#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
DVL1	1855	broad.mit.edu	37	1	1273747	1273747	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:1273747T>A	ENST00000378888.5	-	13	1693	c.1409A>T	c.(1408-1410)tAc>tTc	p.Y470F	DVL1_ENST00000378891.5_Missense_Mutation_p.Y445F			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	470	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GCTGCTGGCGTACTTCCGGGC	0.647																																							uc001aer.3		NA																	0					0						c.(1333-1335)TAC>TTC		dishevelled 1							45.0	40.0	42.0					1																	1273747		2201	4295	6496	SO:0001583	missense	1855				canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity	g.chr1:1273747T>A	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1409A>T	1.37:g.1273747T>A	ENSP00000368166:p.Tyr470Phe		Somatic				DVL1_uc002quu.2_Missense_Mutation_p.Y187F|DVL1_uc009vka.2_Missense_Mutation_p.Y128F|DVL1_uc001aeu.1_Missense_Mutation_p.Y204F	p.Y445F	NM_004421	NP_004412	WXS	Illumina HiSeq	Unspecified	O14640	DVL1_HUMAN		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	13	1381	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	470			DEP.		Q5TA33|Q5TA35	Missense_Mutation	SNP	ENST00000378888.5	37	c.1334A>T		.	.	.	.	.	.	.	.	.	.	T	16.74	3.205973	0.58234	.	.	ENSG00000107404	ENST00000378891;ENST00000378888;ENST00000345100;ENST00000263743	T;T	0.20332	2.08;2.08	3.48	3.48	0.39840	DEP domain (6);Winged helix-turn-helix transcription repressor DNA-binding (2);	0.162336	0.42682	D	0.000673	T	0.34048	0.0884	L	0.47716	1.5	0.58432	D	0.999999	D;D;B;B	0.58620	0.98;0.983;0.041;0.094	D;P;B;B	0.64595	0.927;0.874;0.174;0.214	T	0.03051	-1.1078	10	0.31617	T	0.26	.	12.4915	0.55903	0.0:0.0:0.0:1.0	.	128;470;445;445	G3XA93;O14640;P54792;O14640-2	.;DVL1_HUMAN;DVL1L_HUMAN;.	F	445;470;219;128	ENSP00000368169:Y445F;ENSP00000368166:Y470F	ENSP00000263743:Y128F	Y	-	2	0	DVL1	1263610	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	7.699000	0.84547	1.598000	0.50083	0.369000	0.22263	TAC		0.647	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421		18	23	0	0	0	0.007413	0	18	23				
UTS2	10911	broad.mit.edu	37	1	7912998	7912998	+	Silent	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:7912998A>T	ENST00000361696.5	-	1	97	c.66T>A	c.(64-66)ccT>ccA	p.P22P	UTS2_ENST00000054668.5_Intron|UTS2_ENST00000377516.2_Silent_p.P22P	NM_006786.3	NP_006777.1	O95399	UTS2_HUMAN	urotensin 2	22					muscle contraction (GO:0006936)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell differentiation (GO:0045597)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of heart rate (GO:0010460)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to testosterone (GO:0033574)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			kidney(1)|lung(4)|urinary_tract(1)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		AGTCAAGGAGAGGAAGAGATA	0.393																																							uc001aor.2		NA																	0					0						c.(64-66)CCT>CCA		urotensin 2 isoform b preproprotein							84.0	91.0	89.0					1																	7912998		2203	4300	6503	SO:0001819	synonymous_variant	10911				muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity	g.chr1:7912998A>T	AF104118	CCDS90.1, CCDS91.1	1p36	2013-02-28			ENSG00000049247	ENSG00000049247		"""Endogenous ligands"""	12636	protein-coding gene	gene with protein product	"""prepro U-II"""	604097				9861051, 10499587	Standard	NM_021995		Approved	UII, U-II, UCN2, PRO1068	uc001aos.3	O95399	OTTHUMG00000001218	ENST00000361696.5:c.66T>A	1.37:g.7912998A>T			Somatic				UTS2_uc001aoq.2_Silent_p.P22P|UTS2_uc001aos.2_Intron	p.P22P	NM_006786	NP_006777	WXS	Illumina HiSeq	Unspecified	O95399	UTS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)	1	107	-	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	22					Q5H8X7|Q6UXF6|Q9UKP7	Silent	SNP	ENST00000361696.5	37	c.66T>A	CCDS91.1																																																																																				0.393	UTS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003612.1	NM_006786		11	41	0	0	0	0.016723	0	11	41				
IL22RA1	58985	broad.mit.edu	37	1	24460774	24460774	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:24460774C>G	ENST00000270800.1	-	4	496	c.458G>C	c.(457-459)cGg>cCg	p.R153P		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	153	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)	p.R153L(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		CAGGGTTAGCCGGTGGCCATC	0.522																																							uc001biq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(457-459)CGG>CCG		interleukin 22 receptor, alpha 1 precursor							112.0	95.0	101.0					1																	24460774		2203	4300	6503	SO:0001583	missense	58985					integral to membrane	interferon receptor activity	g.chr1:24460774C>G	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.458G>C	1.37:g.24460774C>G	ENSP00000270800:p.Arg153Pro		Somatic				IL22RA1_uc010oeg.1_Missense_Mutation_p.R45P|IL22RA1_uc009vrb.1_Missense_Mutation_p.R17P|IL22RA1_uc010oeh.1_Missense_Mutation_p.R153P	p.R153P	NM_021258	NP_067081	WXS	Illumina HiSeq	Unspecified	Q8N6P7	I22R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)	4	497	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	153			Extracellular (Potential).|Fibronectin type-III 2.		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	c.458G>C	CCDS247.1	.	.	.	.	.	.	.	.	.	.	C	2.478	-0.320396	0.05386	.	.	ENSG00000142677	ENST00000270800	T	0.42131	0.98	4.98	-9.97	0.00440	Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	1.278620	0.05486	N	0.555755	T	0.20047	0.0482	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.15435	-1.0437	10	0.19590	T	0.45	-10.7396	9.9978	0.41909	0.0:0.1081:0.1068:0.785	.	45;153	B4E2V9;Q8N6P7	.;I22R1_HUMAN	P	153	ENSP00000270800:R153P	ENSP00000270800:R153P	R	-	2	0	IL22RA1	24333361	0.001000	0.12720	0.007000	0.13788	0.001000	0.01503	-2.265000	0.01172	-1.682000	0.01446	-2.320000	0.00252	CGG		0.522	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			18	38	0	0	0	0.012319	0	18	38				
