edu	37	2	157435653	157435653	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:157435653G>T	ENST00000310454.6	+	15	2308	c.1936G>T	c.(1936-1938)Gtt>Ttt	p.V646F	GPD2_ENST00000409125.4_Missense_Mutation_p.V419F|GPD2_ENST00000409674.1_Missense_Mutation_p.V646F|GPD2_ENST00000438166.2_Missense_Mutation_p.V646F|GPD2_ENST00000540309.1_3'UTR	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	646	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						TATTACCATTGTTGATGTTCA	0.323																																							uc002tzf.3		NA																	0				ovary(1)	1						c.(1936-1938)GTT>TTT		glycerol-3-phosphate dehydrogenase 2,							179.0	185.0	183.0					2																	157435653		2202	4300	6502	SO:0001583	missense	2820				cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity	g.chr2:157435653G>T		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1936G>T	2.37:g.157435653G>T	ENSP00000308610:p.Val646Phe		Somatic				GPD2_uc010zch.1_Missense_Mutation_p.V419F|GPD2_uc002tzd.3_Missense_Mutation_p.V646F|GPD2_uc002tze.1_RNA	p.V646F	NM_001083112	NP_001076581	WXS	Illumina HiSeq	Unspecified	P43304	GPDM_HUMAN			15	2296	+			646			EF-hand 1.		A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	37	c.1936G>T	CCDS2202.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715847	0.48622	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000409674	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.89	5.0	0.66597	EF-hand-like domain (1);	0.170054	0.51477	D	0.000084	T	0.64670	0.2619	M	0.71581	2.175	0.46725	D	0.999176	B	0.30727	0.292	B	0.28638	0.092	T	0.66428	-0.5926	10	0.51188	T	0.08	.	5.8545	0.18712	0.0743:0.2183:0.5896:0.1179	.	646	P43304	GPDM_HUMAN	F	646;419;646;646	ENSP00000308610:V646F;ENSP00000386484:V419F;ENSP00000409708:V646F;ENSP00000386425:V646F	ENSP00000308610:V646F	V	+	1	0	GPD2	157143899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.485000	0.45250	2.788000	0.95919	0.585000	0.79938	GTT		0.323	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3			58	160	1	0	2.165e-29	0.000781405	2.20796e-28	58	160				
HOXD8	3234	broad.mit.edu	37	2	176995628	176995628	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:176995628G>C	ENST00000313173.4	+	1	1161	c.534G>C	c.(532-534)caG>caC	p.Q178H	HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000429017.1_5'UTR|HOXD8_ENST00000450510.2_Missense_Mutation_p.Q178H|HOXD8_ENST00000548663.1_Missense_Mutation_p.Q74H|HOXD8_ENST00000544999.1_Missense_Mutation_p.Q178H	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	178					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		ACTTAAATCAGAGCTCGTCTC	0.463																																							uc002uko.2		NA																	0					0						c.(532-534)CAG>CAC		homeobox D8							66.0	66.0	66.0					2																	176995628		2184	4263	6447	SO:0001583	missense	3234				anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176995628G>C		CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.534G>C	2.37:g.176995628G>C	ENSP00000315949:p.Gln178His		Somatic				uc002ukl.1_5'Flank|uc002ukm.1_5'Flank|HOXD8_uc002ukn.2_5'UTR|HOXD8_uc002ukp.2_Missense_Mutation_p.Q178H	p.Q178H	NM_019558	NP_062458	WXS	Illumina HiSeq	Unspecified	P13378	HXD8_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)	1	1152	+			178					F8WBG7|Q5BL00|Q8IXZ1	Missense_Mutation	SNP	ENST00000313173.4	37	c.534G>C	CCDS2268.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655261	0.29425	.	.	ENSG00000175879	ENST00000313173;ENST00000544999;ENST00000548663;ENST00000450510	T;T;D;T	0.95622	0.83;0.83;-3.76;0.83	4.63	3.74	0.42951	Homeodomain-like (1);	0.000000	0.56097	D	0.000036	D	0.92087	0.7492	L	0.46157	1.445	0.36929	D	0.891799	B;P	0.36392	0.353;0.551	B;B	0.32762	0.152;0.143	D	0.92258	0.5814	10	0.51188	T	0.08	.	12.9945	0.58638	0.0:0.0:0.7072:0.2928	.	178;178	Q8IXZ1;P13378	.;HXD8_HUMAN	H	178;178;74;178	ENSP00000315949:Q178H;ENSP00000437431:Q178H;ENSP00000448196:Q74H;ENSP00000409026:Q178H	ENSP00000315949:Q178H	Q	+	3	2	HOXD8	176703874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.316000	0.65815	1.039000	0.40074	0.655000	0.94253	CAG		0.463	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255694.1			28	69	0	0	0	0.001512	0	28	69				
CERKL	375298	broad.mit.edu	37	2	182423393	182423393	+	Silent	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:182423393G>T	ENST00000339098.5	-	6	797	c.798C>A	c.(796-798)gcC>gcA	p.A266A	CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000409440.3_Silent_p.A222A|CERKL_ENST00000410087.3_Silent_p.A240A|CERKL_ENST00000374969.2_Intron|CERKL_ENST00000374970.2_Intron			Q49MI3	CERKL_HUMAN	ceramide kinase-like	266	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GCAAAGCATGGGCTACTTCGC	0.448																																							uc002unx.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(796-798)GCC>GCA		ceramide kinase-like isoform b							120.0	119.0	119.0					2																	182423393		1977	4160	6137	SO:0001819	synonymous_variant	375298				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity	g.chr2:182423393G>T	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.798C>A	2.37:g.182423393G>T			Somatic				CERKL_uc002uny.2_Silent_p.A240A|CERKL_uc010zfm.1_Silent_p.A222A|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Silent_p.A35A|CERKL_uc002uoe.2_Silent_p.A240A	p.A266A	NM_001030311	NP_001025482	WXS	Illumina HiSeq	Unspecified	Q49MI3	CERKL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		6	899	-			266			DAGKc.		B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Silent	SNP	ENST00000339098.5	37	c.798C>A	CCDS42789.1																																																																																				0.448	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1			21	55	1	0	3.8784e-16	0.00188189	3.48514e-15	21	55				
ANKAR	150709	broad.mit.edu	37	2	190569878	190569878	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:190569878A>G	ENST00000520309.1	+	8	1926	c.1838A>G	c.(1837-1839)tAt>tGt	p.Y613C	ANKAR_ENST00000313581.4_Missense_Mutation_p.Y613C|ANKAR_ENST00000438402.2_Missense_Mutation_p.Y613C|ANKAR_ENST00000281412.6_Missense_Mutation_p.Y377C|ANKAR_ENST00000431575.2_Missense_Mutation_p.Y542C	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	613						integral component of membrane (GO:0016021)		p.Y613C(1)|p.Y542C(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GCCGCTTTCTATGACAACGTT	0.413																																							uc002uqw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1624-1626)TAT>TGT		ankyrin and armadillo repeat containing							166.0	159.0	161.0					2																	190569878		2203	4300	6503	SO:0001583	missense	150709					integral to membrane	binding	g.chr2:190569878A>G	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1838A>G	2.37:g.190569878A>G	ENSP00000427882:p.Tyr613Cys		Somatic				ANKAR_uc002uqu.2_RNA	p.Y542C	NM_144708	NP_653309	WXS	Illumina HiSeq	Unspecified	Q7Z5J8	ANKAR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)		7	1625	+			613			ANK 3.		Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	ENST00000520309.1	37	c.1625A>G	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.088133	0.76642	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.49	5.49	0.81192	.	0.000000	0.47093	D	0.000243	T	0.71451	0.3341	M	0.64404	1.975	0.48571	D	0.999671	.	.	.	.	.	.	T	0.71988	-0.4426	8	0.45353	T	0.12	-17.9306	14.5683	0.68194	1.0:0.0:0.0:0.0	.	.	.	.	C	613;613;613;542;377	ENSP00000427882:Y613C;ENSP00000313513:Y613C;ENSP00000397243:Y613C;ENSP00000393043:Y542C;ENSP00000281412:Y377C	ENSP00000281412:Y377C	Y	+	2	0	ANKAR	190278123	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	4.665000	0.61547	2.081000	0.62600	0.459000	0.35465	TAT		0.413	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708		43	93	0	0	0	0.000437636	0	43	93				
DNAH7	56171	broad.mit.edu	37	2	196774919	196774919	+	Splice_Site	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:196774919T>A	ENST00000312428.6	-	25	4036	c.3936A>T	c.(3934-3936)agA>agT	p.R1312S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1312	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAAATAAGGTTCTGAAACATA	0.408																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(3934-3936)AGA>AGT		dynein, axonemal, heavy chain 7							43.0	41.0	41.0					2																	196774919		1829	4098	5927	SO:0001630	splice_region_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196774919T>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3936-1A>T	2.37:g.196774919T>A			Somatic					p.R1312S	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			25	4037	-			1312			AAA 1 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.3936A>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	19.23	3.787935	0.70337	.	.	ENSG00000118997	ENST00000312428	T	0.09073	3.02	5.6	3.22	0.36961	.	0.161482	0.46442	D	0.000289	T	0.24699	0.0599	M	0.79614	2.46	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.00338	-1.1806	10	0.66056	D	0.02	.	7.3768	0.26833	0.0:0.3892:0.0:0.6108	.	1312	Q8WXX0	DYH7_HUMAN	S	1312	ENSP00000311273:R1312S	ENSP00000311273:R1312S	R	-	3	2	DNAH7	196483164	0.998000	0.40836	1.000000	0.80357	0.936000	0.57629	0.383000	0.20651	0.409000	0.25649	0.533000	0.62120	AGA		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	Missense_Mutation	10	21	0	0	0	0.000673444	0	10	21				
ERBB4	2066	broad.mit.edu	37	2	212248358	212248358	+	Missense_Mutation	SNP	G	G	T	rs375899745		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:212248358G>T	ENST00000342788.4	-	28	4219	c.3909C>A	c.(3907-3909)caC>caA	p.H1303Q	ERBB4_ENST00000436443.1_Missense_Mutation_p.H1287Q|ERBB4_ENST00000402597.1_Missense_Mutation_p.H1293Q	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1303					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CAGTATTCCGGTGTCTGTAAG	0.537										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(3907-3909)CAC>CAA		v-erb-a erythroblastic leukemia viral oncogene							62.0	65.0	64.0					2																	212248358		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212248358G>T	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3909C>A	2.37:g.212248358G>T	ENSP00000342235:p.His1303Gln	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.H1287Q|ERBB4_uc010zji.1_Missense_Mutation_p.H1293Q|ERBB4_uc010zjj.1_Missense_Mutation_p.H1277Q	p.H1303Q	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	28	4007	-		Renal(323;0.06)|Lung NSC(271;0.197)	1303			Cytoplasmic (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.3909C>A	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.730234	0.30684	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.73258	-0.72;-0.73;-0.72	5.35	5.35	0.76521	.	0.058416	0.64402	D	0.000002	T	0.48021	0.1477	N	0.01576	-0.805	0.50171	D	0.999854	B;B;B;B	0.13145	0.001;0.007;0.001;0.001	B;B;B;B	0.14578	0.003;0.011;0.003;0.001	T	0.46091	-0.9216	10	0.41790	T	0.15	.	19.2448	0.93898	0.0:0.0:1.0:0.0	.	1277;1293;1287;1303	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	Q	1303;1287;1293	ENSP00000342235:H1303Q;ENSP00000403204:H1287Q;ENSP00000385565:H1293Q	ENSP00000342235:H1303Q	H	-	3	2	ERBB4	211956603	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.573000	0.60893	2.777000	0.95525	0.557000	0.71058	CAC		0.537	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		19	53	1	0	4.96729e-08	0.00121646	3.48796e-07	19	53				
TMEM169	92691	broad.mit.edu	37	2	216964934	216964934	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:216964934A>G	ENST00000295658.4	+	3	770	c.563A>G	c.(562-564)tAc>tGc	p.Y188C	TMEM169_ENST00000437356.2_Missense_Mutation_p.Y188C|TMEM169_ENST00000406027.2_Missense_Mutation_p.Y188C|TMEM169_ENST00000454545.1_Missense_Mutation_p.Y188C	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	188						integral component of membrane (GO:0016021)		p.Y188C(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCACCTGGTACAACATCTTC	0.502																																							uc010zjr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(562-564)TAC>TGC		transmembrane protein 169							298.0	246.0	263.0					2																	216964934		2203	4300	6503	SO:0001583	missense	92691					integral to membrane		g.chr2:216964934A>G	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.563A>G	2.37:g.216964934A>G	ENSP00000295658:p.Tyr188Cys		Somatic				TMEM169_uc010zjs.1_Missense_Mutation_p.Y188C|TMEM169_uc002vfw.2_Missense_Mutation_p.Y188C|TMEM169_uc002vfv.3_Missense_Mutation_p.Y188C	p.Y188C	NM_001142310	NP_001135782	WXS	Illumina HiSeq	Unspecified	Q96HH4	TM169_HUMAN		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	889	+		Renal(323;0.0651)	188			Cytoplasmic (Potential).		B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	c.563A>G	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.088877	0.76756	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.77458	0.4133	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78833	-0.2048	8	.	.	.	-6.3997	13.5509	0.61732	1.0:0.0:0.0:0.0	.	188	Q96HH4	TM169_HUMAN	C	188	.	.	Y	+	2	0	TMEM169	216673179	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.120000	0.94369	1.978000	0.57642	0.533000	0.62120	TAC		0.502	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390		65	126	0	0	0	0.000781405	0	65	126				
SPHKAP	80309	broad.mit.edu	37	2	228996758	228996758	+	Nonsense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:228996758G>A	ENST00000392056.3	-	2	122	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	SPHKAP_ENST00000344657.5_Nonsense_Mutation_p.Q26*	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	26						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCTCTGCCCTGCTGCGGTTCC	0.488																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(76-78)CAG>TAG		sphingosine kinase type 1-interacting protein							87.0	91.0	89.0					2																	228996758		2203	4300	6503	SO:0001587	stop_gained	80309					cytoplasm	protein binding	g.chr2:228996758G>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.76C>T	2.37:g.228996758G>A	ENSP00000375909:p.Gln26*		Somatic				SPHKAP_uc002vpp.2_Nonsense_Mutation_p.Q26*|SPHKAP_uc010zlx.1_Nonsense_Mutation_p.Q26*	p.Q26*	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	2	123	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	26					Q68DA3|Q68DR8|Q9C0I5	Nonsense_Mutation	SNP	ENST00000392056.3	37	c.76C>T	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662970	0.67700	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	.	.	.	5.93	5.93	0.95920	.	0.600804	0.14610	N	0.309089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	15.854	0.78960	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	ENSP00000339886:Q26X	Q	-	1	0	SPHKAP	228705002	0.997000	0.39634	0.847000	0.33407	0.112000	0.19704	3.534000	0.53568	2.826000	0.97356	0.655000	0.94253	CAG		0.488	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		35	92	0	0	0	0.00148497	0	35	92				
UGT1A10	54575	broad.mit.edu	37	2	234546000	234546000	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:234546000C>A	ENST00000344644.5	+	1	901	c.832C>A	c.(832-834)Cat>Aat	p.H278N	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Missense_Mutation_p.H278N	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	278					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	TATCAACTGTCATCAGGGAAA	0.413																																							uc002vur.2		NA																	0				ovary(2)|skin(1)	3						c.(832-834)CAT>AAT		UDP glycosyltransferase 1 family, polypeptide							199.0	191.0	194.0					2																	234546000		2203	4300	6503	SO:0001583	missense	54575				flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding	g.chr2:234546000C>A	U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.832C>A	2.37:g.234546000C>A	ENSP00000343838:p.His278Asn		Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.H278N	p.H278N	NM_019075	NP_061948	WXS	Illumina HiSeq	Unspecified	Q9HAW8	UD110_HUMAN		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	1	878	+		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)	278					O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	ENST00000344644.5	37	c.832C>A	CCDS33403.1	.	.	.	.	.	.	.	.	.	.	C	0.093	-1.163489	0.01673	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.58940	0.3;0.3	3.56	1.63	0.23807	.	.	.	.	.	T	0.36331	0.0963	N	0.11789	0.175	0.09310	N	1	B;B	0.15473	0.013;0.011	B;B	0.16722	0.016;0.014	T	0.27739	-1.0065	9	0.59425	D	0.04	.	6.2171	0.20661	0.3101:0.4424:0.2475:0.0	.	278;278	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	N	278	ENSP00000343838:H278N;ENSP00000362544:H278N	ENSP00000343838:H278N	H	+	1	0	UGT1A10	234210739	0.000000	0.05858	0.089000	0.20774	0.306000	0.27790	0.040000	0.13905	0.282000	0.22254	-0.750000	0.03501	CAT		0.413	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130986.1	NM_019075		76	224	1	0	5.02048e-33	0.000781405	5.24497e-32	76	224				
TTI1	9675	broad.mit.edu	37	20	36640312	36640312	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:36640312T>A	ENST00000373448.2	-	3	2145	c.1907A>T	c.(1906-1908)cAg>cTg	p.Q636L	TTI1_ENST00000449821.1_Missense_Mutation_p.Q636L|TTI1_ENST00000373447.3_Missense_Mutation_p.Q636L|TTI1_ENST00000487362.1_5'UTR	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	636					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						ATATGCAAACTGGCCAATTCC	0.433																																							uc002xhl.2		NA																	0					0						c.(1906-1908)CAG>CTG		hypothetical protein LOC9675							121.0	117.0	118.0					20																	36640312		2203	4300	6503	SO:0001583	missense	9675						binding	g.chr20:36640312T>A	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.1907A>T	20.37:g.36640312T>A	ENSP00000362547:p.Gln636Leu		Somatic				KIAA0406_uc002xhm.2_Missense_Mutation_p.Q636L	p.Q636L	NM_014657	NP_055472	WXS	Illumina HiSeq	Unspecified	O43156	TTI1_HUMAN			3	2116	-		Myeloproliferative disorder(115;0.00874)	636					D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	c.1907A>T	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	T	7.354	0.623516	0.14193	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.68025	-0.3;-0.3;-0.3	5.23	1.63	0.23807	Armadillo-type fold (1);	0.416980	0.30658	N	0.009141	T	0.43211	0.1237	N	0.22421	0.69	0.26115	N	0.98062	B	0.02656	0.0	B	0.04013	0.001	T	0.17137	-1.0379	10	0.10902	T	0.67	-3.7802	6.3567	0.21404	0.0:0.5109:0.0:0.4891	.	636	O43156	TTI1_HUMAN	L	636	ENSP00000362547:Q636L;ENSP00000362546:Q636L;ENSP00000407270:Q636L	ENSP00000362546:Q636L	Q	-	2	0	TTI1	36073726	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.513000	0.35823	0.448000	0.26722	0.533000	0.62120	CAG		0.433	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		64	55	0	0	0	0.000781405	0	64	55				
ZNF217	7764	broad.mit.edu	37	20	52192804	52192804	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:52192804G>A	ENST00000371471.2	-	4	2924	c.2499C>T	c.(2497-2499)gcC>gcT	p.A833A	ZNF217_ENST00000302342.3_Silent_p.A833A|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	833					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GTTGCCTGGTGGCGGCCCCTT	0.517																																							uc002xwq.3		NA																	0				skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(2497-2499)GCC>GCT		zinc finger protein 217							83.0	92.0	89.0					20																	52192804		2203	4300	6503	SO:0001819	synonymous_variant	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52192804G>A	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2499C>T	20.37:g.52192804G>A			Somatic				ZNF217_uc010gij.1_Silent_p.A825A	p.A833A	NM_006526	NP_006517	WXS	Illumina HiSeq	Unspecified	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		3	2770	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		833					E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	c.2499C>T	CCDS13443.1																																																																																				0.517	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		65	78	0	0	0	0.000781405	0	65	78				
PCK1	5105	broad.mit.edu	37	20	56136641	56136641	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:56136641C>A	ENST00000319441.4	+	2	338	c.174C>A	c.(172-174)ggC>ggA	p.G58G	PCK1_ENST00000535860.1_5'UTR|PCK1_ENST00000543666.1_5'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	58					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GGCTTCTGGGCCAGATGGAGG	0.602																																							uc002xyn.3		NA																	0				skin(1)	1						c.(172-174)GGC>GGA		cytosolic phosphoenolpyruvate carboxykinase 1							80.0	80.0	80.0					20																	56136641		2203	4300	6503	SO:0001819	synonymous_variant	5105				gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity	g.chr20:56136641C>A		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.174C>A	20.37:g.56136641C>A			Somatic				PCK1_uc010zzm.1_5'UTR	p.G58G	NM_002591	NP_002582	WXS	Illumina HiSeq	Unspecified	P35558	PCKGC_HUMAN	BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)		2	337	+	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		58					A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	37	c.174C>A	CCDS13460.1																																																																																				0.602	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2			11	111	1	0	1.58986e-06	0.000673444	1.0925e-05	11	111				
PCK1	5105	broad.mit.edu	37	20	56138656	56138656	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:56138656G>A	ENST00000319441.4	+	6	998	c.834G>A	c.(832-834)aaG>aaA	p.K278K	PCK1_ENST00000535860.1_Silent_p.K146K|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	278					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GTGAGAAGAAGTACCTGGCGG	0.557																																							uc002xyn.3		NA																	0				skin(1)	1						c.(832-834)AAG>AAA		cytosolic phosphoenolpyruvate carboxykinase 1							65.0	66.0	65.0					20																	56138656		2203	4300	6503	SO:0001819	synonymous_variant	5105				gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity	g.chr20:56138656G>A		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.834G>A	20.37:g.56138656G>A			Somatic				PCK1_uc010zzm.1_Intron	p.K278K	NM_002591	NP_002582	WXS	Illumina HiSeq	Unspecified	P35558	PCKGC_HUMAN	BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)		6	997	+	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		278					A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	37	c.834G>A	CCDS13460.1																																																																																				0.557	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2			9	50	0	0	0	0.000442599	0	9	50				
