#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ATAD3B	83858	broad.mit.edu	37	1	1412655	1412655	+	Splice_Site	SNP	T	T	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:1412655T>C	ENST00000308647.7	+	2	323	c.207T>C	c.(205-207)cgT>cgC	p.R69R	ATAD3B_ENST00000378741.3_5'UTR	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	69						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)	p.R69R(2)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CGCCCGCAGGTTACGCCAAGG	0.567																																							uc001afv.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(205-207)CGT>CGC		AAA-ATPase  TOB3							45.0	42.0	43.0					1																	1412655		2203	4294	6497	SO:0001630	splice_region_variant	83858						ATP binding|nucleoside-triphosphatase activity	g.chr1:1412655T>C	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.206-1T>C	1.37:g.1412655T>C			Somatic				ATAD3B_uc001afw.2_5'Flank|ATAD3B_uc001afx.2_5'Flank	p.R69R	NM_031921	NP_114127	WXS	Illumina HiSeq	Unspecified	Q5T9A4	ATD3B_HUMAN		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	2	308	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	69			Potential.		A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	ENST00000308647.7	37	c.207T>C	CCDS30.1																																																																																				0.567	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	Silent	9	20	0	0	0	0.047766	0	9	20				
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																							uc009vos.1		NA																	0					0						c.e6+1		hypothetical protein LOC55672																																				SO:0001630	splice_region_variant	55672					cytoplasm		g.chr1:16918653C>T	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			Somatic				NBPF1_uc010oce.1_Intron		NM_017940	NP_060410	WXS	Illumina HiSeq	Unspecified	Q3BBV0	NBPF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)	6	853	-								Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37	c.-35_splice																																																																																					0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	Intron	4	54	0	0	0	0.038147	0	4	54				
ZFYVE9	9372	broad.mit.edu	37	1	52703522	52703522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:52703522G>T	ENST00000371591.1	+	3	564	c.433G>T	c.(433-435)Gag>Tag	p.E145*	ZFYVE9_ENST00000357206.2_Nonsense_Mutation_p.E145*|ZFYVE9_ENST00000287727.3_Nonsense_Mutation_p.E145*	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	145					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)	p.E145*(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						TCTGCCAGATGAGAAGAATGT	0.368																																							uc001cto.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						c.(433-435)GAG>TAG		zinc finger, FYVE domain containing 9 isoform 3							76.0	75.0	76.0					1																	52703522		2203	4300	6503	SO:0001587	stop_gained	9372				endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity	g.chr1:52703522G>T	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.433G>T	1.37:g.52703522G>T	ENSP00000360647:p.Glu145*		Somatic				ZFYVE9_uc001ctn.2_Nonsense_Mutation_p.E145*|ZFYVE9_uc001ctp.2_Nonsense_Mutation_p.E145*	p.E145*	NM_004799	NP_004790	WXS	Illumina HiSeq	Unspecified	O95405	ZFYV9_HUMAN			4	605	+			145					Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Nonsense_Mutation	SNP	ENST00000371591.1	37	c.433G>T	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	33	5.260409	0.95368	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	.	.	.	5.77	5.77	0.91146	.	0.114320	0.38005	N	0.001854	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	19.9859	0.97351	0.0:0.0:1.0:0.0	.	.	.	.	X	145	.	ENSP00000287727:E145X	E	+	1	0	ZFYVE9	52476110	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.943000	0.63554	2.729000	0.93468	0.655000	0.94253	GAG		0.368	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324		31	39	1	0	1.30897e-18	0.041601	1.52457e-18	31	39				
HSD3B1	3283	broad.mit.edu	37	1	120050242	120050242	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:120050242C>T	ENST00000369413.3	+	2	288	c.143C>T	c.(142-144)tCt>tTt	p.S48F	HSD3B1_ENST00000235547.6_Missense_Mutation_p.S50F|HSD3B1_ENST00000528909.1_Missense_Mutation_p.S48F			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	48					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.S48F(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	GAGGAATTTTCTAGTAAGTAA	0.473																																							uc001ehv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(142-144)TCT>TTT		3 beta-hydroxysteroid dehydrogenase 1	NADH(DB00157)|Trilostane(DB01108)						172.0	146.0	155.0					1																	120050242		2203	4300	6503	SO:0001583	missense	3283				androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:120050242C>T	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.143C>T	1.37:g.120050242C>T	ENSP00000358421:p.Ser48Phe		Somatic				HSD3B1_uc001ehw.2_Missense_Mutation_p.S50F	p.S48F	NM_000862	NP_000853	WXS	Illumina HiSeq	Unspecified	P14060	3BHS1_HUMAN		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	2	288	+	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)	48					A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	37	c.143C>T	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	7.308	0.614459	0.14129	.	.	ENSG00000203857	ENST00000531340;ENST00000369413;ENST00000235547;ENST00000528909	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	2.61	1.63	0.23807	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.601937	0.15822	N	0.242939	T	0.62490	0.2432	L	0.36672	1.1	0.09310	N	1	B;B	0.26400	0.02;0.148	B;B	0.34590	0.048;0.186	T	0.55108	-0.8192	10	0.30078	T	0.28	-9.8115	5.8306	0.18579	0.0:0.8347:0.0:0.1653	.	50;48	Q5TDG2;P14060	.;3BHS1_HUMAN	F	48;48;50;48	ENSP00000435999:S48F;ENSP00000358421:S48F;ENSP00000235547:S50F;ENSP00000432268:S48F	ENSP00000235547:S50F	S	+	2	0	HSD3B1	119851765	0.006000	0.16342	0.128000	0.21923	0.203000	0.24098	0.448000	0.21726	0.378000	0.24764	0.313000	0.20887	TCT		0.473	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862		48	165	0	0	0	0.048971	0	48	165				
SETDB1	9869	broad.mit.edu	37	1	150916440	150916440	+	Missense_Mutation	SNP	A	A	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:150916440A>T	ENST00000271640.5	+	8	1110	c.920A>T	c.(919-921)cAg>cTg	p.Q307L	SETDB1_ENST00000368969.4_Missense_Mutation_p.Q307L|SETDB1_ENST00000368963.1_Missense_Mutation_p.S240C|SETDB1_ENST00000368962.2_Missense_Mutation_p.Q307L|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	307	Tudor 1.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.Q307L(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TATGTCACACAGTCGGAACTG	0.413																																							uc001evu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(919-921)CAG>CTG		SET domain, bifurcated 1 isoform 1							213.0	188.0	196.0					1																	150916440		2203	4300	6503	SO:0001583	missense	9869				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding	g.chr1:150916440A>T	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.920A>T	1.37:g.150916440A>T	ENSP00000271640:p.Gln307Leu		Somatic				SETDB1_uc009wmf.2_Missense_Mutation_p.Q307L|SETDB1_uc001evv.2_Missense_Mutation_p.Q307L|SETDB1_uc001evw.3_Missense_Mutation_p.Q307L|SETDB1_uc009wmg.1_Missense_Mutation_p.Q307L	p.Q307L	NM_001145415	NP_001138887	WXS	Illumina HiSeq	Unspecified	Q15047	SETB1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)		8	1110	+	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		307			Tudor 1.		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	c.920A>T	CCDS44217.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.148|9.148	1.015496|1.015496	0.19355|0.19355	.|.	.|.	ENSG00000143379|ENSG00000143379	ENST00000271640;ENST00000368962;ENST00000534805;ENST00000368969;ENST00000498193;ENST00000413562|ENST00000368963	T;T;T;T;T|.	0.40225|.	1.04;1.04;1.04;1.04;1.04|.	5.17|5.17	5.17|5.17	0.71159|0.71159	Tudor domain (1);|.	0.181162|.	0.48767|.	D|.	0.000178|.	T|T	0.06735|0.06735	0.0172|0.0172	N|N	0.00538|0.00538	-1.39|-1.39	0.25800|0.25800	N|N	0.984529|0.984529	B;B;B;B;B|.	0.06786|.	0.0;0.0;0.0;0.001;0.0|.	B;B;B;B;B|.	0.04013|.	0.0;0.0;0.0;0.001;0.0|.	T|T	0.39800|0.39800	-0.9596|-0.9596	10|6	0.38643|0.87932	T|D	0.18|0	.|.	15.187|15.187	0.73009|0.73009	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	307;307;307;307;307|.	E9PRF4;E9PQM8;Q15047-2;Q15047-3;Q15047|.	.;.;.;.;SETB1_HUMAN|.	L|C	307;307;307;307;307;150|240	ENSP00000271640:Q307L;ENSP00000357958:Q307L;ENSP00000436148:Q307L;ENSP00000357965:Q307L;ENSP00000432348:Q307L|.	ENSP00000271640:Q307L|ENSP00000357959:S240C	Q|S	+|+	2|1	0|0	SETDB1|SETDB1	149183064|149183064	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.834000|4.834000	0.62774|0.62774	2.177000|2.177000	0.69029|0.69029	0.377000|0.377000	0.23210|0.23210	CAG|AGT		0.413	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			16	161	0	0	0	0.069288	0	16	161				
ADCY10	55811	broad.mit.edu	37	1	167815048	167815048	+	Silent	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:167815048C>G	ENST00000367851.4	-	21	2944	c.2760G>C	c.(2758-2760)gtG>gtC	p.V920V	ADCY10_ENST00000367848.1_Silent_p.V828V|ADCY10_ENST00000545172.1_Silent_p.V767V	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	920					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.V920V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GGCACTCGATCACCTCATTCT	0.502																																							uc001ger.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(2758-2760)GTG>GTC		adenylate cyclase 10							110.0	99.0	102.0					1																	167815048		2203	4300	6503	SO:0001819	synonymous_variant	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167815048C>G	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.2760G>C	1.37:g.167815048C>G			Somatic				ADCY10_uc009wvk.2_Silent_p.V828V|ADCY10_uc010plj.1_Silent_p.V767V|ADCY10_uc009wvl.2_Silent_p.V919V	p.V920V	NM_018417	NP_060887	WXS	Illumina HiSeq	Unspecified	Q96PN6	ADCYA_HUMAN			21	3058	-			920					B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	37	c.2760G>C	CCDS1265.1																																																																																				0.502	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		10	107	0	0	0	0.058154	0	10	107				
XCL2	6846	broad.mit.edu	37	1	168510221	168510221	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:168510221G>A	ENST00000367819.2	-	3	346	c.314C>T	c.(313-315)tCg>tTg	p.S105L		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	105					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.S105L(1)		large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					TGTATTGGTCGATTGCTGGGT	0.532																																							uc001gfn.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(313-315)TCG>TTG		chemokine (C motif) ligand 2 precursor							265.0	210.0	228.0					1																	168510221		2203	4300	6503	SO:0001583	missense	6846				blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity	g.chr1:168510221G>A	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.314C>T	1.37:g.168510221G>A	ENSP00000356793:p.Ser105Leu		Somatic					p.S105L	NM_003175	NP_003166	WXS	Illumina HiSeq	Unspecified	Q9UBD3	XCL2_HUMAN			3	347	-	all_hematologic(923;0.215)		105						Missense_Mutation	SNP	ENST00000367819.2	37	c.314C>T	CCDS1273.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295506	0.40594	.	.	ENSG00000143185	ENST00000367819	T	0.04049	3.72	2.35	2.35	0.29111	Chemokine interleukin-8-like domain (1);	0.527319	0.18984	N	0.125799	T	0.02156	0.0067	L	0.59436	1.845	0.28795	N	0.899091	D	0.58268	0.982	B	0.38921	0.285	T	0.43637	-0.9379	9	0.72032	D	0.01	-2.1747	8.2163	0.31514	0.0:0.0:1.0:0.0	.	105	Q9UBD3	XCL2_HUMAN	L	105	ENSP00000356793:S105L	ENSP00000356793:S105L	S	-	2	0	XCL2	166776845	0.079000	0.21365	0.009000	0.14445	0.463000	0.32649	2.532000	0.45659	1.313000	0.45069	0.184000	0.17185	TCG		0.532	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175		7	69	0	0	0	0.02938	0	7	69				
C1orf112	55732	broad.mit.edu	37	1	169816906	169816906	+	Missense_Mutation	SNP	T	T	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:169816906T>G	ENST00000286031.6	+	20	2720	c.2020T>G	c.(2020-2022)Tct>Gct	p.S674A	C1orf112_ENST00000359326.4_Missense_Mutation_p.S674A|C1orf112_ENST00000498289.1_3'UTR	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	674								p.S674A(1)		breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GGATTTTGTATCTTCTTTAGG	0.343																																							uc001ggp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2020-2022)TCT>GCT		hypothetical protein LOC55732							194.0	182.0	186.0					1																	169816906		2202	4300	6502	SO:0001583	missense	55732							g.chr1:169816906T>G	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.2020T>G	1.37:g.169816906T>G	ENSP00000286031:p.Ser674Ala		Somatic				C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Missense_Mutation_p.S674A|C1orf112_uc009wvt.2_Missense_Mutation_p.S351A|C1orf112_uc009wvu.1_Missense_Mutation_p.S550A|C1orf112_uc001ggr.2_Missense_Mutation_p.S539A|C1orf112_uc010plv.1_Missense_Mutation_p.S616A	p.S674A	NM_018186	NP_060656	WXS	Illumina HiSeq	Unspecified	Q9NSG2	CA112_HUMAN			21	2330	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		674					A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	c.2020T>G	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487036	0.44249	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.40756	1.02;1.02	5.76	4.57	0.56435	.	0.213655	0.50627	D	0.000103	T	0.22475	0.0542	L	0.59436	1.845	0.80722	D	1	B;B	0.32620	0.378;0.378	B;B	0.30646	0.118;0.118	T	0.06607	-1.0817	10	0.30854	T	0.27	-21.8654	10.3385	0.43864	0.0:0.0:0.1645:0.8354	.	616;674	B4DGF2;Q9NSG2	.;CA112_HUMAN	A	674	ENSP00000352276:S674A;ENSP00000286031:S674A	ENSP00000286031:S674A	S	+	1	0	C1orf112	168083530	0.986000	0.35501	0.519000	0.27824	0.820000	0.46376	2.599000	0.46231	2.191000	0.70037	0.533000	0.62120	TCT		0.343	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186		6	236	0	0	0	0.02938	0	6	236				
BTG2	7832	broad.mit.edu	37	1	203276285	203276285	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:203276285C>G	ENST00000290551.4	+	2	267	c.196C>G	c.(196-198)Cgc>Ggc	p.R66G	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	66					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R66G(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CTCCGGCTACCGCTGCATTCG	0.612																																							uc001gzq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|skin(1)	3						c.(196-198)CGC>GGC		B-cell translocation gene 2							44.0	47.0	46.0					1																	203276285		2203	4300	6503	SO:0001583	missense	7832				DNA repair|neuron projection development|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr1:203276285C>G		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.196C>G	1.37:g.203276285C>G	ENSP00000290551:p.Arg66Gly		Somatic				FMOD_uc010pqi.1_Intron|uc009xao.1_5'Flank|uc001gzp.1_5'Flank|BTG2_uc009xap.1_RNA	p.R66G	NM_006763	NP_006754	WXS	Illumina HiSeq	Unspecified	P78543	BTG2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.203)		2	267	+			66					A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	c.196C>G	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.915153	0.73098	.	.	ENSG00000159388	ENST00000290551	T	0.49720	0.77	4.53	4.53	0.55603	Anti-proliferative protein (4);	0.000000	0.64402	D	0.000001	T	0.74122	0.3675	M	0.90705	3.14	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.80973	-0.1143	10	0.87932	D	0	-8.8843	15.9917	0.80211	0.0:1.0:0.0:0.0	.	66	P78543	BTG2_HUMAN	G	66	ENSP00000290551:R66G	ENSP00000290551:R66G	R	+	1	0	BTG2	201542908	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.560000	0.67332	2.360000	0.80028	0.313000	0.20887	CGC		0.612	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763		13	44	0	0	0	0.09319	0	13	44				