INADL	10207	broad.mit.edu	37	1	62613980	62613980	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:62613980G>T	ENST00000371158.2	+	42	5410	c.5296G>T	c.(5296-5298)Gcc>Tcc	p.A1766S		NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1766					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						CAATATAAGCGCCATAGCAGC	0.433																																							uc001dab.2		NA																	0				ovary(3)|skin(1)	4						c.(5296-5298)GCC>TCC		InaD-like							149.0	140.0	143.0					1																	62613980		1891	4120	6011	SO:0001583	missense	10207				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding	g.chr1:62613980G>T	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.5296G>T	1.37:g.62613980G>T	ENSP00000360200:p.Ala1766Ser		Somatic				INADL_uc001dac.2_RNA|INADL_uc009wag.2_Missense_Mutation_p.A550S	p.A1766S	NM_176877	NP_795352	WXS	Illumina HiSeq	Unspecified	Q8NI35	INADL_HUMAN			42	5410	+			1766					O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	c.5296G>T	CCDS617.2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277987	0.80692	.	.	ENSG00000132849	ENST00000371158	T	0.11385	2.78	5.46	5.46	0.80206	PDZ/DHR/GLGF (1);	0.155412	0.43747	D	0.000532	T	0.19604	0.0471	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	P	0.62491	0.903	T	0.04579	-1.0941	10	0.09338	T	0.73	.	19.2998	0.94140	0.0:0.0:1.0:0.0	.	1766	Q8NI35	INADL_HUMAN	S	1766	ENSP00000360200:A1766S	ENSP00000360200:A1766S	A	+	1	0	INADL	62386568	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	6.637000	0.74304	2.549000	0.85964	0.655000	0.94253	GCC		0.433	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		22	51	1	0	3.28513e-13	0.021523	4.33805e-13	22	51				
DNASE2B	58511	broad.mit.edu	37	1	84880520	84880520	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:84880520G>A	ENST00000370665.3	+	6	1088	c.1055G>A	c.(1054-1056)gGa>gAa	p.G352E	DNASE2B_ENST00000370662.3_Missense_Mutation_p.G144E	NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	352					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		GCATTTCAAGGATTAGTATTA	0.393																																					Pancreas(54;788 1175 11852 16034 30034)	Pancreas(54;788 1175 11852 16034 30034)	uc001djt.1		NA																	0					0						c.(1054-1056)GGA>GAA	Direct_reversal_of_damage	deoxyribonuclease II beta isoform 1 precursor							44.0	43.0	43.0					1																	84880520		2203	4300	6503	SO:0001583	missense	58511				DNA metabolic process	lysosome	deoxyribonuclease II activity	g.chr1:84880520G>A	AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.1055G>A	1.37:g.84880520G>A	ENSP00000359699:p.Gly352Glu		Somatic				DNASE2B_uc001dju.1_Missense_Mutation_p.G144E|DNASE2B_uc009wch.1_Missense_Mutation_p.G144E	p.G352E	NM_021233	NP_067056	WXS	Illumina HiSeq	Unspecified	Q8WZ79	DNS2B_HUMAN		all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)	6	1088	+			352					Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Missense_Mutation	SNP	ENST00000370665.3	37	c.1055G>A	CCDS44167.1	.	.	.	.	.	.	.	.	.	.	G	0.069	-1.205482	0.01568	.	.	ENSG00000137976	ENST00000370665;ENST00000370662	T;T	0.12569	2.67;2.67	5.28	3.38	0.38709	.	0.980022	0.08417	N	0.948889	T	0.02342	0.0072	L	0.38175	1.15	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.45948	-0.9226	10	0.02654	T	1	-6.5854	5.8769	0.18834	0.2857:0.1313:0.583:0.0	.	352	Q8WZ79	DNS2B_HUMAN	E	352;144	ENSP00000359699:G352E;ENSP00000359696:G144E	ENSP00000359696:G144E	G	+	2	0	DNASE2B	84653108	0.003000	0.15002	0.358000	0.25811	0.889000	0.51656	1.035000	0.30216	0.771000	0.33359	0.655000	0.94253	GGA		0.393	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027248.1	NM_021233		4	14	0	0	0	0.009096	0	4	14				
OR6K3	391114	broad.mit.edu	37	1	158687501	158687501	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:158687501G>A	ENST00000368146.1	-	1	452	c.453C>T	c.(451-453)atC>atT	p.I151I	OR6K3_ENST00000368145.1_Silent_p.I135I			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GGGGGGTCATGATCATTTGAT	0.498																																							uc010pip.1		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(451-453)ATC>ATT		olfactory receptor, family 6, subfamily K,							93.0	101.0	98.0					1																	158687501		2203	4300	6503	SO:0001819	synonymous_variant	391114				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158687501G>A	AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.453C>T	1.37:g.158687501G>A			Somatic					p.I151I	NM_001005327	NP_001005327	WXS	Illumina HiSeq	Unspecified	Q8NGY3	OR6K3_HUMAN			1	453	-	all_hematologic(112;0.0378)		151			Cytoplasmic (Potential).		Q5VUV0|Q6IFR5	Silent	SNP	ENST00000368146.1	37	c.453C>T																																																																																					0.498	OR6K3-201	KNOWN	basic	protein_coding	protein_coding				26	62	0	0	0	0.034045	0	26	62				
PBX1	5087	broad.mit.edu	37	1	164768988	164768988	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:164768988G>T	ENST00000420696.2	+	4	751	c.563G>T	c.(562-564)cGg>cTg	p.R188L	PBX1_ENST00000367897.1_Missense_Mutation_p.R188L|PBX1_ENST00000540246.1_Missense_Mutation_p.R83L|PBX1_ENST00000540236.1_Missense_Mutation_p.R188L|PBX1_ENST00000401534.1_Missense_Mutation_p.R188L|PBX1_ENST00000560641.1_Missense_Mutation_p.R83L|PBX1_ENST00000559240.1_Missense_Mutation_p.R188L	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	188					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GAGCAAAGCCGGACCAGGCCC	0.567			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																		uc001gct.2		NA		Dom	yes		1	1q23	5087	T	pre-B-cell leukemia transcription factor 1			"""L, M"""	TCF3|EWSR1		pre B-ALL|myoepithelioma	EWSR1/PBX1(3)	0				soft_tissue(3)|lung(1)|skin(1)	5						c.