SS18L1	26039	broad.mit.edu	37	20	60736500	60736500	+	Silent	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:60736500G>T	ENST00000331758.3	+	4	266	c.240G>T	c.(238-240)acG>acT	p.T80T	SS18L1_ENST00000421564.1_Silent_p.T80T|SS18L1_ENST00000370848.4_Silent_p.T83T	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	80	N-terminal auto-inhibitory domain; necessary for interaction with SMARCA4/BRG1. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			AGCCGCCCACGCAGAACATGA	0.622			T	SSX1	synovial sarcoma																																		uc002ycb.2		NA		Dom	yes		20	20q13.3	26039	T	synovial sarcoma translocation gene on chromosome 18-like 1			M	SSX1		synovial sarcoma		0				ovary(2)	2						c.(238-240)ACG>ACT		SS18-like protein 1							30.0	36.0	34.0					20																	60736500		2203	4299	6502	SO:0001819	synonymous_variant	26039				chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome kinetochore		g.chr20:60736500G>T	AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.240G>T	20.37:g.60736500G>T			Somatic				SS18L1_uc011aaa.1_Silent_p.T80T|SS18L1_uc002ybz.1_RNA|SS18L1_uc002yca.1_RNA|SS18L1_uc002ycc.1_RNA	p.T80T	NM_198935	NP_945173	WXS	Illumina HiSeq	Unspecified	O75177	CREST_HUMAN	BRCA - Breast invasive adenocarcinoma(19;1.92e-08)		4	295	+	Breast(26;3.97e-09)		80			N-terminal auto-inhibitory domain; necessary for interaction with SMARCA4/BRG1 (By similarity).		A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Silent	SNP	ENST00000331758.3	37	c.240G>T	CCDS13491.1																																																																																				0.622	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2			6	39	1	0	0.00116845	0.00116845	0.00711589	6	39				
DIDO1	11083	broad.mit.edu	37	20	61512066	61512066	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr20:61512066G>T	ENST00000266070.4	-	16	5567	c.5242C>A	c.(5242-5244)Ccc>Acc	p.P1748T	DIDO1_ENST00000395343.1_Missense_Mutation_p.P1748T	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1748	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGAAACGGGGGCTGAGAGCCC	0.677																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(5242-5244)CCC>ACC		death inducer-obliterator 1 isoform c							41.0	52.0	48.0					20																	61512066		2203	4295	6498	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61512066G>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5242C>A	20.37:g.61512066G>T	ENSP00000266070:p.Pro1748Thr		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.P1748T	p.P1748T	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			16	5506	-	Breast(26;5.68e-08)		1748			Pro-rich.		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.5242C>A	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917028	0.33815	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.10288	2.89;2.89	5.17	2.82	0.32997	.	0.175399	0.27159	N	0.020647	T	0.07052	0.0179	L	0.34521	1.04	0.24451	N	0.994483	B	0.34103	0.437	B	0.32864	0.154	T	0.28396	-1.0045	10	0.27082	T	0.32	-19.0337	5.9506	0.19245	0.1192:0.1258:0.6269:0.1281	.	1748	Q9BTC0	DIDO1_HUMAN	T	1748	ENSP00000266070:P1748T;ENSP00000378752:P1748T	ENSP00000266070:P1748T	P	-	1	0	DIDO1	60982511	0.862000	0.29867	0.807000	0.32361	0.162000	0.22319	1.836000	0.39191	1.141000	0.42275	0.555000	0.69702	CCC		0.677	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		11	66	1	0	9.31168e-06	0.00185496	6.26466e-05	11	66				
TPTE	7179	broad.mit.edu	37	21	10970031	10970031	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr21:10970031C>T	ENST00000361285.4	-	6	426	c.97G>A	c.(97-99)Gag>Aag	p.E33K	TPTE_ENST00000298232.7_Missense_Mutation_p.E33K|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.E33K	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	33					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGTGCCTCCTCGGTTGCTCCT	0.393																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(97-99)GAG>AAG		transmembrane phosphatase with tensin homology							248.0	230.0	236.0					21																	10970031		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10970031C>T	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.97G>A	21.37:g.10970031C>T	ENSP00000355208:p.Glu33Lys		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.E33K|TPTE_uc002yir.1_Missense_Mutation_p.E33K|TPTE_uc010gkv.1_Intron	p.E33K	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	6	465	-			33					B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.97G>A	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	C	1.681	-0.506473	0.04231	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.95137	-3.4;-3.62;-3.49	0.725	-0.767	0.11016	.	.	.	.	.	T	0.79913	0.4528	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.17667	0.001;0.023;0.0	B;B;B	0.08055	0.001;0.003;0.0	T	0.69873	-0.5027	9	0.06236	T	0.91	.	3.4121	0.07363	0.5411:0.4589:0.0:0.0	.	33;33;33	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	K	33	ENSP00000298232:E33K;ENSP00000355208:E33K;ENSP00000344441:E33K	ENSP00000298232:E33K	E	-	1	0	TPTE	9991902	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.951000	0.00678	-0.260000	0.09418	0.194000	0.17425	GAG		0.393	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			39	143	0	0	0	0.000437636	0	39	143				
SYNJ1	8867	broad.mit.edu	37	21	34037310	34037310	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr21:34037310G>A	ENST00000322229.7	-	17	2216	c.2217C>T	c.(2215-2217)aaC>aaT	p.N739N	SYNJ1_ENST00000433931.2_Silent_p.N778N|SYNJ1_ENST00000382491.3_Silent_p.N734N|SYNJ1_ENST00000382499.2_Silent_p.N778N|SYNJ1_ENST00000357345.3_Silent_p.N739N			O43426	SYNJ1_HUMAN	synaptojanin 1	739	Catalytic. {ECO:0000255}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TAACTTCTTCGTTAGGGAGAT	0.353																																							uc002yqh.2		NA																	0				ovary(4)|skin(1)	5						c.(2332-2334)AAC>AAT		synaptojanin 1 isoform a							119.0	113.0	115.0					21																	34037310		2203	4300	6503	SO:0001819	synonymous_variant	8867						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr21:34037310G>A	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.2217C>T	21.37:g.34037310G>A			Somatic				SYNJ1_uc011ads.1_Silent_p.N734N|SYNJ1_uc002yqf.2_Silent_p.N739N|SYNJ1_uc002yqg.2_Silent_p.N734N|SYNJ1_uc002yqi.2_Silent_p.N778N	p.N778N	NM_003895	NP_003886	WXS	Illumina HiSeq	Unspecified	O43426	SYNJ1_HUMAN			18	2334	-			739			Catalytic (Potential).		O43425|O94984|Q4KMR1	Silent	SNP	ENST00000322229.7	37	c.2334C>T	CCDS54484.1																																																																																				0.353	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				9	32	0	0	0	0.000978159	0	9	32				
RUNX1	861	broad.mit.edu	37	21	36231782	36231782	+	Missense_Mutation	SNP	C	C	T	rs74315450		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr21:36231782C>T	ENST00000344691.4	-	3	2098	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	RUNX1_ENST00000325074.5_Missense_Mutation_p.R189Q|RUNX1_ENST00000399240.1_Missense_Mutation_p.R174Q|RUNX1_ENST00000486278.2_Missense_Mutation_p.R177Q|RUNX1_ENST00000437180.1_Missense_Mutation_p.R201Q|RUNX1_ENST00000358356.5_Missense_Mutation_p.R174Q|RUNX1_ENST00000300305.3_Missense_Mutation_p.R201Q	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	174	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.		R -> Q (in FPDMM; impaired phosphorylation). {ECO:0000269|PubMed:10508512, ECO:0000269|PubMed:18695000}.		behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R201Q(8)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						TCGAGGTTCTCGGGGCCCATC	0.552			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																		uc002yuh.2		NA		Dom	yes		21	21q22.3	861	T	runt-related transcription factor 1  (AML1)			L	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4		AML|preB- ALL|T-ALL		8	Substitution - Missense(8)	p.R201Q(7)|p.T174T(1)	haematopoietic_and_lymphoid_tissue(8)	haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387	GRCh37	CM992140	RUNX1	M	rs74315450	c.(520-522)CGA>CAA		runt-related transcription factor 1 isoform							265.0	232.0	243.0					21																	36231782		2203	4300	6503	SO:0001583	missense	861	Platelet_disorder_associated_with_Myeloid_Malignancies			myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr21:36231782C>T	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.521G>A	21.37:g.36231782C>T	ENSP00000340690:p.Arg174Gln		Somatic				RUNX1_uc002yui.2_Missense_Mutation_p.R174Q|RUNX1_uc010gmu.2_Missense_Mutation_p.R201Q|RUNX1_uc010gmv.2_Missense_Mutation_p.R201Q|RUNX1_uc002yuj.3_Missense_Mutation_p.R69Q|RUNX1_uc002yuk.3_Missense_Mutation_p.R201Q|RUNX1_uc002yum.1_Missense_Mutation_p.R69Q|RUNX1_uc010gmw.1_Missense_Mutation_p.R201Q|RUNX1_uc002yuo.1_Missense_Mutation_p.R174Q|RUNX1_uc002yur.1_Missense_Mutation_p.R69Q|uc002yus.1_RNA	p.R174Q	NM_001001890	NP_001001890	WXS	Illumina HiSeq	Unspecified	Q01196	RUNX1_HUMAN			3	2099	-			174	R->A: Strongly reduces DNA-binding.|Missing: No DNA-binding.	R -> Q (in FPDMM; impaired phosphorylation).	Interaction with DNA.|Runt.		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	ENST00000344691.4	37	c.521G>A	CCDS42922.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209326	0.95069	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000399245;ENST00000358356;ENST00000399237;ENST00000486278	D;D;D;D;D;D;D;D	0.99706	-6.47;-6.47;-6.47;-6.47;-6.47;-6.47;-6.47;-6.47	5.12	5.12	0.69794	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	M	0.83118	2.625	0.80722	A	1	D;D;D;B;P;P;D	0.89917	1.0;1.0;0.987;0.353;0.926;0.945;0.998	D;D;P;B;B;B;D	0.80764	0.987;0.994;0.908;0.064;0.28;0.148;0.98	D	0.97754	1.0216	9	0.56958	D	0.05	-10.7194	16.0721	0.80941	0.0:1.0:0.0:0.0	.	201;174;174;177;201;189;174	Q2TAM6;Q01196-5;Q01196-3;C9JK12;Q01196-8;Q01196-10;Q01196	.;.;.;.;.;.;RUNX1_HUMAN	Q	174;201;201;189;174;177;174;189;177	ENSP00000340690:R174Q;ENSP00000300305:R201Q;ENSP00000409227:R201Q;ENSP00000319459:R189Q;ENSP00000382184:R174Q;ENSP00000351123:R174Q;ENSP00000382182:R189Q;ENSP00000438019:R177Q	ENSP00000300305:R201Q	R	-	2	0	RUNX1	35153652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.486000	0.81215	2.377000	0.81083	0.655000	0.94253	CGA		0.552	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1			38	67	0	0	0	0.00128727	0	38	67				
IGLL1	3543	broad.mit.edu	37	22	23915496	23915496	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr22:23915496C>A	ENST00000330377.2	-	3	716	c.599G>T	c.(598-600)gGg>gTg	p.G200V	IGLL1_ENST00000249053.3_3'UTR|AP000345.2_ENST00000458318.1_RNA|AP000345.2_ENST00000454863.1_RNA	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	200	C region (By similarity to lambda light- chain).|Ig-like C1-type.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						CACGGTGCTCCCTTCGTGCAT	0.627																																							uc002zxd.2		NA																	0					0						c.(598-600)GGG>GTG		immunoglobulin lambda-like polypeptide 1 isoform							72.0	69.0	70.0					22																	23915496		2203	4300	6503	SO:0001583	missense	3543				immune response	extracellular region|membrane		g.chr22:23915496C>A	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.599G>T	22.37:g.23915496C>A	ENSP00000329312:p.Gly200Val		Somatic				IGLL1_uc002zxe.2_3'UTR	p.G200V	NM_020070	NP_064455	WXS	Illumina HiSeq	Unspecified	P15814	IGLL1_HUMAN			3	717	-			200			C region (By similarity to lambda light- chain).|Ig-like C1-type.		Q0P681	Missense_Mutation	SNP	ENST00000330377.2	37	c.599G>T	CCDS13809.1	.	.	.	.	.	.	.	.	.	.	N	11.31	1.600162	0.28534	.	.	ENSG00000128322	ENST00000330377	T	0.03413	3.94	2.45	2.45	0.29901	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.218004	0.32301	N	0.006287	T	0.26882	0.0658	H	0.97540	4.025	0.58432	D	0.999999	D	0.63880	0.993	D	0.79108	0.992	T	0.41610	-0.9499	10	0.87932	D	0	.	11.065	0.47970	0.0:1.0:0.0:0.0	.	200	P15814	IGLL1_HUMAN	V	200	ENSP00000329312:G200V	ENSP00000329312:G200V	G	-	2	0	IGLL1	22245496	0.001000	0.12720	0.689000	0.30133	0.020000	0.10135	0.334000	0.19787	1.363000	0.46019	0.165000	0.16767	GGG		0.627	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	NM_020070		12	34	1	0	0.00010058	0.00136819	0.000630464	12	34				
PARVG	64098	broad.mit.edu	37	22	44592093	44592093	+	Splice_Site	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr22:44592093G>T	ENST00000444313.3	+	10	1126	c.642G>T	c.(640-642)gaG>gaT	p.E214D	PARVG_ENST00000415224.1_Splice_Site_p.E214D|PARVG_ENST00000422871.1_Splice_Site_p.E214D	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	214	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				CAGTGAAAGAGGTAGGAGAGA	0.527																																							uc011aqe.1		NA																	0					0						c.(640-642)GAG>GAT		parvin, gamma							114.0	112.0	113.0					22																	44592093		2203	4300	6503	SO:0001630	splice_region_variant	64098				cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr22:44592093G>T	AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.642+1G>T	22.37:g.44592093G>T			Somatic				PARVG_uc003bep.2_Missense_Mutation_p.E214D|PARVG_uc011aqf.1_Missense_Mutation_p.E214D|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	p.E214D	NM_001137605	NP_001131077	WXS	Illumina HiSeq	Unspecified	Q9HBI0	PARVG_HUMAN			10	1066	+		Ovarian(80;0.024)|all_neural(38;0.0299)	214			CH 2.		B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Missense_Mutation	SNP	ENST00000444313.3	37	c.642G>T	CCDS14057.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170002	0.78452	.	.	ENSG00000138964	ENST00000422871;ENST00000444313;ENST00000415224	D;D;D	0.94966	-3.57;-3.57;-3.57	4.69	3.65	0.41850	Calponin homology domain (5);	0.136294	0.49916	D	0.000136	D	0.95188	0.8440	L	0.56769	1.78	0.42971	D	0.994437	D	0.63046	0.992	P	0.61003	0.882	D	0.94877	0.8035	10	0.59425	D	0.04	0.0033	10.9467	0.47304	0.096:0.0:0.9039:0.0	.	214	Q9HBI0	PARVG_HUMAN	D	214	ENSP00000391453:E214D;ENSP00000391583:E214D;ENSP00000416761:E214D	ENSP00000416761:E214D	E	+	3	2	PARVG	42923426	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.389000	0.59639	2.134000	0.65973	0.650000	0.86243	GAG		0.527	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318238.4	NM_022141	Missense_Mutation	14	51	1	0	9.31168e-06	0.00185496	6.26466e-05	14	51				
CACNA1D	776	broad.mit.edu	37	3	53752354	53752354	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:53752354T>A	ENST00000350061.5	+	10	1928	c.1417T>A	c.(1417-1419)Tct>Act	p.S473T	CACNA1D_ENST00000422281.2_Missense_Mutation_p.S473T|CACNA1D_ENST00000288139.4_Missense_Mutation_p.S473T	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	473					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGAGACTGAGTCTGTGAACAC	0.622																																							uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(1417-1419)TCT>ACT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						140.0	120.0	127.0					3																	53752354		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53752354T>A	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1417T>A	3.37:g.53752354T>A	ENSP00000288133:p.Ser473Thr		Somatic				CACNA1D_uc003dgu.3_Missense_Mutation_p.S473T|CACNA1D_uc003dgy.3_Missense_Mutation_p.S473T|CACNA1D_uc003dgw.3_Missense_Mutation_p.S120T	p.S473T	NM_001128840	NP_001122312	WXS	Illumina HiSeq	Unspecified	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	10	1580	+			473			Cytoplasmic (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.1417T>A	CCDS46848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.6|24.6	4.553482|4.553482	0.86127|0.86127	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000481085|ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	.|D;D;D;D	.|0.94138	.|-3.36;-3.36;-3.36;-3.36	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	5.753360|5.753360	0.00166|0.00166	N|N	0.000000|0.000000	D|D	0.96175|0.96175	0.8753|0.8753	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;B;B;P	.|0.56521	.|0.976;0.011;0.01;0.775	.|P;B;B;P	.|0.57776	.|0.827;0.015;0.008;0.569	D|D	0.85926|0.85926	0.1449|0.1449	6|10	.|0.46703	.|T	.|0.11	.|.	14.6721|14.6721	0.68951|0.68951	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|473;146;473;473	.|B0FYA3;Q59GD8;Q01668;Q01668-2	.|.;.;CAC1D_HUMAN;.	R|T	186|473;473;473;146	.|ENSP00000288133:S473T;ENSP00000288139:S473T;ENSP00000409174:S473T;ENSP00000418014:S146T	.|ENSP00000288139:S473T	S|S	+|+	3|1	2|0	CACNA1D|CACNA1D	53727394|53727394	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.855000|0.855000	0.48748|0.48748	7.779000|7.779000	0.85648|0.85648	2.063000|2.063000	0.61619|0.61619	0.533000|0.533000	0.62120|0.62120	AGT|TCT		0.622	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		25	36	0	0	0	0.001512	0	25	36				
CRYBG3	131544	broad.mit.edu	37	3	97596628	97596628	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:97596628A>T	ENST00000182096.4	+	1	810	c.746A>T	c.(745-747)tAt>tTt	p.Y249F		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2197							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						AAGAATTCATATGTGATGCCA	0.448																																							uc003drx.2		NA																	0					0						c.(745-747)TAT>TTT		beta-gamma crystallin domain containing 3							79.0	79.0	79.0					3																	97596628		1950	4150	6100	SO:0001583	missense	131544							g.chr3:97596628A>T			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.746A>T	3.37:g.97596628A>T	ENSP00000182096:p.Tyr249Phe		Somatic					p.Y249F	NM_153605	NP_705833	WXS	Illumina HiSeq	Unspecified					1	810	+								B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37	c.746A>T		.	.	.	.	.	.	.	.	.	.	A	0.289	-0.981497	0.02197	.	.	ENSG00000080200	ENST00000182096	T	0.73363	-0.74	5.66	-2.25	0.06888	.	2.341680	0.01516	N	0.018142	T	0.52338	0.1728	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24799	-1.0150	10	0.16896	T	0.51	.	0.7676	0.01018	0.2061:0.3076:0.154:0.3322	.	249	Q68DQ2	CRBG3_HUMAN	F	249	ENSP00000182096:Y249F	ENSP00000182096:Y249F	Y	+	2	0	CRYBG3	99079318	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	0.001000	0.13038	-0.172000	0.10779	0.454000	0.30748	TAT		0.448	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605		12	12	0	0	0	0.00185496	0	12	12				
GPR128	84873	broad.mit.edu	37	3	100373882	100373882	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:100373882C>T	ENST00000273352.3	+	12	1851	c.1583C>T	c.(1582-1584)gCg>gTg	p.A528V	GPR128_ENST00000481506.1_3'UTR|GPR128_ENST00000475887.1_Missense_Mutation_p.A233V	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	528					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ATGTGCACTGCGATTGCCGCC	0.438																																					Pancreas(87;185 1975 7223 18722)	Pancreas(87;185 1975 7223 18722)	uc003duc.2		NA																	0				ovary(3)|skin(1)	4						c.(1582-1584)GCG>GTG		G protein-coupled receptor 128 precursor							225.0	193.0	204.0					3																	100373882		2203	4300	6503	SO:0001583	missense	84873				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:100373882C>T	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1583C>T	3.37:g.100373882C>T	ENSP00000273352:p.Ala528Val		Somatic				GPR128_uc011bhc.1_Missense_Mutation_p.A229V|GPR128_uc003dud.2_Missense_Mutation_p.A51V	p.A528V	NM_032787	NP_116176	WXS	Illumina HiSeq	Unspecified	Q96K78	GP128_HUMAN			12	1851	+			528			Extracellular (Potential).		Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	c.1583C>T	CCDS2938.1	.	.	.	.	.	.	.	.	.	.	C	2.945	-0.218063	0.06101	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.35973	1.28;1.28	5.59	-6.58	0.01836	GPCR, family 2-like (1);	0.710266	0.13294	N	0.398770	T	0.13415	0.0325	N	0.04320	-0.23	0.09310	N	1	B;B	0.22800	0.007;0.075	B;B	0.24701	0.024;0.055	T	0.33548	-0.9864	10	0.02654	T	1	.	15.7992	0.78439	0.0:0.2065:0.0:0.7935	.	233;528	E9PHI0;Q96K78	.;GP128_HUMAN	V	528;233	ENSP00000273352:A528V;ENSP00000419788:A233V	ENSP00000273352:A528V	A	+	2	0	GPR128	101856572	0.000000	0.05858	0.002000	0.10522	0.051000	0.14879	-1.662000	0.01970	-1.154000	0.02825	-0.345000	0.07892	GCG		0.438	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1			20	116	0	0	0	0.00152264	0	20	116				
TIGIT	201633	broad.mit.edu	37	3	114014445	114014445	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:114014445G>A	ENST00000486257.1	+	3	372	c.115G>A	c.(115-117)Ggc>Agc	p.G39S	TIGIT_ENST00000383671.3_Missense_Mutation_p.G39S|TIGIT_ENST00000481065.1_Missense_Mutation_p.G106S			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	39	Homodimerization.|Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						AGAGAAAGGTGGCTCTATCAT	0.522																																							uc003ebg.1		NA																	0				central_nervous_system(1)	1						c.(115-117)GGC>AGC		T cell immunoreceptor with Ig and ITIM domains							152.0	152.0	152.0					3																	114014445		2203	4300	6503	SO:0001583	missense	201633				negative regulation of interleukin-12 production|negative regulation of T cell activation|positive regulation of interleukin-10 production	cell surface|integral to membrane|plasma membrane	protein binding	g.chr3:114014445G>A	AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.115G>A	3.37:g.114014445G>A	ENSP00000419085:p.Gly39Ser		Somatic					p.G39S	NM_173799	NP_776160	WXS	Illumina HiSeq	Unspecified	Q495A1	TIGIT_HUMAN			2	149	+			39			Extracellular (Potential).|Ig-like V-type.		Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	37	c.115G>A	CCDS2980.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.573197	0.28092	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	4.45	2.62	0.31277	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.646165	0.14580	N	0.310956	T	0.31513	0.0799	L	0.39467	1.215	0.29075	N	0.883061	B	0.27013	0.166	B	0.31337	0.128	T	0.20706	-1.0267	10	0.24483	T	0.36	-4.5912	6.7275	0.23365	0.2078:0.0:0.7922:0.0	.	39	Q495A1	TIGIT_HUMAN	S	18;106;39;39;18	ENSP00000418917:G18S;ENSP00000420552:G106S;ENSP00000419085:G39S;ENSP00000373167:G39S;ENSP00000419706:G18S	ENSP00000373167:G39S	G	+	1	0	TIGIT	115497135	0.861000	0.29849	1.000000	0.80357	0.576000	0.36127	0.959000	0.29240	1.219000	0.43474	0.561000	0.74099	GGC		0.522	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799		62	87	0	0	0	0.000781405	0	62	87				