ESRRG	2104	broad.mit.edu	37	1	216824404	216824404	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:216824404G>A	ENST00000408911.3	-	3	653	c.500C>T	c.(499-501)aCg>aTg	p.T167M	ESRRG_ENST00000366937.1_Missense_Mutation_p.T172M|ESRRG_ENST00000463665.1_Intron|ESRRG_ENST00000359162.2_Missense_Mutation_p.T144M|ESRRG_ENST00000366940.2_Missense_Mutation_p.T144M|ESRRG_ENST00000361395.2_Missense_Mutation_p.T144M|ESRRG_ENST00000391890.3_Missense_Mutation_p.T144M|ESRRG_ENST00000493748.1_Missense_Mutation_p.T144M|ESRRG_ENST00000361525.3_Missense_Mutation_p.T144M|ESRRG_ENST00000366938.2_Missense_Mutation_p.T144M|ESRRG_ENST00000493603.1_Missense_Mutation_p.T144M|ESRRG_ENST00000360012.3_Missense_Mutation_p.T144M|ESRRG_ENST00000487276.1_Missense_Mutation_p.T144M	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	167					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.T167M(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ACATTCATTCGTGGCAGGGCA	0.418																																							uc001hkw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(499-501)ACG>ATG		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						104.0	98.0	100.0					1																	216824404		2203	4300	6503	SO:0001583	missense	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216824404G>A	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.500C>T	1.37:g.216824404G>A	ENSP00000386171:p.Thr167Met		Somatic				ESRRG_uc001hky.1_Missense_Mutation_p.T144M|ESRRG_uc009xdp.1_Missense_Mutation_p.T144M|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Missense_Mutation_p.T144M|ESRRG_uc001hla.1_Missense_Mutation_p.T144M|ESRRG_uc001hlb.1_Missense_Mutation_p.T144M|ESRRG_uc010pud.1_Translation_Start_Site|ESRRG_uc001hlc.1_Missense_Mutation_p.T144M|ESRRG_uc001hld.1_Missense_Mutation_p.T144M|ESRRG_uc001hkx.1_Missense_Mutation_p.T172M|ESRRG_uc009xdo.1_Missense_Mutation_p.T144M|ESRRG_uc001hle.1_Missense_Mutation_p.T144M	p.T167M	NM_001438	NP_001429	WXS	Illumina HiSeq	Unspecified	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	3	666	-			167			Nuclear receptor.|NR C4-type.		A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	c.500C>T	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317764	0.81469	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	5.74	5.74	0.90152	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.96470	0.8848	L	0.58101	1.795	0.80722	D	1	D;P	0.57257	0.979;0.882	B;P	0.45119	0.437;0.47	D	0.96824	0.9606	10	0.87932	D	0	.	19.9295	0.97114	0.0:0.0:1.0:0.0	.	172;167	F8W8J3;P62508	.;ERR3_HUMAN	M	144;144;172;167;144;144;144;144;144;144;144;144;144;144	ENSP00000355225:T144M;ENSP00000355907:T144M;ENSP00000355904:T172M;ENSP00000386171:T167M;ENSP00000352077:T144M;ENSP00000354584:T144M;ENSP00000355905:T144M;ENSP00000353108:T144M;ENSP00000419594:T144M;ENSP00000375761:T144M;ENSP00000419155:T144M;ENSP00000417374:T144M;ENSP00000419514:T144M	ENSP00000346386:T144M	T	-	2	0	ESRRG	214891027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.695000	0.91970	0.655000	0.94253	ACG		0.418	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		29	103	0	0	0	0.041601	0	29	103				
ENAH	55740	broad.mit.edu	37	1	225702299	225702299	+	Splice_Site	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr1:225702299C>T	ENST00000366844.3	-	7	1668	c.1217G>A	c.(1216-1218)cGg>cAg	p.R406Q	ENAH_ENST00000366843.2_Splice_Site_p.R406Q|ENAH_ENST00000284563.6_Splice_Site_p.R653Q	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	406	EVH2 block A.|EVH2.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.R406Q(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		GGTATTTACCCGTGACACTTT	0.333																																							uc001hpc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1216-1218)CGG>CAG		enabled homolog isoform a							42.0	45.0	44.0					1																	225702299		2192	4283	6475	SO:0001630	splice_region_variant	55740				axon guidance|intracellular transport|T cell receptor signaling pathway	cytosol|filopodium|focal adhesion|lamellipodium|synapse	actin binding|SH3 domain binding|WW domain binding	g.chr1:225702299C>T	AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.1218+1G>A	1.37:g.225702299C>T			Somatic				ENAH_uc001hpd.1_Missense_Mutation_p.R406Q|ENAH_uc001hpb.1_Missense_Mutation_p.R25Q	p.R406Q	NM_001008493	NP_001008493	WXS	Illumina HiSeq	Unspecified	Q8N8S7	ENAH_HUMAN		GBM - Glioblastoma multiforme(131;0.19)	7	1670	-	Breast(184;0.206)		406			EVH2.|EVH2 block A.		D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	ENST00000366844.3	37	c.1217G>A	CCDS31041.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565313	0.86439	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	T;T;T	0.80566	-0.31;-0.22;-1.39	5.19	4.25	0.50352	.	0.079738	0.49916	D	0.000128	D	0.88411	0.6429	M	0.73372	2.23	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.969	D	0.88744	0.3245	10	0.52906	T	0.07	-15.1641	14.8151	0.70028	0.1453:0.8547:0.0:0.0	.	406;406	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	Q	406;406;653;368	ENSP00000355809:R406Q;ENSP00000355808:R406Q;ENSP00000284563:R653Q	ENSP00000284563:R653Q	R	-	2	0	ENAH	223768922	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	6.724000	0.74747	1.133000	0.42147	0.591000	0.81541	CGG		0.333	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357426.2	NM_018212	Missense_Mutation	18	114	0	0	0	0.0333	0	18	114				
PPRC1	23082	broad.mit.edu	37	10	103901711	103901711	+	Missense_Mutation	SNP	C	C	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr10:103901711C>A	ENST00000278070.2	+	5	3485	c.3446C>A	c.(3445-3447)cCa>cAa	p.P1149Q	PPRC1_ENST00000413464.2_Missense_Mutation_p.P1149Q|PPRC1_ENST00000370012.1_Missense_Mutation_p.P116Q|PPRC1_ENST00000489648.1_3'UTR	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P1149Q(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTGCCTACCCCACGTACTCAG	0.572																																							uc001kum.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(3445-3447)CCA>CAA		peroxisome proliferator-activated receptor							56.0	56.0	56.0					10																	103901711		2203	4300	6503	SO:0001583	missense	23082				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding	g.chr10:103901711C>A	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3446C>A	10.37:g.103901711C>A	ENSP00000278070:p.Pro1149Gln		Somatic				PPRC1_uc001kun.2_Missense_Mutation_p.P1029Q|PPRC1_uc010qqj.1_Missense_Mutation_p.P1149Q|PPRC1_uc009xxa.2_RNA	p.P1149Q	NM_015062	NP_055877	WXS	Illumina HiSeq	Unspecified	Q5VV67	PPRC1_HUMAN		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)	5	3485	+		Colorectal(252;0.122)	1149					Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	c.3446C>A	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417985	0.25552	.	.	ENSG00000148840	ENST00000278070;ENST00000413464;ENST00000370012	T;T;T	0.32753	1.79;1.74;1.44	6.04	4.15	0.48705	.	0.230461	0.34750	N	0.003714	T	0.20861	0.0502	L	0.29908	0.895	0.24107	N	0.99585	B;B;B	0.21381	0.033;0.055;0.033	B;B;B	0.21917	0.03;0.037;0.016	T	0.15809	-1.0424	10	0.62326	D	0.03	.	6.4281	0.21780	0.1575:0.7031:0.0:0.1394	.	1149;1029;1149	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	Q	1149;1149;116	ENSP00000278070:P1149Q;ENSP00000399743:P1149Q;ENSP00000359029:P116Q	ENSP00000278070:P1149Q	P	+	2	0	PPRC1	103891701	0.014000	0.17966	0.724000	0.30704	0.143000	0.21401	2.443000	0.44881	1.524000	0.49035	0.563000	0.77884	CCA		0.572	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062		7	29	1	0	4.68919e-08	0.069234	5.15811e-08	7	29				
TACC2	10579	broad.mit.edu	37	10	123970013	123970013	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr10:123970013G>A	ENST00000369005.1	+	9	6413	c.6073G>A	c.(6073-6075)Gat>Aat	p.D2025N	TACC2_ENST00000358010.1_Missense_Mutation_p.D171N|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000334433.3_Missense_Mutation_p.D2025N|TACC2_ENST00000360561.3_Missense_Mutation_p.D103N|TACC2_ENST00000369000.1_De_novo_Start_OutOfFrame|TACC2_ENST00000453444.2_Missense_Mutation_p.D2029N|TACC2_ENST00000260733.3_Missense_Mutation_p.D103N|TACC2_ENST00000515273.1_Missense_Mutation_p.D2029N|TACC2_ENST00000369001.1_De_novo_Start_OutOfFrame|TACC2_ENST00000513429.1_Missense_Mutation_p.D171N|TACC2_ENST00000368999.1_Missense_Mutation_p.D103N|TACC2_ENST00000515603.1_Missense_Mutation_p.D1980N|TACC2_ENST00000369004.3_Missense_Mutation_p.D103N	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2025					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.D2025H(2)|p.D2025N(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TGCCGTCTTCGATGAAGACAA	0.552																																							uc001lfv.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(6073-6075)GAT>AAT		transforming, acidic coiled-coil containing							103.0	89.0	94.0					10																	123970013		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123970013G>A	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6073G>A	10.37:g.123970013G>A	ENSP00000358001:p.Asp2025Asn		Somatic				TACC2_uc001lfw.2_Missense_Mutation_p.D171N|TACC2_uc009xzx.2_Missense_Mutation_p.D1980N|TACC2_uc010qtv.1_Missense_Mutation_p.D2029N|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Missense_Mutation_p.D103N|TACC2_uc001lga.2_Missense_Mutation_p.D103N|TACC2_uc009xzy.2_Missense_Mutation_p.D103N|TACC2_uc001lgb.2_Missense_Mutation_p.D60N|TACC2_uc010qtw.1_Missense_Mutation_p.D120N	p.D2025N	NM_206862	NP_996744	WXS	Illumina HiSeq	Unspecified	O95359	TACC2_HUMAN			9	6433	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	2025					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.6073G>A	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	34	5.412397	0.96072	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.16196	3.0;2.59;3.06;3.0;3.0;2.59;3.06;2.39;2.72;2.68;2.7;2.36	5.64	5.64	0.86602	.	0.000000	0.38164	N	0.001786	T	0.44350	0.1289	M	0.69823	2.125	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.89917	0.995;1.0;0.984;1.0;1.0;0.995;0.995;0.995;1.0	P;D;P;D;D;P;P;P;D	0.76575	0.837;0.983;0.691;0.983;0.983;0.837;0.837;0.837;0.988	T	0.20605	-1.0270	10	0.52906	T	0.07	-7.4072	19.7154	0.96115	0.0:0.0:1.0:0.0	.	120;2029;103;1980;2029;103;103;171;2025	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	N	2025;171;2029;1980;2025;171;2029;2015;103;103;103;103;120	ENSP00000358001:D2025N;ENSP00000425062:D171N;ENSP00000424467:D2029N;ENSP00000427618:D1980N;ENSP00000334280:D2025N;ENSP00000350701:D171N;ENSP00000395048:D2029N;ENSP00000353763:D103N;ENSP00000357995:D103N;ENSP00000422815:D103N;ENSP00000260733:D103N;ENSP00000420967:D120N	ENSP00000260733:D103N	D	+	1	0	TACC2	123960003	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.465000	0.80898	2.664000	0.90586	0.655000	0.94253	GAT		0.552	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			4	26	0	0	0	0.009096	0	4	26				
RIC8A	60626	broad.mit.edu	37	11	211339	211339	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:211339G>A	ENST00000526104.1	+	5	2303	c.959G>A	c.(958-960)cGt>cAt	p.R320H	RIC8A_ENST00000325207.5_Missense_Mutation_p.R320H|RIC8A_ENST00000527696.1_Missense_Mutation_p.R314H			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	320					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R320H(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTAGAGAAGCGTTTGCACAAG	0.562																																							uc001log.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(958-960)CGT>CAT		resistance to inhibitors of cholinesterase 8							101.0	92.0	95.0					11																	211339		2203	4300	6503	SO:0001583	missense	60626					cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity	g.chr11:211339G>A	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.959G>A	11.37:g.211339G>A	ENSP00000432008:p.Arg320His		Somatic				RIC8A_uc001lof.2_Missense_Mutation_p.R320H|RIC8A_uc001loh.2_Missense_Mutation_p.R313H	p.R320H	NM_021932	NP_068751	WXS	Illumina HiSeq	Unspecified	Q9NPQ8	RIC8A_HUMAN		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)	5	1284	+		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	320					Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	ENST00000526104.1	37	c.959G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.6|29.6	5.019441|5.019441	0.93462|0.93462	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000527696|ENST00000527728	.|.	.|.	.|.	4.16|4.16	4.16|4.16	0.48862|0.48862	Armadillo-type fold (1);|.	0.051815|.	0.64402|.	D|.	0.000001|.	T|T	0.79707|0.79707	0.4492|0.4492	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.81914|.	0.991;0.995;0.991|.	D|D	0.83416|0.83416	0.0030|0.0030	9|5	0.72032|.	D|.	0.01|.	-13.9058|-13.9058	16.3109|16.3109	0.82869|0.82869	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	314;320;320|.	Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3|.	.;RIC8A_HUMAN;.|.	H|I	320;320;314|215	.|.	ENSP00000325941:R320H|.	R|V	+|+	2|1	0|0	RIC8A|RIC8A	201339|201339	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.990000|0.990000	0.78478|0.78478	9.778000|9.778000	0.99011|0.99011	2.264000|2.264000	0.75181|0.75181	0.555000|0.555000	0.69702|0.69702	CGT|GTT		0.562	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932		3	32	0	0	0	0.004672	0	3	32				
MUC5B	727897	broad.mit.edu	37	11	1278885	1278885	+	Silent	SNP	C	C	T	rs367641061		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:1278885C>T	ENST00000529681.1	+	41	16453	c.16395C>T	c.(16393-16395)ttC>ttT	p.F5465F	MUC5B_ENST00000447027.1_Silent_p.F5468F	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5465	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.F5420F(1)|p.F5465F(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTCCCGGCTTCGTAACCGTGA	0.697																																							uc009ycr.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(17404-17406)TTC>TTT		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;		C		0,4144		0,0,2072	26.0	35.0	32.0		16395	-8.3	0.0	11		32	1,8325		0,1,4162	no	coding-synonymous	MUC5B	NM_002458.2		0,1,6234	TT,TC,CC		0.012,0.0,0.0080		5465/5763	1278885	1,12469	2072	4163	6235	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1278885C>T	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16395C>T	11.37:g.1278885C>T			Somatic				MUC5B_uc001ltb.2_Silent_p.F5468F	p.F5802F	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	63	17532	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	5465			VWFC 2.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.17406C>T	CCDS44515.2																																																																																				0.697	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		3	4	0	0	0	0.004672	0	3	4				
IGSF22	283284	broad.mit.edu	37	11	18737204	18737204	+	Missense_Mutation	SNP	C	C	T	rs142049851		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:18737204C>T	ENST00000513874.1	-	11	1445	c.1306G>A	c.(1306-1308)Gca>Aca	p.A436T	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	436	Ig-like 3.							p.A436T(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TCCAGGCATGCGCGACTCCTC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		22767	0.001		0.0	False		,,,				2504	0.0						uc009yht.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|kidney(1)	7						c.(1306-1308)GCA>ACA		immunoglobulin superfamily, member 22							135.0	128.0	130.0					11																	18737204		2196	4289	6485	SO:0001583	missense	283284							g.chr11:18737204C>T	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1306G>A	11.37:g.18737204C>T	ENSP00000421191:p.Ala436Thr		Somatic				IGSF22_uc001mpa.2_RNA	p.A436T	NM_173588	NP_775859	WXS	Illumina HiSeq	Unspecified	Q8N9C0	IGS22_HUMAN			11	1496	-			436			Ig-like 3.		A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	c.1306G>A	CCDS41625.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	6.674	0.492841	0.12702	.	.	ENSG00000179057	ENST00000513874	T	0.05996	3.36	4.91	-0.331	0.12679	.	0.000000	0.38778	N	0.001564	T	0.04815	0.0130	L	0.52126	1.63	0.09310	N	1	B	0.19583	0.037	B	0.15052	0.012	T	0.35351	-0.9792	10	0.35671	T	0.21	.	1.2081	0.01899	0.2524:0.4069:0.1228:0.2179	.	436	D6RGV7	.	T	436	ENSP00000421191:A436T	ENSP00000322422:A436T	A	-	1	0	IGSF22	18693780	0.113000	0.22115	0.000000	0.03702	0.164000	0.22412	0.380000	0.20602	-0.365000	0.08076	-0.384000	0.06662	GCA		0.527	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		4	81	0	0	0	0.009096	0	4	81				
WT1	7490	broad.mit.edu	37	11	32456382	32456382	+	Silent	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:32456382G>C	ENST00000332351.3	-	1	794	c.510C>G	c.(508-510)ggC>ggG	p.G170G	WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Silent_p.G170G|WT1-AS_ENST00000395900.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	102					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G102G(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CTCCGGCTGTGCCAGTGAACT	0.667			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														uc001mtn.1		NA	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	D|Mis|N|F|S	Wilms tumour 1 gene			O	EWSR1	Wilms	Wilms|desmoplastic small round cell tumor	EWSR1/WT1(231)	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687						c.(508-510)GGC>GGG		Wilms tumor 1 isoform D							17.0	18.0	18.0					11																	32456382		2200	4291	6491	SO:0001819	synonymous_variant	7490	Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr11:32456382G>C		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.510C>G	11.37:g.32456382G>C			Somatic				WT1_uc001mto.1_Silent_p.G170G|WT1_uc001mtp.1_Silent_p.G170G|WT1_uc001mtq.1_Silent_p.G170G|WT1_uc009yjs.1_RNA|WIT1_uc010rec.1_5'Flank|WIT1_uc010red.1_5'Flank|WIT1_uc010ree.1_5'Flank	p.G170G	NM_024426	NP_077744	WXS	Illumina HiSeq	Unspecified	P19544	WT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(30;0.128)		1	706	-	Breast(20;0.247)		102					A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	c.510C>G	CCDS7878.2																																																																																				0.667	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378		5	19	0	0	0	0.014758	0	5	19				