(562-564)CGG>CTG		pre-B-cell leukemia homeobox 1							95.0	82.0	86.0					1																	164768988		2203	4300	6503	SO:0001583	missense	5087				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:164768988G>T	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.563G>T	1.37:g.164768988G>T	ENSP00000405890:p.Arg188Leu		Somatic				PBX1_uc010pku.1_Missense_Mutation_p.R188L|PBX1_uc010pkv.1_Missense_Mutation_p.R105L|PBX1_uc001gcs.2_Missense_Mutation_p.R188L|PBX1_uc010pkw.1_Missense_Mutation_p.R78L	p.R188L	NM_002585	NP_002576	WXS	Illumina HiSeq	Unspecified	P40424	PBX1_HUMAN			4	821	+			188					B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	c.563G>T	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	35	5.525358	0.96431	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	5.76	5.76	0.90799	PBX (1);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.85299	2.745	0.80722	D	1	P;D;D;D;D	0.69078	0.887;0.989;0.973;0.997;0.978	P;D;P;D;P	0.74348	0.73;0.963;0.875;0.983;0.898	T	0.65010	-0.6272	10	0.62326	D	0.03	-13.2983	19.571	0.95419	0.0:0.0:1.0:0.0	.	83;188;188;188;188	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	L	188;188;188;188;83	ENSP00000405890:R188L;ENSP00000356872:R188L;ENSP00000439943:R188L;ENSP00000384856:R188L;ENSP00000440869:R83L	ENSP00000356872:R188L	R	+	2	0	PBX1	163035612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	2.713000	0.92767	0.655000	0.94253	CGG		0.567	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585		16	39	1	0	0.000566183	0.0333	0.000589059	16	39				
SELL	6402	broad.mit.edu	37	1	169677576	169677577	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:169677576_169677577CC>AA	ENST00000236147.4	-	3	652_653	c.492_493GG>TT	c.(490-495)aaGGca>aaTTca	p.164_165KA>NS	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	151	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					CAGAGGGCTGCCTTTAGTTTGT	0.49																																							uc001ggk.2		NA																	0					0						c.(451-456)AAGGCA>AATTCA		selectin L precursor																																				SO:0001583	missense	6402				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding	g.chr1:169677576_169677577CC>AA	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.492_493delinsAA	1.37:g.169677576_169677577delinsAA	ENSP00000236147:p.K164_A165delinsNS		Somatic				C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Missense_Mutation_p.104_105KA>NS|SELL_uc001ggl.1_Missense_Mutation_p.164_165KA>NS	p.151_152KA>NS	NM_000655	NP_000646	WXS	Illumina HiSeq	Unspecified	P14151	LYAM1_HUMAN			3	651_652	-	all_hematologic(923;0.208)		151_152			C-type lectin.|Extracellular (Potential).		B2R6Q8|P15023|Q9UJ43	Missense_Mutation	DNP	ENST00000236147.4	37	c.453_454GG>TT	CCDS53427.1																																																																																				0.490	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655		23	41	0	0	0	0.004672	0	23	41				
CFHR2	3080	broad.mit.edu	37	1	196927176	196927176	+	Missense_Mutation	SNP	C	C	G	rs372276827		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:196927176C>G	ENST00000367415.5	+	4	686	c.586C>G	c.(586-588)Caa>Gaa	p.Q196E	CFHR2_ENST00000367421.3_Missense_Mutation_p.Q196E|CFHR2_ENST00000476712.2_Missense_Mutation_p.Q180E|CFHR2_ENST00000496448.1_3'UTR	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	196	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TAGAAACGGACAATGGTCAGA	0.368																																							uc001gtq.1		NA																	0				skin(2)|ovary(1)	3						c.(586-588)CAA>GAA		H factor (complement)-like 3 precursor							172.0	156.0	161.0					1																	196927176		2203	4300	6503	SO:0001583	missense	3080					extracellular region		g.chr1:196927176C>G	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.586C>G	1.37:g.196927176C>G	ENSP00000356385:p.Gln196Glu		Somatic				CFHR2_uc001gtr.1_Missense_Mutation_p.Q72E	p.Q196E	NM_005666	NP_005657	WXS	Illumina HiSeq	Unspecified	P36980	FHR2_HUMAN			4	663	+			196			Sushi 3.		Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367415.5	37	c.586C>G	CCDS30959.1	.	.	.	.	.	.	.	.	.	.	.	0.044	-1.272106	0.01421	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	T;T	0.63744	-0.06;-0.06	4.0	-8.01	0.01122	Complement control module (2);Sushi/SCR/CCP (3);	2.087720	0.02951	N	0.141774	T	0.28267	0.0698	N	0.04724	-0.175	0.09310	N	1	B;B	0.12013	0.0;0.005	B;B	0.09377	0.001;0.004	T	0.38023	-0.9680	10	0.02654	T	1	.	3.0277	0.06096	0.4467:0.239:0.2275:0.0868	.	169;196	P36980-2;P36980	.;FHR2_HUMAN	E	196	ENSP00000356391:Q196E;ENSP00000356385:Q196E	ENSP00000356385:Q196E	Q	+	1	0	CFHR2	195193799	0.000000	0.05858	0.244000	0.24202	0.170000	0.22686	-1.876000	0.01633	-1.966000	0.01009	0.511000	0.50034	CAA		0.368	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2	NM_005666		17	45	0	0	0	0.008871	0	17	45				
PRELP	5549	broad.mit.edu	37	1	203452824	203452824	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:203452824G>T	ENST00000343110.2	+	2	639	c.512G>T	c.(511-513)cGg>cTg	p.R171L		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	171					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GCCCTGCCCCGGAACCTGGAG	0.597																																							uc001gzs.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(511-513)CGG>CTG		proline arginine-rich end leucine-rich repeat							68.0	74.0	72.0					1																	203452824		2203	4300	6503	SO:0001583	missense	5549				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent	g.chr1:203452824G>T	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.512G>T	1.37:g.203452824G>T	ENSP00000343924:p.Arg171Leu		Somatic				PRELP_uc001gzt.2_Missense_Mutation_p.R171L	p.R171L	NM_002725	NP_002716	WXS	Illumina HiSeq	Unspecified	P51888	PRELP_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		2	712	+			171			LRR 4.		Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	c.512G>T	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395223	0.42512	.	.	ENSG00000188783	ENST00000343110	T	0.58940	0.3	4.59	-3.04	0.05412	.	0.412872	0.22755	N	0.056021	T	0.41166	0.1147	L	0.29908	0.895	0.28000	N	0.935317	B	0.21225	0.053	B	0.34093	0.175	T	0.34725	-0.9817	10	0.45353	T	0.12	-12.1321	6.3515	0.21379	0.3738:0.3942:0.232:0.0	.	171	P51888	PRELP_HUMAN	L	171	ENSP00000343924:R171L	ENSP00000343924:R171L	R	+	2	0	PRELP	201719447	0.000000	0.05858	0.813000	0.32504	0.931000	0.56810	0.318000	0.19504	-0.579000	0.05952	-0.369000	0.07265	CGG		0.597	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725		28	56	1	0	1.74807e-11	0.010818	2.19575e-11	28	56				