MYLK	4638	broad.mit.edu	37	3	123457878	123457878	+	Missense_Mutation	SNP	G	G	A	rs559933360		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:123457878G>A	ENST00000475616.1	-	4	453	c.454C>T	c.(454-456)Cgt>Tgt	p.R152C	MYLK_ENST00000360304.3_Missense_Mutation_p.R152C|MYLK_ENST00000346322.5_Missense_Mutation_p.R152C|MYLK_ENST00000359169.1_Missense_Mutation_p.R152C|MYLK_ENST00000360772.3_Missense_Mutation_p.R152C			Q15746	MYLK_HUMAN	myosin light chain kinase	152					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ATGCTAGGACGGGTCTCCACT	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18921	0.0		0.0	False		,,,				2504	0.0						uc003ego.2		NA																	0				ovary(6)|skin(2)|stomach(1)	9						c.(454-456)CGT>TGT		myosin light chain kinase isoform 1							59.0	52.0	54.0					3																	123457878		2203	4300	6503	SO:0001583	missense	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123457878G>A	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.454C>T	3.37:g.123457878G>A	ENSP00000418335:p.Arg152Cys		Somatic				MYLK_uc011bjw.1_Missense_Mutation_p.R152C|MYLK_uc003egp.2_Missense_Mutation_p.R152C|MYLK_uc003egq.2_Missense_Mutation_p.R152C|MYLK_uc003egr.2_Missense_Mutation_p.R152C|MYLK_uc003egs.2_5'UTR|MYLK_uc010hrs.1_Missense_Mutation_p.R152C	p.R152C	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	7	736	-		Lung NSC(201;0.0496)	152					B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	c.454C>T	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956496	0.73902	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.69926	-0.44;-0.38;-0.44;-0.4;-0.38	4.52	2.71	0.32032	.	.	.	.	.	T	0.68924	0.3054	L	0.27053	0.805	0.80722	D	1	D;D;B;D;B;D	0.89917	1.0;1.0;0.163;1.0;0.163;1.0	D;D;B;D;B;P	0.91635	0.949;0.999;0.042;0.949;0.042;0.891	T	0.69807	-0.5045	9	0.59425	D	0.04	.	10.2759	0.43510	0.1769:0.0:0.8231:0.0	.	152;152;152;152;152;152	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	C	152	ENSP00000354004:R152C;ENSP00000353452:R152C;ENSP00000352088:R152C;ENSP00000320622:R152C;ENSP00000418335:R152C	ENSP00000320622:R152C	R	-	1	0	MYLK	124940568	0.989000	0.36119	0.994000	0.49952	0.977000	0.68977	1.792000	0.38754	1.256000	0.44068	0.655000	0.94253	CGT		0.527	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		6	17	0	0	0	0.000274275	0	6	17				
BFSP2	8419	broad.mit.edu	37	3	133119189	133119189	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:133119189C>T	ENST00000302334.2	+	1	351	c.262C>T	c.(262-264)Ctg>Ttg	p.L88L		NM_003571.2	NP_003562.1	Q13515	BFSP2_HUMAN	beaded filament structural protein 2, phakinin	88	Head.				cell maturation (GO:0048469)|intermediate filament cytoskeleton organization (GO:0045104)|lens fiber cell development (GO:0070307)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|urinary_tract(1)	13						CCTTCAGGGCCTGCGGAGCTC	0.642																																							uc003epn.1		NA																	0					0						c.(262-264)CTG>TTG		phakinin							45.0	52.0	50.0					3																	133119189		2203	4300	6503	SO:0001819	synonymous_variant	8419				response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens	g.chr3:133119189C>T	U48224	CCDS33859.1	3q22.1	2013-01-16			ENSG00000170819	ENSG00000170819		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1041	protein-coding gene	gene with protein product		603212					Standard	NM_003571		Approved	CP47, CP49, LIFL-L, phakinin	uc003epn.1	Q13515	OTTHUMG00000159719	ENST00000302334.2:c.262C>T	3.37:g.133119189C>T			Somatic					p.L88L	NM_003571	NP_003562	WXS	Illumina HiSeq	Unspecified	Q13515	BFSP2_HUMAN			1	400	+			88			Head.		Q14D32|Q9HBW5	Silent	SNP	ENST00000302334.2	37	c.262C>T	CCDS33859.1																																																																																				0.642	BFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357031.1			28	26	0	0	0	0.000878237	0	28	26				
ACAP2	23527	broad.mit.edu	37	3	195022341	195022341	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr3:195022341G>C	ENST00000326793.6	-	15	1588	c.1358C>G	c.(1357-1359)tCt>tGt	p.S453C		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	453	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TAAAGTTAAAGATCGTACTTT	0.323																																							uc003fun.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(1357-1359)TCT>TGT		centaurin, beta 2							48.0	52.0	51.0					3																	195022341		2200	4299	6499	SO:0001583	missense	23527				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr3:195022341G>C		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1358C>G	3.37:g.195022341G>C	ENSP00000324287:p.Ser453Cys		Somatic					p.S453C	NM_012287	NP_036419	WXS	Illumina HiSeq	Unspecified	Q15057	ACAP2_HUMAN			15	1599	-			453			Arf-GAP.		A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	c.1358C>G	CCDS33924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.899625|4.899625	0.91962|0.91962	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000450200|ENST00000326793	.|T	.|0.62941	.|-0.01	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87849|0.87849	0.6281|0.6281	H|H	0.98068|0.98068	4.14|4.14	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91702|0.91702	0.5374|0.5374	5|10	.|0.87932	.|D	.|0	.|.	19.2458|19.2458	0.93902|0.93902	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|453	.|Q15057	.|ACAP2_HUMAN	M|C	11|453	.|ENSP00000324287:S453C	.|ENSP00000324287:S453C	I|S	-|-	3|2	3|0	ACAP2|ACAP2	196503630|196503630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.813000|9.813000	0.99286|0.99286	2.783000|2.783000	0.95769|0.95769	0.655000|0.655000	0.94253|0.94253	ATC|TCT		0.323	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287		28	36	0	0	0	0.001512	0	28	36				
PDE6B	5158	broad.mit.edu	37	4	628465	628465	+	Splice_Site	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:628465G>T	ENST00000496514.1	+	2	489		c.e2-1		PDE6B_ENST00000255622.6_Splice_Site			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta						cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	TCTTGCGGCAGTGCCCTCACT	0.582																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	0					0						c.e2-1		phosphodiesterase 6B isoform 1							130.0	116.0	121.0					4																	628465		2203	4300	6503	SO:0001630	splice_region_variant	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:628465G>T	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.469-1G>T	4.37:g.628465G>T			Somatic				PDE6B_uc003gao.3_Splice_Site_p.C157_splice	p.C157_splice	NM_000283	NP_000274	WXS	Illumina HiSeq	Unspecified	P35913	PDE6B_HUMAN			2	522	+								B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Splice_Site	SNP	ENST00000496514.1	37	c.469_splice	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	g	11.75	1.730560	0.30684	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	.	.	.	4.11	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8421	0.63446	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE6B	618465	1.000000	0.71417	0.750000	0.31169	0.147000	0.21601	8.776000	0.91776	1.856000	0.53863	0.306000	0.20318	.		0.582	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	Intron	31	48	1	0	1.61788e-16	0.000409698	1.46407e-15	31	48				
DRD5	1816	broad.mit.edu	37	4	9784934	9784934	+	Silent	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:9784934C>T	ENST00000304374.2	+	1	1677	c.1281C>T	c.(1279-1281)aaC>aaT	p.N427N		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	427					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	AGGTGGACAACGACGAGGAGG	0.572																																							uc003gmb.3		NA																	0				skin(1)	1						c.(1279-1281)AAC>AAT		dopamine receptor D5	Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)						89.0	77.0	81.0					4																	9784934		2203	4300	6503	SO:0001819	synonymous_variant	1816				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane		g.chr4:9784934C>T	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1281C>T	4.37:g.9784934C>T			Somatic					p.N427N	NM_000798	NP_000789	WXS	Illumina HiSeq	Unspecified	P21918	DRD5_HUMAN			1	1677	+			427			Cytoplasmic (Potential).		B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	c.1281C>T	CCDS3405.1																																																																																				0.572	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			8	53	0	0	0	0.000157383	0	8	53				
CHRNA9	55584	broad.mit.edu	37	4	40356304	40356304	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:40356304G>T	ENST00000310169.2	+	5	1346	c.1207G>T	c.(1207-1209)Gac>Tac	p.D403Y		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	403					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	CTTAAAGAACGACCTGGGCTG	0.483																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)	Esophageal Squamous(115;1297 1602 22235 25158 43327)	uc003gva.1		NA																	0				breast(3)|skin(3)|central_nervous_system(1)	7						c.(1207-1209)GAC>TAC		cholinergic receptor, nicotinic, alpha 9	Nicotine(DB00184)						84.0	74.0	78.0					4																	40356304		2203	4300	6503	SO:0001583	missense	55584				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity	g.chr4:40356304G>T	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.1207G>T	4.37:g.40356304G>T	ENSP00000312663:p.Asp403Tyr		Somatic					p.D403Y	NM_017581	NP_060051	WXS	Illumina HiSeq	Unspecified	Q9UGM1	ACHA9_HUMAN			5	1223	+			403			Cytoplasmic (Potential).		Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	c.1207G>T	CCDS3459.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337855	0.24253	.	.	ENSG00000174343	ENST00000310169	D	0.85088	-1.94	5.72	3.99	0.46301	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.564180	0.02758	N	0.118299	D	0.83303	0.5225	L	0.52011	1.625	0.09310	N	1	B	0.31459	0.324	B	0.35182	0.197	T	0.67795	-0.5578	10	0.40728	T	0.16	.	5.7747	0.18273	0.223:0.152:0.625:0.0	.	403	Q9UGM1	ACHA9_HUMAN	Y	403	ENSP00000312663:D403Y	ENSP00000312663:D403Y	D	+	1	0	CHRNA9	40051061	0.963000	0.33076	0.996000	0.52242	0.266000	0.26442	2.182000	0.42556	1.433000	0.47394	0.561000	0.74099	GAC		0.483	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1			22	39	1	0	4.35082e-09	0.00152264	3.19474e-08	22	39				
APBB2	323	broad.mit.edu	37	4	41016079	41016079	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:41016079T>C	ENST00000295974.8	-	6	985	c.356A>G	c.(355-357)aAc>aGc	p.N119S	APBB2_ENST00000506352.1_Missense_Mutation_p.N119S|APBB2_ENST00000508593.1_Missense_Mutation_p.N119S|APBB2_ENST00000513140.1_Missense_Mutation_p.N119S	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	119					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						CAGGTTTTTGTTGGGGTCCTG	0.537																																					Ovarian(3;20 75 16686 49997)	Ovarian(3;20 75 16686 49997)	uc003gvl.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(355-357)AAC>AGC		amyloid beta A4 precursor protein-binding,							68.0	65.0	66.0					4																	41016079		1922	4142	6064	SO:0001583	missense	323				cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding	g.chr4:41016079T>C	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.356A>G	4.37:g.41016079T>C	ENSP00000295974:p.Asn119Ser		Somatic				APBB2_uc003gvm.2_Missense_Mutation_p.N119S|APBB2_uc003gvn.2_Missense_Mutation_p.N119S|APBB2_uc011byt.1_Missense_Mutation_p.N102S	p.N119S	NM_173075	NP_775098	WXS	Illumina HiSeq	Unspecified	Q92870	APBB2_HUMAN			6	986	-			119					B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	c.356A>G	CCDS54761.1	.	.	.	.	.	.	.	.	.	.	T	19.24	3.790085	0.70337	.	.	ENSG00000163697	ENST00000295974;ENST00000316212;ENST00000513140;ENST00000508593;ENST00000506352;ENST00000509446	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.76494	0.986;0.998;0.999;0.999	D;D;D;D	0.85130	0.965;0.993;0.997;0.993	T	0.09618	-1.0666	10	0.31617	T	0.26	-30.196	14.7918	0.69848	0.0:0.0:0.0:1.0	.	102;119;119;119	B4DJ88;E9PG87;Q92870-2;Q92870	.;.;.;APBB2_HUMAN	S	119;118;119;119;119;102	ENSP00000295974:N119S;ENSP00000426018:N119S;ENSP00000427211:N119S;ENSP00000421539:N119S;ENSP00000424414:N102S	ENSP00000295974:N119S	N	-	2	0	APBB2	40710836	1.000000	0.71417	0.998000	0.56505	0.659000	0.38960	7.772000	0.85439	1.894000	0.54839	0.459000	0.35465	AAC		0.537	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075		18	47	0	0	0	0.00074312	0	18	47				
KIT	3815	broad.mit.edu	37	4	55594049	55594049	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:55594049T>C	ENST00000288135.5	+	12	1932	c.1835T>C	c.(1834-1836)aTt>aCt	p.I612T		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	612	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TATGGCTTAATTAAGTCAGAT	0.483		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														uc010igr.2		1	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	Mis|O	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	Piebald trait	"""L, M, O, E"""		GIST|epithelioma	GIST|AML|TGCT|mastocytosis|mucosal melanoma		0				soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118						c.(1834-1836)ATT>ACT		v-kit Hardy-Zuckerman 4 feline sarcoma viral	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)						122.0	105.0	111.0					4																	55594049		2203	4300	6503	SO:0001583	missense	3815	Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	g.chr4:55594049T>C	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1835T>C	4.37:g.55594049T>C	ENSP00000288135:p.Ile612Thr		Somatic				KIT_uc010igs.2_Missense_Mutation_p.I608T|KIT_uc010igt.1_Missense_Mutation_p.I61T	p.I612T	NM_000222	NP_000213	WXS	Illumina HiSeq	Unspecified	P10721	KIT_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	12	1922	+	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		612			Protein kinase.|Cytoplasmic (Potential).		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	c.1835T>C	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	3.945	-0.013453	0.07727	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.81996	-1.56;-1.56	6.07	6.07	0.98685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.096369	0.45361	D	0.000371	T	0.74313	0.3700	N	0.16567	0.415	0.36573	D	0.873105	B;B;B	0.21688	0.01;0.01;0.059	B;B;B	0.28709	0.029;0.021;0.093	T	0.73020	-0.4114	10	0.29301	T	0.29	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	119;608;612	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	T	612;608	ENSP00000288135:I612T;ENSP00000390987:I608T	ENSP00000288135:I612T	I	+	2	0	KIT	55288806	1.000000	0.71417	0.967000	0.41034	0.106000	0.19336	2.243000	0.43115	2.326000	0.78906	0.533000	0.62120	ATT		0.483	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			16	49	0	0	0	0.00152264	0	16	49				
EPHA5	2044	broad.mit.edu	37	4	66213797	66213797	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:66213797G>T	ENST00000273854.3	-	15	3233	c.2633C>A	c.(2632-2634)cCc>cAc	p.P878H	EPHA5_ENST00000354839.4_Missense_Mutation_p.P856H|EPHA5_ENST00000511294.1_Missense_Mutation_p.P879H|EPHA5_ENST00000432638.2_Missense_Mutation_p.P715H	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	878	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CTCCCAGTAGGGTCTCTCTCC	0.418										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2632-2634)CCC>CAC		ephrin receptor EphA5 isoform a precursor							187.0	170.0	175.0					4																	66213797		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66213797G>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2633C>A	4.37:g.66213797G>T	ENSP00000273854:p.Pro878His	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.P810H|EPHA5_uc003hcz.2_Missense_Mutation_p.P856H|EPHA5_uc011cah.1_Missense_Mutation_p.P879H|EPHA5_uc011cai.1_Missense_Mutation_p.P857H|EPHA5_uc003hda.2_Missense_Mutation_p.P879H	p.P878H	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			15	2826	-			878			Cytoplasmic (Potential).|Protein kinase.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2633C>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932297	0.92389	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.86	5.86	0.93980	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.97278	0.9110	H	0.99042	4.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98298	1.0517	10	0.87932	D	0	.	20.1823	0.98208	0.0:0.0:1.0:0.0	.	857;879;856;878	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	H	878;715;856;879	ENSP00000273854:P878H;ENSP00000389208:P715H;ENSP00000346899:P856H;ENSP00000427638:P879H	ENSP00000273854:P878H	P	-	2	0	EPHA5	65896392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.771000	0.95319	0.650000	0.86243	CCC		0.418	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		36	75	1	0	1.04594e-18	0.00128727	9.60023e-18	36	75				
IL21	59067	broad.mit.edu	37	4	123542199	123542199	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr4:123542199G>A	ENST00000264497.3	-	0	25				IL21-AS1_ENST00000417927.1_RNA	NM_001207006.2|NM_021803.3	NP_001193935.1|NP_068575.1	Q9HBE4	IL21_HUMAN	interleukin 21						cell maturation (GO:0048469)|immune response (GO:0006955)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	cytokine receptor binding (GO:0005126)|interleukin-2 receptor binding (GO:0005134)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(3)	8						CCTTGGTCTCGTTTTCACTTC	0.463																																							uc003ies.2		NA																	0					0						c.(-34--30)AACGA>AATGA		interleukin 21							91.0	86.0	88.0					4																	123542199		2203	4300	6503			59067				cell maturation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-17 production|positive regulation of T cell proliferation|signal transduction	extracellular space	cytokine activity|interleukin-2 receptor binding	g.chr4:123542199G>A	AF254069	CCDS3727.1, CCDS75189.1	4q26-q27	2011-07-15			ENSG00000138684	ENSG00000138684		"""Interleukins and interleukin receptors"""	6005	protein-coding gene	gene with protein product		605384				11081504, 17947662	Standard	NM_001207006		Approved	Za11, IL-21	uc003ies.3	Q9HBE4	OTTHUMG00000133073	ENST00000264497.3:c.-33C>T	4.37:g.123542199G>A			Somatic				uc003iet.2_RNA|IL21_uc010int.2_Translation_Start_Site		NM_021803	NP_068575	WXS	Illumina HiSeq	Unspecified	Q9HBE4	IL21_HUMAN			1	13	-								A5J0L4	Translation_Start_Site	SNP	ENST00000264497.3	37	c.-32C>T	CCDS3727.1																																																																																				0.463	IL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256713.1	NM_021803		8	46	0	0	0	0.000157383	0	8	46				
CDH12	1010	broad.mit.edu	37	5	21752007	21752007	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:21752007C>A	ENST00000382254.1	-	15	3310	c.2224G>T	c.(2224-2226)Gaa>Taa	p.E742*	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Nonsense_Mutation_p.E702*|CDH12_ENST00000504376.2_Nonsense_Mutation_p.E742*|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	742					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCACTCCCTTCGTAGGCATAT	0.507										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(2224-2226)GAA>TAA		cadherin 12, type 2 preproprotein							177.0	157.0	164.0					5																	21752007		2203	4300	6503	SO:0001587	stop_gained	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21752007C>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2224G>T	5.37:g.21752007C>A	ENSP00000371689:p.Glu742*	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Nonsense_Mutation_p.E702*|CDH12_uc003jgk.2_Nonsense_Mutation_p.E742*|uc003jgj.2_Intron	p.E742*	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			12	2682	-			742			Cytoplasmic (Potential).		B2RBT1|B7Z2U6|Q86UD2	Nonsense_Mutation	SNP	ENST00000382254.1	37	c.2224G>T	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	38	7.198606	0.98129	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	.	.	.	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.1497	0.89671	0.0:1.0:0.0:0.0	.	.	.	.	X	742;742;702	.	ENSP00000371689:E742X	E	-	1	0	CDH12	21787764	1.000000	0.71417	0.948000	0.38648	0.096000	0.18686	7.818000	0.86416	2.295000	0.77249	0.467000	0.42956	GAA		0.507	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		28	70	1	0	2.12542e-12	0.00106085	1.77348e-11	28	70				
CDH10	1008	broad.mit.edu	37	5	24509754	24509754	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:24509754C>A	ENST00000264463.4	-	7	1684	c.1177G>T	c.(1177-1179)Gtt>Ttt	p.V393F		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	393	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCTTCATGAACTTCAAACAGA	0.378										HNSCC(23;0.051)																													uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(1177-1179)GTT>TTT		cadherin 10, type 2 preproprotein							104.0	104.0	104.0					5																	24509754		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24509754C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1177G>T	5.37:g.24509754C>A	ENSP00000264463:p.Val393Phe	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.V393F	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	7	1509	-			393			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1177G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183394	0.78677	.	.	ENSG00000040731	ENST00000264463	T	0.57436	0.4	5.26	4.39	0.52855	Cadherin (3);Cadherin-like (1);	0.057823	0.64402	D	0.000002	T	0.79684	0.4488	H	0.96333	3.805	0.50039	D	0.999846	D	0.69078	0.997	D	0.71184	0.972	D	0.85787	0.1365	10	0.87932	D	0	.	13.0483	0.58939	0.0:0.9223:0.0:0.0777	.	393	Q9Y6N8	CAD10_HUMAN	F	393	ENSP00000264463:V393F	ENSP00000264463:V393F	V	-	1	0	CDH10	24545511	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.651000	0.61447	1.361000	0.45981	0.650000	0.86243	GTT		0.378	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		16	31	1	0	7.07596e-05	0.00074312	0.000452369	16	31				