KBTBD4	55709	broad.mit.edu	37	11	47599133	47599133	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:47599133C>T	ENST00000526005.1	-	2	572	c.419G>A	c.(418-420)cGc>cAc	p.R140H	NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000533290.1_Missense_Mutation_p.R165H|NDUFS3_ENST00000263774.4_5'Flank|KBTBD4_ENST00000525720.1_Missense_Mutation_p.R189H|KBTBD4_ENST00000450908.1_5'Flank|KBTBD4_ENST00000395288.2_Missense_Mutation_p.R140H|NDUFS3_ENST00000534208.1_5'Flank|NDUFS3_ENST00000528192.1_5'Flank|RNU5E-10P_ENST00000363506.1_RNA|NDUFS3_ENST00000529276.1_5'Flank|NDUFS3_ENST00000534716.2_5'Flank|KBTBD4_ENST00000430070.2_Missense_Mutation_p.R156H			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	140								p.R140H(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						TTGCACTGTGCGGGCCAAAAA	0.517																																							uc001nfx.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)	2						c.(418-420)CGC>CAC		kelch repeat and BTB (POZ) domain containing 4							174.0	172.0	173.0					11																	47599133		2201	4298	6499	SO:0001583	missense	55709							g.chr11:47599133C>T	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.419G>A	11.37:g.47599133C>T	ENSP00000433340:p.Arg140His		Somatic				NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.R165H|KBTBD4_uc001nfz.2_Missense_Mutation_p.R156H|KBTBD4_uc001nfy.2_Missense_Mutation_p.R140H|NDUFS3_uc010rhn.1_5'Flank|NDUFS3_uc001nga.2_5'Flank	p.R140H	NM_016506	NP_057590	WXS	Illumina HiSeq	Unspecified	Q9NVX7	KBTB4_HUMAN			2	590	-			140					D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	ENST00000526005.1	37	c.419G>A	CCDS7940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.836560|4.836560	0.91117|0.91117	.|.	.|.	ENSG00000123444|ENSG00000123444	ENST00000359900|ENST00000526005;ENST00000533290;ENST00000395288;ENST00000430070;ENST00000525720;ENST00000529499;ENST00000531067;ENST00000529946;ENST00000534239	.|T;T;T;T;T;T;T;T;T	.|0.73047	.|-0.64;-0.71;-0.64;-0.7;-0.57;-0.57;-0.57;-0.57;-0.57	5.4|5.4	5.4|5.4	0.78164|0.78164	.|BTB/POZ-like (1);BTB/POZ fold (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82591|0.82591	0.5070|0.5070	L|L	0.60067|0.60067	1.865|1.865	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.81914	.|0.991;0.995;0.995	D|D	0.83844|0.83844	0.0259|0.0259	6|10	0.02654|0.72032	T|D	1|0.01	-17.6736|-17.6736	19.1652|19.1652	0.93553|0.93553	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|156;140;165	.|Q9NVX7-2;Q9NVX7;B3KRH9	.|.;KBTB4_HUMAN;.	T|H	155|140;165;140;156;189;140;140;140;165	.|ENSP00000433340:R140H;ENSP00000436713:R165H;ENSP00000378703:R140H;ENSP00000415106:R156H;ENSP00000434477:R189H;ENSP00000433404:R140H;ENSP00000433653:R140H;ENSP00000435651:R140H;ENSP00000433124:R165H	ENSP00000352971:A155T|ENSP00000378703:R140H	A|R	-|-	1|2	0|0	KBTBD4|KBTBD4	47555709|47555709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.487000|7.487000	0.81328|0.81328	2.520000|2.520000	0.84964|0.84964	0.462000|0.462000	0.41574|0.41574	GCA|CGC		0.517	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1	NM_016506		4	171	0	0	0	0.02938	0	4	171				
OR5M1	390168	broad.mit.edu	37	11	56380559	56380559	+	Silent	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:56380559G>A	ENST00000526538.1	-	1	419	c.420C>T	c.(418-420)atC>atT	p.I140I		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I140I(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						GACAGACACAGATGTTCTTGG	0.448																																							uc001nja.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(418-420)ATC>ATT		olfactory receptor, family 5, subfamily M,							138.0	120.0	126.0					11																	56380559		1979	4175	6154	SO:0001819	synonymous_variant	390168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56380559G>A	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.420C>T	11.37:g.56380559G>A			Somatic					p.I140I	NM_001004740	NP_001004740	WXS	Illumina HiSeq	Unspecified	Q8NGP8	OR5M1_HUMAN			1	420	-			140			Helical; Name=4; (Potential).		Q6IF60|Q96RB6	Silent	SNP	ENST00000526538.1	37	c.420C>T	CCDS53631.1																																																																																				0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740		11	56	0	0	0	0.080935	0	11	56				
CD248	57124	broad.mit.edu	37	11	66084240	66084240	+	Missense_Mutation	SNP	G	G	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr11:66084240G>T	ENST00000311330.3	-	1	275	c.259C>A	c.(259-261)Ctg>Atg	p.L87M	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	87	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)	p.L87M(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						TGCCGCTGCAGCCCGATCCAC	0.731																																							uc001ohm.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)	3						c.(259-261)CTG>ATG		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						13.0	14.0	13.0					11																	66084240		1835	3713	5548	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66084240G>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.259C>A	11.37:g.66084240G>T	ENSP00000308117:p.Leu87Met		Somatic					p.L87M	NM_020404	NP_065137	WXS	Illumina HiSeq	Unspecified	Q9HCU0	CD248_HUMAN			1	276	-			87			C-type lectin.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.259C>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320393	0.60634	.	.	ENSG00000174807	ENST00000311330	T	0.28255	1.62	4.05	2.14	0.27477	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	D	0.000024	T	0.53867	0.1823	M	0.85373	2.75	0.38215	D	0.940583	D	0.89917	1.0	D	0.91635	0.999	T	0.57545	-0.7793	10	0.87932	D	0	-9.4322	7.5709	0.27907	0.2228:0.0:0.7772:0.0	.	87	Q9HCU0	CD248_HUMAN	M	87	ENSP00000308117:L87M	ENSP00000308117:L87M	L	-	1	2	CD248	65840816	0.998000	0.40836	0.999000	0.59377	0.990000	0.78478	2.509000	0.45459	0.350000	0.24002	-0.224000	0.12420	CTG		0.731	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		4	12	1	0	3.59834e-05	0.021553	3.91467e-05	4	12				
B4GALNT3	283358	broad.mit.edu	37	12	665822	665822	+	Missense_Mutation	SNP	C	C	T	rs145153320	byFrequency	TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:665822C>T	ENST00000266383.5	+	15	2183	c.2170C>T	c.(2170-2172)Cgg>Tgg	p.R724W		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	724					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.R724W(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GCGCGTGGTGCGGCTCTCGGA	0.632																																							uc001qii.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2170-2172)CGG>TGG		beta		C	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	61.0	59.0	60.0		2170	3.7	1.0	12	dbSNP_134	60	3,8597	3.0+/-9.4	0,3,4297	yes	missense	B4GALNT3	NM_173593.3	101	0,6,6497	TT,TC,CC		0.0349,0.0681,0.0461	probably-damaging	724/999	665822	6,13000	2203	4300	6503	SO:0001583	missense	283358					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity	g.chr12:665822C>T	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2170C>T	12.37:g.665822C>T	ENSP00000266383:p.Arg724Trp		Somatic				B4GALNT3_uc001qik.1_Missense_Mutation_p.R273W	p.R724W	NM_173593	NP_775864	WXS	Illumina HiSeq	Unspecified	Q6L9W6	B4GN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)		15	2170	+	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		724			Lumenal (Potential).		Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	c.2170C>T	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963950	0.74131	6.81E-4	3.49E-4	ENSG00000139044	ENST00000266383	T	0.17854	2.25	5.52	3.67	0.42095	.	0.057305	0.64402	D	0.000001	T	0.45115	0.1326	M	0.83774	2.66	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.51474	-0.8701	10	0.87932	D	0	-34.0723	14.5924	0.68378	0.2658:0.7341:0.0:0.0	.	724	Q6L9W6	B4GN3_HUMAN	W	724	ENSP00000266383:R724W	ENSP00000266383:R724W	R	+	1	2	B4GALNT3	536083	0.984000	0.35163	0.966000	0.40874	0.576000	0.36127	1.561000	0.36342	0.678000	0.31325	0.655000	0.94253	CGG		0.632	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593		3	38	0	0	0	0.004672	0	3	38				
KCNA1	3736	broad.mit.edu	37	12	5021828	5021828	+	Silent	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:5021828C>T	ENST00000382545.3	+	2	2391	c.1284C>T	c.(1282-1284)ctC>ctT	p.L428L	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	428					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.L428L(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTCAGTTGCTCCACGTCAGTT	0.502																																							uc001qnh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1282-1284)CTC>CTT		potassium voltage-gated channel subfamily A	Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						220.0	218.0	219.0					12																	5021828		2203	4300	6503	SO:0001819	synonymous_variant	3736				synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity	g.chr12:5021828C>T	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1284C>T	12.37:g.5021828C>T			Somatic					p.L428L	NM_000217	NP_000208	WXS	Illumina HiSeq	Unspecified	Q09470	KCNA1_HUMAN			2	2389	+			428					A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	c.1284C>T	CCDS8535.1																																																																																				0.502	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217		6	317	0	0	0	0.021553	0	6	317				
TFCP2	7024	broad.mit.edu	37	12	51501052	51501052	+	Silent	SNP	A	A	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:51501052A>G	ENST00000257915.5	-	7	1253	c.795T>C	c.(793-795)taT>taC	p.Y265Y	TFCP2_ENST00000548115.1_Silent_p.Y214Y|TFCP2_ENST00000307660.4_Silent_p.Y214Y|TFCP2_ENST00000549867.1_Silent_p.Y265Y	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	265	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y265Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						AGGAAGGCTGATATTTCTCCT	0.338																																							uc001rxw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(793-795)TAT>TAC		transcription factor CP2							281.0	273.0	275.0					12																	51501052		2203	4300	6503	SO:0001819	synonymous_variant	7024				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:51501052A>G	U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.795T>C	12.37:g.51501052A>G			Somatic				TFCP2_uc001rxv.1_Silent_p.Y265Y|TFCP2_uc009zlx.1_Silent_p.Y214Y|TFCP2_uc001rxx.2_Silent_p.Y265Y|TFCP2_uc009zly.1_Silent_p.Y167Y	p.Y265Y	NM_005653	NP_005644	WXS	Illumina HiSeq	Unspecified	Q12800	TFCP2_HUMAN			7	1254	-			265			DNA-binding.		A8K5E9|Q12801|Q9UD75|Q9UD77	Silent	SNP	ENST00000257915.5	37	c.795T>C	CCDS8808.1																																																																																				0.338	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653		91	190	0	0	0	0.048971	0	91	190				
KRT71	112802	broad.mit.edu	37	12	52942007	52942007	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:52942007C>T	ENST00000267119.5	-	5	976	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	303	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E303K(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		GTGCGGACTTCGTCAATGATG	0.567																																							uc001sao.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|skin(1)	2						c.(907-909)GAA>AAA		keratin 71							195.0	155.0	169.0					12																	52942007		2203	4300	6503	SO:0001583	missense	112802						structural molecule activity	g.chr12:52942007C>T	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.907G>A	12.37:g.52942007C>T	ENSP00000267119:p.Glu303Lys		Somatic					p.E303K	NM_033448	NP_258259	WXS	Illumina HiSeq	Unspecified	Q3SY84	K2C71_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.194)	5	977	-			303			Coil 2.|Rod.		B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	c.907G>A	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429898	0.43122	.	.	ENSG00000139648	ENST00000267119	D	0.92199	-2.99	4.3	4.3	0.51218	Filament (1);	0.000000	0.45361	D	0.000363	D	0.92090	0.7493	M	0.92691	3.335	0.47737	D	0.999507	P	0.46142	0.873	B	0.33568	0.166	D	0.93717	0.7029	10	0.72032	D	0.01	.	13.1764	0.59629	0.0:0.918:0.0:0.082	.	303	Q3SY84	K2C71_HUMAN	K	303	ENSP00000267119:E303K	ENSP00000267119:E303K	E	-	1	0	KRT71	51228274	0.997000	0.39634	0.859000	0.33776	0.073000	0.16967	4.049000	0.57397	2.343000	0.79666	0.603000	0.83216	GAA		0.567	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448		10	85	0	0	0	0.058154	0	10	85				
ACACB	32	broad.mit.edu	37	12	109698352	109698352	+	Silent	SNP	C	C	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:109698352C>A	ENST00000338432.7	+	48	6683	c.6564C>A	c.(6562-6564)ccC>ccA	p.P2188P	ACACB_ENST00000377854.5_Silent_p.P2118P|ACACB_ENST00000377848.3_Silent_p.P2188P|ACACB_ENST00000543201.1_3'UTR			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2188	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.P2188P(2)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	ACAAACAGCCCATCCTGATCT	0.537																																							uc001tob.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(6562-6564)CCC>CCA		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)						175.0	165.0	168.0					12																	109698352		2203	4300	6503	SO:0001819	synonymous_variant	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109698352C>A	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6564C>A	12.37:g.109698352C>A			Somatic				ACACB_uc001toc.2_Silent_p.P2188P|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Silent_p.P854P	p.P2188P	NM_001093	NP_001084	WXS	Illumina HiSeq	Unspecified	O00763	ACACB_HUMAN			48	6683	+			2188			Carboxyltransferase.		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	c.6564C>A	CCDS31898.1																																																																																				0.537	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		68	76	1	0	5.7554e-21	0.048971	6.78316e-21	68	76				
SPPL3	121665	broad.mit.edu	37	12	121204115	121204115	+	Missense_Mutation	SNP	T	T	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr12:121204115T>C	ENST00000353487.2	-	10	1537	c.1034A>G	c.(1033-1035)tAt>tGt	p.Y345C		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	346						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.Y345C(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGGCACCAAATAGAGAAGGGC	0.522																																							uc001tzd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1033-1035)TAT>TGT		signal peptide peptidase 3							45.0	40.0	42.0					12																	121204115		2203	4298	6501	SO:0001583	missense	121665					integral to membrane	aspartic-type endopeptidase activity	g.chr12:121204115T>C		CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.1034A>G	12.37:g.121204115T>C	ENSP00000288680:p.Tyr345Cys		Somatic				SPPL3_uc009zwz.2_Missense_Mutation_p.Y338C|SPPL3_uc001tzc.2_Missense_Mutation_p.Y175C	p.Y345C	NM_139015	NP_620584	WXS	Illumina HiSeq	Unspecified	Q8TCT6	PSL4_HUMAN			10	1515	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		346			Helical; (Potential).		Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	37	c.1034A>G	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.571614	0.86542	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.51574	0.7	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.79997	0.4543	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.87432	0.2389	10	0.87932	D	0	-36.7946	15.5241	0.75887	0.0:0.0:0.0:1.0	.	346;345	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	C	345;344	ENSP00000288680:Y345C	ENSP00000288680:Y345C	Y	-	2	0	AC069214.1	119688498	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.066000	0.61787	0.455000	0.32223	TAT		0.522	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	NM_139015		3	8	0	0	0	0.004672	0	3	8				
PAN3	255967	broad.mit.edu	37	13	28855451	28855451	+	Splice_Site	SNP	G	G	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr13:28855451G>T	ENST00000380958.3	+	17	2471		c.e17-1		PAN3_ENST00000282391.5_Splice_Site|PAN3_ENST00000399613.1_Splice_Site	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit									p.?(2)		endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		ATGTTTTATAGGAGGTTCAAA	0.303																																							uc001urz.2		NA																	2	Unknown(2)		lung(2)	ovary(1)	1						c.e16-1		PABP1-dependent poly A-specific ribonuclease							48.0	55.0	52.0					13																	28855451		2202	4297	6499	SO:0001630	splice_region_variant	255967				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity	g.chr13:28855451G>T	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.2320-1G>T	13.37:g.28855451G>T			Somatic				PAN3_uc001ury.2_Splice_Site_p.E462_splice|PAN3_uc001urx.2_Splice_Site_p.E574_splice	p.E628_splice	NM_175854	NP_787050	WXS	Illumina HiSeq	Unspecified	Q58A45	PAN3_HUMAN	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)	16	1890	+	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)							Splice_Site	SNP	ENST00000380958.3	37	c.1882_splice	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734525	0.89482	.	.	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9766	0.97312	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAN3	27753451	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.837000	0.99465	2.728000	0.93425	0.561000	0.74099	.		0.303	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	Intron	11	42	1	0	1.5842e-08	0.105934	1.7622e-08	11	42				