ATP2B4	493	broad.mit.edu	37	1	203708726	203708726	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:203708726C>G	ENST00000357681.5	+	21	4485	c.3362C>G	c.(3361-3363)cCc>cGc	p.P1121R	ATP2B4_ENST00000341360.2_3'UTR|ATP2B4_ENST00000367218.3_3'UTR|ATP2B4_ENST00000391954.2_3'UTR|ATP2B4_ENST00000367219.3_3'UTR	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1157					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATTCAGAAACCCTACAACCAA	0.483																																							uc001gzw.2		NA																	0				ovary(2)|skin(1)	3						c.(3361-3363)CCC>CGC		plasma membrane calcium ATPase 4 isoform 4b							129.0	123.0	125.0					1																	203708726		2203	4300	6503	SO:0001583	missense	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203708726C>G	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3362C>G	1.37:g.203708726C>G	ENSP00000350310:p.Pro1121Arg		Somatic				ATP2B4_uc001gzv.2_3'UTR|ATP2B4_uc001gzx.2_Missense_Mutation_p.P188R|ATP2B4_uc009xar.2_3'UTR	p.P1121R	NM_001684	NP_001675	WXS	Illumina HiSeq	Unspecified	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		21	4246	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		1157			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	c.3362C>G	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.479635	0.44044	.	.	ENSG00000058668	ENST00000357681	T	0.77750	-1.12	5.36	4.45	0.53987	.	1.045460	0.07572	N	0.918782	T	0.75620	0.3874	L	0.52905	1.665	0.80722	D	1	B	0.18013	0.025	B	0.26416	0.069	T	0.58120	-0.7692	10	0.15066	T	0.55	-5.8599	13.6685	0.62409	0.0:0.9246:0.0:0.0754	.	1121	P23634-6	.	R	1121	ENSP00000350310:P1121R	ENSP00000350310:P1121R	P	+	2	0	ATP2B4	201975349	1.000000	0.71417	0.972000	0.41901	0.488000	0.33401	6.084000	0.71335	1.276000	0.44395	0.655000	0.94253	CCC		0.483	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396		16	51	0	0	0	0.008871	0	16	51				
PIK3C2B	5287	broad.mit.edu	37	1	204415219	204415219	+	Missense_Mutation	SNP	G	G	A	rs368714819		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:204415219G>A	ENST00000367187.3	-	17	3099	c.2543C>T	c.(2542-2544)tCg>tTg	p.S848L	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.S848L	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	848	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GCTCACCTCCGAGTGGCAGTA	0.622											OREG0014135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0014	5008	,	,		19740	0.0		0.0	False		,,,				2504	0.0						uc001haw.2		NA																	0				lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.(2542-2544)TCG>TTG		phosphoinositide-3-kinase, class 2 beta							57.0	57.0	57.0					1																	204415219		2203	4300	6503	SO:0001583	missense	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204415219G>A	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2543C>T	1.37:g.204415219G>A	ENSP00000356155:p.Ser848Leu		Somatic	OREG0014135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2144	PIK3C2B_uc010pqv.1_Missense_Mutation_p.S848L	p.S848L	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		17	3022	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		848					O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	c.2543C>T	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.468953	0.43839	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.64438	-0.1;-0.1	5.51	5.51	0.81932	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.811425	0.11354	N	0.572627	T	0.51449	0.1675	N	0.25426	0.745	0.09310	N	1	B;B	0.26120	0.001;0.142	B;B	0.25140	0.003;0.058	T	0.38993	-0.9635	10	0.32370	T	0.25	.	13.9798	0.64297	0.0:0.0:0.8483:0.1517	.	848;848	F5GWN5;O00750	.;P3C2B_HUMAN	L	848	ENSP00000356155:S848L;ENSP00000400561:S848L	ENSP00000356155:S848L	S	-	2	0	PIK3C2B	202681842	0.001000	0.12720	0.967000	0.41034	0.964000	0.63967	0.956000	0.29202	2.618000	0.88619	0.460000	0.39030	TCG		0.622	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		27	51	0	0	0	0.012213	0	27	51				
ZNF670	93474	broad.mit.edu	37	1	247202725	247202725	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:247202725G>A	ENST00000366503.2	-	2	276	c.118C>T	c.(118-120)Ctg>Ttg	p.L40L		NM_001204220.1|NM_033213.4	NP_001191149.1|NP_149990.1	Q9BS34	ZN670_HUMAN	zinc finger protein 670	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ACAGAAGCCAGGTTCCTGAAG	0.463																																							uc001icd.1		NA																	0				ovary(1)	1						c.(118-120)CTG>TTG		zinc finger protein 670							105.0	99.0	101.0					1																	247202725		2203	4300	6503	SO:0001819	synonymous_variant	93474				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:247202725G>A		CCDS31087.1	1q44	2013-01-08			ENSG00000135747	ENSG00000135747		"""Zinc fingers, C2H2-type"", ""-"""	28167	protein-coding gene	gene with protein product						12477932	Standard	NM_033213		Approved	MGC12466	uc001icd.2	Q9BS34	OTTHUMG00000040868	ENST00000366503.2:c.118C>T	1.37:g.247202725G>A			Somatic				ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	p.L40L	NM_033213	NP_149990	WXS	Illumina HiSeq	Unspecified	Q9BS34	ZN670_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00427)		2	289	-	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	40			KRAB.			Silent	SNP	ENST00000366503.2	37	c.118C>T	CCDS31087.1																																																																																				0.463	ZNF670-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098183.3	NM_033213		16	33	0	0	0	0.008871	0	16	33				