TMEM171	134285	broad.mit.edu	37	5	72419515	72419515	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:72419515G>T	ENST00000454765.2	+	2	788	c.315G>T	c.(313-315)gaG>gaT	p.E105D	TMEM171_ENST00000287773.5_Missense_Mutation_p.E105D			Q8WVE6	TM171_HUMAN	transmembrane protein 171	105						integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TCTGTGGAGAGAGCCGCCAGT	0.612																																					NSCLC(112;638 2280 27369 30736)	NSCLC(112;638 2280 27369 30736)	uc003kcm.2		NA																	0					0						c.(313-315)GAG>GAT		transmembrane protein 171 isoform 1							82.0	86.0	85.0					5																	72419515		2203	4300	6503	SO:0001583	missense	134285					integral to membrane		g.chr5:72419515G>T	BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.315G>T	5.37:g.72419515G>T	ENSP00000415030:p.Glu105Asp		Somatic				TMEM171_uc003kcn.3_Missense_Mutation_p.E105D	p.E105D	NM_173490	NP_775761	WXS	Illumina HiSeq	Unspecified	Q8WVE6	TM171_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)	2	519	+		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)	105					Q8N0S1|Q8TDT7	Missense_Mutation	SNP	ENST00000454765.2	37	c.315G>T	CCDS4017.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.306978	0.60305	.	.	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.25749	1.78;1.78	5.35	4.28	0.50868	.	0.155374	0.43747	D	0.000533	T	0.22742	0.0549	L	0.32530	0.975	0.35006	D	0.756442	P;P	0.49559	0.925;0.925	P;P	0.47162	0.54;0.54	T	0.14476	-1.0471	10	0.40728	T	0.16	-21.5435	8.9656	0.35874	0.2457:0.0:0.7543:0.0	.	105;105	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	D	105	ENSP00000415030:E105D;ENSP00000287773:E105D	ENSP00000287773:E105D	E	+	3	2	TMEM171	72455271	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.429000	0.44758	2.512000	0.84698	0.462000	0.41574	GAG		0.612	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254037.2	NM_173490		20	50	1	0	7.45023e-12	0.00152264	5.9463e-11	20	50				
ADAMTS19	171019	broad.mit.edu	37	5	128863519	128863519	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:128863519A>T	ENST00000274487.4	+	5	1292	c.1147A>T	c.(1147-1149)Act>Tct	p.T383S	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	383	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GCTCCATGAAACTCCAGTAAG	0.308																																							uc003kvb.1		NA																	0				ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(1147-1149)ACT>TCT		ADAM metallopeptidase with thrombospondin type 1							88.0	94.0	92.0					5																	128863519		2203	4300	6503	SO:0001583	missense	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128863519A>T	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1147A>T	5.37:g.128863519A>T	ENSP00000274487:p.Thr383Ser		Somatic				ADAMTS19_uc003kvc.1_RNA	p.T383S	NM_133638	NP_598377	WXS	Illumina HiSeq	Unspecified	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	5	1147	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	383			Peptidase M12B.			Missense_Mutation	SNP	ENST00000274487.4	37	c.1147A>T	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	14.13	2.443333	0.43429	.	.	ENSG00000145808	ENST00000274487	T	0.62639	0.01	4.41	4.41	0.53225	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.158954	0.41712	D	0.000833	T	0.35770	0.0943	N	0.03608	-0.345	0.31821	N	0.625927	B	0.19200	0.034	B	0.26310	0.068	T	0.38156	-0.9674	9	.	.	.	.	9.5679	0.39409	0.7405:0.0:0.0:0.2595	.	383	Q8TE59	ATS19_HUMAN	S	383	ENSP00000274487:T383S	.	T	+	1	0	ADAMTS19	128891418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.529000	0.53532	2.209000	0.71365	0.460000	0.39030	ACT		0.308	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		5	88	0	0	0	0.000157383	0	5	88				
PCDHA1	56147	broad.mit.edu	37	5	140167779	140167779	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:140167779G>A	ENST00000504120.2	+	1	1904	c.1904G>A	c.(1903-1905)cGt>cAt	p.R635H	PCDHA1_ENST00000378133.3_Missense_Mutation_p.R635H|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	635	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCACGACTCGTGTCCTGGAC	0.647																																							uc003lhb.2		NA																	0				skin(1)	1						c.(1903-1905)CGT>CAT		protocadherin alpha 1 isoform 1 precursor							81.0	85.0	84.0					5																	140167779		2203	4300	6503	SO:0001583	missense	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140167779G>A	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1904G>A	5.37:g.140167779G>A	ENSP00000420840:p.Arg635His		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.R635H	p.R635H	NM_018900	NP_061723	WXS	Illumina HiSeq	Unspecified	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1904	+			635			Cadherin 6.|Extracellular (Potential).		O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	c.1904G>A	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	g	16.63	3.175549	0.57692	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.53857	0.6;0.6	3.36	3.36	0.38483	Cadherin (4);Cadherin-like (1);	0.000000	0.37136	U	0.002238	T	0.73697	0.3620	M	0.87617	2.895	0.35250	D	0.778617	D;D	0.89917	1.0;0.998	D;P	0.66497	0.944;0.84	D	0.85404	0.1133	10	0.87932	D	0	.	15.0474	0.71838	0.0:0.0:1.0:0.0	.	635;635	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	H	635	ENSP00000420840:R635H;ENSP00000367373:R635H	ENSP00000367373:R635H	R	+	2	0	PCDHA1	140147963	0.991000	0.36638	0.313000	0.25210	0.340000	0.28889	5.202000	0.65169	1.572000	0.49736	0.484000	0.47621	CGT		0.647	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		28	51	0	0	0	0.000878237	0	28	51				
PCDHA9	9752	broad.mit.edu	37	5	140389282	140389282	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:140389282C>A	ENST00000532602.1	+	4	3646	c.2613C>A	c.(2611-2613)taC>taA	p.Y871*	PCDHA5_ENST00000529859.1_Nonsense_Mutation_p.Y857*|PCDHA4_ENST00000512229.2_Nonsense_Mutation_p.Y868*|PCDHA6_ENST00000527624.1_Nonsense_Mutation_p.Y607*|PCDHA13_ENST00000409494.1_Nonsense_Mutation_p.Y871*|PCDHA10_ENST00000506939.2_Nonsense_Mutation_p.Y606*|PCDHA4_ENST00000530339.1_Nonsense_Mutation_p.Y868*|PCDHA6_ENST00000529310.1_Nonsense_Mutation_p.Y871*|PCDHA10_ENST00000307360.5_Nonsense_Mutation_p.Y869*|PCDHA7_ENST00000525929.1_Nonsense_Mutation_p.Y858*|PCDHA1_ENST00000394633.3_Nonsense_Mutation_p.Y607*|PCDHA11_ENST00000398640.2_Nonsense_Mutation_p.Y870*|PCDHA2_ENST00000526136.1_Nonsense_Mutation_p.Y869*|PCDHA1_ENST00000504120.2_Nonsense_Mutation_p.Y871*|PCDHA5_ENST00000529619.1_Nonsense_Mutation_p.Y857*|PCDHAC1_ENST00000253807.2_Nonsense_Mutation_p.Y884*|PCDHA8_ENST00000531613.1_Nonsense_Mutation_p.Y871*|PCDHA13_ENST00000289272.2_Nonsense_Mutation_p.Y871*|PCDHAC2_ENST00000289269.5_Nonsense_Mutation_p.Y928*|PCDHA12_ENST00000398631.2_Nonsense_Mutation_p.Y862*|PCDHA3_ENST00000522353.2_Nonsense_Mutation_p.Y871*	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	871	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTTAAATACGGACCAGGCA	0.507																																					Melanoma(55;1800 1972 14909)	Melanoma(190;638 2083 3390 11909 52360)	uc003lii.2		NA																	0				ovary(2)|skin(2)	4						c.(2782-2784)TAC>TAA		protocadherin alpha subfamily C, 2 isoform 1							78.0	83.0	81.0					5																	140389282		2203	4300	6503	SO:0001587	stop_gained	56134				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140389282C>A	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2613C>A	5.37:g.140389282C>A	ENSP00000436042:p.Tyr871*		Somatic				PCDHA1_uc003lha.2_Nonsense_Mutation_p.Y607*|PCDHA1_uc003lhb.2_Nonsense_Mutation_p.Y871*|PCDHA2_uc003lhd.2_Nonsense_Mutation_p.Y869*|PCDHA3_uc003lhf.2_Nonsense_Mutation_p.Y871*|PCDHA4_uc003lhi.2_Nonsense_Mutation_p.Y868*|PCDHA4_uc003lhh.1_Nonsense_Mutation_p.Y868*|PCDHA5_uc003lhk.1_Nonsense_Mutation_p.Y857*|PCDHA5_uc003lhl.2_Nonsense_Mutation_p.Y857*|PCDHA6_uc003lhn.2_Nonsense_Mutation_p.Y607*|PCDHA6_uc003lho.2_Nonsense_Mutation_p.Y871*|PCDHA7_uc003lhq.2_Nonsense_Mutation_p.Y858*|PCDHA8_uc003lhs.2_Nonsense_Mutation_p.Y871*|PCDHA9_uc003lhu.2_Nonsense_Mutation_p.Y871*|PCDHA10_uc003lhw.2_Nonsense_Mutation_p.Y606*|PCDHA10_uc003lhx.2_Nonsense_Mutation_p.Y869*|PCDHA11_uc003lia.2_Nonsense_Mutation_p.Y870*|PCDHA12_uc003lic.2_Nonsense_Mutation_p.Y862*|PCDHA13_uc003lie.1_Nonsense_Mutation_p.Y871*|PCDHA13_uc003lif.2_Nonsense_Mutation_p.Y871*|PCDHAC1_uc003lih.2_Nonsense_Mutation_p.Y884*	p.Y928*	NM_018899	NP_061722	WXS	Illumina HiSeq	Unspecified	Q9Y5I4	PCDC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		4	3024	+			928			4 X 4 AA repeats of P-X-X-P.|Cytoplasmic (Potential).		O15053|Q2M3S5	Nonsense_Mutation	SNP	ENST00000532602.1	37	c.2784C>A	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	45	11.670259	0.99589	.	.	ENSG00000204970;ENSG00000204970;ENSG00000204969;ENSG00000255408;ENSG00000204967;ENSG00000204967;ENSG00000204965;ENSG00000204965;ENSG00000081842;ENSG00000081842;ENSG00000204963;ENSG00000204962;ENSG00000204961;ENSG00000250120;ENSG00000250120;ENSG00000249158;ENSG00000251664;ENSG00000239389;ENSG00000239389;ENSG00000248383;ENSG00000243232	ENST00000504120;ENST00000394633;ENST00000526136;ENST00000522353;ENST00000512229;ENST00000530339;ENST00000529619;ENST00000529859;ENST00000529310;ENST00000527624;ENST00000525929;ENST00000531613;ENST00000532602;ENST00000506939;ENST00000307360;ENST00000398640;ENST00000398631;ENST00000409494;ENST00000289272;ENST00000253807;ENST00000289269	.	.	.	5.77	-1.38	0.09027	.	0.000000	0.36854	N	0.002369	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2657	0.54676	0.0:0.3344:0.0:0.6656	.	.	.	.	X	871;607;869;871;868;868;857;857;871;607;858;871;871;606;869;870;862;871;871;884;928	.	ENSP00000304234:Y869X	Y	+	3	2	PCDHA6;PCDHA7;PCDHA8;PCDHA9;PCDHA2;PCDHA3;PCDHA4;PCDHA5;PCDHA10;PCDHA11;PCDHA12;PCDHA1;PCDHA13;PCDHAC2;PCDHAC1	140369466	0.163000	0.22920	0.988000	0.46212	0.996000	0.88848	-0.495000	0.06443	-0.246000	0.09611	-0.140000	0.14226	TAC		0.507	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		25	62	1	0	7.07758e-08	0.000720815	4.94277e-07	25	62				
PCDHGA3	56112	broad.mit.edu	37	5	140725707	140725707	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:140725707G>A	ENST00000253812.6	+	1	2107	c.2107G>A	c.(2107-2109)Gtc>Atc	p.V703I	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	703					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTCCTGCGTCTTCCTGGC	0.682																																							uc003ljm.1		NA																	0				breast(1)	1						c.(2107-2109)GTC>ATC		protocadherin gamma subfamily A, 3 isoform 1							49.0	56.0	53.0					5																	140725707		2203	4294	6497	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725707G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2107G>A	5.37:g.140725707G>A	ENSP00000253812:p.Val703Ile		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.V463I|PCDHGA3_uc011dap.1_Missense_Mutation_p.V703I	p.V703I	NM_018916	NP_061739	WXS	Illumina HiSeq	Unspecified	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2107	+			703			Helical; (Potential).		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.2107G>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	8.025	0.760458	0.15914	.	.	ENSG00000254245	ENST00000253812	T	0.13657	2.57	5.16	1.37	0.22104	.	0.819765	0.09431	N	0.803105	T	0.09642	0.0237	L	0.33189	0.99	0.20764	N	0.999853	B;B	0.20550	0.046;0.012	B;B	0.17722	0.019;0.014	T	0.37126	-0.9719	10	0.32370	T	0.25	.	4.683	0.12745	0.376:0.2458:0.3783:0.0	.	703;703	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	I	703	ENSP00000253812:V703I	ENSP00000253812:V703I	V	+	1	0	PCDHGA3	140705891	0.000000	0.05858	0.579000	0.28588	0.043000	0.13939	-0.646000	0.05403	0.444000	0.26612	-0.253000	0.11424	GTC		0.682	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		17	91	0	0	0	0.00188189	0	17	91				
NDST1	3340	broad.mit.edu	37	5	149901013	149901013	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:149901013G>T	ENST00000261797.6	+	2	699	c.197G>T	c.(196-198)cGc>cTc	p.R66L	NDST1_ENST00000523767.1_Missense_Mutation_p.R66L	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	66	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCCCCAGTCGCCTGCTGCCA	0.672																																							uc003lsk.3		NA																	0				breast(1)|skin(1)	2						c.(196-198)CGC>CTC		N-deacetylase/N-sulfotransferase (heparan							29.0	37.0	34.0					5																	149901013		2203	4300	6503	SO:0001583	missense	3340				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr5:149901013G>T	U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.197G>T	5.37:g.149901013G>T	ENSP00000261797:p.Arg66Leu		Somatic				NDST1_uc011dcj.1_Missense_Mutation_p.R66L|NDST1_uc003lsl.2_Missense_Mutation_p.R66L	p.R66L	NM_001543	NP_001534	WXS	Illumina HiSeq	Unspecified	P52848	NDST1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	699	+		all_hematologic(541;0.224)	66			Heparan sulfate N-deacetylase 1.|Lumenal (Potential).		Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	c.197G>T	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788157	0.70337	.	.	ENSG00000070614	ENST00000522491;ENST00000519157;ENST00000523767;ENST00000261797	T;T;T	0.50548	0.74;0.82;1.15	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.81682	2.555	0.80722	D	1	P;P;P	0.47191	0.891;0.839;0.785	P;P;B	0.51055	0.657;0.452;0.426	T	0.65331	-0.6194	10	0.39692	T	0.17	.	18.9189	0.92518	0.0:0.0:1.0:0.0	.	66;66;66	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	L	66	ENSP00000427813:R66L;ENSP00000428604:R66L;ENSP00000261797:R66L	ENSP00000261797:R66L	R	+	2	0	NDST1	149881206	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	4.042000	0.57347	2.535000	0.85469	0.655000	0.94253	CGC		0.672	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543		11	31	1	0	3.86212e-05	0.000673444	0.000248141	11	31				
DOCK2	1794	broad.mit.edu	37	5	169474616	169474616	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:169474616C>T	ENST00000256935.8	+	40	4149	c.4069C>T	c.(4069-4071)Cgg>Tgg	p.R1357W	DOCK2_ENST00000540750.1_Missense_Mutation_p.R418W|DOCK2_ENST00000520908.1_Missense_Mutation_p.R849W|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1357	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.R1357W(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCTTCCTGCGGGTGAGTTT	0.542																																							uc003maf.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(5)|pancreas(2)	7						c.(4069-4071)CGG>TGG		dedicator of cytokinesis 2							68.0	68.0	68.0					5																	169474616		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169474616C>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4069C>T	5.37:g.169474616C>T	ENSP00000256935:p.Arg1357Trp		Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.R849W	p.R1357W	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		40	4149	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1357			DHR-2.|Interaction with CRKL.		Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.4069C>T	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983404	0.74474	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.12465	3.34;2.96;2.68	5.21	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.46560	0.1399	M	0.92507	3.315	0.41599	D	0.988849	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.60811	-0.7189	10	0.87932	D	0	.	14.8729	0.70471	0.1947:0.8053:0.0:0.0	.	849;1357	E7ERW7;Q92608	.;DOCK2_HUMAN	W	1357;849;418	ENSP00000256935:R1357W;ENSP00000429283:R849W;ENSP00000438827:R418W	ENSP00000256935:R1357W	R	+	1	2	DOCK2	169407194	0.901000	0.30685	1.000000	0.80357	0.859000	0.49053	1.258000	0.32944	2.419000	0.82065	0.561000	0.74099	CGG		0.542	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		7	30	0	0	0	8.12818e-05	0	7	30				
ADAMTS2	9509	broad.mit.edu	37	5	178634657	178634657	+	Missense_Mutation	SNP	C	C	T	rs143764421	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr5:178634657C>T	ENST00000251582.7	-	4	849	c.748G>A	c.(748-750)Gcc>Acc	p.A250T	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.A250T	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	250					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GAGCTGTTGGCGTGCTCCTCT	0.662																																							uc003mjw.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(748-750)GCC>ACC		ADAM metallopeptidase with thrombospondin type 1		C	THR/ALA,THR/ALA	0,4406		0,0,2203	112.0	94.0	100.0		748,748	-6.2	0.0	5	dbSNP_134	100	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	ADAMTS2	NM_014244.4,NM_021599.2	58,58	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	benign,benign	250/1212,250/567	178634657	6,13000	2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178634657C>T	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.748G>A	5.37:g.178634657C>T	ENSP00000251582:p.Ala250Thr		Somatic				ADAMTS2_uc011dgm.1_Missense_Mutation_p.A250T	p.A250T	NM_014244	NP_055059	WXS	Illumina HiSeq	Unspecified	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	4	748	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	250						Missense_Mutation	SNP	ENST00000251582.7	37	c.748G>A	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	0.419	-0.909121	0.02434	0.0	6.98E-4	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.59638	0.28;0.25	5.34	-6.17	0.02091	.	1.596650	0.04146	N	0.320376	T	0.31606	0.0802	N	0.08118	0	0.09310	N	1	B;B	0.21147	0.052;0.005	B;B	0.12837	0.008;0.003	T	0.24012	-1.0172	10	0.13108	T	0.6	.	10.0374	0.42137	0.0:0.3333:0.0949:0.5719	.	250;250	O95450-2;O95450	.;ATS2_HUMAN	T	250	ENSP00000251582:A250T;ENSP00000274609:A250T	ENSP00000251582:A250T	A	-	1	0	ADAMTS2	178567263	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.438000	0.06905	-1.179000	0.02737	-0.997000	0.02515	GCC		0.662	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		10	61	0	0	0	0.000442599	0	10	61				
RREB1	6239	broad.mit.edu	37	6	7231254	7231254	+	Silent	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:7231254A>T	ENST00000349384.6	+	10	3236	c.2922A>T	c.(2920-2922)gcA>gcT	p.A974A	RREB1_ENST00000334984.6_Silent_p.A974A|RREB1_ENST00000379933.3_Silent_p.A974A|RREB1_ENST00000379938.2_Silent_p.A974A	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	974	Pro-rich.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CCTGCCCAGCACCCGGCCCTT	0.662																																							uc003mxc.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11						c.(2920-2922)GCA>GCT		ras responsive element binding protein 1 isoform							22.0	25.0	24.0					6																	7231254		2203	4300	6503	SO:0001819	synonymous_variant	6239				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding	g.chr6:7231254A>T	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2922A>T	6.37:g.7231254A>T			Somatic				RREB1_uc003mxb.2_Silent_p.A974A|RREB1_uc010jnx.2_Silent_p.A974A	p.A974A	NM_001003698	NP_001003698	WXS	Illumina HiSeq	Unspecified	Q92766	RREB1_HUMAN			10	3312	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	974			Pro-rich.		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	ENST00000349384.6	37	c.2922A>T	CCDS34336.1																																																																																				0.662	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			13	26	0	0	0	0.00136819	0	13	26				
HIST1H3D	8351	broad.mit.edu	37	6	26197336	26197336	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:26197336G>A	ENST00000356476.2	-	1	142	c.143C>T	c.(142-144)gCt>gTt	p.A48V	HIST1H3D_ENST00000377831.5_Missense_Mutation_p.A48V|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	48					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				CTCGCGCAGAGCCACCGTGCC	0.637																																					GBM(108;3816 4467)	GBM(108;3816 4467)	uc003ngv.2		NA																	0					0						c.(142-144)GCT>GTT		histone cluster 1, H3d							46.0	51.0	50.0					6																	26197336		2203	4300	6503	SO:0001583	missense	8351				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26197336G>A	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.143C>T	6.37:g.26197336G>A	ENSP00000366999:p.Ala48Val		Somatic				HIST1H2BF_uc003ngx.2_5'Flank	p.A48V	NM_003530	NP_003521	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			2	540	-		all_hematologic(11;0.196)	48					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000356476.2	37	c.143C>T	CCDS4590.1	.	.	.	.	.	.	.	.	.	.	.	15.66	2.899361	0.52227	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.47869	0.83;0.83	4.29	3.41	0.39046	.	.	.	.	.	T	0.47710	0.1460	.	.	.	0.38609	D	0.950845	.	.	.	.	.	.	T	0.54669	-0.8259	6	0.87932	D	0	.	11.2867	0.49226	0.0905:0.0:0.9095:0.0	.	.	.	.	V	48	ENSP00000366999:A48V;ENSP00000367062:A48V	ENSP00000366999:A48V	A	-	2	0	HIST1H3D	26305315	1.000000	0.71417	0.984000	0.44739	0.139000	0.21198	5.230000	0.65321	0.903000	0.36546	0.655000	0.94253	GCT		0.637	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530		17	63	0	0	0	0.000566183	0	17	63				