AHNAK2	113146	broad.mit.edu	37	14	105418451	105418451	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr14:105418451G>A	ENST00000333244.5	-	7	3456	c.3337C>T	c.(3337-3339)Ccc>Tcc	p.P1113S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1113						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P1113S(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCGCCTTGGGGCTTTTCAGG	0.647																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3337-3339)CCC>TCC		AHNAK nucleoprotein 2							117.0	145.0	136.0					14																	105418451		1886	4114	6000	SO:0001583	missense	113146					nucleus		g.chr14:105418451G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3337C>T	14.37:g.105418451G>A	ENSP00000353114:p.Pro1113Ser		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.P1013S	p.P1113S	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	3457	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	1113					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.3337C>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	7.649	0.682595	0.14907	.	.	ENSG00000185567	ENST00000333244	T	0.05649	3.41	3.06	-1.62	0.08372	.	.	.	.	.	T	0.08980	0.0222	M	0.91717	3.235	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.50415	-0.8831	9	0.10902	T	0.67	.	1.0851	0.01650	0.2823:0.2911:0.2873:0.1393	.	1113	Q8IVF2	AHNK2_HUMAN	S	1113	ENSP00000353114:P1113S	ENSP00000353114:P1113S	P	-	1	0	AHNAK2	104489496	0.001000	0.12720	0.000000	0.03702	0.038000	0.13279	0.560000	0.23500	-0.541000	0.06257	-0.333000	0.08304	CCC		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		45	226	0	0	0	0.045515	0	45	226				
AQP9	366	broad.mit.edu	37	15	58467128	58467128	+	Missense_Mutation	SNP	T	T	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr15:58467128T>A	ENST00000219919.4	+	4	758	c.388T>A	c.(388-390)Tcc>Acc	p.S130T	AQP9_ENST00000558772.1_Missense_Mutation_p.S65T|ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000536493.1_Missense_Mutation_p.S130T	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	130					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.S130T(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TGGACTTATGTCCTTTGCTGG	0.478																																							uc002aez.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(388-390)TCC>ACC		aquaporin 9							134.0	120.0	125.0					15																	58467128		2192	4292	6484	SO:0001583	missense	366				cellular response to cAMP|excretion|immune response|metabolic process|response to mercury ion|response to osmotic stress|water homeostasis	integral to plasma membrane|intracellular membrane-bounded organelle	amine transmembrane transporter activity|carboxylic acid transmembrane transporter activity|glycerol channel activity|porin activity|purine base transmembrane transporter activity|pyrimidine base transmembrane transporter activity|water channel activity	g.chr15:58467128T>A	AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.388T>A	15.37:g.58467128T>A	ENSP00000219919:p.Ser130Thr		Somatic				ALDH1A2_uc010ugw.1_Intron|AQP9_uc010ugx.1_Missense_Mutation_p.S65T	p.S130T	NM_020980	NP_066190	WXS	Illumina HiSeq	Unspecified	O43315	AQP9_HUMAN		GBM - Glioblastoma multiforme(80;0.16)	4	745	+			130			Helical; (Potential).		Q9NP32	Missense_Mutation	SNP	ENST00000219919.4	37	c.388T>A	CCDS10165.1	.	.	.	.	.	.	.	.	.	.	t	2.713	-0.268305	0.05716	.	.	ENSG00000103569	ENST00000219919;ENST00000536493	T;T	0.11169	2.8;2.8	5.4	-1.85	0.07784	Aquaporin-like (2);	0.731491	0.12956	N	0.425450	T	0.05090	0.0136	N	0.16368	0.405	0.09310	N	1	B	0.14012	0.009	B	0.16722	0.016	T	0.46105	-0.9215	10	0.11485	T	0.65	.	7.3998	0.26956	0.2668:0.0:0.3994:0.3338	.	130	O43315	AQP9_HUMAN	T	130	ENSP00000219919:S130T;ENSP00000441390:S130T	ENSP00000219919:S130T	S	+	1	0	AQP9	56254420	1.000000	0.71417	0.975000	0.42487	0.039000	0.13416	0.914000	0.28624	-0.108000	0.12066	-1.176000	0.01726	TCC		0.478	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980		9	47	0	0	0	0.058154	0	9	47				
UACA	55075	broad.mit.edu	37	15	70960850	70960850	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr15:70960850C>G	ENST00000322954.6	-	16	2358	c.2173G>C	c.(2173-2175)Gat>Cat	p.D725H	UACA_ENST00000560441.1_Missense_Mutation_p.D710H|UACA_ENST00000379983.2_Missense_Mutation_p.D712H|UACA_ENST00000539319.1_Missense_Mutation_p.D616H	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	725					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.D725H(1)|p.D712H(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						AGCTTATTATCCAAATAAACT	0.318																																							uc002asr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(2173-2175)GAT>CAT		uveal autoantigen with coiled-coil domains and							92.0	93.0	92.0					15																	70960850		2199	4295	6494	SO:0001583	missense	55075					cytoskeleton|extracellular region		g.chr15:70960850C>G	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.2173G>C	15.37:g.70960850C>G	ENSP00000314556:p.Asp725His		Somatic				UACA_uc010uke.1_Missense_Mutation_p.D616H|UACA_uc002asq.2_Missense_Mutation_p.D712H|UACA_uc010bin.1_Missense_Mutation_p.D700H	p.D725H	NM_018003	NP_060473	WXS	Illumina HiSeq	Unspecified	Q9BZF9	UACA_HUMAN			16	2277	-			725			Potential.		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	c.2173G>C	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002779	0.74932	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.39997	1.05;1.07;1.51	5.6	5.6	0.85130	.	0.090453	0.47852	D	0.000207	T	0.63616	0.2526	L	0.57536	1.79	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.983;0.979;0.979;0.991	T	0.64462	-0.6402	10	0.72032	D	0.01	-36.3284	19.6143	0.95626	0.0:1.0:0.0:0.0	.	616;725;725;712	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	H	725;712;616	ENSP00000314556:D725H;ENSP00000369319:D712H;ENSP00000438667:D616H	ENSP00000314556:D725H	D	-	1	0	UACA	68747904	1.000000	0.71417	0.952000	0.39060	0.980000	0.70556	7.152000	0.77419	2.640000	0.89533	0.561000	0.74099	GAT		0.318	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			11	84	0	0	0	0.069234	0	11	84				
UACA	55075	broad.mit.edu	37	15	70961012	70961012	+	Missense_Mutation	SNP	G	G	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr15:70961012G>T	ENST00000322954.6	-	16	2196	c.2011C>A	c.(2011-2013)Ctt>Att	p.L671I	UACA_ENST00000560441.1_Missense_Mutation_p.L656I|UACA_ENST00000379983.2_Missense_Mutation_p.L658I|UACA_ENST00000539319.1_Missense_Mutation_p.L562I	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	671					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.L671I(1)|p.L658I(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						ACATTCTCAAGTTCTCTCTTT	0.358																																							uc002asr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(2011-2013)CTT>ATT		uveal autoantigen with coiled-coil domains and							113.0	113.0	113.0					15																	70961012		2199	4297	6496	SO:0001583	missense	55075					cytoskeleton|extracellular region		g.chr15:70961012G>T	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.2011C>A	15.37:g.70961012G>T	ENSP00000314556:p.Leu671Ile		Somatic				UACA_uc010uke.1_Missense_Mutation_p.L562I|UACA_uc002asq.2_Missense_Mutation_p.L658I|UACA_uc010bin.1_Missense_Mutation_p.L646I	p.L671I	NM_018003	NP_060473	WXS	Illumina HiSeq	Unspecified	Q9BZF9	UACA_HUMAN			16	2115	-			671			Potential.		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	c.2011C>A	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304244	0.23736	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.52057	0.68;0.7;1.24	5.61	3.7	0.42460	.	0.498015	0.18598	N	0.136540	T	0.47303	0.1438	M	0.62723	1.935	0.09310	N	1	P;B;B;B	0.35401	0.499;0.325;0.325;0.255	B;B;B;B	0.40228	0.323;0.142;0.142;0.106	T	0.30060	-0.9991	10	0.23891	T	0.37	-0.6101	11.504	0.50454	0.0655:0.3501:0.5844:0.0	.	562;671;671;658	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	I	671;658;562	ENSP00000314556:L671I;ENSP00000369319:L658I;ENSP00000438667:L562I	ENSP00000314556:L671I	L	-	1	0	UACA	68748066	0.273000	0.24181	0.028000	0.17463	0.996000	0.88848	0.956000	0.29202	0.698000	0.31739	0.491000	0.48974	CTT		0.358	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			22	97	1	0	2.44723e-14	0.099896	2.78478e-14	22	97				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		3	17	0	0	0	0.014758	0	3	17				
SEPT12	124404	broad.mit.edu	37	16	4829784	4829784	+	Nonsense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr16:4829784G>A	ENST00000268231.8	-	8	993	c.730C>T	c.(730-732)Cga>Tga	p.R244*	SEPT12_ENST00000396693.5_Nonsense_Mutation_p.R198*	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	244	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)	p.R244*(1)|p.R244R(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						AAAGGGATTCGGTCCTGGGAA	0.572																																							uc002cxq.2		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	skin(1)	1						c.(730-732)CGA>TGA		septin 12 isoform 2							64.0	56.0	58.0					16																	4829784		2197	4300	6497	SO:0001587	stop_gained	124404				cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity	g.chr16:4829784G>A	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.730C>T	16.37:g.4829784G>A	ENSP00000268231:p.Arg244*		Somatic				SEPT12_uc002cxr.2_Nonsense_Mutation_p.R198*|SEPT12_uc010bty.2_RNA	p.R244*	NM_144605	NP_653206	WXS	Illumina HiSeq	Unspecified	Q8IYM1	SEP12_HUMAN			8	871	-			244					Q0P6B0|Q1PBH0|Q96LL0	Nonsense_Mutation	SNP	ENST00000268231.8	37	c.730C>T	CCDS10522.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463993	0.63513	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	.	.	.	4.99	3.97	0.46021	.	0.259261	0.38548	N	0.001645	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	10.2652	0.43452	0.0:0.0:0.6717:0.3283	.	.	.	.	X	198;244	.	ENSP00000268231:R244X	R	-	1	2	SEPT12	4769785	0.336000	0.24757	0.966000	0.40874	0.097000	0.18754	2.754000	0.47532	2.590000	0.87494	0.655000	0.94253	CGA		0.572	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251645.2	NM_144605		21	44	0	0	0	0.049695	0	21	44				
FHOD1	29109	broad.mit.edu	37	16	67265670	67265670	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr16:67265670G>A	ENST00000258201.4	-	15	2502	c.2255C>T	c.(2254-2256)gCc>gTc	p.A752V		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	752	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.|Interaction with ROCK1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.A752V(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GGCCAGCTGGGCTTCCTCAAT	0.602																																							uc002esl.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(2254-2256)GCC>GTC		formin homology 2 domain containing 1							72.0	69.0	70.0					16																	67265670		2198	4300	6498	SO:0001583	missense	29109				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding	g.chr16:67265670G>A	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2255C>T	16.37:g.67265670G>A	ENSP00000258201:p.Ala752Val		Somatic				FHOD1_uc002esk.2_5'Flank|FHOD1_uc010ced.2_Missense_Mutation_p.A559V	p.A752V	NM_013241	NP_037373	WXS	Illumina HiSeq	Unspecified	Q9Y613	FHOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	15	2367	-		Ovarian(137;0.0563)	752			Interaction with ROCK1.|FH2.		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	c.2255C>T	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	30	5.050734	0.93740	.	.	ENSG00000135723	ENST00000258201	T	0.63417	-0.04	5.75	5.75	0.90469	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.095896	0.64402	D	0.000001	T	0.82066	0.4956	M	0.84948	2.725	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.84327	0.0519	10	0.87932	D	0	.	18.503	0.90888	0.0:0.0:1.0:0.0	.	752	Q9Y613	FHOD1_HUMAN	V	752	ENSP00000258201:A752V	ENSP00000258201:A752V	A	-	2	0	FHOD1	65823171	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.848000	0.99507	2.713000	0.92767	0.655000	0.94253	GCC		0.602	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			6	19	0	0	0	0.038147	0	6	19				
CNTNAP4	85445	broad.mit.edu	37	16	76555040	76555040	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr16:76555040C>A	ENST00000476707.1	+	15	2517	c.2378C>A	c.(2377-2379)tCa>tAa	p.S793*	CNTNAP4_ENST00000307431.8_Nonsense_Mutation_p.S789*|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Nonsense_Mutation_p.S717*|CNTNAP4_ENST00000377504.4_Nonsense_Mutation_p.S741*			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	790	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S789*(1)|p.S717*(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						AAAACAGGATCATTTTGGAAT	0.303																																							uc002feu.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(2368-2370)TCA>TAA		cell recognition protein CASPR4 isoform 1							166.0	156.0	159.0					16																	76555040		1805	4076	5881	SO:0001587	stop_gained	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76555040C>A	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2378C>A	16.37:g.76555040C>A	ENSP00000417628:p.Ser793*		Somatic				CNTNAP4_uc002fev.1_Nonsense_Mutation_p.S654*|CNTNAP4_uc010chb.1_Nonsense_Mutation_p.S717*|CNTNAP4_uc002fex.1_Nonsense_Mutation_p.S793*	p.S790*	NM_033401	NP_207837	WXS	Illumina HiSeq	Unspecified	Q9C0A0	CNTP4_HUMAN			18	2754	+			790			Extracellular (Potential).|Fibrinogen C-terminal.		E9PFZ6|Q86YZ7	Nonsense_Mutation	SNP	ENST00000476707.1	37	c.2369C>A		.	.	.	.	.	.	.	.	.	.	C	35	5.577867	0.96565	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	.	.	.	4.99	0.852	0.18995	.	0.464118	0.16048	N	0.232099	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.528	0.02529	0.1347:0.4227:0.1313:0.3113	.	.	.	.	X	789;741;717;793	.	ENSP00000306893:S789X	S	+	2	0	CNTNAP4	75112541	0.010000	0.17322	0.087000	0.20705	0.896000	0.52359	0.004000	0.13106	0.038000	0.15604	-0.258000	0.10820	TCA		0.303	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		49	93	1	0	1.35964e-18	0.048971	1.56516e-18	49	93				
MYO15A	51168	broad.mit.edu	37	17	18063273	18063273	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:18063273C>T	ENST00000205890.5	+	56	9666	c.9328C>T	c.(9328-9330)Cgg>Tgg	p.R3110W	MYO15A_ENST00000451725.2_Missense_Mutation_p.R2W|MYO15A_ENST00000418233.3_Missense_Mutation_p.R374W	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3110	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R3110W(2)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TGAGGTCATGCGGGATGAATG	0.522																																							uc010vxh.1		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(9328-9330)CGG>TGG		myosin XV							108.0	109.0	109.0					17																	18063273		2104	4231	6335	SO:0001583	missense	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18063273C>T	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.9328C>T	17.37:g.18063273C>T	ENSP00000205890:p.Arg3110Trp		Somatic				MYO15A_uc010vxi.1_Missense_Mutation_p.R374W|MYO15A_uc010vxk.1_Intron|MYO15A_uc010vxl.1_Missense_Mutation_p.R99W|MYO15A_uc002gsl.2_Missense_Mutation_p.R117W|MYO15A_uc010vxm.1_Missense_Mutation_p.R32W|MYO15A_uc002gsm.1_5'Flank|MYO15A_uc010cpv.2_5'Flank	p.R3110W	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			55	9666	+	all_neural(463;0.228)		3110			Tail.|MyTH4 2.		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.9328C>T	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102477	0.76983	.	.	ENSG00000091536	ENST00000205890;ENST00000418233;ENST00000556535;ENST00000557190;ENST00000451725	D;D;D	0.96265	-3.96;-3.96;-3.96	5.6	4.6	0.57074	MyTH4 domain (3);	.	.	.	.	D	0.98317	0.9442	M	0.91561	3.22	0.44798	D	0.997809	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;0.992;0.999;0.927;0.997	D	0.99041	1.0824	9	0.87932	D	0	.	13.0331	0.58854	0.429:0.571:0.0:0.0	.	2;99;374;3110;117	B4DQJ3;B4DLV9;B4DFC7;Q9UKN7;Q8TCK0	.;.;.;MYO15_HUMAN;.	W	3110;99;64;2;2	ENSP00000205890:R3110W;ENSP00000451782:R64W;ENSP00000409098:R2W	ENSP00000205890:R3110W	R	+	1	2	MYO15A	18003998	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.766000	0.38491	1.318000	0.45170	0.561000	0.74099	CGG		0.522	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		3	20	0	0	0	0.014758	0	3	20				
SUPT6H	6830	broad.mit.edu	37	17	27004785	27004785	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:27004785C>G	ENST00000314616.6	+	8	1233	c.950C>G	c.(949-951)gCt>gGt	p.A317G	SUPT6H_ENST00000347486.4_Missense_Mutation_p.A317G	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	317	Interaction with IWS1. {ECO:0000250}.|Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A317G(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GAAGAAGAAGCTGACTGGATC	0.458																																							uc002hby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(949-951)GCT>GGT		suppressor of Ty 6 homolog							183.0	179.0	180.0					17																	27004785		2203	4300	6503	SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27004785C>G	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.950C>G	17.37:g.27004785C>G	ENSP00000319104:p.Ala317Gly		Somatic				SUPT6H_uc010crt.2_Missense_Mutation_p.A317G	p.A317G	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			8	1040	+	Lung NSC(42;0.00431)		317					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.950C>G	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	34	5.323349	0.95708	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.84347	0.5452	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	D	0.86427	0.1758	9	0.66056	D	0.02	-11.4603	19.1359	0.93428	0.0:1.0:0.0:0.0	.	317	Q7KZ85	SPT6H_HUMAN	G	317	.	ENSP00000319104:A317G	A	+	2	0	SUPT6H	24028912	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.082000	0.76851	2.627000	0.88993	0.563000	0.77884	GCT		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		22	179	0	0	0	0.076483	0	22	179				