OR2M5	127059	broad.mit.edu	37	1	248308974	248308974	+	Silent	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:248308974C>A	ENST00000366476.1	+	1	525	c.525C>A	c.(523-525)gcC>gcA	p.A175A		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GGGAAATAGCCCACTTCTTCT	0.428																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(523-525)GCC>GCA		olfactory receptor, family 2, subfamily M,							292.0	275.0	281.0					1																	248308974		2203	4298	6501	SO:0001819	synonymous_variant	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308974C>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.525C>A	1.37:g.248308974C>A			Somatic					p.A175A	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	525	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		175			Extracellular (Potential).			Silent	SNP	ENST00000366476.1	37	c.525C>A	CCDS31105.1																																																																																				0.428	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		53	174	1	0	3.45129e-13	0.01441	4.49978e-13	53	174				
A1CF	29974	broad.mit.edu	37	10	52601733	52601733	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr10:52601733A>T	ENST00000373993.1	-	3	298	c.254T>A	c.(253-255)aTg>aAg	p.M85K	A1CF_ENST00000282641.2_Missense_Mutation_p.M85K|A1CF_ENST00000395495.1_Missense_Mutation_p.M85K|A1CF_ENST00000373997.3_Missense_Mutation_p.M85K|A1CF_ENST00000395489.2_Missense_Mutation_p.M78K|A1CF_ENST00000373995.3_Missense_Mutation_p.M93K|A1CF_ENST00000374001.2_Missense_Mutation_p.M85K			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	85	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						CATCATTCTCATTTCATAAAT	0.303																																							uc001jjj.2		NA																	0				central_nervous_system(1)	1						c.(253-255)ATG>AAG		apobec-1 complementation factor isoform 2							117.0	112.0	114.0					10																	52601733		2202	4299	6501	SO:0001583	missense	29974				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:52601733A>T	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.254T>A	10.37:g.52601733A>T	ENSP00000363105:p.Met85Lys		Somatic				A1CF_uc010qhn.1_Missense_Mutation_p.M93K|A1CF_uc001jji.2_Missense_Mutation_p.M85K|A1CF_uc001jjh.2_Missense_Mutation_p.M93K|A1CF_uc010qho.1_Missense_Mutation_p.M93K|A1CF_uc009xov.2_Missense_Mutation_p.M85K|A1CF_uc001jjk.1_Missense_Mutation_p.M85K	p.M85K	NM_138932	NP_620310	WXS	Illumina HiSeq	Unspecified	Q9NQ94	A1CF_HUMAN			5	442	-			85			RRM 1.		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	c.254T>A	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.729453	0.69074	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39;2.39;2.39;2.39	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.080948	0.85682	D	0.000000	T	0.19525	0.0469	L	0.35854	1.095	0.58432	D	0.999997	B;B;B;B	0.34372	0.451;0.072;0.125;0.446	B;B;B;B	0.39660	0.113;0.18;0.043;0.306	T	0.02339	-1.1174	10	0.87932	D	0	-8.8418	14.0338	0.64632	1.0:0.0:0.0:0.0	.	78;85;85;93	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	K	85;85;85;93;85;85;68;78;85	ENSP00000363113:M85K;ENSP00000363105:M85K;ENSP00000363109:M85K;ENSP00000363107:M93K;ENSP00000282641:M85K;ENSP00000378873:M85K;ENSP00000378868:M78K;ENSP00000397953:M85K	ENSP00000282641:M85K	M	-	2	0	A1CF	52271739	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.866000	0.92307	2.206000	0.71126	0.383000	0.25322	ATG		0.303	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576		5	8	0	0	0	0.014758	0	5	8				
KCNMA1	3778	broad.mit.edu	37	10	78771737	78771737	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr10:78771737C>A	ENST00000286628.8	-	18	2079	c.2080G>T	c.(2080-2082)Ggc>Tgc	p.G694C	KCNMA1_ENST00000404857.1_Missense_Mutation_p.G694C|KCNMA1_ENST00000406533.3_Missense_Mutation_p.G698C|KCNMA1_ENST00000354353.5_Missense_Mutation_p.G694C|KCNMA1_ENST00000372440.1_Missense_Mutation_p.G694C|KCNMA1_ENST00000286627.5_Missense_Mutation_p.G694C|KCNMA1_ENST00000372443.1_Missense_Mutation_p.G694C|KCNMA1_ENST00000404771.3_Missense_Mutation_p.G694C	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	694					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CGTTTGCAGCCACATTTTTTT	0.413																																							uc001jxn.2		NA																	0				pancreas(2)|ovary(1)	3						c.(2080-2082)GGC>TGC		large conductance calcium-activated potassium	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)						140.0	130.0	133.0					10																	78771737		2203	4300	6503	SO:0001583	missense	3778				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity	g.chr10:78771737C>A	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2080G>T	10.37:g.78771737C>A	ENSP00000286628:p.Gly694Cys		Somatic				KCNMA1_uc001jxj.2_Missense_Mutation_p.G698C|KCNMA1_uc001jxk.1_Missense_Mutation_p.G309C|KCNMA1_uc009xrt.1_Missense_Mutation_p.G514C|KCNMA1_uc001jxl.1_Missense_Mutation_p.G348C|KCNMA1_uc001jxo.2_Missense_Mutation_p.G694C|KCNMA1_uc001jxm.2_Missense_Mutation_p.G694C|KCNMA1_uc001jxq.2_Missense_Mutation_p.G694C	p.G694C	NM_001161352	NP_001154824	WXS	Illumina HiSeq	Unspecified	Q12791	KCMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		18	2257	-	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		694			Cytoplasmic (Potential).		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37	c.2080G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.800577|4.800577	0.90538|0.90538	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208;ENST00000450795	D;D;D;D;D;D;D;D;D|.	0.84223|.	-1.8;-1.8;-1.76;-1.78;-1.82;-1.8;-1.79;-1.8;-1.8|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.154659|.	0.56097|.	D|.	0.000021|.	T|T	0.69762|0.69762	0.3147|0.3147	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	D;P;P;P;P;P;P;P|.	0.56746|.	0.977;0.837;0.777;0.837;0.949;0.669;0.948;0.837|.	P;P;P;P;P;P;P;P|.	0.58172|.	0.834;0.592;0.556;0.592;0.556;0.469;0.669;0.474|.	T|T	0.64537|0.64537	-0.6384|-0.6384	10|5	0.72032|.	D|.	0.01|.	-14.8144|-14.8144	19.8016|19.8016	0.96509|0.96509	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	694;694;694;694;694;476;694;694|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.;.;.|.	C|L	694;631;629;668;631;694;694;668;698;694;694;476|682;372;186	ENSP00000361517:G694C;ENSP00000361485:G631C;ENSP00000361514:G629C;ENSP00000396608:G668C;ENSP00000361520:G694C;ENSP00000286627:G694C;ENSP00000385552:G698C;ENSP00000346321:G694C;ENSP00000385806:G694C|.	ENSP00000286627:G694C|.	G|W	-|-	1|2	0|0	KCNMA1|KCNMA1	78441743|78441743	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.677000|2.677000	0.91161|0.91161	0.655000|0.655000	0.94253|0.94253	GGC|TGG		0.413	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247		8	29	1	0	0.00829132	0.008291	0.0084555	8	29				