GABBR1	2550	broad.mit.edu	37	6	29577119	29577119	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:29577119C>A	ENST00000377034.4	-	15	2081	c.1746G>T	c.(1744-1746)aaG>aaT	p.K582N	GABBR1_ENST00000377016.4_Missense_Mutation_p.K520N|GABBR1_ENST00000355973.3_Missense_Mutation_p.K465N|GABBR1_ENST00000376977.3_Intron|GABBR1_ENST00000377012.4_Missense_Mutation_p.K465N	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	582					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	AGCGGAATGTCTTGATGACCA	0.527																																							uc003nmt.3		NA																	0				ovary(5)|liver(1)|skin(1)	7						c.(1744-1746)AAG>AAT		gamma-aminobutyric acid (GABA) B receptor 1	Baclofen(DB00181)|Progabide(DB00837)						104.0	85.0	92.0					6																	29577119		1511	2709	4220	SO:0001583	missense	2550				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr6:29577119C>A	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1746G>T	6.37:g.29577119C>A	ENSP00000366233:p.Lys582Asn		Somatic				GABBR1_uc003nmp.3_Missense_Mutation_p.K465N|GABBR1_uc003nms.3_Missense_Mutation_p.K465N|GABBR1_uc003nmu.3_Missense_Mutation_p.K520N|GABBR1_uc011dlr.1_Missense_Mutation_p.K405N|GABBR1_uc011dls.1_Intron	p.K582N	NM_001470	NP_001461	WXS	Illumina HiSeq	Unspecified	Q9UBS5	GABR1_HUMAN			15	2082	-			582			Extracellular (Potential).		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	c.1746G>T	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748086	0.30955	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;T	0.83419	-1.72;-1.64;-1.72;-0.5	5.93	5.93	0.95920	.	0.344653	0.32147	N	0.006503	T	0.64136	0.2571	L	0.34521	1.04	0.80722	D	1	B;B;B	0.20887	0.043;0.049;0.049	B;B;B	0.21360	0.034;0.014;0.01	T	0.60188	-0.7312	10	0.27082	T	0.32	-40.0518	12.7496	0.57300	0.1638:0.8362:0.0:0.0	.	520;582;465	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	N	465;520;465;582	ENSP00000348248:K465N;ENSP00000366215:K520N;ENSP00000366211:K465N;ENSP00000366233:K582N	ENSP00000348248:K465N	K	-	3	2	GABBR1	29685098	0.895000	0.30542	1.000000	0.80357	0.998000	0.95712	-0.060000	0.11712	2.826000	0.97356	0.655000	0.94253	AAG		0.527	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3			19	41	1	0	2.4624e-09	0.00121646	1.81849e-08	19	41				
C4A	720	broad.mit.edu	37	6	31963559	31963559	+	Missense_Mutation	SNP	A	A	G	rs147162052		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:31963559A>G	ENST00000428956.2	+	25	3302	c.3218A>G	c.(3217-3219)gAc>gGc	p.D1073G	C4A_ENST00000498271.1_Missense_Mutation_p.D1073G	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1073			D -> G (in allotype C4A1, allotype C4A2; dbSNP:rs147162052). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:3696167, ECO:0000269|Ref.8}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	TTGTCACGGGACAGCAGCACC	0.612																																							uc011doy.1		NA																	0					0						c.(3217-3219)GAC>GGC		complement component 4A preproprotein							101.0	86.0	91.0					6																	31963559		1499	2656	4155	SO:0001583	missense	720				complement activation, classical pathway|inflammatory response|innate immune response	extracellular space	endopeptidase inhibitor activity	g.chr6:31963559A>G	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3218A>G	6.37:g.31963559A>G	ENSP00000396688:p.Asp1073Gly		Somatic				C4A_uc011doz.1_Missense_Mutation_p.D1073G	p.D1073G	NM_007293	NP_009224	WXS	Illumina HiSeq	Unspecified	P0C0L4	CO4A_HUMAN			25	3269	+			1073					A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000428956.2	37	c.3218A>G	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	A	1.712	-0.498842	0.04291	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.37915	1.17;1.17	3.11	1.88	0.25563	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.16642	0.0400	M	0.64170	1.965	0.80722	D	1	B;B	0.19200	0.015;0.034	B;B	0.23150	0.026;0.044	T	0.04885	-1.0920	9	0.46703	T	0.11	.	5.4739	0.16686	0.8606:0.0:0.1394:0.0	.	1073;1073	A6H8M8;P0C0L4	.;CO4A_HUMAN	G	1073	ENSP00000396688:D1073G;ENSP00000420212:D1073G	ENSP00000396688:D1073G	D	+	2	0	C4A	32071538	0.168000	0.22989	0.910000	0.35882	0.043000	0.13939	0.471000	0.22100	0.399000	0.25367	-1.226000	0.01582	GAC		0.612	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293		3	62	0	0	0	6.4e-05	0	3	62				
CPNE5	57699	broad.mit.edu	37	6	36710132	36710132	+	Silent	SNP	C	C	A	rs144328823	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:36710132C>A	ENST00000244751.2	-	21	2319	c.1695G>T	c.(1693-1695)ccG>ccT	p.P565P	CPNE5_ENST00000393189.2_Silent_p.P273P|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	565						extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GTGGGGGACGCGGGCGAATGC	0.682																																							uc003omr.1		NA																	0				skin(1)	1						c.(1693-1695)CCG>CCT		copine V							86.0	78.0	81.0					6																	36710132		2203	4300	6503	SO:0001819	synonymous_variant	57699							g.chr6:36710132C>A	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1695G>T	6.37:g.36710132C>A			Somatic				CPNE5_uc003omp.1_Silent_p.P273P|CPNE5_uc010jwn.1_Silent_p.P215P|CPNE5_uc003omq.1_Silent_p.P215P	p.P565P	NM_020939	NP_065990	WXS	Illumina HiSeq	Unspecified	Q9HCH3	CPNE5_HUMAN			21	1762	-			565					Q7Z6C8	Silent	SNP	ENST00000244751.2	37	c.1695G>T	CCDS4825.1																																																																																				0.682	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939		21	43	1	0	2.21704e-12	0.000375601	1.83799e-11	21	43				
TTBK1	84630	broad.mit.edu	37	6	43251598	43251598	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:43251598C>A	ENST00000259750.4	+	14	3203	c.3120C>A	c.(3118-3120)atC>atA	p.I1040I		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1040					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGGCCACCATCTCCCCCAGAC	0.662																																							uc003ouq.1		NA																	0				lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(3118-3120)ATC>ATA		tau tubulin kinase 1							31.0	29.0	30.0					6																	43251598		2184	4241	6425	SO:0001819	synonymous_variant	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43251598C>A	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3120C>A	6.37:g.43251598C>A			Somatic					p.I1040I	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		14	3399	+			1040					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	c.3120C>A	CCDS34455.1																																																																																				0.662	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			9	32	1	0	9.70103e-10	0.000673444	7.42013e-09	9	32				
GCLC	2729	broad.mit.edu	37	6	53365045	53365045	+	Splice_Site	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:53365045C>A	ENST00000229416.6	-	14	2064	c.1581G>T	c.(1579-1581)aaG>aaT	p.K527N	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	527					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	ACCCTCCTACCTTCCCATTGA	0.557																																							uc003pbw.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1579-1581)AAG>AAT		glutamate-cysteine ligase, catalytic subunit	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)						169.0	148.0	155.0					6																	53365045		2203	4300	6503	SO:0001630	splice_region_variant	2729				anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding	g.chr6:53365045C>A	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.1581+1G>T	6.37:g.53365045C>A			Somatic				GCLC_uc003pbv.1_Missense_Mutation_p.K251N	p.K527N	NM_001498	NP_001489	WXS	Illumina HiSeq	Unspecified	P48506	GSH1_HUMAN			14	1969	-	Lung NSC(77;0.0137)		527					Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	c.1581G>T	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244985	0.79912	.	.	ENSG00000001084	ENST00000229416	T	0.74315	-0.83	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.82328	0.5013	M	0.67569	2.06	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	T	0.80883	-0.1183	10	0.44086	T	0.13	.	19.3312	0.94288	0.0:1.0:0.0:0.0	.	527	P48506	GSH1_HUMAN	N	527	ENSP00000229416:K527N	ENSP00000229416:K527N	K	-	3	2	GCLC	53473004	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.553000	0.82203	2.656000	0.90262	0.655000	0.94253	AAG		0.557	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		Missense_Mutation	25	54	1	0	3.28513e-13	0.000586117	2.83315e-12	25	54				
CASP8AP2	9994	broad.mit.edu	37	6	90577242	90577242	+	RNA	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:90577242G>T	ENST00000551025.1	+	0	5670									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TGTTTGAAGTGTCTACTAACC	0.383																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	0				ovary(2)	2						c.(4231-4233)GTG>GTT		caspase 8 associated protein 2							90.0	92.0	92.0					6																	90577242		1914	4117	6031			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90577242G>T	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577242G>T			Somatic				CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Silent_p.V1411V|CASP8AP2_uc011dzz.1_Silent_p.V1411V	p.V1411V	NM_001137667	NP_001131139	WXS	Illumina HiSeq	Unspecified	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	8	4429	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	1411						Silent	SNP	ENST00000551025.1	37	c.4233G>T																																																																																					0.383	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		35	43	1	0	1.36161e-19	0.000814825	1.27713e-18	35	43				
HEY2	23493	broad.mit.edu	37	6	126080624	126080624	+	Silent	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:126080624G>A	ENST00000368364.3	+	5	887	c.690G>A	c.(688-690)acG>acA	p.T230T	HEY2_ENST00000368365.1_Silent_p.T184T	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	230					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		TCACGGCCACGTTTGCCCATG	0.642																																							uc003qad.2		NA																	0				breast(1)	1						c.(688-690)ACG>ACA		hairy/enhancer-of-split related with YRPW motif							174.0	159.0	164.0					6																	126080624		2203	4300	6503	SO:0001819	synonymous_variant	23493				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding	g.chr6:126080624G>A	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.690G>A	6.37:g.126080624G>A			Somatic				HEY2_uc011ebr.1_Silent_p.T184T	p.T230T	NM_012259	NP_036391	WXS	Illumina HiSeq	Unspecified	Q9UBP5	HEY2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)	5	881	+			230						Silent	SNP	ENST00000368364.3	37	c.690G>A	CCDS5131.1																																																																																				0.642	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1			37	215	0	0	0	0.00148497	0	37	215				
SYNE1	23345	broad.mit.edu	37	6	152651835	152651835	+	Missense_Mutation	SNP	T	T	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:152651835T>A	ENST00000367255.5	-	78	14586	c.13985A>T	c.(13984-13986)aAg>aTg	p.K4662M	SYNE1_ENST00000448038.1_Missense_Mutation_p.K4591M|SYNE1_ENST00000341594.5_Missense_Mutation_p.K4409M|SYNE1_ENST00000265368.4_Missense_Mutation_p.K4662M|SYNE1_ENST00000423061.1_Missense_Mutation_p.K4591M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4662					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTATAGAACTTGTCTTTAGC	0.403										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(13984-13986)AAG>ATG		spectrin repeat containing, nuclear envelope 1							65.0	63.0	64.0					6																	152651835		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152651835T>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13985A>T	6.37:g.152651835T>A	ENSP00000356224:p.Lys4662Met	HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Missense_Mutation_p.K4591M|SYNE1_uc003qou.3_Missense_Mutation_p.K4662M|SYNE1_uc010kiz.2_Missense_Mutation_p.K417M	p.K4662M	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	78	14587	-		Ovarian(120;0.0955)	4662			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.13985A>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	14.35	2.510596	0.44660	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.62941	1.24;1.24;1.24;1.24;-0.01	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000004	T	0.74222	0.3688	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.77507	-0.2562	10	0.66056	D	0.02	.	16.3871	0.83514	0.0:0.0:0.0:1.0	.	4662;4662;4662;4591	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	M	4662;4591;4662;4591;4409	ENSP00000356224:K4662M;ENSP00000396024:K4591M;ENSP00000265368:K4662M;ENSP00000390975:K4591M;ENSP00000341887:K4409M	ENSP00000265368:K4662M	K	-	2	0	SYNE1	152693528	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.289000	0.72696	2.270000	0.75569	0.482000	0.46254	AAG		0.403	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		22	72	0	0	0	0.000295444	0	22	72				
TULP4	56995	broad.mit.edu	37	6	158919845	158919845	+	Splice_Site	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:158919845G>A	ENST00000367097.3	+	12	3371		c.e12+1		TULP4_ENST00000367094.2_Splice_Site	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GATTTACCAGGTGTGTTCACA	0.423																																							uc003qrf.2		NA																	0				ovary(1)	1						c.e12+1		tubby like protein 4 isoform 1							165.0	161.0	162.0					6																	158919845		2203	4300	6503	SO:0001630	splice_region_variant	56995				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:158919845G>A		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2014+1G>A	6.37:g.158919845G>A			Somatic				TULP4_uc003qrg.2_Splice_Site_p.G672_splice	p.V672_splice	NM_020245	NP_064630	WXS	Illumina HiSeq	Unspecified	Q9NRJ4	TULP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	12	3371	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)						Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Splice_Site	SNP	ENST00000367097.3	37	c.2014_splice	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189733	0.78789	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.172	0.89749	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TULP4	158839833	1.000000	0.71417	0.973000	0.42090	0.750000	0.42670	6.352000	0.73027	2.723000	0.93209	0.655000	0.94253	.		0.423	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	Intron	6	110	0	0	0	0.000442599	0	6	110				
LPA	4018	broad.mit.edu	37	6	161020611	161020611	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:161020611C>G	ENST00000316300.5	-	20	3252	c.3208G>C	c.(3208-3210)Gtc>Ctc	p.V1070L	LPA_ENST00000447678.1_Missense_Mutation_p.V1070L			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3578	Kringle 10. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CTTCCTGTGACAGTGGTGGAG	0.483																																							uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(3208-3210)GTC>CTC		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						248.0	267.0	260.0					6																	161020611		2203	4300	6503	SO:0001583	missense	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161020611C>G	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3208G>C	6.37:g.161020611C>G	ENSP00000321334:p.Val1070Leu		Somatic					p.V1070L	NM_005577	NP_005568	WXS	Illumina HiSeq	Unspecified	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	21	3328	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	3578			Kringle 32.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.3208G>C	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	11.08	1.532976	0.27387	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.65916	-0.18;-0.18	2.48	-4.07	0.03975	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.43700	0.1259	L	0.55213	1.73	0.09310	N	1	B	0.31752	0.338	P	0.49276	0.605	T	0.58036	-0.7707	9	0.20519	T	0.43	.	6.9257	0.24414	0.0:0.4159:0.0:0.5841	.	3578	P08519	APOA_HUMAN	L	1070	ENSP00000321334:V1070L;ENSP00000395608:V1070L	ENSP00000321334:V1070L	V	-	1	0	LPA	160940601	0.002000	0.14202	0.000000	0.03702	0.008000	0.06430	-0.774000	0.04684	-1.084000	0.03092	0.436000	0.28706	GTC		0.483	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		163	274	0	0	0	0.000781405	0	163	274				
WDR27	253769	broad.mit.edu	37	6	170068177	170068177	+	Silent	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr6:170068177C>G	ENST00000448612.1	-	5	670	c.561G>C	c.(559-561)cgG>cgC	p.R187R	WDR27_ENST00000420344.2_Intron|WDR27_ENST00000546525.1_5'Flank|WDR27_ENST00000333572.6_Silent_p.R187R|WDR27_ENST00000423258.1_Intron	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	157						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GCAGCTCGGCCCGAACAGCCT	0.577																																							uc003qwx.2		NA																	0				pancreas(1)	1						c.(559-561)CGG>CGC		RecName: Full=WD repeat-containing protein 27;							79.0	96.0	90.0					6																	170068177		2050	4190	6240	SO:0001819	synonymous_variant	253769							g.chr6:170068177C>G	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.561G>C	6.37:g.170068177C>G			Somatic				WDR27_uc010kkw.1_Silent_p.R187R|WDR27_uc003qwy.2_Intron|WDR27_uc011egw.1_Intron	p.R187R			WXS	Illumina HiSeq	Unspecified	A2RRH5	WDR27_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)	5	1081	-		Breast(66;1.53e-05)|Ovarian(120;0.216)	157					A5PLM8|C9JGV0|Q5T066	Silent	SNP	ENST00000448612.1	37	c.561G>C	CCDS47520.2																																																																																				0.577	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552		7	19	0	0	0	0.000157383	0	7	19				
GLI3	2737	broad.mit.edu	37	7	42005353	42005353	+	Silent	SNP	T	T	A	rs148780793		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:42005353T>A	ENST00000395925.3	-	15	3402	c.3318A>T	c.(3316-3318)gcA>gcT	p.A1106A	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1106					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCTCGTACCCTGCTTGGTTCT	0.622									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	0				lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(3316-3318)GCA>GCT		GLI-Kruppel family member GLI3							74.0	77.0	76.0					7																	42005353		2203	4300	6503	SO:0001819	synonymous_variant	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42005353T>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3318A>T	7.37:g.42005353T>A			Somatic				GLI3_uc011kbg.1_Silent_p.A1047A	p.A1106A	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			15	3409	-			1106					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	c.3318A>T	CCDS5465.1																																																																																				0.622	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		18	68	0	0	0	0.000958276	0	18	68				
ZNF716	441234	broad.mit.edu	37	7	57529325	57529325	+	Silent	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:57529325C>G	ENST00000420713.1	+	4	1270	c.1158C>G	c.(1156-1158)ggC>ggG	p.G386G		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						AAGAATGTGGCAAAGCCTTTA	0.418																																							uc011kdi.1		NA																	0				ovary(2)	2						c.(1156-1158)GGC>GGG		zinc finger protein 716							47.0	46.0	47.0					7																	57529325		692	1591	2283	SO:0001819	synonymous_variant	441234							g.chr7:57529325C>G	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1158C>G	7.37:g.57529325C>G			Somatic					p.G386G	NM_001159279	NP_001152751	WXS	Illumina HiSeq	Unspecified					4	1270	+									Silent	SNP	ENST00000420713.1	37	c.1158C>G	CCDS55112.1																																																																																				0.418	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		12	24	0	0	0	0.000978159	0	12	24				
MUC17	140453	broad.mit.edu	37	7	100677772	100677772	+	Silent	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:100677772C>A	ENST00000306151.4	+	3	3139	c.3075C>A	c.(3073-3075)ccC>ccA	p.P1025P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1025	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCTCCTCCCACTGCTGAAG	0.512																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(3073-3075)CCC>CCA		mucin 17 precursor							476.0	383.0	415.0					7																	100677772		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100677772C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3075C>A	7.37:g.100677772C>A			Somatic				MUC17_uc010lho.1_RNA	p.P1025P	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	3128	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1025			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|15.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.3075C>A	CCDS34711.1																																																																																				0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		11	447	1	0	0.00136819	0.00136819	0.00829306	11	447				
SLC26A4	5172	broad.mit.edu	37	7	107315451	107315451	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:107315451G>T	ENST00000265715.3	+	6	886	c.662G>T	c.(661-663)gGt>gTt	p.G221V		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	221					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.G221V(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CCTTTGGTTGGTGGCTTCACA	0.408									Pendred syndrome																														uc003vep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(661-663)GGT>GTT		pendrin							264.0	243.0	250.0					7																	107315451		2203	4300	6503	SO:0001583	missense	5172	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity	g.chr7:107315451G>T	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.662G>T	7.37:g.107315451G>T	ENSP00000265715:p.Gly221Val		Somatic					p.G221V	NM_000441	NP_000432	WXS	Illumina HiSeq	Unspecified	O43511	S26A4_HUMAN			6	886	+			221			Helical; (Potential).		B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	c.662G>T	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.679001	0.68042	.	.	ENSG00000091137	ENST00000265715	D	0.91577	-2.87	5.41	5.41	0.78517	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.92456	0.7605	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.90566	0.4519	10	0.25751	T	0.34	.	19.1848	0.93639	0.0:0.0:1.0:0.0	.	221	O43511	S26A4_HUMAN	V	221	ENSP00000265715:G221V	ENSP00000265715:G221V	G	+	2	0	SLC26A4	107102687	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	4.235000	0.58666	2.536000	0.85505	0.650000	0.86243	GGT		0.408	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441		57	117	1	0	7.38948e-41	0.000781405	7.84751e-40	57	117				