SSH2	85464	broad.mit.edu	37	17	27993938	27993938	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:27993938C>T	ENST00000269033.3	-	10	1049	c.898G>A	c.(898-900)Gtg>Atg	p.V300M	RP11-68I3.2_ENST00000581474.1_RNA|SSH2_ENST00000540801.1_Missense_Mutation_p.V327M	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	300					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V300M(1)	SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCAAGGATCACTATCATTTCA	0.383																																							uc002heo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(898-900)GTG>ATG		slingshot 2							180.0	172.0	175.0					17																	27993938		2203	4300	6503	SO:0001583	missense	85464				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr17:27993938C>T	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.898G>A	17.37:g.27993938C>T	ENSP00000269033:p.Val300Met		Somatic				SSH2_uc010wbh.1_Missense_Mutation_p.V327M|SSH2_uc002hep.1_Missense_Mutation_p.V300M	p.V300M	NM_033389	NP_203747	WXS	Illumina HiSeq	Unspecified	Q76I76	SSH2_HUMAN			10	898	-			300					Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	c.898G>A	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606238	0.87157	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	T;T	0.61158	0.13;0.13	5.84	5.84	0.93424	DEK, C-terminal (1);	0.203236	0.43260	D	0.000597	T	0.74921	0.3780	L	0.60455	1.87	0.80722	D	1	D;P;D	0.69078	0.997;0.948;0.997	D;P;D	0.78314	0.975;0.673;0.991	T	0.75453	-0.3312	10	0.87932	D	0	-12.7214	20.1432	0.98067	0.0:1.0:0.0:0.0	.	327;300;300	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	M	300;327;300	ENSP00000269033:V300M;ENSP00000444743:V327M	ENSP00000269033:V300M	V	-	1	0	SSH2	25018064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.944000	0.63561	2.769000	0.95229	0.561000	0.74099	GTG		0.383	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389		34	169	0	0	0	0.054565	0	34	169				
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	C	T	rs425487		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:39274415C>T	ENST00000391413.2	-	1	191	c.153G>A	c.(151-153)agG>agA	p.R51R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51R(6)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																																							uc002hvz.2		NA																	6	Substitution - coding silent(6)		endometrium(3)|kidney(2)|lung(1)		0						c.(151-153)AGG>AGA		keratin associated protein 4-11							9.0	15.0	13.0					17																	39274415		682	1579	2261	SO:0001819	synonymous_variant	653240					keratin filament		g.chr17:39274415C>T	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.153G>A	17.37:g.39274415C>T			Somatic					p.R51R	NM_033059	NP_149048	WXS	Illumina HiSeq	Unspecified	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	192	-		Breast(137;0.000496)	51		Missing (in allele KAP4.14).	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Silent	SNP	ENST00000391413.2	37	c.153G>A	CCDS45675.1																																																																																				0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			5	48	0	0	0	0.021553	0	5	48				
TUBD1	51174	broad.mit.edu	37	17	57968194	57968194	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:57968194C>G	ENST00000592426.1	-	1	170	c.170G>C	c.(169-171)gGa>gCa	p.G57A	RPS6KB1_ENST00000225577.4_5'Flank|TUBD1_ENST00000340993.6_Missense_Mutation_p.G57A|TUBD1_ENST00000346141.6_Missense_Mutation_p.G57A|TUBD1_ENST00000325752.3_Missense_Mutation_p.G57A|RPS6KB1_ENST00000393021.3_5'Flank|RPS6KB1_ENST00000406116.3_5'Flank|RPS6KB1_ENST00000443572.2_5'Flank|TUBD1_ENST00000376094.4_Missense_Mutation_p.G57A|TUBD1_ENST00000539018.1_Intron|TUBD1_ENST00000591611.1_5'UTR|TUBD1_ENST00000394239.3_Missense_Mutation_p.G57A			Q9UJT1	TBD_HUMAN	tubulin, delta 1	57					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G57A(1)		NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	ACACCTACCTCCATTCTCCTC	0.478																																							uc002ixw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(169-171)GGA>GCA		delta-tubulin							182.0	178.0	179.0					17																	57968194		2203	4300	6503	SO:0001583	missense	51174				cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity	g.chr17:57968194C>G	AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.170G>C	17.37:g.57968194C>G	ENSP00000468518:p.Gly57Ala		Somatic				TUBD1_uc010ddf.1_Missense_Mutation_p.G57A|TUBD1_uc010ddg.1_Missense_Mutation_p.G22A|TUBD1_uc010ddh.1_5'UTR|TUBD1_uc010wok.1_Missense_Mutation_p.G57A|TUBD1_uc002ixx.1_Missense_Mutation_p.G57A|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Missense_Mutation_p.G57A|RPS6KB1_uc010ddj.1_5'Flank|RPS6KB1_uc002ixy.2_5'Flank|RPS6KB1_uc010wom.1_5'Flank|RPS6KB1_uc010won.1_5'Flank	p.G57A	NM_016261	NP_057345	WXS	Illumina HiSeq	Unspecified	Q9UJT1	TBD_HUMAN	Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		2	448	-	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		57					B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	37	c.170G>C	CCDS11620.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464587	0.63513	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094	T;T;T;T;T	0.70516	-0.49;-0.49;-0.43;-0.49;-0.49	5.74	2.65	0.31530	Tubulin/FtsZ, GTPase domain (4);	0.155637	0.64402	D	0.000019	T	0.66257	0.2771	L	0.58101	1.795	0.54753	D	0.999987	B;B;B;B;B	0.24675	0.025;0.069;0.035;0.02;0.109	B;B;B;B;B	0.32724	0.033;0.084;0.045;0.029;0.151	T	0.65520	-0.6148	10	0.62326	D	0.03	-7.6402	8.6108	0.33801	0.0:0.6926:0.1122:0.1951	.	57;57;57;57;57	E9PCA7;Q9UJT1-3;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	A	57	ENSP00000320797:G57A;ENSP00000342399:G57A;ENSP00000342561:G57A;ENSP00000377785:G57A;ENSP00000365262:G57A	ENSP00000320797:G57A	G	-	2	0	TUBD1	55322976	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.935000	0.40173	0.908000	0.36671	0.650000	0.86243	GGA		0.478	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261		16	138	0	0	0	0.043863	0	16	138				
TMEM104	54868	broad.mit.edu	37	17	72815930	72815930	+	Silent	SNP	C	C	T	rs368435149		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:72815930C>T	ENST00000335464.5	+	9	840	c.678C>T	c.(676-678)gaC>gaT	p.D226D	TMEM104_ENST00000417024.2_Silent_p.D239D|TMEM104_ENST00000582330.1_Silent_p.D226D|TMEM104_ENST00000582773.1_Silent_p.D226D	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	226						integral component of membrane (GO:0016021)		p.D226D(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					CCTTCTTTGACGTCCAGAAGA	0.562																																							uc002jls.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(676-678)GAC>GAT		transmembrane protein 104		C		1,4405	2.1+/-5.4	0,1,2202	203.0	164.0	177.0		678	-1.1	1.0	17		177	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TMEM104	NM_017728.3		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		226/497	72815930	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	54868					integral to membrane		g.chr17:72815930C>T	AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.678C>T	17.37:g.72815930C>T			Somatic				TMEM104_uc010wrf.1_Silent_p.D226D|TMEM104_uc010wrg.1_Silent_p.D239D|TMEM104_uc010dfx.2_Silent_p.D226D	p.D226D	NM_017728	NP_060198	WXS	Illumina HiSeq	Unspecified	Q8NE00	TM104_HUMAN			9	840	+	all_lung(278;0.23)		226			Cytoplasmic (Potential).		Q8TEU1|Q9NT56|Q9NXH1	Silent	SNP	ENST00000335464.5	37	c.678C>T	CCDS32723.1																																																																																				0.562	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728		20	52	0	0	0	0.043863	0	20	52				
ANKRD30B	374860	broad.mit.edu	37	18	14752603	14752603	+	Missense_Mutation	SNP	A	A	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr18:14752603A>T	ENST00000358984.4	+	2	440	c.260A>T	c.(259-261)gAa>gTa	p.E87V	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.E87V	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	87								p.E87V(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GGCCATGCAGAAGTAGTAACA	0.453																																							uc010dlo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(259-261)GAA>GTA		ankyrin repeat domain 30B							71.0	63.0	66.0					18																	14752603		692	1591	2283	SO:0001583	missense	374860							g.chr18:14752603A>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.260A>T	18.37:g.14752603A>T	ENSP00000351875:p.Glu87Val		Somatic				ANKRD30B_uc010xak.1_RNA	p.E87V	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			2	440	+			87			ANK 1.		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.260A>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	12.60	1.985799	0.35036	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.59364	0.27;0.27	1.59	0.271	0.15640	.	.	.	.	.	T	0.53658	0.1810	M	0.79475	2.455	0.18873	N	0.999986	P	0.44344	0.833	B	0.40702	0.338	T	0.50110	-0.8866	9	0.66056	D	0.02	.	4.339	0.11101	0.6418:0.3582:0.0:0.0	.	87	F8WAG3	.	V	87	ENSP00000351875:E87V;ENSP00000399031:E87V	ENSP00000351875:E87V	E	+	2	0	ANKRD30B	14742603	0.209000	0.23505	0.003000	0.11579	0.006000	0.05464	0.378000	0.20569	0.080000	0.16959	0.235000	0.17854	GAA		0.453	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		3	15	0	0	0	0.009096	0	3	15				
PSTPIP2	9050	broad.mit.edu	37	18	43577777	43577778	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr18:43577777_43577778GC>AG	ENST00000409746.5	-	9	650_651	c.579_580GC>CT	c.(577-582)ctGCac>ctCTac	p.H194Y	PSTPIP2_ENST00000588801.1_Intron|PSTPIP2_ENST00000589328.1_Missense_Mutation_p.H194Y	NM_024430.3	NP_077748.3	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting protein 2	194						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.H194Y(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	17						GTGCCGATGTGCAGCATGTATG	0.569																																							uc002lbp.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(577-582)CTGCAC>CTCTAC		proline-serine-threonine phosphatase interacting																																				SO:0001583	missense	9050					membrane		g.chr18:43577777_43577778GC>AG		CCDS32820.2	18q12	2008-07-28			ENSG00000152229	ENSG00000152229			9581	protein-coding gene	gene with protein product						9804817	Standard	NM_024430		Approved		uc002lbp.4	Q9H939	OTTHUMG00000152674	ENST00000409746.5:c.579_580delinsAG	18.37:g.43577777_43577778delinsAG	ENSP00000387261:p.His194Tyr		Somatic				PSTPIP2_uc002lbq.3_Missense_Mutation_p.H194Y	p.H194Y	NM_024430	NP_077748	WXS	Illumina HiSeq	Unspecified	Q9H939	PPIP2_HUMAN			9	675_676	-			194						Missense_Mutation	DNP	ENST00000409746.5	37	c.579_580GC>CT	CCDS32820.2																																																																																				0.569	PSTPIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327522.1			28	35	0	0	0	0.004672	0	28	35				
SERPINB7	8710	broad.mit.edu	37	18	61465845	61465845	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr18:61465845C>G	ENST00000398019.2	+	6	787	c.462C>G	c.(460-462)atC>atG	p.I154M	SERPINB7_ENST00000546027.1_Missense_Mutation_p.I154M|SERPINB7_ENST00000336429.2_Missense_Mutation_p.I154M|SERPINB7_ENST00000540675.1_Missense_Mutation_p.I137M	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	154					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.I154M(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				AAGGCAAAATCAAGAACGTGA	0.328																																							uc002ljl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)	3						c.(460-462)ATC>ATG		serine (or cysteine) proteinase inhibitor, clade							121.0	105.0	110.0					18																	61465845		2203	4300	6503	SO:0001583	missense	8710				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61465845C>G	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.462C>G	18.37:g.61465845C>G	ENSP00000381101:p.Ile154Met		Somatic				SERPINB7_uc002ljm.2_Missense_Mutation_p.I154M|SERPINB7_uc010xet.1_Missense_Mutation_p.I137M|SERPINB7_uc010dqg.2_Missense_Mutation_p.I154M	p.I154M	NM_001040147	NP_001035237	WXS	Illumina HiSeq	Unspecified	O75635	SPB7_HUMAN			6	558	+		Esophageal squamous(42;0.129)	154					B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Missense_Mutation	SNP	ENST00000398019.2	37	c.462C>G	CCDS11988.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845662	0.32606	.	.	ENSG00000166396	ENST00000336429;ENST00000398019;ENST00000540675;ENST00000447428;ENST00000546027	D;D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99;-2.99	5.68	2.54	0.30619	Serpin domain (3);	0.000000	0.64402	D	0.000004	D	0.97188	0.9081	H	0.97983	4.12	0.35016	D	0.757331	D;D	0.76494	0.999;0.999	D;D	0.77004	0.982;0.989	D	0.98150	1.0441	10	0.87932	D	0	.	10.7828	0.46388	0.2682:0.6649:0.0:0.067	.	137;154	F5GZC0;O75635	.;SPB7_HUMAN	M	154;154;137;154;154	ENSP00000337212:I154M;ENSP00000381101:I154M;ENSP00000444572:I137M;ENSP00000402362:I154M;ENSP00000444861:I154M	ENSP00000337212:I154M	I	+	3	3	SERPINB7	59616825	0.040000	0.19996	0.970000	0.41538	0.251000	0.25915	-0.140000	0.10342	0.249000	0.21456	0.650000	0.86243	ATC		0.328	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		9	80	0	0	0	0.047766	0	9	80				
ZNF548	147694	broad.mit.edu	37	19	57910809	57910809	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr19:57910809G>A	ENST00000366197.5	+	3	1404	c.1154G>A	c.(1153-1155)aGa>aAa	p.R385K	AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Intron|AC003002.6_ENST00000600421.1_Intron|ZNF548_ENST00000336128.7_Missense_Mutation_p.R397K	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R397K(1)		breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAACATTGGAGAAATCACACT	0.438																																							uc002qom.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1153-1155)AGA>AAA		zinc finger protein 548							59.0	58.0	58.0					19																	57910809		2201	4300	6501	SO:0001583	missense	147694				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57910809G>A	AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1154G>A	19.37:g.57910809G>A	ENSP00000379482:p.Arg385Lys		Somatic				ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Missense_Mutation_p.R388K	p.R385K	NM_152909	NP_690873	WXS	Illumina HiSeq	Unspecified	Q8NEK5	ZN548_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	1404	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	385			C2H2-type 7.		Q96M05	Missense_Mutation	SNP	ENST00000366197.5	37	c.1154G>A	CCDS46209.1	.	.	.	.	.	.	.	.	.	.	G	9.397	1.077061	0.20227	.	.	ENSG00000188785	ENST00000336128;ENST00000366197	T;T	0.18338	2.22;2.22	2.76	-0.201	0.13212	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08670	0.0215	N	0.16307	0.4	0.09310	N	1	B;B	0.19331	0.028;0.035	B;B	0.17098	0.01;0.017	T	0.32955	-0.9887	9	0.44086	T	0.13	.	3.0326	0.06111	0.2949:0.0:0.5041:0.201	.	397;385	Q8NEK5-2;Q8NEK5	.;ZN548_HUMAN	K	397;385	ENSP00000337555:R397K;ENSP00000379482:R385K	ENSP00000337555:R397K	R	+	2	0	ZNF548	62602621	0.000000	0.05858	0.002000	0.10522	0.896000	0.52359	-2.365000	0.01079	-0.108000	0.12066	0.563000	0.77884	AGA		0.438	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465937.1	NM_152909		3	56	0	0	0	0.004672	0	3	56				
KIF3C	3797	broad.mit.edu	37	2	26151924	26151924	+	Missense_Mutation	SNP	G	G	A	rs199957407		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:26151924G>A	ENST00000264712.3	-	8	2884	c.2305C>T	c.(2305-2307)Cgg>Tgg	p.R769W	KIF3C_ENST00000496378.1_5'Flank|KIF3C_ENST00000405914.1_Missense_Mutation_p.R769W	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	769	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R769W(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGGAGGCCGCTGAGGACTC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19696	0.001		0.0	False		,,,				2504	0.0						uc002rgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2305-2307)CGG>TGG		kinesin family member 3C							91.0	81.0	84.0					2																	26151924		2203	4300	6503	SO:0001583	missense	3797				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:26151924G>A		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.2305C>T	2.37:g.26151924G>A	ENSP00000264712:p.Arg769Trp		Somatic				KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Missense_Mutation_p.R767W	p.R769W	NM_002254	NP_002245	WXS	Illumina HiSeq	Unspecified	O14782	KIF3C_HUMAN			8	2962	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		769			Globular (Potential).		O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	c.2305C>T	CCDS1719.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	13.06	2.123860	0.37436	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.73258	-0.73;-0.73	5.72	4.85	0.62838	.	0.745034	0.12573	N	0.457110	T	0.53158	0.1779	N	0.14661	0.345	0.27140	N	0.961664	P;P	0.44260	0.83;0.83	B;B	0.30495	0.116;0.116	T	0.45145	-0.9281	10	0.72032	D	0.01	.	16.7796	0.85560	0.0:0.0:0.8685:0.1315	.	767;769	B7ZM25;O14782	.;KIF3C_HUMAN	W	769;575;769	ENSP00000264712:R769W;ENSP00000385030:R769W	ENSP00000264712:R769W	R	-	1	2	KIF3C	26005428	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	0.956000	0.29202	0.779000	0.33543	-2.048000	0.00412	CGG		0.602	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			14	79	0	0	0	0.020292	0	14	79				