LGI1	9211	broad.mit.edu	37	10	95549922	95549922	+	Silent	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr10:95549922A>T	ENST00000371418.4	+	5	758	c.498A>T	c.(496-498)acA>acT	p.T166T	LGI1_ENST00000542308.1_Silent_p.T118T|LGI1_ENST00000371413.3_Silent_p.T166T	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	166					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				ATTCTTTAACAAATGTGTAAG	0.318																																							uc001kjc.3		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(496-498)ACA>ACT		leucine-rich, glioma inactivated 1 precursor							44.0	48.0	47.0					10																	95549922		2203	4298	6501	SO:0001819	synonymous_variant	9211				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding	g.chr10:95549922A>T	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.498A>T	10.37:g.95549922A>T			Somatic				LGI1_uc010qnv.1_Silent_p.T118T|LGI1_uc001kjd.3_Silent_p.T166T|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_RNA	p.T166T	NM_005097	NP_005088	WXS	Illumina HiSeq	Unspecified	O95970	LGI1_HUMAN			5	834	+		Colorectal(252;0.124)	166					A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Silent	SNP	ENST00000371418.4	37	c.498A>T	CCDS7431.1																																																																																				0.318	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097		5	11	0	0	0	0.02938	0	5	11				
TCTN3	26123	broad.mit.edu	37	10	97442454	97442454	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr10:97442454T>A	ENST00000371217.5	-	12	1429	c.1406A>T	c.(1405-1407)cAg>cTg	p.Q469L	TCTN3_ENST00000430368.2_Missense_Mutation_p.Q321L|TCTN3_ENST00000265993.9_Missense_Mutation_p.Q487L			Q6NUS6	TECT3_HUMAN	tectonic family member 3	469					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		CCCTCCTTTCTGGGCTGGGTC	0.468																																							uc001klb.3		NA																	0					0						c.(1405-1407)CAG>CTG		tectonic 3 isoform a precursor							180.0	174.0	176.0					10																	97442454		2203	4300	6503	SO:0001583	missense	26123				apoptosis	integral to membrane		g.chr10:97442454T>A	AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.1406A>T	10.37:g.97442454T>A	ENSP00000360261:p.Gln469Leu		Somatic				TCTN3_uc001kla.3_Missense_Mutation_p.Q313L|TCTN3_uc010qoi.1_Missense_Mutation_p.Q321L	p.Q469L	NM_015631	NP_056446	WXS	Illumina HiSeq	Unspecified	Q6NUS6	TECT3_HUMAN		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)	12	1650	-		Colorectal(252;0.0815)	469			Extracellular (Potential).		A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Missense_Mutation	SNP	ENST00000371217.5	37	c.1406A>T	CCDS31258.2	.	.	.	.	.	.	.	.	.	.	T	15.45	2.835927	0.50951	.	.	ENSG00000119977	ENST00000265993;ENST00000430368;ENST00000371217;ENST00000343162	D	0.82893	-1.66	5.64	4.49	0.54785	.	0.294015	0.33199	N	0.005166	D	0.83995	0.5375	M	0.77820	2.39	0.33294	D	0.563861	D;P;P	0.54207	0.965;0.651;0.897	P;B;P	0.50049	0.629;0.165;0.548	D	0.85257	0.1048	10	0.22109	T	0.4	-26.3314	8.639	0.33966	0.0:0.0891:0.0:0.9109	.	321;469;291	B4DR81;Q6NUS6;Q6NUS6-3	.;TECT3_HUMAN;.	L	469;321;487;291	ENSP00000265993:Q469L	ENSP00000265993:Q469L	Q	-	2	0	TCTN3	97432444	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	2.066000	0.41452	2.148000	0.66965	0.460000	0.39030	CAG		0.468	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000471858.1	NM_015631		44	90	0	0	0	0.01441	0	44	90				
PDZD8	118987	broad.mit.edu	37	10	119043640	119043640	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr10:119043640C>T	ENST00000334464.5	-	5	2843	c.2604G>A	c.(2602-2604)caG>caA	p.Q868Q	PDZD8_ENST00000482496.1_5'Flank	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	868					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		AAAACATACACTGGGAAGCTG	0.393																																							uc001lde.1		NA																	0					0						c.(2602-2604)CAG>CAA		PDZ domain containing 8							83.0	83.0	83.0					10																	119043640		2203	4300	6503	SO:0001819	synonymous_variant	118987				intracellular signal transduction		metal ion binding	g.chr10:119043640C>T	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2604G>A	10.37:g.119043640C>T			Somatic					p.Q868Q	NM_173791	NP_776152	WXS	Illumina HiSeq	Unspecified	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2803	-		Colorectal(252;0.19)	868			Phorbol-ester/DAG-type.		Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	37	c.2604G>A	CCDS7600.1																																																																																				0.393	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		14	35	0	0	0	0.007413	0	14	35				
OR5AS1	219447	broad.mit.edu	37	11	55797982	55797982	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:55797982G>T	ENST00000313555.1	+	1	88	c.88G>T	c.(88-90)Gta>Tta	p.V30L		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					ACTGTTCTTGGTATTCCTTCT	0.328																																							uc010riw.1		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(88-90)GTA>TTA		olfactory receptor, family 5, subfamily AS,							89.0	87.0	88.0					11																	55797982		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55797982G>T	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.88G>T	11.37:g.55797982G>T	ENSP00000324111:p.Val30Leu		Somatic					p.V30L	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	88	+	Esophageal squamous(21;0.00693)		30			Helical; Name=1; (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.88G>T	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.779963	0.00634	.	.	ENSG00000181785	ENST00000313555	T	0.00682	5.86	5.74	-3.83	0.04269	.	0.286393	0.18629	U	0.135627	T	0.00328	0.0010	N	0.05078	-0.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44787	-0.9305	10	0.05436	T	0.98	.	2.7732	0.05340	0.1892:0.0841:0.364:0.3626	.	30	Q8N127	O5AS1_HUMAN	L	30	ENSP00000324111:V30L	ENSP00000324111:V30L	V	+	1	0	OR5AS1	55554558	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-1.917000	0.01575	-0.447000	0.07138	-0.148000	0.13756	GTA		0.328	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		7	17	1	0	3.09899e-07	0.004482	3.54662e-07	7	17				