LAMB4	22798	broad.mit.edu	37	7	107732132	107732132	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:107732132G>A	ENST00000388781.3	-	14	1723	c.1640C>T	c.(1639-1641)cCt>cTt	p.P547L	LAMB4_ENST00000414450.2_Missense_Mutation_p.P547L|LAMB4_ENST00000388780.3_Missense_Mutation_p.P547L|LAMB4_ENST00000418464.1_Missense_Mutation_p.P547L|LAMB4_ENST00000205386.4_Missense_Mutation_p.P547L	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	547	Laminin EGF-like 5; truncated. {ECO:0000255|PROSITE-ProRule:PRU00460}.|Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GAAATTCAAAGGAGCAAAGAA	0.502																																							uc010ljo.1		NA																	0				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(1639-1641)CCT>CTT		laminin, beta 4 precursor							93.0	90.0	91.0					7																	107732132		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107732132G>A	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1640C>T	7.37:g.107732132G>A	ENSP00000373433:p.Pro547Leu		Somatic				LAMB4_uc003vey.2_Missense_Mutation_p.P547L	p.P547L	NM_007356	NP_031382	WXS	Illumina HiSeq	Unspecified	A4D0S4	LAMB4_HUMAN			14	1724	-			547			Laminin EGF-like 5; truncated.|Laminin IV type B.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.1640C>T	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747911	0.69533	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48	4.69	2.85	0.33270	Laminin IV (1);EGF-like, laminin (2);	0.000000	0.47093	D	0.000248	T	0.54447	0.1859	L	0.37750	1.13	0.58432	D	0.999999	D	0.69078	0.997	D	0.68192	0.956	T	0.48927	-0.8991	10	0.08599	T	0.76	.	10.8073	0.46524	0.1549:0.0:0.8451:0.0	.	547	A4D0S4	LAMB4_HUMAN	L	547	ENSP00000205386:P547L;ENSP00000373433:P547L;ENSP00000373432:P547L;ENSP00000402353:P547L;ENSP00000402265:P547L	ENSP00000205386:P547L	P	-	2	0	LAMB4	107519368	0.998000	0.40836	0.682000	0.30024	0.477000	0.33069	5.583000	0.67484	0.561000	0.29186	0.655000	0.94253	CCT		0.502	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		17	78	0	0	0	0.000422831	0	17	78				
PRSS1	5644	broad.mit.edu	37	7	142460344	142460344	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:142460344G>C	ENST00000311737.7	+	4	523	c.517G>C	c.(517-519)Gcc>Ccc	p.A173P	PRSS1_ENST00000486171.1_Missense_Mutation_p.A187P	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	173	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TAAGTGTGAAGCCTCCTACCC	0.522																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(517-519)GCC>CCC		protease, serine, 1 preproprotein							290.0	282.0	285.0					7																	142460344		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142460344G>C	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.517G>C	7.37:g.142460344G>C	ENSP00000308720:p.Ala173Pro		Somatic				uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc003wam.2_Missense_Mutation_p.A113P	p.A173P	NM_002769	NP_002760	WXS	Illumina HiSeq	Unspecified	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		4	534	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	173			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.517G>C	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	5.591	0.293808	0.10567	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.89050	-2.46;-2.46;-2.46	3.28	2.34	0.29019	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.497347	0.23377	N	0.048851	D	0.86785	0.6016	M	0.67569	2.06	0.30618	N	0.758806	B;B	0.32507	0.15;0.373	B;B	0.35353	0.132;0.201	T	0.83322	-0.0017	10	0.45353	T	0.12	.	10.7697	0.46314	0.0:0.0:0.8076:0.1924	.	187;173	E7EQ64;P07477	.;TRY1_HUMAN	P	187;173;163;123	ENSP00000417854:A187P;ENSP00000308720:A173P;ENSP00000419912:A123P	ENSP00000308720:A173P	A	+	1	0	PRSS1	142139918	0.000000	0.05858	0.334000	0.25495	0.034000	0.12701	0.955000	0.29188	0.630000	0.30394	0.398000	0.26397	GCC		0.522	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			27	291	0	0	0	0.00128727	0	27	291				
TRPV6	55503	broad.mit.edu	37	7	142572292	142572292	+	Missense_Mutation	SNP	G	G	C	rs200231244		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:142572292G>C	ENST00000359396.3	-	11	1649	c.1404C>G	c.(1402-1404)ttC>ttG	p.F468L	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	468					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					ATCCTCGGGCGAAGTACATGA	0.592																																							uc003wbx.1		NA																	0				ovary(2)	2						c.(1402-1404)TTC>TTG		transient receptor potential cation channel,							126.0	118.0	120.0					7																	142572292		2203	4300	6503	SO:0001583	missense	55503				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding	g.chr7:142572292G>C	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1404C>G	7.37:g.142572292G>C	ENSP00000352358:p.Phe468Leu		Somatic				TRPV6_uc003wbw.1_Missense_Mutation_p.F254L|TRPV6_uc010lou.1_Missense_Mutation_p.F339L	p.F468L	NM_018646	NP_061116	WXS	Illumina HiSeq	Unspecified	Q9H1D0	TRPV6_HUMAN			11	1620	-	Melanoma(164;0.059)		468			Helical; (Potential).		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	c.1404C>G	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701722	0.68501	.	.	ENSG00000165125	ENST00000359396;ENST00000311470;ENST00000436401	D;D	0.87966	-2.32;-2.32	4.45	-3.59	0.04583	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.91858	0.7423	M	0.91090	3.175	0.58432	D	0.999999	D	0.65815	0.995	D	0.67548	0.952	D	0.88966	0.3397	10	0.72032	D	0.01	-14.0288	7.1676	0.25700	0.4701:0.1244:0.4054:0.0	.	468	Q9H1D0	TRPV6_HUMAN	L	468;300;91	ENSP00000352358:F468L;ENSP00000411100:F91L	ENSP00000310825:F300L	F	-	3	2	TRPV6	142282414	0.003000	0.15002	0.987000	0.45799	0.983000	0.72400	-0.914000	0.04038	-0.516000	0.06470	-0.947000	0.02670	TTC		0.592	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		10	76	0	0	0	0.000442599	0	10	76				
FAM131B	9715	broad.mit.edu	37	7	143054005	143054005	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:143054005C>A	ENST00000409408.1	-	6	2345	c.637G>T	c.(637-639)Gcc>Tcc	p.A213S	FAM131B_ENST00000409346.1_Missense_Mutation_p.A213S|FAM131B_ENST00000443739.2_Missense_Mutation_p.A241S|FAM131B_ENST00000409578.1_Missense_Mutation_p.A229S|FAM131B_ENST00000409222.3_Missense_Mutation_p.A213S			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	213										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					GCCGGAGAGGCAATGAGGGAC	0.552																																							uc003wct.2		NA																	0					0						c.(637-639)GCC>TCC		hypothetical protein LOC9715 isoform b							69.0	65.0	66.0					7																	143054005		2203	4300	6503	SO:0001583	missense	9715							g.chr7:143054005C>A	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.637G>T	7.37:g.143054005C>A	ENSP00000387017:p.Ala213Ser		Somatic				FAM131B_uc010loz.2_Missense_Mutation_p.A181S|FAM131B_uc003wcu.3_Missense_Mutation_p.A213S|FAM131B_uc010lpa.2_Missense_Mutation_p.A241S	p.A213S	NM_014690	NP_055505	WXS	Illumina HiSeq	Unspecified	Q86XD5	F131B_HUMAN			6	2343	-	Melanoma(164;0.205)		213					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	ENST00000409408.1	37	c.637G>T	CCDS5882.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449665	0.84101	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.46	5.46	0.80206	.	0.099179	0.64402	D	0.000002	T	0.32224	0.0822	L	0.55481	1.735	0.51767	D	0.999936	P;P	0.50819	0.939;0.739	B;B	0.44278	0.445;0.291	T	0.02966	-1.1088	10	0.36615	T	0.2	-16.7267	19.3138	0.94204	0.0:1.0:0.0:0.0	.	229;213	Q86XD5-2;Q86XD5	.;F131B_HUMAN	S	241;229;213;217;213;213	ENSP00000410603:A241S;ENSP00000386568:A229S;ENSP00000386984:A213S;ENSP00000387017:A213S;ENSP00000387147:A213S	ENSP00000387147:A213S	A	-	1	0	FAM131B	142764127	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.546000	0.60705	2.561000	0.86390	0.655000	0.94253	GCC		0.552	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		25	33	1	0	3.08376e-08	0.00047179	2.21376e-07	25	33				
ABCB8	11194	broad.mit.edu	37	7	150730846	150730846	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:150730846C>A	ENST00000297504.6	+	3	367	c.301C>A	c.(301-303)Ctg>Atg	p.L101M	ABCB8_ENST00000477092.1_Missense_Mutation_p.L84M|ABCB8_ENST00000542328.1_Intron|ABCB8_ENST00000498578.1_Missense_Mutation_p.L84M|ABCB8_ENST00000356058.4_Missense_Mutation_p.L121M|ABCB8_ENST00000477719.1_Missense_Mutation_p.L84M|ABCB8_ENST00000358849.4_Missense_Mutation_p.L84M|ABCB8_ENST00000493338.1_3'UTR			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	101					transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CCCCATGGTACTGAGTAAGCA	0.657																																							uc003wil.3		NA																	0				breast(2)|upper_aerodigestive_tract(1)	3						c.(301-303)CTG>ATG		ATP-binding cassette, sub-family B, member 8							67.0	60.0	62.0					7																	150730846		2203	4300	6503	SO:0001583	missense	11194					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr7:150730846C>A	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.301C>A	7.37:g.150730846C>A	ENSP00000297504:p.Leu101Met		Somatic				ABCB8_uc003wii.2_Missense_Mutation_p.L121M|ABCB8_uc003wij.3_Missense_Mutation_p.L84M|ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Missense_Mutation_p.L84M|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Missense_Mutation_p.L84M	p.L101M	NM_007188	NP_009119	WXS	Illumina HiSeq	Unspecified	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	394	+			101			Helical; (Potential).		A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37	c.301C>A		.	.	.	.	.	.	.	.	.	.	C	10.23	1.291938	0.23564	.	.	ENSG00000197150	ENST00000461373;ENST00000358849;ENST00000360651;ENST00000297504;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D	0.91407	-2.72;-2.72;-2.84;-2.07;-2.13;-2.15	4.07	2.17	0.27698	.	0.246869	0.32416	N	0.006138	D	0.88966	0.6581	L	0.27053	0.805	0.09310	N	1	B;B;B;P;D	0.71674	0.104;0.129;0.027;0.94;0.998	B;B;B;P;D	0.63381	0.036;0.086;0.067;0.541;0.914	T	0.79988	-0.1571	10	0.59425	D	0.04	-7.0706	7.5329	0.27693	0.0:0.7656:0.0:0.2344	.	84;101;84;84;121	A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;ABCB8_HUMAN;.;.;.	M	121;84;67;101;84;121;84;84	ENSP00000351717:L84M;ENSP00000297504:L101M;ENSP00000418271:L84M;ENSP00000348353:L121M;ENSP00000419891:L84M;ENSP00000419558:L84M	ENSP00000297504:L101M	L	+	1	2	ABCB8	150361779	0.003000	0.15002	0.012000	0.15200	0.035000	0.12851	1.584000	0.36589	0.992000	0.38840	0.561000	0.74099	CTG		0.657	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188		9	57	1	0	3.86212e-05	0.000673444	0.000248141	9	57				
KCNU1	157855	broad.mit.edu	37	8	36766902	36766902	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:36766902C>A	ENST00000399881.3	+	21	2217	c.2180C>A	c.(2179-2181)gCc>gAc	p.A727D		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	727	Segment S9.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		GCCCACTCAGCCCCGATGGGG	0.468																																							uc010lvw.2		NA																	0				ovary(1)	1						c.(2179-2181)GCC>GAC		potassium channel, subfamily U, member 1							231.0	224.0	227.0					8																	36766902		1871	4115	5986	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36766902C>A	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2180C>A	8.37:g.36766902C>A	ENSP00000382770:p.Ala727Asp		Somatic				KCNU1_uc003xjw.2_RNA	p.A727D	NM_001031836	NP_001027006	WXS	Illumina HiSeq	Unspecified	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	21	2267	+			727			Segment S9.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.2180C>A	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.528773	0.44969	.	.	ENSG00000215262	ENST00000399881	T	0.52983	0.64	5.8	5.8	0.92144	.	0.775901	0.10322	U	0.688664	T	0.52240	0.1722	L	0.55481	1.735	0.80722	D	1	P	0.38922	0.651	B	0.38428	0.273	T	0.56269	-0.8007	10	0.87932	D	0	-1.8121	19.6593	0.95859	0.0:1.0:0.0:0.0	.	727	A8MYU2	KCNU1_HUMAN	D	727	ENSP00000382770:A727D	ENSP00000382770:A727D	A	+	2	0	KCNU1	36886060	0.172000	0.23043	0.015000	0.15790	0.087000	0.18053	4.349000	0.59385	2.745000	0.94114	0.655000	0.94253	GCC		0.468	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		158	125	1	0	3.59702e-68	0.000781405	3.85181e-67	158	125				
PXDNL	137902	broad.mit.edu	37	8	52321470	52321470	+	Missense_Mutation	SNP	C	C	G	rs201163014	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:52321470C>G	ENST00000356297.4	-	17	2814	c.2714G>C	c.(2713-2715)cGg>cCg	p.R905P	PXDNL_ENST00000543296.1_Missense_Mutation_p.R905P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	905					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CTGGGATTCCCGCTCCGAGCT	0.582																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(2713-2715)CGG>CCG		peroxidasin homolog-like precursor							38.0	43.0	41.0					8																	52321470		1985	4146	6131	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52321470C>G		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2714G>C	8.37:g.52321470C>G	ENSP00000348645:p.Arg905Pro		Somatic				PXDNL_uc003xqt.3_RNA	p.R905P	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			17	2815	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	905					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.2714G>C	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.189|2.189	-0.385700|-0.385700	0.04966|0.04966	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000522933|ENST00000356297;ENST00000543296	.|T;T	.|0.69435	.|-0.4;-0.4	4.03|4.03	-1.5|-1.5	0.08691|0.08691	.|.	.|0.817539	.|0.10469	.|N	.|0.671059	T|T	0.47930|0.47930	0.1472|0.1472	L|L	0.31578|0.31578	0.945|0.945	0.22435|0.22435	N|N	0.999105|0.999105	.|B	.|0.14805	.|0.011	.|B	.|0.22386	.|0.039	T|T	0.26780|0.26780	-1.0093|-1.0093	5|10	.|0.28530	.|T	.|0.3	.|.	4.3308|4.3308	0.11062|0.11062	0.1635:0.3274:0.0:0.5091|0.1635:0.3274:0.0:0.5091	.|.	.|905	.|A1KZ92	.|PXDNL_HUMAN	R|P	24|905	.|ENSP00000348645:R905P;ENSP00000444865:R905P	.|ENSP00000348645:R905P	G|R	-|-	1|2	0|0	PXDNL|PXDNL	52484023|52484023	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.139000|0.139000	0.21198|0.21198	-0.092000|-0.092000	0.11129|0.11129	-0.874000|-0.874000	0.04027|0.04027	0.561000|0.561000	0.74099|0.74099	GGG|CGG		0.582	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		9	47	0	0	0	0.000673444	0	9	47				
LYN	4067	broad.mit.edu	37	8	56911984	56911984	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:56911984G>C	ENST00000519728.1	+	12	1508	c.1212G>C	c.(1210-1212)aaG>aaC	p.K404N	LYN_ENST00000520220.2_Missense_Mutation_p.K383N	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	404	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TAGGTGCTAAGTTCCCTATTA	0.368																																							uc003xsk.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1210-1212)AAG>AAC		Yamaguchi sarcoma viral (v-yes-1) oncogene							111.0	106.0	108.0					8																	56911984		2203	4300	6503	SO:0001583	missense	4067				erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity	g.chr8:56911984G>C	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1212G>C	8.37:g.56911984G>C	ENSP00000428924:p.Lys404Asn		Somatic				LYN_uc003xsl.3_Missense_Mutation_p.K383N	p.K404N	NM_002350	NP_002341	WXS	Illumina HiSeq	Unspecified	P07948	LYN_HUMAN	Epithelial(17;0.000834)|all cancers(17;0.00598)		12	1494	+		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	404			Protein kinase.		A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	37	c.1212G>C	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053997	0.55218	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.11712	2.75;2.75	4.89	1.76	0.24704	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24392	0.0591	L	0.58101	1.795	0.58432	D	0.999998	D;D	0.65815	0.995;0.973	D;D	0.69654	0.965;0.94	T	0.00704	-1.1602	10	0.87932	D	0	.	10.3154	0.43734	0.3896:0.0:0.6104:0.0	.	474;404	Q6NUK7;P07948	.;LYN_HUMAN	N	404;383	ENSP00000428924:K404N;ENSP00000428424:K383N	ENSP00000428924:K404N	K	+	3	2	LYN	57074538	0.998000	0.40836	1.000000	0.80357	0.950000	0.60333	0.392000	0.20801	0.454000	0.26884	-0.229000	0.12294	AAG		0.368	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350		9	128	0	0	0	0.000978159	0	9	128				
TRPA1	8989	broad.mit.edu	37	8	72970051	72970051	+	Splice_Site	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:72970051C>A	ENST00000262209.4	-	9	1201	c.994G>T	c.(994-996)Gga>Tga	p.G332*		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	332					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATATCTGCTCCCTAAAAATCA	0.323																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(994-996)GGA>TGA		ankyrin-like protein 1	Menthol(DB00825)						69.0	67.0	68.0					8																	72970051		2203	4300	6503	SO:0001630	splice_region_variant	8989					integral to plasma membrane		g.chr8:72970051C>A	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.994-1G>T	8.37:g.72970051C>A			Somatic					p.G332*	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		9	1169	-			332			ANK 8.|Cytoplasmic (Potential).		A6NIN6	Nonsense_Mutation	SNP	ENST00000262209.4	37	c.994G>T	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003627	0.74932	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-10.5917	19.4942	0.95065	0.0:1.0:0.0:0.0	.	.	.	.	X	184;332	.	ENSP00000262209:G332X	G	-	1	0	TRPA1	73132605	1.000000	0.71417	1.000000	0.80357	0.250000	0.25880	6.294000	0.72738	2.602000	0.87976	0.655000	0.94253	GGA		0.323	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Nonsense_Mutation	32	31	1	0	2.85442e-18	0.000339439	2.60136e-17	32	31				
RGS22	26166	broad.mit.edu	37	8	100975116	100975116	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:100975116C>A	ENST00000360863.6	-	25	3900	c.3706G>T	c.(3706-3708)Gca>Tca	p.A1236S	RGS22_ENST00000523287.1_Missense_Mutation_p.A1055S|RGS22_ENST00000523437.1_Missense_Mutation_p.A1224S	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1236					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AAATTACCTGCAAACAACTTT	0.308																																							uc003yjb.1		NA																	0				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3706-3708)GCA>TCA		regulator of G-protein signaling 22							67.0	64.0	65.0					8																	100975116		1802	4067	5869	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:100975116C>A	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3706G>T	8.37:g.100975116C>A	ENSP00000354109:p.Ala1236Ser		Somatic				RGS22_uc003yja.1_Missense_Mutation_p.A1055S|RGS22_uc003yjc.1_Missense_Mutation_p.A1224S	p.A1236S	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		25	3901	-			1236					A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.3706G>T	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	C	8.439	0.850317	0.17034	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000517843;ENST00000523437	T;T;T	0.30981	1.52;1.51;1.52	5.14	-9.18	0.00688	.	1.003210	0.08039	N	0.994847	T	0.13114	0.0318	L	0.28274	0.84	0.09310	N	1	B;B;B	0.12013	0.003;0.003;0.005	B;B;B	0.13407	0.004;0.004;0.009	T	0.23119	-1.0197	10	0.13853	T	0.58	.	4.1986	0.10455	0.1096:0.4562:0.111:0.3232	.	1224;1236;1055	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	S	1236;1223;1055;108;1224	ENSP00000354109:A1236S;ENSP00000429382:A1055S;ENSP00000428212:A1224S	ENSP00000354109:A1236S	A	-	1	0	RGS22	101044292	0.045000	0.20229	0.017000	0.16124	0.022000	0.10575	-0.358000	0.07641	-1.569000	0.01668	-0.339000	0.08088	GCA		0.308	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		5	78	1	0	0.000602214	0.000602214	0.00370261	5	78				
TRPS1	7227	broad.mit.edu	37	8	116426987	116426987	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:116426987A>T	ENST00000220888.5	-	6	3269	c.3110T>A	c.(3109-3111)aTt>aAt	p.I1037N	TRPS1_ENST00000519076.1_Missense_Mutation_p.I791N|TRPS1_ENST00000395715.3_Missense_Mutation_p.I1050N|TRPS1_ENST00000520276.1_Missense_Mutation_p.I1041N			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1037	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTTTATCTGAATGTGCAAAGG	0.448									Langer-Giedion syndrome																														uc003ynz.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(3109-3111)ATT>AAT		zinc finger transcription factor TRPS1							141.0	133.0	136.0					8																	116426987		1891	4116	6007	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116426987A>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3110T>A	8.37:g.116426987A>T	ENSP00000220888:p.Ile1037Asn		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.I1041N|TRPS1_uc003yny.2_Missense_Mutation_p.I1050N|TRPS1_uc010mcy.2_Missense_Mutation_p.I1037N	p.I1037N	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		6	3569	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		1037			Mediates interaction with RNF4 (By similarity).		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.3110T>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.45|18.45	3.627274|3.627274	0.66901|0.66901	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D|D;D;D;D	0.99454|0.98617	-5.92|-5.03;-5.0;-4.96;-5.0	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.057130	.|0.64402	.|D	.|0.000001	D|D	0.97545|0.97545	0.9196|0.9196	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.996;0.998	.|P;P;P	.|0.59703	.|0.862;0.731;0.862	D|D	0.99482|0.99482	1.0948|1.0948	7|10	0.51188|0.66056	T|D	0.08|0.02	.|.	15.8115|15.8115	0.78568|0.78568	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1041;1037;1050	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	Q|N	161|1050;1037;791;1041	ENSP00000428121:H161Q|ENSP00000379065:I1050N;ENSP00000220888:I1037N;ENSP00000428910:I791N;ENSP00000428680:I1041N	ENSP00000428121:H161Q|ENSP00000220888:I1037N	H|I	-|-	3|2	2|0	TRPS1|TRPS1	116496163|116496163	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.686000|8.686000	0.91250|0.91250	2.131000|2.131000	0.65755|0.65755	0.533000|0.533000	0.62120|0.62120	CAT|ATT		0.448	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		18	190	0	0	0	0.000958276	0	18	190				