NLRC4	58484	broad.mit.edu	37	2	32476011	32476011	+	Missense_Mutation	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:32476011G>C	ENST00000404025.2	-	5	1410	c.922C>G	c.(922-924)Ctc>Gtc	p.L308V	NLRC4_ENST00000402280.1_Missense_Mutation_p.L308V|NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.L308V			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	308	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.L308V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TCTCGGATGAGAGCCTGGGCG	0.532																																							uc002roi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|lung(1)|skin(1)	6						c.(922-924)CTC>GTC		caspase recruitment domain protein 12							90.0	80.0	84.0					2																	32476011		2203	4300	6503	SO:0001583	missense	58484				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity	g.chr2:32476011G>C	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.922C>G	2.37:g.32476011G>C	ENSP00000385090:p.Leu308Val		Somatic				NLRC4_uc002roj.1_Missense_Mutation_p.L308V|NLRC4_uc010ezt.1_Intron	p.L308V	NM_021209	NP_067032	WXS	Illumina HiSeq	Unspecified	Q9NPP4	NLRC4_HUMAN			4	1168	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		308			NACHT.		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	c.922C>G	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	G	3.558	-0.090267	0.07053	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.80480	-1.38;-1.38;-1.38	3.26	3.26	0.37387	.	0.000000	0.38720	N	0.001586	T	0.80534	0.4641	L	0.34521	1.04	0.30987	N	0.721808	D	0.69078	0.997	D	0.81914	0.995	T	0.82263	-0.0544	9	0.51188	T	0.08	-10.8328	5.3123	0.15837	0.2477:0.0:0.7523:0.0	.	308	Q9NPP4	NLRC4_HUMAN	V	308	ENSP00000354159:L308V;ENSP00000385428:L308V;ENSP00000385090:L308V	ENSP00000354159:L308V	L	-	1	0	NLRC4	32329515	0.857000	0.29778	0.895000	0.35142	0.038000	0.13279	1.076000	0.30729	1.831000	0.53308	0.536000	0.68110	CTC		0.532	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		5	64	0	0	0	0.014758	0	5	64				
EML4	27436	broad.mit.edu	37	2	42488319	42488319	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:42488319C>G	ENST00000318522.5	+	4	659	c.397C>G	c.(397-399)Cat>Gat	p.H133D	EML4_ENST00000401738.3_Missense_Mutation_p.H133D|EML4_ENST00000402711.2_Intron	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	133					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)		p.H133D(1)	EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						agaggaaTCTCATTCTAATGA	0.368			T	ALK	NSCLC																																		uc002rsi.2		NA		Dom	yes		2	2p21	27436	T	echinoderm microtubule associated protein like 4			E	ALK		NSCLC	EML4/ALK(246)	1	Substitution - Missense(1)		lung(1)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						c.(397-399)CAT>GAT		echinoderm microtubule associated protein like 4							115.0	114.0	114.0					2																	42488319		2203	4300	6503	SO:0001583	missense	27436				microtubule-based process|mitosis	cytoplasm|microtubule	protein binding	g.chr2:42488319C>G	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.397C>G	2.37:g.42488319C>G	ENSP00000320663:p.His133Asp		Somatic				EML4_uc002rsh.3_Missense_Mutation_p.H133D|EML4_uc010fap.2_Intron	p.H133D	NM_019063	NP_061936	WXS	Illumina HiSeq	Unspecified	Q9HC35	EMAL4_HUMAN			4	659	+			133					A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	37	c.397C>G	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457105	0.43634	.	.	ENSG00000143924	ENST00000318522;ENST00000401738	T;T	0.61274	1.13;0.12	5.52	5.52	0.82312	.	0.771606	0.12501	N	0.463329	T	0.48714	0.1515	L	0.29908	0.895	0.80722	D	1	B;B	0.33694	0.329;0.421	B;B	0.32980	0.057;0.156	T	0.41680	-0.9495	10	0.12430	T	0.62	-15.6039	19.4311	0.94768	0.0:1.0:0.0:0.0	.	133;133	Q9HC35;A6P4T4	EMAL4_HUMAN;.	D	133	ENSP00000320663:H133D;ENSP00000384939:H133D	ENSP00000320663:H133D	H	+	1	0	EML4	42341823	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.677000	0.68142	2.591000	0.87537	0.555000	0.69702	CAT		0.368	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063		5	67	0	0	0	0.014758	0	5	67				
SOCS5	9655	broad.mit.edu	37	2	46986084	46986084	+	Missense_Mutation	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:46986084G>C	ENST00000306503.5	+	2	587	c.415G>C	c.(415-417)Gat>Cat	p.D139H	SOCS5_ENST00000394861.2_Missense_Mutation_p.D139H	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	139					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)	p.D139H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ATTGGATGCTGATAAAAAGTT	0.458																																							uc002rvf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(415-417)GAT>CAT		suppressor of cytokine signaling 5							65.0	65.0	65.0					2																	46986084		2203	4300	6503	SO:0001583	missense	9655				cell growth|cytokine-mediated signaling pathway|intracellular signal transduction|negative regulation of signal transduction|negative regulation of T-helper 2 cell differentiation|positive regulation of T-helper 1 cell differentiation|regulation of growth			g.chr2:46986084G>C	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.415G>C	2.37:g.46986084G>C	ENSP00000305133:p.Asp139His		Somatic				SOCS5_uc010yoe.1_Missense_Mutation_p.D108H|SOCS5_uc002rvg.2_Missense_Mutation_p.D139H	p.D139H	NM_014011	NP_054730	WXS	Illumina HiSeq	Unspecified	O75159	SOCS5_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)		2	579	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	139					Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	37	c.415G>C	CCDS1830.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339562	0.24339	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.38722	1.12;1.12	5.4	4.53	0.55603	.	0.413475	0.28349	N	0.015680	T	0.33731	0.0873	L	0.27053	0.805	0.43047	D	0.994648	B	0.26512	0.151	B	0.33295	0.161	T	0.26224	-1.0109	10	0.66056	D	0.02	-8.5699	11.2581	0.49067	0.1487:0.0:0.8513:0.0	.	139	O75159	SOCS5_HUMAN	H	139	ENSP00000305133:D139H;ENSP00000378330:D139H	ENSP00000305133:D139H	D	+	1	0	SOCS5	46839588	1.000000	0.71417	0.010000	0.14722	0.781000	0.44180	7.551000	0.82182	1.510000	0.48803	0.655000	0.94253	GAT		0.458	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2			6	59	0	0	0	0.038147	0	6	59				
PDE11A	50940	broad.mit.edu	37	2	178969106	178969106	+	Nonsense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:178969106G>A	ENST00000358450.4	-	2	183	c.85C>T	c.(85-87)Caa>Taa	p.Q29*		NM_001077197.1	NP_001070665.1	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	0					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.Q29*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CCAGAGATTTGGACCAGTCTT	0.438									Primary Pigmented Nodular Adrenocortical Disease, Familial																														uc002ulr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(85-87)CAA>TAA		phosphodiesterase 11A isoform 3							178.0	162.0	167.0					2																	178969106		1829	4085	5914	SO:0001587	stop_gained	50940	Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr2:178969106G>A	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000358450.4:c.85C>T	2.37:g.178969106G>A	ENSP00000351232:p.Gln29*		Somatic				PDE11A_uc002ult.1_Nonsense_Mutation_p.Q29*	p.Q29*	NM_001077197	NP_001070665	WXS	Illumina HiSeq	Unspecified	Q9HCR9	PDE11_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		2	184	-			Error:Variant_position_missing_in_Q9HCR9_after_alignment					Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Nonsense_Mutation	SNP	ENST00000358450.4	37	c.85C>T	CCDS42785.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660520	0.67586	.	.	ENSG00000128655	ENST00000358450	.	.	.	4.98	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.6432	0.56720	0.0796:0.0:0.9204:0.0	.	.	.	.	X	29	.	ENSP00000351232:Q29X	Q	-	1	0	PDE11A	178677352	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	7.565000	0.82337	1.333000	0.45449	0.561000	0.74099	CAA		0.438	PDE11A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334314.2			13	134	0	0	0	0.020292	0	13	134				
ZNF385B	151126	broad.mit.edu	37	2	180311403	180311403	+	Silent	SNP	T	T	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:180311403T>G	ENST00000410066.1	-	7	1368	c.765A>C	c.(763-765)ccA>ccC	p.P255P	ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_Silent_p.P179P|ZNF385B_ENST00000336917.5_Silent_p.P153P|ZNF385B_ENST00000409692.1_Silent_p.P153P	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	255	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CTGCTCCAGGTGGCAGGGGTG	0.453																																					Colon(155;204 2491 32774 51842)	Colon(155;204 2491 32774 51842)	uc002unn.3		NA																	0				ovary(1)	1						c.(763-765)CCA>CCC		zinc finger protein 385B isoform 1							82.0	93.0	89.0					2																	180311403		2203	4300	6503	SO:0001819	synonymous_variant	151126					nucleus	nucleic acid binding|zinc ion binding	g.chr2:180311403T>G	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.765A>C	2.37:g.180311403T>G			Somatic				ZNF385B_uc002unj.2_Silent_p.P153P|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Silent_p.P152P|ZNF385B_uc002unm.2_Silent_p.P179P	p.P255P	NM_152520	NP_689733	WXS	Illumina HiSeq	Unspecified	Q569K4	Z385B_HUMAN	Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)		7	1369	-			255					Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Silent	SNP	ENST00000410066.1	37	c.765A>C	CCDS33339.1																																																																																				0.453	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520		8	101	0	0	0	0.020292	0	8	101				
GTF3C3	9330	broad.mit.edu	37	2	197629319	197629319	+	Missense_Mutation	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr2:197629319G>C	ENST00000263956.3	-	18	2718	c.2629C>G	c.(2629-2631)Caa>Gaa	p.Q877E		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	877					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.Q877E(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						AAAAGCGTTTGAGCCATTCCG	0.453																																							uc002uts.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|pancreas(1)	7						c.(2629-2631)CAA>GAA		general transcription factor IIIC, polypeptide							115.0	112.0	113.0					2																	197629319		2203	4300	6503	SO:0001583	missense	9330					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr2:197629319G>C	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.2629C>G	2.37:g.197629319G>C	ENSP00000263956:p.Gln877Glu		Somatic				GTF3C3_uc010zgu.1_Missense_Mutation_p.Q848E	p.Q877E	NM_012086	NP_036218	WXS	Illumina HiSeq	Unspecified	Q9Y5Q9	TF3C3_HUMAN			18	2719	-			877					Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	c.2629C>G	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351609	0.61183	.	.	ENSG00000119041	ENST00000263956	T	0.28255	1.62	5.1	5.1	0.69264	Tetratricopeptide-like helical (1);	0.260319	0.39544	N	0.001328	T	0.20373	0.0490	N	0.14661	0.345	0.80722	D	1	B	0.12013	0.005	B	0.09377	0.004	T	0.06356	-1.0831	10	0.15952	T	0.53	-11.5222	18.7065	0.91640	0.0:0.0:1.0:0.0	.	877	Q9Y5Q9	TF3C3_HUMAN	E	877	ENSP00000263956:Q877E	ENSP00000263956:Q877E	Q	-	1	0	GTF3C3	197337564	1.000000	0.71417	0.429000	0.26710	0.018000	0.09664	6.364000	0.73086	2.648000	0.89879	0.591000	0.81541	CAA		0.453	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1			8	76	0	0	0	0.038147	0	8	76				
PRDM15	63977	broad.mit.edu	37	21	43274737	43274737	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr21:43274737G>A	ENST00000269844.3	-	12	1684	c.1574C>T	c.(1573-1575)gCg>gTg	p.A525V	PRDM15_ENST00000398548.1_Missense_Mutation_p.A196V|PRDM15_ENST00000447207.2_Missense_Mutation_p.A159V|PRDM15_ENST00000422911.1_Missense_Mutation_p.A196V|PRDM15_ENST00000538201.1_Missense_Mutation_p.A159V	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	525	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.A525V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						ATAGAAGGCCGCATACCACAC	0.647																																							uc002yzq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1573-1575)GCG>GTG		PR domain containing 15 isoform 1							73.0	73.0	73.0					21																	43274737		2203	4300	6503	SO:0001583	missense	63977				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr21:43274737G>A	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1574C>T	21.37:g.43274737G>A	ENSP00000269844:p.Ala525Val		Somatic				PRDM15_uc002yzo.2_Missense_Mutation_p.A196V|PRDM15_uc002yzp.2_Missense_Mutation_p.A196V|PRDM15_uc002yzr.1_Missense_Mutation_p.A196V	p.A525V	NM_022115	NP_071398	WXS	Illumina HiSeq	Unspecified	P57071	PRD15_HUMAN			12	1685	-			525			SET.		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	c.1574C>T	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598649	0.87055	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;1.02	4.98	4.98	0.66077	SET domain (2);	.	.	.	.	T	0.68833	0.3044	M	0.73962	2.25	0.58432	D	0.999991	D;D;D	0.89917	1.0;0.968;0.988	D;B;B	0.67103	0.949;0.206;0.333	T	0.73836	-0.3857	9	0.87932	D	0	-13.9202	18.2675	0.90056	0.0:0.0:1.0:0.0	.	525;196;196	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	V	196;196;159;159;525;159	ENSP00000408592:A196V;ENSP00000381556:A196V;ENSP00000444044:A159V;ENSP00000390245:A159V;ENSP00000269844:A525V	ENSP00000269844:A525V	A	-	2	0	PRDM15	42147806	1.000000	0.71417	0.914000	0.36105	0.900000	0.52787	6.359000	0.73060	2.298000	0.77334	0.655000	0.94253	GCG		0.647	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115		4	97	0	0	0	0.009096	0	4	97				
SMTN	6525	broad.mit.edu	37	22	31492754	31492754	+	Missense_Mutation	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr22:31492754G>C	ENST00000347557.2	+	14	2115	c.1897G>C	c.(1897-1899)Gag>Cag	p.E633Q	SMTN_ENST00000358743.1_Missense_Mutation_p.E633Q|SMTN_ENST00000404574.1_Intron|SMTN_ENST00000333137.7_Missense_Mutation_p.E633Q	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	633					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.E633Q(2)|p.E656Q(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GCGGCTGCAGGAGGCACGGGG	0.677																																							uc003ajl.1		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)|pancreas(1)	3						c.(1897-1899)GAG>CAG		smoothelin isoform c							28.0	34.0	32.0					22																	31492754		2202	4299	6501	SO:0001583	missense	6525				muscle organ development|smooth muscle contraction	actin cytoskeleton|cytoplasm	actin binding|structural constituent of muscle	g.chr22:31492754G>C	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1897G>C	22.37:g.31492754G>C	ENSP00000328635:p.Glu633Gln		Somatic				SMTN_uc003ajk.1_Missense_Mutation_p.E633Q|SMTN_uc003ajm.1_Missense_Mutation_p.E633Q|SMTN_uc011ale.1_Missense_Mutation_p.E718Q|SMTN_uc011alf.1_Missense_Mutation_p.E689Q|SMTN_uc003ajn.1_Missense_Mutation_p.E656Q|SMTN_uc011alg.1_Missense_Mutation_p.E89Q|SMTN_uc003ajo.1_Intron|SMTN_uc011alh.1_RNA|SMTN_uc010gwe.1_Intron	p.E633Q	NM_006932	NP_008863	WXS	Illumina HiSeq	Unspecified	P53814	SMTN_HUMAN			14	2115	+			633					O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	c.1897G>C	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572974	0.86542	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.70869	-0.12;-0.52;-0.52	4.55	4.55	0.56014	.	0.526287	0.14590	N	0.310340	T	0.78710	0.4326	L	0.53249	1.67	0.80722	D	1	D;D;P;P;P;D	0.65815	0.978;0.995;0.829;0.868;0.732;0.983	P;P;P;P;B;P	0.62014	0.611;0.791;0.502;0.488;0.38;0.897	T	0.77705	-0.2488	10	0.51188	T	0.08	-14.0295	13.1423	0.59442	0.081:0.0:0.919:0.0	.	689;718;656;633;633;633	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	Q	633;633;633;631;656	ENSP00000351593:E633Q;ENSP00000328635:E633Q;ENSP00000329532:E633Q	ENSP00000329393:E631Q	E	+	1	0	SMTN	29822754	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.275000	0.89892	2.241000	0.73720	0.462000	0.41574	GAG		0.677	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270		12	54	0	0	0	0.024245	0	12	54				
APEH	327	broad.mit.edu	37	3	49722464	49722464	+	IGR	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr3:49722464G>C	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|MST1_ENST00000449682.2_Missense_Mutation_p.R535G|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.R521G(2)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGCACTGCCGGGCAGTCAGT	0.592																																						GBM(110;181 1524 8005 22865 46297)	uc003cxg.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(1603-1605)CGG>GGG		macrophage stimulating 1 (hepatocyte growth							8.0	8.0	8.0					3																	49722464		2121	4165	6286	SO:0001628	intergenic_variant	4485				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr3:49722464G>C	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49722464G>C			Somatic					p.R535G	NM_020998	NP_066278	WXS	Illumina HiSeq	Unspecified	P26927	HGFL_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	14	1675	-			521			Peptidase S1.		Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	c.1603C>G	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717706	0.48622	.	.	ENSG00000173531	ENST00000449682	D	0.92446	-3.04	4.8	4.8	0.61643	.	0.207615	0.24102	N	0.041522	D	0.85669	0.5750	N	0.03238	-0.38	0.80722	D	1	D	0.61697	0.99	P	0.50970	0.655	D	0.87882	0.2678	10	0.62326	D	0.03	.	12.2518	0.54601	0.0:0.0:0.8298:0.1702	.	535	G3XAK1	.	G	535	ENSP00000414287:R535G	ENSP00000414287:R535G	R	-	1	2	MST1	49697468	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	5.903000	0.69877	2.636000	0.89361	0.655000	0.94253	CGG		0.592	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2			3	12	0	0	0	0.004672	0	3	12				