CPSF7	79869	broad.mit.edu	37	11	61183946	61183946	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:61183946T>A	ENST00000394888.4	-	6	768	c.596A>T	c.(595-597)gAt>gTt	p.D199V	CPSF7_ENST00000448745.1_Missense_Mutation_p.D190V|CPSF7_ENST00000439958.3_Missense_Mutation_p.D190V|CPSF7_ENST00000340437.4_Missense_Mutation_p.D242V	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	199					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GGCCCGTCCATCAGCAGAATC	0.537																																							uc001nrq.2		NA																	0				central_nervous_system(1)	1						c.(595-597)GAT>GTT		pre-mRNA cleavage factor I, 59 kDa subunit							99.0	96.0	97.0					11																	61183946		2202	4299	6501	SO:0001583	missense	79869				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding	g.chr11:61183946T>A		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.596A>T	11.37:g.61183946T>A	ENSP00000378352:p.Asp199Val		Somatic				CPSF7_uc001nro.2_Missense_Mutation_p.D190V|CPSF7_uc001nrp.2_Missense_Mutation_p.D242V|CPSF7_uc001nrr.2_Missense_Mutation_p.D190V|CPSF7_uc001nrs.1_Missense_Mutation_p.D100V	p.D199V	NM_001136040	NP_001129512	WXS	Illumina HiSeq	Unspecified	Q8N684	CPSF7_HUMAN			6	730	-			199					B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	c.596A>T	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.425381	0.83667	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000477890;ENST00000539952;ENST00000544585;ENST00000413232	.	.	.	5.77	5.77	0.91146	.	0.055117	0.64402	D	0.000002	T	0.66436	0.2789	L	0.38175	1.15	0.80722	D	1	D;D;D;D	0.76494	0.994;0.998;0.999;0.999	D;D;D;D	0.83275	0.99;0.99;0.996;0.996	T	0.61715	-0.7006	9	0.21540	T	0.41	-4.8509	15.7692	0.78152	0.0:0.0:0.0:1.0	.	190;199;242;190	B4DGF8;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	V	242;199;190;190;190;190;190;190	.	ENSP00000345412:D242V	D	-	2	0	CPSF7	60940522	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.822000	0.69265	2.199000	0.70637	0.533000	0.62120	GAT		0.537	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811		49	104	0	0	0	0.01441	0	49	104				
FADS3	3995	broad.mit.edu	37	11	61644995	61644995	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:61644995G>A	ENST00000278829.2	-	7	1025	c.873C>T	c.(871-873)tgC>tgT	p.C291C	FADS3_ENST00000540820.1_Silent_p.C291C|FADS3_ENST00000527697.1_Silent_p.C167C|FADS3_ENST00000525588.1_Silent_p.C263C	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	291					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCCACTGCATGCACACCAGCA	0.627																																							uc001nsm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(871-873)TGC>TGT		fatty acid desaturase 3							108.0	92.0	98.0					11																	61644995		2202	4299	6501	SO:0001819	synonymous_variant	3995				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	heme binding|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water	g.chr11:61644995G>A		CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.873C>T	11.37:g.61644995G>A			Somatic				FADS3_uc001nsn.2_Silent_p.C167C	p.C291C	NM_021727	NP_068373	WXS	Illumina HiSeq	Unspecified	Q9Y5Q0	FADS3_HUMAN			7	1026	-			291			Lumenal (Potential).		O60426	Silent	SNP	ENST00000278829.2	37	c.873C>T	CCDS8013.1	.	.	.	.	.	.	.	.	.	.	.	10.90	1.481699	0.26598	.	.	ENSG00000221968	ENST00000527379	.	.	.	5.69	4.78	0.61160	.	.	.	.	.	T	0.59004	0.2162	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57236	-0.7846	4	.	.	.	-15.5308	8.198	0.31409	0.0836:0.1576:0.7588:0.0	.	.	.	.	V	66	.	.	A	-	2	0	FADS3	61401571	0.495000	0.26051	0.998000	0.56505	0.995000	0.86356	1.607000	0.36836	1.415000	0.47037	0.561000	0.74099	GCA		0.627	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394836.1			18	45	0	0	0	0.014323	0	18	45				
PCNXL3	399909	broad.mit.edu	37	11	65397824	65397824	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:65397824A>T	ENST00000355703.3	+	27	4758	c.4219A>T	c.(4219-4221)Act>Tct	p.T1407S		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1407						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTCCACAGGCACTTACTGCCA	0.627																																							uc001oey.2		NA																	0					0						c.(4219-4221)ACT>TCT		pecanex-like 3							28.0	31.0	30.0					11																	65397824		2099	4214	6313	SO:0001583	missense	399909					integral to membrane		g.chr11:65397824A>T	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4219A>T	11.37:g.65397824A>T	ENSP00000347931:p.Thr1407Ser		Somatic				PCNXL3_uc001oez.2_Missense_Mutation_p.T294S	p.T1407S	NM_032223	NP_115599	WXS	Illumina HiSeq	Unspecified	Q9H6A9	PCX3_HUMAN			27	4219	+			1407					Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	c.4219A>T	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.397876	0.83120	.	.	ENSG00000197136	ENST00000355703	T	0.33438	1.41	4.72	4.72	0.59763	.	0.188036	0.45126	D	0.000383	T	0.59649	0.2209	M	0.89715	3.055	0.47698	D	0.999491	D;D	0.63880	0.987;0.993	D;D	0.65443	0.923;0.935	T	0.68648	-0.5353	10	0.87932	D	0	.	12.5226	0.56069	1.0:0.0:0.0:0.0	.	294;1407	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	S	1407	ENSP00000347931:T1407S	ENSP00000347931:T1407S	T	+	1	0	PCNXL3	65154400	1.000000	0.71417	0.971000	0.41717	0.842000	0.47809	8.701000	0.91331	2.131000	0.65755	0.529000	0.55759	ACT		0.627	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		10	27	0	0	0	0.010729	0	10	27				