TRPS1	7227	broad.mit.edu	37	8	116632147	116632147	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:116632147C>A	ENST00000220888.5	-	2	298	c.139G>T	c.(139-141)Gat>Tat	p.D47Y	TRPS1_ENST00000519076.1_Missense_Mutation_p.D47Y|TRPS1_ENST00000395715.3_Missense_Mutation_p.D60Y|TRPS1_ENST00000519674.1_Missense_Mutation_p.D47Y|TRPS1_ENST00000520276.1_Missense_Mutation_p.D51Y			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	47					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCACTCTGATCCGTATTTTCT	0.428									Langer-Giedion syndrome																														uc003ynz.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(139-141)GAT>TAT		zinc finger transcription factor TRPS1							110.0	100.0	103.0					8																	116632147		1912	4151	6063	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116632147C>A	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.139G>T	8.37:g.116632147C>A	ENSP00000220888:p.Asp47Tyr		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.D51Y|TRPS1_uc003yny.2_Missense_Mutation_p.D60Y|TRPS1_uc010mcy.2_Missense_Mutation_p.D47Y	p.D47Y	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	598	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		47					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.139G>T		.	.	.	.	.	.	.	.	.	.	C	17.20	3.327740	0.60743	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815;ENST00000422939	D;D;D;D;T	0.99014	-5.23;-5.2;-5.33;-5.2;0.6	5.82	5.82	0.92795	.	0.151310	0.45867	D	0.000339	D	0.97748	0.9261	N	0.19112	0.55	0.48696	D	0.999691	P;P;P	0.39022	0.655;0.524;0.655	P;B;P	0.46049	0.502;0.185;0.502	D	0.98465	1.0598	10	0.87932	D	0	-9.4404	20.0966	0.97849	0.0:1.0:0.0:0.0	.	51;47;60	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Y	60;47;47;51;47;60;60;60	ENSP00000379065:D60Y;ENSP00000220888:D47Y;ENSP00000428910:D47Y;ENSP00000428680:D51Y;ENSP00000429174:D47Y	ENSP00000220888:D47Y	D	-	1	0	TRPS1	116701322	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.286000	0.58995	2.751000	0.94390	0.650000	0.86243	GAT		0.428	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		62	46	1	0	1.69475e-38	0.000781405	1.78505e-37	62	46				
FAM135B	51059	broad.mit.edu	37	8	139255183	139255183	+	Splice_Site	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:139255183A>G	ENST00000395297.1	-	7	840		c.e7+1			NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B											NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CACAGGCCTTACCTCTGAGGA	0.458										HNSCC(54;0.14)																													uc003yuy.2		NA																	0				ovary(7)|skin(2)	9						c.e7+1		hypothetical protein LOC51059							72.0	73.0	73.0					8																	139255183		1895	4111	6006	SO:0001630	splice_region_variant	51059							g.chr8:139255183A>G	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.669+1T>C	8.37:g.139255183A>G		HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Splice_Site_p.E124_splice|FAM135B_uc003yuz.2_Splice_Site	p.E223_splice	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		7	840	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)							B5MDB3|O95879|Q2WGJ7|Q3KP46	Splice_Site	SNP	ENST00000395297.1	37	c.669_splice	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	A	22.3	4.265686	0.80358	.	.	ENSG00000147724	ENST00000395297	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6571	0.62344	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM135B	139324365	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.264000	0.89866	1.977000	0.57605	0.533000	0.62120	.		0.458	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	Intron	14	110	0	0	0	0.00074312	0	14	110				
EPPK1	83481	broad.mit.edu	37	8	144940555	144940555	+	Silent	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr8:144940555C>G	ENST00000525985.1	-	2	6938	c.6867G>C	c.(6865-6867)gcG>gcC	p.A2289A				P58107	EPIPL_HUMAN	epiplakin 1	2289						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCACCACGCCCGCGGCCACGG	0.726																																							uc003zaa.1		NA																	0				pancreas(1)|skin(1)	2						c.(14875-14877)GCG>GCC		epiplakin 1							70.0	69.0	69.0					8																	144940555		2163	4246	6409	SO:0001819	synonymous_variant	83481					cytoplasm|cytoskeleton	protein binding|structural molecule activity	g.chr8:144940555C>G	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6867G>C	8.37:g.144940555C>G			Somatic					p.A4959A	NM_031308	NP_112598	WXS	Illumina HiSeq	Unspecified	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		2	14890	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		4959			Plectin 62.		Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37	c.14877G>C																																																																																					0.726	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		8	98	0	0	0	0.000673444	0	8	98				
PTPRD	5789	broad.mit.edu	37	9	8486234	8486234	+	Silent	SNP	G	G	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:8486234G>C	ENST00000381196.4	-	25	3126	c.2583C>G	c.(2581-2583)ggC>ggG	p.G861G	PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000356435.5_Silent_p.G861G|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000360074.4_Silent_p.G848G|PTPRD_ENST00000358503.5_Silent_p.G839G|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000540109.1_Silent_p.G861G|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	861	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TATCCTTGCGGCCAAATTTTA	0.468										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(2581-2583)GGC>GGG		protein tyrosine phosphatase, receptor type, D							74.0	75.0	75.0					9																	8486234		2203	4300	6503	SO:0001819	synonymous_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8486234G>C	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2583C>G	9.37:g.8486234G>C		TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Silent_p.G852G|PTPRD_uc003zkm.2_Silent_p.G848G|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	p.G861G	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	27	3294	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	861			Fibronectin type-III 6.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	c.2583C>G	CCDS43786.1																																																																																				0.468	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			42	38	0	0	0	0.000437636	0	42	38				
Unknown	0	broad.mit.edu	37	9	69440203	69440203	+	IGR	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:69440203A>G								ANKRD20A4 (14643 upstream) : AL445665.2 (147174 downstream)																							CTTAAGACACATATGGAAAAC	0.299																																							uc010mnx.1		NA																	0					NA						c.(286-288)CAT>CGT		coiled-coil domain containing 29							14.0	17.0	16.0					9																	69440203		1450	3520	4970	SO:0001628	intergenic_variant	0							g.chr9:69440203A>G																													9.37:g.69440203A>G			Somatic					p.H96R	NM_001098806	NP_001092276	WXS	Illumina HiSeq	Unspecified					3	456	+									Missense_Mutation	SNP		37	c.287A>G																																																																																				0	0.299									31	51	0	0	0	0.00178596	0	31	51				
ASTN2	23245	broad.mit.edu	37	9	119977013	119977013	+	Silent	SNP	G	G	T	rs7856949	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:119977013G>T	ENST00000313400.4	-	3	739	c.639C>A	c.(637-639)ctC>ctA	p.L213L	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Silent_p.L213L|ASTN2_ENST00000361209.2_Silent_p.L213L			O75129	ASTN2_HUMAN	astrotactin 2	213					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GCAGCGCGATGAGGCCACCCT	0.612													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17425	0.0		0.0	False		,,,				2504	0.0						uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(637-639)CTC>CTA		astrotactin 2 isoform c		G		2,4404		0,2,2201	28.0	29.0	29.0		639	3.5	1.0	9	dbSNP_116	29	0,8594		0,0,4297	no	coding-synonymous	ASTN2	NM_014010.4		0,2,6498	TT,TG,GG		0.0,0.0454,0.0154		213/1289	119977013	2,12998	2203	4297	6500	SO:0001819	synonymous_variant	23245					integral to membrane		g.chr9:119977013G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.639C>A	9.37:g.119977013G>T			Somatic				ASTN2_uc004bjr.1_Silent_p.L213L|ASTN2_uc004bjt.1_Silent_p.L213L	p.L213L	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			3	740	-			213			Helical; (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37	c.639C>A																																																																																					0.612	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		10	33	1	0	2.68362e-12	0.00136819	2.21055e-11	10	33				
ASTN2	23245	broad.mit.edu	37	9	120053696	120053696	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:120053696G>T	ENST00000313400.4	-	2	639	c.539C>A	c.(538-540)tCc>tAc	p.S180Y	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.S180Y|ASTN2_ENST00000361209.2_Missense_Mutation_p.S180Y			O75129	ASTN2_HUMAN	astrotactin 2	180					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CAGCTGCCCGGAGCTGCTCAT	0.592																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(538-540)TCC>TAC		astrotactin 2 isoform c							64.0	62.0	62.0					9																	120053696		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:120053696G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.539C>A	9.37:g.120053696G>T	ENSP00000314038:p.Ser180Tyr		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.S180Y|ASTN2_uc004bjt.1_Missense_Mutation_p.S180Y	p.S180Y	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			2	640	-			180			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.539C>A		.	.	.	.	.	.	.	.	.	.	G	25.3	4.621559	0.87460	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.11712	2.78;2.78;2.75	5.58	5.58	0.84498	.	0.233360	0.36002	N	0.002841	T	0.13072	0.0317	L	0.29908	0.895	0.41720	D	0.989505	B;B;D	0.54397	0.25;0.162;0.966	B;B;P	0.49953	0.241;0.121;0.627	T	0.03000	-1.1084	9	.	.	.	-9.1142	13.1929	0.59722	0.0729:0.0:0.9271:0.0	.	180;180;180	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	Y	180	ENSP00000314038:S180Y;ENSP00000363108:S180Y;ENSP00000354504:S180Y	.	S	-	2	0	ASTN2	119093517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.728000	0.74769	2.782000	0.95742	0.655000	0.94253	TCC		0.592	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		13	43	1	0	3.27435e-08	0.000219431	2.33752e-07	13	43				
RC3H2	54542	broad.mit.edu	37	9	125618088	125618088	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:125618088C>A	ENST00000373670.1	-	13	3124	c.2524G>T	c.(2524-2526)Ggc>Tgc	p.G842C	RC3H2_ENST00000423239.2_Missense_Mutation_p.G842C|RC3H2_ENST00000357244.2_Missense_Mutation_p.G842C			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	842					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						CCTATGGTGCCACAAGACCAG	0.378																																							uc010mwc.1		NA																	0				ovary(2)|lung(2)	4						c.(2524-2526)GGC>TGC		ring finger and CCCH-type zinc finger domains 2							101.0	99.0	100.0					9																	125618088		1871	4100	5971	SO:0001583	missense	54542					cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding	g.chr9:125618088C>A	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2524G>T	9.37:g.125618088C>A	ENSP00000362774:p.Gly842Cys		Somatic				RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.G842C|RC3H2_uc004bne.3_Missense_Mutation_p.G842C	p.G842C	NM_001100588	NP_001094058	WXS	Illumina HiSeq	Unspecified	Q9HBD1	RC3H2_HUMAN			14	2765	-			842					Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	c.2524G>T	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384904	0.61956	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.49139	0.79;0.79;0.81	5.53	5.53	0.82687	.	0.053328	0.85682	D	0.000000	T	0.38295	0.1035	N	0.14661	0.345	0.80722	D	1	P;P	0.43169	0.698;0.8	B;B	0.43575	0.243;0.424	T	0.40403	-0.9565	10	0.66056	D	0.02	-11.0258	16.6089	0.84838	0.0:1.0:0.0:0.0	.	842;842	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	C	842;842;713;842	ENSP00000362774:G842C;ENSP00000349783:G842C;ENSP00000411767:G842C	ENSP00000349783:G842C	G	-	1	0	RC3H2	124657909	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.833000	0.55790	2.595000	0.87683	0.655000	0.94253	GGC		0.378	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835		14	55	1	0	1.05317e-09	0.000219431	7.96073e-09	14	55				
ABO	28	broad.mit.edu	37	9	136135254	136135254	+	RNA	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:136135254G>A	ENST00000453660.2	-	0	183							P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		AGATGGTCAGGTTCCCTAACA	0.532																																							uc004cda.1		NA																	0					0						c.(172-174)CCT>TCT		ABO blood group (alpha							105.0	104.0	104.0					9																	136135254		2121	4234	6355			28				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	fucosylgalactoside 3-alpha-galactosyltransferase activity|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity|metal ion binding	g.chr9:136135254G>A	AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136135254G>A			Somatic				ABO_uc010naf.1_5'UTR|ABO_uc011mcz.1_5'UTR|ABO_uc010nag.1_5'UTR	p.P58S	NM_020469	NP_065202	WXS	Illumina HiSeq	Unspecified	P16442	BGAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)	4	197	-			58			Lumenal (Potential).		B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	Missense_Mutation	SNP	ENST00000453660.2	37	c.172C>T																																																																																					0.532	ABO-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054907.4	NM_020469		5	13	0	0	0	0.000442599	0	5	13				
TMEM27	57393	broad.mit.edu	37	X	15657827	15657827	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:15657827C>G	ENST00000380342.3	-	5	625	c.370G>C	c.(370-372)Gaa>Caa	p.E124Q		NM_020665.4	NP_065716.1	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27	124					positive regulation of amino acid transport (GO:0051957)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of SNARE complex assembly (GO:0035543)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)			endometrium(3)|lung(4)|ovary(1)	8	Hepatocellular(33;0.183)					TTTAAAAATTCCAGAGTTTGG	0.338																																							uc004cxc.1		NA																	0				ovary(1)	1						c.(370-372)GAA>CAA		transmembrane protein 27 precursor							140.0	144.0	143.0					X																	15657827		2203	4300	6503	SO:0001583	missense	57393				proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity	g.chrX:15657827C>G	AF229179	CCDS14170.1	Xp22	2012-04-13			ENSG00000147003	ENSG00000147003			29437	protein-coding gene	gene with protein product	"""collectrin"""	300631				11278314	Standard	NM_020665		Approved	NX17	uc004cxc.2	Q9HBJ8	OTTHUMG00000021181	ENST00000380342.3:c.370G>C	X.37:g.15657827C>G	ENSP00000369699:p.Glu124Gln		Somatic					p.E124Q	NM_020665	NP_065716	WXS	Illumina HiSeq	Unspecified	Q9HBJ8	TMM27_HUMAN			5	626	-	Hepatocellular(33;0.183)		124			Extracellular (Potential).		B2R9M1|Q6UW07	Missense_Mutation	SNP	ENST00000380342.3	37	c.370G>C	CCDS14170.1	.	.	.	.	.	.	.	.	.	.	c	14.94	2.686195	0.47991	.	.	ENSG00000147003	ENST00000380342	D	0.85773	-2.03	5.95	5.95	0.96441	.	0.046518	0.85682	D	0.000000	D	0.85974	0.5822	M	0.67700	2.07	0.41352	D	0.987375	P	0.51537	0.946	P	0.46253	0.509	D	0.86960	0.2091	10	0.51188	T	0.08	-21.3806	14.1168	0.65159	0.0:0.8528:0.1472:0.0	.	124	Q9HBJ8	TMM27_HUMAN	Q	124	ENSP00000369699:E124Q	ENSP00000369699:E124Q	E	-	1	0	TMEM27	15567748	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.271000	0.51608	2.520000	0.84964	0.591000	0.81541	GAA		0.338	TMEM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055879.1	NM_020665		62	96	0	0	0	0.000781405	0	62	96				
GJB1	2705	broad.mit.edu	37	X	70444128	70444128	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:70444128A>T	ENST00000374022.3	+	2	666	c.571A>T	c.(571-573)Acc>Tcc	p.T191S	GJB1_ENST00000361726.6_Missense_Mutation_p.T191S|GJB1_ENST00000374029.1_Missense_Mutation_p.T191S	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	191			Missing (in CMTX1). {ECO:0000269|PubMed:9361298}.|T -> A (in CMTX1). {ECO:0000269|PubMed:12477701}.		cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					AACCGTCTTCACCGTCTTCAT	0.632																																							uc004dzf.3		NA																	0				breast(1)	1	GRCh37	CI023722|CM004049	GJB1	I|M		c.(571-573)ACC>TCC		gap junction protein, beta 1, 32kDa							100.0	65.0	77.0					X																	70444128		2203	4300	6503	SO:0001583	missense	2705				cell-cell signaling|cellular membrane organization|gap junction assembly|nervous system development	connexon complex|endoplasmic reticulum membrane|integral to membrane	gap junction channel activity	g.chrX:70444128A>T	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.571A>T	X.37:g.70444128A>T	ENSP00000363134:p.Thr191Ser		Somatic				BCYRN1_uc011mpt.1_Intron|GJB1_uc004dzg.3_Missense_Mutation_p.T191S	p.T191S	NM_001097642	NP_001091111	WXS	Illumina HiSeq	Unspecified	P08034	CXB1_HUMAN			2	666	+	Renal(35;0.156)		191		Missing (in CMTX1).|T -> A (in CMTX1).	Extracellular (Probable).		B2R8R2|D3DVV2|Q5U0S4	Missense_Mutation	SNP	ENST00000374022.3	37	c.571A>T	CCDS14408.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343376	0.61073	.	.	ENSG00000169562	ENST00000374029;ENST00000374022;ENST00000361726	D;D;D	0.95588	-3.75;-3.75;-3.75	4.99	4.99	0.66335	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97855	1.0277	10	0.72032	D	0.01	.	13.8919	0.63744	1.0:0.0:0.0:0.0	.	191	P08034	CXB1_HUMAN	S	191	ENSP00000363141:T191S;ENSP00000363134:T191S;ENSP00000354900:T191S	ENSP00000354900:T191S	T	+	1	0	GJB1	70360853	1.000000	0.71417	0.995000	0.50966	0.569000	0.35902	9.136000	0.94489	1.854000	0.53819	0.480000	0.44947	ACC		0.632	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166		5	46	0	0	0	0.000157383	0	5	46				
TAF1	6872	broad.mit.edu	37	X	70595136	70595136	+	Splice_Site	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:70595136G>T	ENST00000373790.4	+	4	583	c.532G>T	c.(532-534)Gag>Tag	p.E178*	TAF1_ENST00000423759.1_Splice_Site_p.V178L|TAF1_ENST00000276072.3_Splice_Site_p.V178L|TAF1_ENST00000449580.1_Splice_Site_p.E178*	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	178	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TATTACTGGTGGTAAGTAGAG	0.443																																							uc004dzu.3		NA																	0				ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17						c.(532-534)GAG>TAG		TBP-associated factor 1 isoform 2							94.0	80.0	85.0					X																	70595136		2203	4300	6503	SO:0001630	splice_region_variant	6872				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity	g.chrX:70595136G>T		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.532+1G>T	X.37:g.70595136G>T			Somatic				BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.V178L	p.E178*	NM_138923	NP_620278	WXS	Illumina HiSeq	Unspecified	P21675	TAF1_HUMAN			4	583	+	Renal(35;0.156)	all_lung(315;0.000321)	178			Protein kinase 1.		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Nonsense_Mutation	SNP	ENST00000373790.4	37	c.532G>T	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.5|24.5	4.543529|4.543529	0.86022|0.86022	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580|ENST00000423759;ENST00000276072	.|T;T	.|0.08634	.|3.13;3.07	4.83|4.83	3.95|3.95	0.45737|0.45737	.|.	.|0.085006	.|0.44285	.|D	.|0.000464	.|T	.|0.05135	.|0.0137	.|.	.|.	.|.	0.37489|0.37489	D|D	0.916327|0.916327	.|B	.|0.12013	.|0.005	.|B	.|0.15052	.|0.012	.|T	.|0.33574	.|-0.9863	.|9	0.21540|0.11485	T|T	0.41|0.65	.|.	12.0516|12.0516	0.53509|0.53509	0.0866:0.0:0.9134:0.0|0.0866:0.0:0.9134:0.0	.|.	.|178	.|P21675-2	.|.	X|L	178|178	.|ENSP00000406549:V178L;ENSP00000276072:V178L	ENSP00000362895:E178X|ENSP00000276072:V178L	E|V	+|+	1|1	0|0	TAF1|TAF1	70511861|70511861	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.207000|0.207000	0.24258|0.24258	6.139000|6.139000	0.71728|0.71728	2.128000|2.128000	0.65567|0.65567	0.429000|0.429000	0.28392|0.28392	GAG|GTG		0.443	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	Nonsense_Mutation	8	47	1	0	1.12685e-05	0.000274275	7.54168e-05	8	47				
BTK	695	broad.mit.edu	37	X	100617598	100617598	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:100617598C>A	ENST00000308731.7	-	6	634	c.471G>T	c.(469-471)caG>caT	p.Q157H	BTK_ENST00000372880.1_Missense_Mutation_p.Q157H	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	157					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TTTTGGCTGTCTGAGAGCAGC	0.433									Agammaglobulinemia, X-linked																														uc004ehg.2		NA																	0				lung(3)|central_nervous_system(2)|ovary(1)	6	GRCh37	CI973253	BTK	I		c.(469-471)CAG>CAT		Bruton agammaglobulinemia tyrosine kinase							142.0	131.0	135.0					X																	100617598		2203	4300	6503	SO:0001583	missense	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100617598C>A	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.471G>T	X.37:g.100617598C>A	ENSP00000308176:p.Gln157His		Somatic				BTK_uc010nnn.2_Missense_Mutation_p.Q157H|BTK_uc010nno.2_Missense_Mutation_p.Q191H|BTK_uc004ehi.2_Missense_Mutation_p.Q157H	p.Q157H	NM_000061	NP_000052	WXS	Illumina HiSeq	Unspecified	Q06187	BTK_HUMAN			6	664	-			157			Btk-type.		B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.471G>T	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949734	0.73787	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;D	0.95788	-3.81;-3.81	5.49	3.71	0.42584	Pleckstrin homology-type (1);Zinc finger, Btk motif (4);	0.000000	0.85682	D	0.000000	D	0.96962	0.9008	M	0.77486	2.375	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.996	D	0.96333	0.9245	10	0.59425	D	0.04	.	9.0949	0.36634	0.0:0.7659:0.0:0.2341	.	157;157;157	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	H	157	ENSP00000361971:Q157H;ENSP00000308176:Q157H	ENSP00000308176:Q157H	Q	-	3	2	BTK	100504254	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.588000	0.36633	1.093000	0.41377	0.529000	0.55759	CAG		0.433	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061		49	81	1	0	2.9001e-28	0.000781405	2.93436e-27	49	81				