FRYL	285527	broad.mit.edu	37	4	48542536	48542536	+	Silent	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr4:48542536C>T	ENST00000503238.1	-	43	6128	c.6129G>A	c.(6127-6129)aaG>aaA	p.K2043K	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000537810.1_Silent_p.K2043K|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Silent_p.K2043K			O94915	FRYL_HUMAN	FRY-like	2043					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.K2043K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CATTTTCAATCTTCTCTCGAC	0.383																																							uc003gyh.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(6127-6129)AAG>AAA		furry-like							111.0	100.0	103.0					4																	48542536		1849	4091	5940	SO:0001819	synonymous_variant	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48542536C>T	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.6129G>A	4.37:g.48542536C>T			Somatic				FRYL_uc003gyg.1_Silent_p.K739K|FRYL_uc003gyi.1_Silent_p.K931K|FRYL_uc003gyj.1_Silent_p.K338K	p.K2043K	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			46	6734	-			2043					O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	c.6129G>A	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.446495	0.01089	.	.	ENSG00000075539	ENST00000514617	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	T	0.71693	0.3370	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68413	-0.5415	4	.	.	.	.	14.9398	0.70983	0.0:0.9325:0.0:0.0675	.	.	.	.	N	913	.	.	D	-	1	0	FRYL	48237293	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	1.497000	0.35649	2.937000	0.99478	0.650000	0.86243	GAT		0.383	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			9	97	0	0	0	0.058154	0	9	97				
CXXC4	80319	broad.mit.edu	37	4	105412175	105412175	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr4:105412175G>A	ENST00000426831.1	-	1	292	c.278C>T	c.(277-279)gCa>gTa	p.A93V	CXXC4_ENST00000466963.1_Intron|CXXC4_ENST00000394767.2_Missense_Mutation_p.A262V|AC093628.1_ENST00000606234.1_RNA|AC004053.1_ENST00000500179.1_RNA			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	93					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)	p.A93V(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		TGCTGAGGCTGCTGCGGGGGA	0.602																																							uc003hxg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(277-279)GCA>GTA		CXXC finger 4							64.0	71.0	69.0					4																	105412175		2203	4300	6503	SO:0001583	missense	80319				negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding	g.chr4:105412175G>A		CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.278C>T	4.37:g.105412175G>A	ENSP00000412267:p.Ala93Val		Somatic				uc003hxh.1_RNA|CXXC4_uc010ilo.2_Intron	p.A93V	NM_025212	NP_079488	WXS	Illumina HiSeq	Unspecified	Q9H2H0	CXXC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)	1	293	-			93						Missense_Mutation	SNP	ENST00000426831.1	37	c.278C>T		.	.	.	.	.	.	.	.	.	.	G	19.72	3.880457	0.72294	.	.	ENSG00000168772	ENST00000394767;ENST00000426831	.	.	.	4.56	4.56	0.56223	.	0.069491	0.56097	D	0.000024	T	0.51805	0.1696	N	0.08118	0	0.44880	D	0.997893	D	0.57571	0.98	D	0.65443	0.935	T	0.61257	-0.7099	9	0.52906	T	0.07	-5.7964	15.4735	0.75458	0.0:0.0:1.0:0.0	.	93	Q9H2H0	CXXC4_HUMAN	V	93	.	ENSP00000378248:A93V	A	-	2	0	CXXC4	105631624	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.373000	0.59537	2.245000	0.73994	0.484000	0.47621	GCA		0.602	CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212		23	67	0	0	0	0.062417	0	23	67				
FAT1	2195	broad.mit.edu	37	4	187521354	187521354	+	Missense_Mutation	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr4:187521354G>A	ENST00000441802.2	-	22	12010	c.11801C>T	c.(11800-11802)tCg>tTg	p.S3934L	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3934	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S3934L(1)|p.S3937L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCTGTGCCCGATGCAGTATG	0.517										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(11800-11802)TCG>TTG		FAT tumor suppressor 1 precursor							59.0	59.0	59.0					4																	187521354		1975	4157	6132	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187521354G>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11801C>T	4.37:g.187521354G>A	ENSP00000406229:p.Ser3934Leu	HNSCC(5;0.00058)	Somatic				FAT1_uc003ize.2_5'Flank	p.S3934L	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			22	11989	-			3934			Extracellular (Potential).|Laminin G-like.			Missense_Mutation	SNP	ENST00000441802.2	37	c.11801C>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063064	0.93898	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.78481	-1.18	4.94	4.94	0.65067	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.83700	0.5311	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79538	-0.1762	10	0.23302	T	0.38	.	18.7161	0.91677	0.0:0.0:1.0:0.0	.	3934	Q14517	FAT1_HUMAN	L	3934;3936	ENSP00000406229:S3934L	ENSP00000260147:S3936L	S	-	2	0	FAT1	187758348	1.000000	0.71417	0.162000	0.22713	0.929000	0.56500	7.508000	0.81686	2.726000	0.93360	0.655000	0.94253	TCG		0.517	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		3	46	0	0	0	0.004672	0	3	46				
ZNF451	26036	broad.mit.edu	37	6	57006175	57006175	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr6:57006175C>T	ENST00000370706.4	+	8	1022	c.778C>T	c.(778-780)Ctt>Ttt	p.L260F	ZNF451_ENST00000357489.3_Missense_Mutation_p.L260F|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.L260F|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L260F(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AAATTGCTTCCTTCTTTTTAG	0.373																																							uc003pdm.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(778-780)CTT>TTT		zinc finger protein 451 isoform 1							134.0	116.0	122.0					6																	57006175		2203	4299	6502	SO:0001583	missense	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:57006175C>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.778C>T	6.37:g.57006175C>T	ENSP00000359740:p.Leu260Phe		Somatic				ZNF451_uc003pdl.2_Missense_Mutation_p.L260F|ZNF451_uc003pdn.1_Missense_Mutation_p.L260F|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.L260F	p.L260F	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		8	1002	+	Lung NSC(77;0.145)		260			C2H2-type 2.		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	c.778C>T	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707449	0.68615	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.27557	1.66;1.66;1.66	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.072130	0.56097	D	0.000034	T	0.20536	0.0494	L	0.43152	1.355	0.80722	D	1	P;P;P;P	0.48407	0.91;0.719;0.709;0.719	P;P;B;B	0.45474	0.48;0.482;0.269;0.347	T	0.01172	-1.1429	10	0.44086	T	0.13	-20.6467	13.0416	0.58901	0.0:0.9264:0.0:0.0736	.	260;260;260;260	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	F	260	ENSP00000359740:L260F;ENSP00000350083:L260F;ENSP00000421645:L260F	ENSP00000350083:L260F	L	+	1	0	ZNF451	57114134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.137000	0.42130	2.668000	0.90789	0.591000	0.81541	CTT		0.373	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		7	32	0	0	0	0.02938	0	7	32				
SHPRH	257218	broad.mit.edu	37	6	146215302	146215302	+	Missense_Mutation	SNP	C	C	T	rs375643591		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr6:146215302C>T	ENST00000367505.2	-	27	4943	c.4679G>A	c.(4678-4680)cGt>cAt	p.R1560H	SHPRH_ENST00000367503.3_Missense_Mutation_p.R1564H|SHPRH_ENST00000275233.7_Missense_Mutation_p.R1560H|SHPRH_ENST00000438092.2_Missense_Mutation_p.R1564H			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1560	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R1564H(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TGTCTTAACACGACTGATTTG	0.313																																							uc003qlf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(4678-4680)CGT>CAT		SNF2 histone linker PHD RING helicase isoform a		C	HIS/ARG,HIS/ARG	1,3669		0,1,1834	115.0	108.0	110.0		4679,4691	5.5	1.0	6		110	0,8196		0,0,4098	no	missense,missense	SHPRH	NM_001042683.2,NM_173082.3	29,29	0,1,5932	TT,TC,CC		0.0,0.0272,0.0084	probably-damaging,probably-damaging	1560/1684,1564/1660	146215302	1,11865	1835	4098	5933	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146215302C>T	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.4679G>A	6.37:g.146215302C>T	ENSP00000356475:p.Arg1560His		Somatic				SHPRH_uc003qld.2_Missense_Mutation_p.R1564H|SHPRH_uc003qle.2_Missense_Mutation_p.R1564H	p.R1560H	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	27	5078	-		Ovarian(120;0.0365)	1560			Helicase C-terminal.		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.4679G>A	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394656	0.83011	2.72E-4	0.0	ENSG00000146414	ENST00000367507;ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.46	5.46	0.80206	Helicase, C-terminal (2);	0.073245	0.53938	D	0.000048	T	0.59891	0.2227	N	0.03608	-0.345	0.48341	D	0.999635	D;D	0.67145	0.996;0.996	P;P	0.58620	0.842;0.656	T	0.70662	-0.4810	10	0.45353	T	0.12	-17.4466	16.8133	0.85726	0.0:1.0:0.0:0.0	.	1560;1564	Q149N8;Q149N8-4	SHPRH_HUMAN;.	H	8;1560;1564;1564;1560	ENSP00000356475:R1560H;ENSP00000356473:R1564H;ENSP00000412797:R1564H;ENSP00000275233:R1560H	ENSP00000275233:R1560H	R	-	2	0	SHPRH	146256995	1.000000	0.71417	0.994000	0.49952	0.846000	0.48090	7.241000	0.78201	2.710000	0.92621	0.585000	0.79938	CGT		0.313	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		6	26	0	0	0	0.021553	0	6	26				
CDC14C	168448	broad.mit.edu	37	7	48965166	48965166	+	IGR	SNP	A	A	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr7:48965166A>T								AC004899.1 (73945 upstream) : AC010971.1 (304566 downstream)																							CTGCTACATCATGAAGCATTA	0.498																																							uc010kyv.1		NA																	0					0						c.(898-900)ATG>TTG		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48965166A>T																													7.37:g.48965166A>T			Somatic					p.M300L	NR_003595		WXS	Illumina HiSeq	Unspecified					1	1010	+									Missense_Mutation	SNP		37	c.898A>T																																																																																				0	0.498									5	18	0	0	0	0.02938	0	5	18				
AKAP9	10142	broad.mit.edu	37	7	91712538	91712538	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr7:91712538C>T	ENST00000359028.2	+	34	8476	c.8251C>T	c.(8251-8253)Cac>Tac	p.H2751Y	AKAP9_ENST00000358100.2_Missense_Mutation_p.H2751Y|AKAP9_ENST00000356239.3_Missense_Mutation_p.H2739Y			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2751	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.H2739Y(1)|p.H2751Y(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTTAGGGATCACCTCGCAGA	0.373			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(8215-8217)CAC>TAC		A-kinase anchor protein 9 isoform 2							62.0	61.0	62.0					7																	91712538		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91712538C>T	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8251C>T	7.37:g.91712538C>T	ENSP00000351922:p.His2751Tyr		Somatic				AKAP9_uc003ulf.2_Missense_Mutation_p.H2731Y|AKAP9_uc003uli.2_Missense_Mutation_p.H2362Y|AKAP9_uc003ulj.2_Missense_Mutation_p.H509Y|AKAP9_uc003ulk.2_Missense_Mutation_p.H14Y	p.H2739Y	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		33	8440	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		2751			Potential.|Glu-rich.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.8215C>T		.	.	.	.	.	.	.	.	.	.	C	4.124	0.021309	0.08006	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.8	3.89	0.44902	.	0.419790	0.17615	N	0.167960	T	0.23014	0.0556	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.26483	0.15;0.09;0.054;0.09;0.09	B;B;B;B;B	0.28709	0.093;0.058;0.026;0.058;0.058	T	0.15752	-1.0426	10	0.54805	T	0.06	.	7.7275	0.28767	0.3314:0.4104:0.2582:0.0	.	2743;2743;2751;2739;2731	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	Y	2739;2751;2751;2743;585	ENSP00000348573:H2739Y;ENSP00000351922:H2751Y;ENSP00000350813:H2751Y;ENSP00000378042:H585Y	ENSP00000348573:H2739Y	H	+	1	0	AKAP9	91550474	0.192000	0.23301	0.918000	0.36340	0.568000	0.35870	1.081000	0.30791	1.212000	0.43366	0.591000	0.81541	CAC		0.373	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		13	87	0	0	0	0.09319	0	13	87				
ORAI2	80228	broad.mit.edu	37	7	102087127	102087127	+	Silent	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr7:102087127G>A	ENST00000356387.2	+	4	628	c.393G>A	c.(391-393)ctG>ctA	p.L131L	ORAI2_ENST00000473939.1_Silent_p.L131L|ORAI2_ENST00000403646.3_Silent_p.L131L|ORAI2_ENST00000488996.1_3'UTR|ORAI2_ENST00000478730.2_Silent_p.L131L	NM_001126340.1|NM_001271818.1|NM_001271819.1|NM_032831.3	NP_001119812.1|NP_001258747.1|NP_001258748.1|NP_116220.1	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator 2	131						growth cone (GO:0030426)|integral component of membrane (GO:0016021)		p.L131L(1)		autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15						TCCACAACCTGAACTCCATCA	0.637																																							uc010lhz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(391-393)CTG>CTA		ORAI calcium release-activated calcium modulator							177.0	148.0	158.0					7																	102087127		2203	4300	6503	SO:0001819	synonymous_variant	80228					integral to membrane	protein binding	g.chr7:102087127G>A	AF258552	CCDS5722.1	7q22.1	2007-08-14	2007-08-14	2007-08-14	ENSG00000160991	ENSG00000160991		"""ORAI calcium release-activated calcium modulators"""	21667	protein-coding gene	gene with protein product	"""CAP-binding protein complex interacting protein 2"""	610929	"""chromosome 7 open reading frame 19"", ""transmembrane protein 142B"""	C7orf19, TMEM142B		16582901	Standard	NM_001126340		Approved	CBCIP2, FLJ12474, FLJ14733, H_NH0514P08.8	uc003uzj.3	Q96SN7	OTTHUMG00000157722	ENST00000356387.2:c.393G>A	7.37:g.102087127G>A			Somatic				ORAI2_uc003uzj.2_Silent_p.L131L|ORAI2_uc003uzk.2_Silent_p.L131L|ORAI2_uc011kks.1_Silent_p.L54L	p.L131L	NM_001126340	NP_001119812	WXS	Illumina HiSeq	Unspecified	Q96SN7	ORAI2_HUMAN			4	628	+			131					Q6IA68|Q8WY94|Q9H9Y3	Silent	SNP	ENST00000356387.2	37	c.393G>A	CCDS5722.1																																																																																				0.637	ORAI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349509.2	NM_032831		12	123	0	0	0	0.09319	0	12	123				
CADPS2	93664	broad.mit.edu	37	7	122091483	122091483	+	Missense_Mutation	SNP	C	C	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr7:122091483C>G	ENST00000449022.2	-	15	2252	c.2233G>C	c.(2233-2235)Gag>Cag	p.E745Q	CADPS2_ENST00000412584.2_Missense_Mutation_p.E742Q|CADPS2_ENST00000313070.7_Missense_Mutation_p.E742Q|CADPS2_ENST00000334010.7_Missense_Mutation_p.E746Q	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	745					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.E745Q(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						TTTATCTCCTCAAATCTTTCT	0.274																																							uc010lkp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2233-2235)GAG>CAG		Ca2+-dependent activator protein for secretion 2							38.0	37.0	37.0					7																	122091483		1785	4045	5830	SO:0001583	missense	93664				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding	g.chr7:122091483C>G		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2233G>C	7.37:g.122091483C>G	ENSP00000398481:p.Glu745Gln		Somatic				CADPS2_uc011knx.1_Missense_Mutation_p.E116Q|CADPS2_uc003vkg.3_Missense_Mutation_p.E442Q|CADPS2_uc010lkq.2_Missense_Mutation_p.E742Q	p.E745Q	NM_017954	NP_060424	WXS	Illumina HiSeq	Unspecified	Q86UW7	CAPS2_HUMAN			14	2396	-			745					A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	c.2233G>C	CCDS55158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.37|12.37	1.918603|1.918603	0.33908|0.33908	.|.	.|.	ENSG00000081803|ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000397721	T;T;T;T|.	0.29142|.	1.58;1.58;1.58;1.58|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.062472|.	0.64402|.	D|.	0.000009|.	T|.	0.59101|.	0.2169|.	L|L	0.31804|0.31804	0.96|0.96	0.58432|0.58432	D|D	0.99999|0.99999	B;B;B;B|.	0.18863|.	0.031;0.013;0.031;0.017|.	B;B;B;B|.	0.15484|.	0.012;0.013;0.012;0.005|.	T|.	0.53500|.	-0.8430|.	10|.	0.13470|.	T|.	0.59|.	-19.0773|-19.0773	19.2716|19.2716	0.94013|0.94013	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	745;742;745;742|.	B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3|.	.;.;CAPS2_HUMAN;.|.	Q|S	742;746;746;709;742;745|390	ENSP00000325581:E742Q;ENSP00000333940:E746Q;ENSP00000400401:E742Q;ENSP00000398481:E745Q|.	ENSP00000325581:E742Q|.	E|X	-|-	1|2	0|2	CADPS2|CADPS2	121878719|121878719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.886000|6.886000	0.75611|0.75611	2.550000|2.550000	0.86006|0.86006	0.585000|0.585000	0.79938|0.79938	GAG|TGA		0.274	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954		3	57	0	0	0	0.004672	0	3	57				