BTK	695	broad.mit.edu	37	X	100617612	100617612	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:100617612G>A	ENST00000308731.7	-	6	620	c.457C>T	c.(457-459)Ctc>Ttc	p.L153F	BTK_ENST00000372880.1_Missense_Mutation_p.L153F	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	153					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GAGCAGCAGAGATACTGCCCA	0.433									Agammaglobulinemia, X-linked																														uc004ehg.2		NA																	0				lung(3)|central_nervous_system(2)|ovary(1)	6						c.(457-459)CTC>TTC		Bruton agammaglobulinemia tyrosine kinase							154.0	142.0	146.0					X																	100617612		2203	4300	6503	SO:0001583	missense	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100617612G>A	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.457C>T	X.37:g.100617612G>A	ENSP00000308176:p.Leu153Phe		Somatic				BTK_uc010nnn.2_Missense_Mutation_p.L153F|BTK_uc010nno.2_Missense_Mutation_p.L187F|BTK_uc004ehi.2_Missense_Mutation_p.L153F	p.L153F	NM_000061	NP_000052	WXS	Illumina HiSeq	Unspecified	Q06187	BTK_HUMAN			6	650	-			153			Btk-type.		B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.457C>T	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380347	0.82682	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;D	0.94723	-3.5;-3.5	5.49	5.49	0.81192	Pleckstrin homology-type (1);Zinc finger, Btk motif (3);	0.134998	0.52532	D	0.000072	D	0.96738	0.8935	M	0.68952	2.095	0.58432	D	0.999998	D;D;D	0.67145	0.996;0.993;0.994	D;D;P	0.68765	0.96;0.928;0.906	D	0.97041	0.9757	10	0.62326	D	0.03	.	18.4742	0.90786	0.0:0.0:1.0:0.0	.	153;153;153	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	F	153	ENSP00000361971:L153F;ENSP00000308176:L153F	ENSP00000308176:L153F	L	-	1	0	BTK	100504268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.114000	0.71560	2.305000	0.77605	0.529000	0.55759	CTC		0.433	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061		46	97	0	0	0	0.000781405	0	46	97				
MUM1L1	139221	broad.mit.edu	37	X	105449717	105449717	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:105449717A>G	ENST00000357175.2	+	4	941	c.292A>G	c.(292-294)Aat>Gat	p.N98D	MUM1L1_ENST00000337685.2_Missense_Mutation_p.N98D|MUM1L1_ENST00000372552.1_Missense_Mutation_p.N98D	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	98						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGGTATTCTGAATGAGAGAAC	0.453																																							uc004emf.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(292-294)AAT>GAT		melanoma associated antigen (mutated) 1-like 1							58.0	49.0	52.0					X																	105449717		1918	4108	6026	SO:0001583	missense	139221							g.chrX:105449717A>G	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.292A>G	X.37:g.105449717A>G	ENSP00000349699:p.Asn98Asp		Somatic				MUM1L1_uc004emg.1_Missense_Mutation_p.N98D	p.N98D	NM_152423	NP_689636	WXS	Illumina HiSeq	Unspecified	Q5H9M0	MUML1_HUMAN			4	941	+			98					D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	ENST00000357175.2	37	c.292A>G	CCDS55469.1	.	.	.	.	.	.	.	.	.	.	A	10.77	1.442865	0.25987	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.33654	1.4;1.4;1.4	4.8	2.28	0.28536	.	0.511199	0.17844	N	0.160118	T	0.33030	0.0849	M	0.66297	2.02	0.20873	N	0.999831	B	0.15473	0.013	B	0.09377	0.004	T	0.29941	-0.9995	10	0.54805	T	0.06	-18.9723	6.4484	0.21890	0.7922:0.0:0.2078:0.0	.	98	Q5H9M0	MUML1_HUMAN	D	98	ENSP00000349699:N98D;ENSP00000338641:N98D;ENSP00000361632:N98D	ENSP00000338641:N98D	N	+	1	0	MUM1L1	105336373	0.996000	0.38824	0.962000	0.40283	0.403000	0.30841	0.978000	0.29488	0.211000	0.20683	0.486000	0.48141	AAT		0.453	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423		23	23	0	0	0	0.000586117	0	23	23				
GUCY2F	2986	broad.mit.edu	37	X	108619377	108619377	+	Missense_Mutation	SNP	G	G	T	rs372240553		TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:108619377G>T	ENST00000218006.2	-	18	3461	c.3170C>A	c.(3169-3171)aCc>aAc	p.T1057N		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	1057					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						CAGCCAGAAGGTTTCCTCTGT	0.408																																							uc004eod.3		NA																	0				lung(4)|breast(3)|central_nervous_system(1)	8						c.(3169-3171)ACC>AAC		guanylate cyclase 2F precursor							136.0	123.0	127.0					X																	108619377		2203	4300	6503	SO:0001583	missense	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108619377G>T	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.3170C>A	X.37:g.108619377G>T	ENSP00000218006:p.Thr1057Asn		Somatic				GUCY2F_uc011msq.1_RNA	p.T1057N	NM_001522	NP_001513	WXS	Illumina HiSeq	Unspecified	P51841	GUC2F_HUMAN			18	3446	-			1057			Cytoplasmic (Potential).		Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	c.3170C>A	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942273	0.53079	.	.	ENSG00000101890	ENST00000218006	D	0.83163	-1.69	4.49	1.66	0.24008	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.057143	0.64402	D	0.000002	D	0.91188	0.7224	M	0.94063	3.49	0.53005	D	0.999961	D	0.89917	1.0	D	0.97110	1.0	D	0.88435	0.3038	10	0.87932	D	0	.	5.9952	0.19489	0.0961:0.0:0.5717:0.3322	.	1057	P51841	GUC2F_HUMAN	N	1057	ENSP00000218006:T1057N	ENSP00000218006:T1057N	T	-	2	0	GUCY2F	108506033	1.000000	0.71417	0.846000	0.33378	0.893000	0.52053	5.515000	0.67049	0.210000	0.20664	0.600000	0.82982	ACC		0.408	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		7	169	1	0	6.5536e-12	0.000157383	5.29646e-11	7	169				
ACSL4	2182	broad.mit.edu	37	X	108904811	108904811	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:108904811G>T	ENST00000469796.2	-	14	2165	c.1769C>A	c.(1768-1770)gCt>gAt	p.A590D	ACSL4_ENST00000348502.6_Missense_Mutation_p.A549D|ACSL4_ENST00000340800.2_Missense_Mutation_p.A590D			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	590					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	CTTCAGTGCAGCTTCTACTTT	0.333																																					Pancreas(188;358 2127 38547 41466 45492)	Pancreas(188;358 2127 38547 41466 45492)	uc004eoi.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(1768-1770)GCT>GAT		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Troglitazone(DB00197)						186.0	159.0	168.0					X																	108904811		2203	4299	6502	SO:0001583	missense	2182				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chrX:108904811G>T	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1769C>A	X.37:g.108904811G>T	ENSP00000419171:p.Ala590Asp		Somatic				ACSL4_uc004eoj.2_Missense_Mutation_p.A549D|ACSL4_uc004eok.2_Missense_Mutation_p.A549D	p.A590D	NM_022977	NP_075266	WXS	Illumina HiSeq	Unspecified	O60488	ACSL4_HUMAN			15	2274	-			590			Cytoplasmic (Potential).		D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	c.1769C>A	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736269	0.89482	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.16324	2.35;2.35;2.35	5.12	5.12	0.69794	AMP-dependent synthetase/ligase (1);	0.184440	0.48767	D	0.000164	T	0.42539	0.1207	M	0.79926	2.475	0.50813	D	0.999894	P	0.50710	0.938	P	0.58928	0.848	T	0.41752	-0.9491	10	0.56958	D	0.05	-14.9409	17.9717	0.89115	0.0:0.0:1.0:0.0	.	590	O60488	ACSL4_HUMAN	D	549;590;590	ENSP00000262835:A549D;ENSP00000419171:A590D;ENSP00000339787:A590D	ENSP00000339787:A590D	A	-	2	0	ACSL4	108791467	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.908000	0.87438	2.265000	0.75225	0.506000	0.49869	GCT		0.333	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458		8	97	1	0	2.74318e-10	0.000442599	2.12349e-09	8	97				
TENM1	10178	broad.mit.edu	37	X	123587225	123587225	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:123587225G>T	ENST00000371130.3	-	22	4108	c.4045C>A	c.(4045-4047)Caa>Aaa	p.Q1349K	TENM1_ENST00000422452.2_Missense_Mutation_p.Q1356K|TENM1_ENST00000461429.1_5'Flank	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1349					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CTCAGTGGTTGTGTGGAAGTC	0.403																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(4045-4047)CAA>AAA		odz, odd Oz/ten-m homolog 1 isoform 3							291.0	206.0	235.0					X																	123587225		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123587225G>T	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4045C>A	X.37:g.123587225G>T	ENSP00000360171:p.Gln1349Lys		Somatic				ODZ1_uc011muj.1_Missense_Mutation_p.Q1355K|ODZ1_uc010nqy.2_Missense_Mutation_p.Q1356K	p.Q1349K	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			22	4109	-			1349			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.4045C>A	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255585	0.80135	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.84944	-1.92;-1.88	5.97	5.97	0.96955	Six-bladed beta-propeller, TolB-like (1);	0.118476	0.64402	D	0.000015	D	0.86859	0.6034	N	0.26042	0.785	0.80722	D	1	D;P;P	0.54964	0.969;0.817;0.608	D;B;B	0.64877	0.93;0.292;0.218	T	0.83003	-0.0176	10	0.15952	T	0.53	.	19.357	0.94418	0.0:0.0:1.0:0.0	.	1355;1356;1349	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	1349;1356	ENSP00000360171:Q1349K;ENSP00000403954:Q1356K	ENSP00000360171:Q1349K	Q	-	1	0	ODZ1	123414906	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.766000	0.98957	2.524000	0.85096	0.600000	0.82982	CAA		0.403	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		51	69	1	0	4.02871e-13	0.000781405	3.45126e-12	51	69				
DCAF12L1	139170	broad.mit.edu	37	X	125685331	125685331	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:125685331A>T	ENST00000371126.1	-	1	1503	c.1261T>A	c.(1261-1263)Ttt>Att	p.F421I		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	421										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						ATGCCACCAAAGTAATTCACC	0.577																																							uc004eul.2		NA																	0				skin(3)|ovary(1)	4						c.(1261-1263)TTT>ATT		DDB1 and CUL4 associated factor 12-like 1							119.0	109.0	112.0					X																	125685331		2203	4300	6503	SO:0001583	missense	139170							g.chrX:125685331A>T	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1261T>A	X.37:g.125685331A>T	ENSP00000360167:p.Phe421Ile		Somatic					p.F421I	NM_178470	NP_848565	WXS	Illumina HiSeq	Unspecified	Q5VU92	DC121_HUMAN			1	1512	-			421					Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	c.1261T>A	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	A	9.429	1.085014	0.20390	.	.	ENSG00000198889	ENST00000371126	T	0.21543	2.0	4.0	1.56	0.23342	.	0.467388	0.16012	N	0.233747	T	0.18341	0.0440	M	0.66939	2.045	0.32040	N	0.598393	B	0.30406	0.278	B	0.24155	0.051	T	0.12116	-1.0560	10	0.45353	T	0.12	.	4.7483	0.13049	0.6927:0.1964:0.1109:0.0	.	421	Q5VU92	DC121_HUMAN	I	421	ENSP00000360167:F421I	ENSP00000360167:F421I	F	-	1	0	DCAF12L1	125513012	1.000000	0.71417	0.001000	0.08648	0.139000	0.21198	3.445000	0.52921	0.205000	0.20568	0.417000	0.27973	TTT		0.577	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		13	131	0	0	0	0.000308642	0	13	131				
UBE2NL	389898	broad.mit.edu	37	X	142967567	142967567	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:142967567T>C	ENST00000370494.1	+	1	395	c.365T>C	c.(364-366)tTa>tCa	p.L122S		NM_001012989.1	NP_001013007.1	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like (gene/pseudogene)	122						extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)			breast(1)|endometrium(1)|large_intestine(8)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GATGATCCATTAGCAAATGAT	0.438																																							uc004fca.2		NA																	0					0						c.(364-366)TTA>TCA		ubiquitin-conjugating enzyme E2N-like							143.0	119.0	128.0					X																	142967567		2203	4300	6503	SO:0001583	missense	389898						acid-amino acid ligase activity	g.chrX:142967567T>C			Xq27.3	2014-06-11	2014-06-11		ENSG00000102069			"""Ubiquitin-conjugating enzymes E2"""	31710	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2N-like"""			20736409	Standard	NM_001012989		Approved		uc004fca.3	Q5JXB2	OTTHUMG00000022586	ENST00000370494.1:c.365T>C	X.37:g.142967567T>C	ENSP00000359525:p.Leu122Ser		Somatic					p.L122S	NM_001012989	NP_001013007	WXS	Illumina HiSeq	Unspecified	Q5JXB2	UE2NL_HUMAN			1	395	+	Acute lymphoblastic leukemia(192;6.56e-05)		122					E9KL27	Missense_Mutation	SNP	ENST00000370494.1	37	c.365T>C	CCDS35420.1	.	.	.	.	.	.	.	.	.	.	T	11.80	1.747030	0.30955	.	.	ENSG00000102069	ENST00000370494	T	0.43688	0.94	1.16	1.16	0.20824	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.26217	U	0.025659	T	0.76506	0.3997	H	0.99911	4.935	0.58432	D	0.999999	D	0.76494	0.999	D	0.79108	0.992	T	0.76432	-0.2961	10	0.87932	D	0	-0.079	6.204	0.20591	0.0:0.0:0.0:1.0	.	122	Q5JXB2	UE2NL_HUMAN	S	122	ENSP00000359525:L122S	ENSP00000359525:L122S	L	+	2	0	UBE2NL	142795233	1.000000	0.71417	0.999000	0.59377	0.248000	0.25809	5.143000	0.64826	0.738000	0.32606	0.151000	0.16131	TTA		0.438	UBE2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058624.1	NM_001012989		3	127	0	0	0	6.4e-05	0	3	127				
AFF2	2334	broad.mit.edu	37	X	148048494	148048494	+	Missense_Mutation	SNP	A	A	G	rs149653283	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chrX:148048494A>G	ENST00000370460.2	+	14	3567	c.3088A>G	c.(3088-3090)Atc>Gtc	p.I1030V	AFF2_ENST00000370457.5_Missense_Mutation_p.I995V|AFF2_ENST00000342251.3_Missense_Mutation_p.I997V|AFF2_ENST00000286437.5_Missense_Mutation_p.I671V	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1030					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					cacctctaccatcactacTGG	0.567																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(3088-3090)ATC>GTC		fragile X mental retardation 2							380.0	264.0	304.0					X																	148048494		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148048494A>G	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3088A>G	X.37:g.148048494A>G	ENSP00000359489:p.Ile1030Val		Somatic				AFF2_uc004fcq.2_Missense_Mutation_p.I1020V|AFF2_uc004fcr.2_Missense_Mutation_p.I991V|AFF2_uc011mxb.1_Missense_Mutation_p.I995V|AFF2_uc004fcs.2_Missense_Mutation_p.I995V|AFF2_uc011mxc.1_Missense_Mutation_p.I671V	p.I1030V	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			14	3567	+	Acute lymphoblastic leukemia(192;6.56e-05)		1030					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.3088A>G	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954234	0.34471	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.71461	0.02;-0.24;-0.24;-0.57	4.18	4.18	0.49190	.	0.089728	0.42053	D	0.000773	T	0.49508	0.1561	N	0.22421	0.69	0.23260	N	0.998024	P;P;P;P;P;P	0.38473	0.633;0.579;0.579;0.579;0.579;0.633	B;B;B;B;B;B	0.35114	0.196;0.124;0.124;0.124;0.124;0.196	T	0.38023	-0.9680	10	0.29301	T	0.29	.	5.4451	0.16531	0.8777:0.0:0.1223:0.0	.	671;995;995;991;1020;1030	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	V	1030;995;997;671	ENSP00000359489:I1030V;ENSP00000359486:I995V;ENSP00000345459:I997V;ENSP00000286437:I671V	ENSP00000286437:I671V	I	+	1	0	AFF2	147856188	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.240000	0.51368	1.860000	0.53959	0.417000	0.27973	ATC		0.567	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		10	165	0	0	0	0.00136819	0	10	165				
KCNA4	3739	broad.mit.edu	37	11	30033550	30033551	+	Frame_Shift_Ins	INS	-	-	T			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:30033550_30033551insT	ENST00000328224.6	-	2	1908_1909	c.675_676insA	c.(673-678)cgccccfs	p.P226fs	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	226					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TCAAAGCTGGGGCGGTTCCTGT	0.465																																							uc001msk.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(673-678)CGCCCCfs		potassium voltage-gated channel, shaker-related																																				SO:0001589	frameshift_variant	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30033550_30033551insT	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.675_676insA	11.37:g.30033550_30033551insT	ENSP00000328511:p.Pro226fs		Somatic					p.R225fs	NM_002233	NP_002224	WXS	Illumina HiSeq	Unspecified	P22459	KCNA4_HUMAN			2	1827_1828	-			225_226						Frame_Shift_Ins	INS	ENST00000328224.6	37	c.675_676insA	CCDS41629.1																																																																																				0.465	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		47	91	NA	NA	NA	NA	NA	47	91	---	---	---	---
OR5M8	219484	broad.mit.edu	37	11	56258610	56258611	+	Frame_Shift_Ins	INS	-	-	T	rs142855645	byFrequency	TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr11:56258610_56258611insT	ENST00000327216.2	-	1	260_261	c.236_237insA	c.(235-237)aagfs	p.K79fs		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					TCTCCAGCATCTTTGGAGTCAC	0.47																																							uc001nix.1		NA																	0				central_nervous_system(1)	1						c.(235-237)AAGfs		olfactory receptor, family 5, subfamily M,																																				SO:0001589	frameshift_variant	219484				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56258610_56258611insT	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.237dupA	11.37:g.56258613_56258613dupT	ENSP00000323354:p.Lys79fs		Somatic					p.K79fs	NM_001005282	NP_001005282	WXS	Illumina HiSeq	Unspecified	Q8NGP6	OR5M8_HUMAN			1	236_237	-	Esophageal squamous(21;0.00352)		79			Extracellular (Potential).		B2RNM5|Q6IEW3|Q96RB8	Frame_Shift_Ins	INS	ENST00000327216.2	37	c.236_237insA	CCDS31533.1																																																																																				0.470	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282		34	83	NA	NA	NA	NA	NA	34	83	---	---	---	---
IL1RL1	9173	broad.mit.edu	37	2	102955384	102955387	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	ACTC	ACTC	-	-	ACTC	ACTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr2:102955384_102955387delACTC	ENST00000233954.1	+	3	420_423	c.149_152delACTC	c.(148-153)tactcafs	p.YS50fs	IL1RL1_ENST00000409584.1_Frame_Shift_Del_p.YS50fs|IL1RL1_ENST00000473175.1_3'UTR|IL1RL1_ENST00000404917.2_Intron|IL1RL1_ENST00000311734.2_Frame_Shift_Del_p.YS50fs|IL1RL1_ENST00000393393.3_Frame_Shift_Del_p.YS50fs	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	50	Ig-like C2-type 1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						GATTGGTATTACTCACAAACAAAC	0.407																																							uc002tbu.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(148-153)TACTCAfs		interleukin 1 receptor-like 1 isoform 1																																				SO:0001589	frameshift_variant	9173				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity	g.chr2:102955384_102955387delACTC	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.149_152delACTC	2.37:g.102955384_102955387delACTC	ENSP00000233954:p.Tyr50fs		Somatic				IL1RL1_uc010ywa.1_Intron|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Frame_Shift_Del_p.Y50fs	p.Y50fs	NM_016232	NP_057316	WXS	Illumina HiSeq	Unspecified	Q01638	ILRL1_HUMAN			3	420_423	+			50_51			Extracellular (Potential).|Ig-like C2-type 1.		A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Frame_Shift_Del	DEL	ENST00000233954.1	37	c.149_152delACTC	CCDS2057.1																																																																																				0.407	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232		15	179	NA	NA	NA	NA	NA	15	179	---	---	---	---
ABCB8	11194	broad.mit.edu	37	7	150737715	150737720	+	Splice_Site	DEL	GCTTCA	GCTTCA	-			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	GCTTCA	GCTTCA	-	-	GCTTCA	GCTTCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr7:150737715_150737720delGCTTCA	ENST00000297504.6	+	12	1499_1504	c.1433_1438delGCTTCA	c.(1432-1440)tgcttcagc>tgc	p.FS479del	ABCB8_ENST00000542328.1_Splice_Site_p.FS374del|ABCB8_ENST00000498578.1_Splice_Site_p.FS462del|ABCB8_ENST00000356058.4_3'UTR|ABCB8_ENST00000358849.4_Splice_Site_p.FS462del			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	479	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CAGAACGTCTGCTTCAGGTCAGCACG	0.612																																							uc003wil.3		NA																	0				breast(2)|upper_aerodigestive_tract(1)	3						c.(1432-1440)TGCTTCAGC>TGC		ATP-binding cassette, sub-family B, member 8																																				SO:0001630	splice_region_variant	11194					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr7:150737715_150737720delGCTTCA	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1439+1GCTTCA>-	7.37:g.150737715_150737720delGCTTCA			Somatic				ABCB8_uc010lpw.1_In_Frame_Del_p.350_352CFR>W|ABCB8_uc010lpx.2_In_Frame_Del_p.FS462del|ABCB8_uc011kvd.1_In_Frame_Del_p.FS374del|ABCB8_uc003wim.3_In_Frame_Del_p.FS257del|ABCB8_uc003wik.3_In_Frame_Del_p.FS462del	p.FS479del	NM_007188	NP_009119	WXS	Illumina HiSeq	Unspecified	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	12	1526_1531	+			479_480			ABC transporter.		A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	In_Frame_Del	DEL	ENST00000297504.6	37	c.1433_1438delGCTTCA																																																																																					0.612	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	In_Frame_Del	9	85	NA	NA	NA	NA	NA	9	85	---	---	---	---
TMEM246	84302	broad.mit.edu	37	9	104238991	104238991	+	Frame_Shift_Del	DEL	A	A	-			TCGA-80-5608-01A-31D-1945-08	TCGA-80-5608-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	fe7172ec-464d-4ca9-aac9-0601accd7a0f	2baaa8cf-1477-43eb-a90f-53ff108d6185	g.chr9:104238991delA	ENST00000374851.1	-	4	1531	c.384delT	c.(382-384)cttfs	p.L129fs	RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|TMEM246_ENST00000374848.3_Frame_Shift_Del_p.L129fs|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374847.1_Frame_Shift_Del_p.L129fs|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	129						integral component of membrane (GO:0016021)											ATTGCTGAAGAAGCCGGTGGA	0.592																																							uc004bbm.2		NA																	0					0						c.(382-384)CTTfs		hypothetical protein LOC84302							66.0	59.0	62.0					9																	104238991		2203	4300	6503	SO:0001589	frameshift_variant	84302					integral to membrane		g.chr9:104238991delA	BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.384delT	9.37:g.104238991delA	ENSP00000363984:p.Leu129fs		Somatic				uc004bbl.1_5'Flank	p.L128fs	NM_032342	NP_115718	WXS	Illumina HiSeq	Unspecified	Q9BRR3	CI125_HUMAN			2	706	-		Acute lymphoblastic leukemia(62;0.0527)	128					Q49AQ4	Frame_Shift_Del	DEL	ENST00000374851.1	37	c.384delT	CCDS6757.1																																																																																				0.592	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342		13	63	NA	NA	NA	NA	NA	13	63	---	---	---	---