RAD54B	25788	broad.mit.edu	37	8	95403999	95403999	+	Silent	SNP	G	G	A			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr8:95403999G>A	ENST00000336148.5	-	10	1771	c.1647C>T	c.(1645-1647)tgC>tgT	p.C549C		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	549					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.C549C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			CTCCTGGTCGGCAAAAGACAA	0.398								Direct reversal of damage;Homologous recombination																															uc003ygk.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(2)|lung(1)|skin(1)	4						c.(1645-1647)TGC>TGT	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							120.0	126.0	124.0					8																	95403999		2203	4300	6503	SO:0001819	synonymous_variant	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95403999G>A	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1647C>T	8.37:g.95403999G>A			Somatic				RAD54B_uc010may.1_Silent_p.C356C|RAD54B_uc003ygl.1_RNA	p.C549C	NM_012415	NP_036547	WXS	Illumina HiSeq	Unspecified	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		10	1745	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Silent	SNP	ENST00000336148.5	37	c.1647C>T	CCDS6262.1																																																																																				0.398	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		4	221	0	0	0	0.02938	0	4	221				
VCP	7415	broad.mit.edu	37	9	35059603	35059603	+	Missense_Mutation	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:35059603G>C	ENST00000358901.6	-	14	2786	c.1891C>G	c.(1891-1893)Cct>Gct	p.P631A		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	631					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.P631A(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGGATGGCAGGATCAATGATG	0.502																																							uc003zvy.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1891-1893)CCT>GCT		valosin-containing protein							191.0	151.0	164.0					9																	35059603		2203	4300	6503	SO:0001583	missense	7415				activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding	g.chr9:35059603G>C	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1891C>G	9.37:g.35059603G>C	ENSP00000351777:p.Pro631Ala		Somatic				VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_Missense_Mutation_p.P300A|VCP_uc010mki.1_Missense_Mutation_p.P586A	p.P631A	NM_007126	NP_009057	WXS	Illumina HiSeq	Unspecified	P55072	TERA_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		14	2280	-			631					B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	c.1891C>G	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845250	0.71603	.	.	ENSG00000165280	ENST00000358901	D	0.95447	-3.71	6.07	6.07	0.98685	ATPase, AAA-type, conserved site (1);ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.94656	0.8277	L	0.58101	1.795	0.80722	D	1	B	0.11235	0.004	B	0.15870	0.014	D	0.90099	0.4183	10	0.62326	D	0.03	-29.5266	20.6439	0.99570	0.0:0.0:1.0:0.0	.	631	P55072	TERA_HUMAN	A	631	ENSP00000351777:P631A	ENSP00000351777:P631A	P	-	1	0	VCP	35049603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CCT		0.502	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126		7	51	0	0	0	0.047766	0	7	51				
TRPM6	140803	broad.mit.edu	37	9	77339635	77339635	+	Missense_Mutation	SNP	T	T	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:77339635T>C	ENST00000360774.1	-	39	6200	c.5963A>G	c.(5962-5964)gAa>gGa	p.E1988G	TRPM6_ENST00000451710.3_Missense_Mutation_p.E1992G|TRPM6_ENST00000361255.3_Missense_Mutation_p.E1983G|TRPM6_ENST00000449912.2_Missense_Mutation_p.E1983G|TRPM6_ENST00000376871.3_Missense_Mutation_p.E825G|TRPM6_ENST00000376872.3_Missense_Mutation_p.E943G	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1988					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.E1988G(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATTTATCCTTTCAGGGGAATA	0.408																																							uc004ajl.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(5962-5964)GAA>GGA		transient receptor potential cation channel,							102.0	105.0	104.0					9																	77339635		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77339635T>C	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5963A>G	9.37:g.77339635T>C	ENSP00000354006:p.Glu1988Gly		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.E1983G|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.E939G|TRPM6_uc010mpd.1_Missense_Mutation_p.E821G|TRPM6_uc010mpe.1_Missense_Mutation_p.E535G|TRPM6_uc004ajj.1_Missense_Mutation_p.E944G	p.E1988G	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			39	6201	-			1988			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.5963A>G	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	0.874	-0.731036	0.03135	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870	T;T;T;T;T;T	0.53423	0.66;0.66;0.62;0.8;0.66;0.66	5.69	2.78	0.32641	.	0.513773	0.20294	N	0.095167	T	0.18002	0.0432	N	0.02142	-0.665	0.80722	D	1	B;B;B;B;B;B	0.10296	0.002;0.003;0.003;0.0;0.0;0.0	B;B;B;B;B;B	0.17433	0.004;0.018;0.007;0.0;0.0;0.0	T	0.04065	-1.0980	10	0.15066	T	0.55	.	6.7146	0.23296	0.0:0.6378:0.1415:0.2207	.	535;821;939;1988;1983;1983	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	G	1988;1992;943;825;1983;1983;534	ENSP00000354006:E1988G;ENSP00000407341:E1992G;ENSP00000366068:E943G;ENSP00000366067:E825G;ENSP00000396672:E1983G;ENSP00000354962:E1983G	ENSP00000354006:E1988G	E	-	2	0	TRPM6	76529455	0.038000	0.19896	0.555000	0.28281	0.273000	0.26683	0.795000	0.26972	0.711000	0.32018	-0.242000	0.12053	GAA		0.408	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		15	91	0	0	0	0.024245	0	15	91				
FOXB2	442425	broad.mit.edu	37	9	79635526	79635526	+	Missense_Mutation	SNP	T	T	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:79635526T>C	ENST00000376708.1	+	1	956	c.956T>C	c.(955-957)gTc>gCc	p.V319A		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	319					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V319A(2)|p.V185A(1)		breast(1)|lung(8)|ovary(1)	10						CACGTTGGCGTCATGGATTCG	0.721																																							uc004ako.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(955-957)GTC>GCC		forkhead box B2							13.0	14.0	13.0					9																	79635526		2197	4291	6488	SO:0001583	missense	442425				brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:79635526T>C		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.956T>C	9.37:g.79635526T>C	ENSP00000365898:p.Val319Ala		Somatic					p.V319A	NM_001013735	NP_001013757	WXS	Illumina HiSeq	Unspecified	Q5VYV0	FOXB2_HUMAN			1	956	+			319						Missense_Mutation	SNP	ENST00000376708.1	37	c.956T>C	CCDS35045.1	.	.	.	.	.	.	.	.	.	.	T	6.189	0.403057	0.11754	.	.	ENSG00000204612	ENST00000376708	D	0.96200	-3.94	3.65	3.65	0.41850	.	0.081675	0.48767	D	0.000175	D	0.90222	0.6943	L	0.39898	1.24	0.27984	N	0.935917	B	0.14438	0.01	B	0.17722	0.019	T	0.78285	-0.2263	10	0.17832	T	0.49	.	6.5692	0.22529	0.0:0.1123:0.0:0.8876	.	319	Q5VYV0	FOXB2_HUMAN	A	319	ENSP00000365898:V319A	ENSP00000365898:V319A	V	+	2	0	FOXB2	78825346	0.932000	0.31603	1.000000	0.80357	0.391000	0.30476	2.190000	0.42630	1.505000	0.48720	0.459000	0.35465	GTC		0.721	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735		2	7	0	0	0	0.004672	0	2	7				
GABBR2	9568	broad.mit.edu	37	9	101052878	101052878	+	Silent	SNP	G	G	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:101052878G>C	ENST00000259455.2	-	19	3273	c.2814C>G	c.(2812-2814)gtC>gtG	p.V938V		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	938					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.V938V(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	ACAGGCCCGAGACCATGACTC	0.682																																							uc004ays.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(2812-2814)GTC>GTG		G protein-coupled receptor 51 precursor	Baclofen(DB00181)						11.0	13.0	13.0					9																	101052878		2189	4280	6469	SO:0001819	synonymous_variant	9568				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr9:101052878G>C	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.2814C>G	9.37:g.101052878G>C			Somatic					p.V938V	NM_005458	NP_005449	WXS	Illumina HiSeq	Unspecified	O75899	GABR2_HUMAN			19	2970	-		Acute lymphoblastic leukemia(62;0.0527)	938			Cytoplasmic (Potential).		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	ENST00000259455.2	37	c.2814C>G	CCDS6736.1																																																																																				0.682	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1			6	5	0	0	0	0.058154	0	6	5				
TOR1A	1861	broad.mit.edu	37	9	132584984	132584984	+	Missense_Mutation	SNP	C	C	T			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:132584984C>T	ENST00000351698.4	-	2	368	c.320G>A	c.(319-321)gGc>gAc	p.G107D	TOR1A_ENST00000473084.1_5'UTR	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	107	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)	p.G107D(4)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				GAAATTTTTGCCGGTGCCTGT	0.468																																							uc004byl.2		NA																	4	Substitution - Missense(4)		kidney(3)|lung(1)	central_nervous_system(1)	1						c.(319-321)GGC>GAC		torsin A precursor							226.0	200.0	209.0					9																	132584984		2203	4300	6503	SO:0001583	missense	1861				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding	g.chr9:132584984C>T	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.320G>A	9.37:g.132584984C>T	ENSP00000345719:p.Gly107Asp		Somatic				TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.G107D	p.G107D	NM_000113	NP_000104	WXS	Illumina HiSeq	Unspecified	O14656	TOR1A_HUMAN			2	397	-		Ovarian(14;0.00556)	107			ATP.		B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	ENST00000351698.4	37	c.320G>A	CCDS6930.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.838232	0.71373	.	.	ENSG00000136827	ENST00000351698	D	0.92099	-2.97	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98397	1.0566	10	0.87932	D	0	-8.4354	17.7332	0.88384	0.0:1.0:0.0:0.0	.	107;107	O14656-2;O14656	.;TOR1A_HUMAN	D	107	ENSP00000345719:G107D	ENSP00000345719:G107D	G	-	2	0	TOR1A	131624805	1.000000	0.71417	0.995000	0.50966	0.072000	0.16883	7.484000	0.81180	2.439000	0.82584	0.561000	0.74099	GGC		0.468	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113		4	206	0	0	0	0.021553	0	4	206				
TUBBP5	643224	broad.mit.edu	37	9	141070969	141070969	+	RNA	SNP	A	A	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr9:141070969A>G	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.A196A(1)									TAGAAAACGCAGATGAGACCT	0.517																																							uc004com.2		NA																	1	Substitution - coding silent(1)		endometrium(1)		0						c.(370-372)GCA>GCG		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070969A>G	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070969A>G			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.A124A			WXS	Illumina HiSeq	Unspecified					4	633	+									Silent	SNP	ENST00000503395.1	37	c.372A>G																																																																																					0.517	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		3	34	0	0	0	0.009096	0	3	34				
SSX7	280658	broad.mit.edu	37	X	52682498	52682498	+	Missense_Mutation	SNP	T	T	C			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chrX:52682498T>C	ENST00000298181.5	-	2	183	c.25A>G	c.(25-27)Agg>Ggg	p.R9G		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R9G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					CTAGGTCTCCTTGCAAAGGCG	0.567																																							uc004dqx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(25-27)AGG>GGG		synovial sarcoma, X breakpoint 7							325.0	267.0	287.0					X																	52682498		2203	4300	6503	SO:0001583	missense	280658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	g.chrX:52682498T>C	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.25A>G	X.37:g.52682498T>C	ENSP00000298181:p.Arg9Gly		Somatic					p.R9G	NM_173358	NP_775494	WXS	Illumina HiSeq	Unspecified	Q7RTT5	SSX7_HUMAN			2	184	-	Ovarian(276;0.236)		9						Missense_Mutation	SNP	ENST00000298181.5	37	c.25A>G	CCDS14343.1	.	.	.	.	.	.	.	.	.	.	N	5.760	0.324606	0.10900	.	.	ENSG00000187754	ENST00000298181	T	0.09723	2.95	0.56	0.56	0.17279	.	1.039150	0.07640	N	0.930178	T	0.13756	0.0333	M	0.65975	2.015	0.09310	N	1	B	0.27932	0.194	B	0.29524	0.103	T	0.35919	-0.9769	9	0.72032	D	0.01	.	.	.	.	.	9	Q7RTT5	SSX7_HUMAN	G	9	ENSP00000298181:R9G	ENSP00000298181:R9G	R	-	1	2	SSX7	52699223	0.003000	0.15002	0.013000	0.15412	0.025000	0.11179	1.559000	0.36320	0.429000	0.26202	0.146000	0.16034	AGG		0.567	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358		8	146	0	0	0	0.047766	0	8	146				
GPRASP2	114928	broad.mit.edu	37	X	101970073	101970073	+	Silent	SNP	A	A	G			TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chrX:101970073A>G	ENST00000535209.1	+	4	1107	c.276A>G	c.(274-276)ggA>ggG	p.G92G	GPRASP2_ENST00000543253.1_Silent_p.G92G|GPRASP2_ENST00000332262.5_Silent_p.G92G			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	92						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)	p.G92G(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGGCTCAAGGAATCACAGGGG	0.577																																							uc004ejk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(274-276)GGA>GGG		G protein-coupled receptor associated sorting							78.0	78.0	78.0					X																	101970073		2203	4300	6503	SO:0001819	synonymous_variant	114928					cytoplasm	protein binding	g.chrX:101970073A>G	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.276A>G	X.37:g.101970073A>G			Somatic				GPRASP2_uc004ejl.2_Silent_p.G92G|GPRASP2_uc004ejm.2_Silent_p.G92G|GPRASP2_uc011mrp.1_5'Flank	p.G92G	NM_138437	NP_612446	WXS	Illumina HiSeq	Unspecified	Q96D09	GASP2_HUMAN			4	1610	+			92					D3DXA0|Q8NAB4	Silent	SNP	ENST00000535209.1	37	c.276A>G	CCDS14501.1																																																																																				0.577	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		17	64	0	0	0	0.038395	0	17	64				
ERBB2	2064	broad.mit.edu	37	17	37880997	37880998	+	In_Frame_Ins	INS	-	-	TCT	rs144434331|rs397516979|rs28933369|rs397516980		TCGA-86-6562-01A-11D-1753-08	TCGA-86-6562-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e48dd11b-89ae-4278-8de0-7956423c8609	15867b54-ec82-49b3-a442-689bda9a716d	g.chr17:37880997_37880998insTCT	ENST00000269571.5	+	20	2485_2486	c.2326_2327insTCT	c.(2326-2328)ggt>gTCTgt	p.776_776G>VC	ERBB2_ENST00000406381.2_In_Frame_Ins_p.746_746G>VC|ERBB2_ENST00000541774.1_In_Frame_Ins_p.761_761G>VC|ERBB2_ENST00000584601.1_In_Frame_Ins_p.746_746G>VC|ERBB2_ENST00000540147.1_In_Frame_Ins_p.746_746G>VC|ERBB2_ENST00000445658.2_In_Frame_Ins_p.500_500G>VC|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584450.1_In_Frame_Ins_p.776_776G>VC			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	776	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		G -> S (in a gastric adenocarcinoma sample; somatic mutation; dbSNP:rs28933369). {ECO:0000269|PubMed:15457249, ECO:0000269|PubMed:17344846}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.A775_G776insYVMA(10)|p.G776>VC(9)|p.G776>LC(3)|p.G776V(2)|p.G776S(2)|p.G776C(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CGTGATGGCTGGTGTGGGCTCC	0.579		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													uc002hso.2		1		Dom	yes		17	17q21.1	2064	A|Mis|O	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""			E			breast|ovarian|other tumour types|NSCLC|gastric		27	Complex - insertion inframe(12)|Insertion - In frame(10)|Substitution - Missense(5)	p.A775_G776insYVMA(19)|p.G776>VC(8)|p.G776>LC(3)|p.G776V(2)|p.G776S(2)	lung(22)|ovary(3)|stomach(2)	lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143						c.(2326-2328)GGT>GTCTGT		erbB-2 isoform a	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)																																			SO:0001652	inframe_insertion	2064				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr17:37880997_37880998insTCT	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		Exception_encountered	17.37:g.37880997_37880998insTCT	ENSP00000269571:p.Gly776delinsValCys	TCGA GBM(5;<1E-08)	Somatic				ERBB2_uc002hsm.2_In_Frame_Ins_p.746_746G>VC|ERBB2_uc010cwa.2_In_Frame_Ins_p.761_761G>VC|ERBB2_uc002hsp.2_In_Frame_Ins_p.579_579G>VC|ERBB2_uc010cwb.2_In_Frame_Ins_p.776_776G>VC|ERBB2_uc010wek.1_In_Frame_Ins_p.500_500G>VC	p.776_776G>VC	NM_004448	NP_004439	WXS	Illumina HiSeq	Unspecified	P04626	ERBB2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	20	2564_2565	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	776			Cytoplasmic (Potential).|Protein kinase.		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	In_Frame_Ins	INS	ENST00000269571.5	37	c.2326_2327insTCT	CCDS32642.1																																																																																				0.579	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			16	54	NA	NA	NA	NA	NA	16	54	---	---	---	---