TENM4	26011	broad.mit.edu	37	11	78380978	78380978	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:78380978C>T	ENST00000278550.7	-	32	6874	c.6412G>A	c.(6412-6414)Gtc>Atc	p.V2138I		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2138					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGGGTCATGACAGCTGTGGTG	0.453																																							uc001ozl.3		NA																	0				ovary(2)|pancreas(2)	4						c.(6412-6414)GTC>ATC		odz, odd Oz/ten-m homolog 4							69.0	66.0	67.0					11																	78380978		2124	4237	6361	SO:0001583	missense	26011				signal transduction	integral to membrane		g.chr11:78380978C>T	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6412G>A	11.37:g.78380978C>T	ENSP00000278550:p.Val2138Ile		Somatic				ODZ4_uc001ozk.3_Missense_Mutation_p.V363I|ODZ4_uc009yvb.1_Missense_Mutation_p.V722I	p.V2138I	NM_001098816	NP_001092286	WXS	Illumina HiSeq	Unspecified	Q6N022	TEN4_HUMAN			32	6875	-			2138			Extracellular (Potential).|YD 15.		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	c.6412G>A	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635991	0.67130	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89552	-2.53;0.9	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.93674	0.7979	M	0.72894	2.215	0.58432	D	0.999998	D	0.64830	0.994	D	0.70716	0.97	D	0.93227	0.6614	9	.	.	.	.	18.1853	0.89791	0.0:1.0:0.0:0.0	.	2138	Q6N022	TEN4_HUMAN	I	2138;602	ENSP00000278550:V2138I;ENSP00000431711:V602I	.	V	-	1	0	ODZ4	78058626	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	7.609000	0.82925	2.597000	0.87782	0.655000	0.94253	GTC		0.453	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			8	28	0	0	0	0.010729	0	8	28				
KLHL1	57626	broad.mit.edu	37	13	70681634	70681634	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr13:70681634G>T	ENST00000377844.4	-	1	957	c.198C>A	c.(196-198)agC>agA	p.S66R	ATXN8OS_ENST00000414504.2_RNA|ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'UTR	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	66	Ser-rich.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCCAGAAAGTGCTCACACCGC	0.592																																							uc001vip.2		NA																	0					0						c.(196-198)AGC>AGA		kelch-like 1 protein							85.0	93.0	90.0					13																	70681634		2203	4300	6503	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70681634G>T	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.198C>A	13.37:g.70681634G>T	ENSP00000367075:p.Ser66Arg		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.S66R|ATXN8OS_uc010aej.1_RNA	p.S66R	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	1	992	-		Breast(118;0.000162)	66			Ser-rich.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.198C>A	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896731	0.33535	.	.	ENSG00000150361	ENST00000377844	T	0.72505	-0.66	5.19	4.28	0.50868	.	4.515440	0.00357	N	0.000035	T	0.63450	0.2512	N	0.22421	0.69	0.80722	D	1	B;B	0.24823	0.112;0.0	B;B	0.19148	0.024;0.001	T	0.25606	-1.0127	10	0.41790	T	0.15	.	13.604	0.62037	0.0:0.155:0.845:0.0	.	66;66	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	R	66	ENSP00000367075:S66R	ENSP00000367075:S66R	S	-	3	2	KLHL1	69579635	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	2.571000	0.45990	2.435000	0.82474	0.650000	0.86243	AGC		0.592	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		18	45	1	0	1.28384e-07	0.012319	1.48579e-07	18	45				
LIG4	3981	broad.mit.edu	37	13	108862925	108862925	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr13:108862925G>A	ENST00000356922.4	-	2	964	c.692C>T	c.(691-693)cCt>cTt	p.P231L	LIG4_ENST00000442234.1_Missense_Mutation_p.P231L|LIG4_ENST00000405925.1_Missense_Mutation_p.P231L	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	231			P -> S (in dbSNP:rs3093765). {ECO:0000269|Ref.2}.		cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TCCTACAGAAGGATCATGCAG	0.363								Non-homologous end-joining																															uc001vqn.2		NA																	0					0						c.(691-693)CCT>CTT	NHEJ	DNA ligase IV							53.0	51.0	52.0					13																	108862925		2203	4298	6501	SO:0001583	missense	3981				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding	g.chr13:108862925G>A	X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.692C>T	13.37:g.108862925G>A	ENSP00000349393:p.Pro231Leu		Somatic				LIG4_uc001vqo.2_Missense_Mutation_p.P231L|LIG4_uc010agg.1_Missense_Mutation_p.P164L|LIG4_uc010agf.2_Missense_Mutation_p.P231L|LIG4_uc001vqp.2_Missense_Mutation_p.P231L	p.P231L	NM_002312	NP_002303	WXS	Illumina HiSeq	Unspecified	P49917	DNLI4_HUMAN			2	965	-	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)		231					Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	c.692C>T	CCDS9508.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397942	0.62177	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	D;D;D	0.83591	-1.74;-1.74;-1.74	5.68	5.68	0.88126	DNA ligase, ATP-dependent, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82995	0.5158	M	0.78049	2.395	0.80722	D	1	P	0.47484	0.896	B	0.40602	0.334	T	0.81479	-0.0914	10	0.16420	T	0.52	.	18.7665	0.91874	0.0:0.0:1.0:0.0	.	231	P49917	DNLI4_HUMAN	L	231	ENSP00000385955:P231L;ENSP00000402030:P231L;ENSP00000349393:P231L	ENSP00000349393:P231L	P	-	2	0	LIG4	107660926	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	9.394000	0.97261	2.682000	0.91365	0.643000	0.83706	CCT		0.363	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312		4	11	0	0	0	0.009096	0	4	11				
AP5M1	55745	broad.mit.edu	37	14	57752960	57752960	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr14:57752960A>G	ENST00000261558.3	+	7	1719	c.1313A>G	c.(1312-1314)gAt>gGt	p.D438G	AP5M1_ENST00000431972.2_Missense_Mutation_p.D452G	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	438	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											AGGATCTTAGATTACACACTT	0.338																																							uc001xcv.2		NA																	0				ovary(1)	1						c.(1312-1314)GAT>GGT		Mu-2 related death-inducing protein							163.0	159.0	160.0					14																	57752960		2203	4298	6501	SO:0001583	missense	55745				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex		g.chr14:57752960A>G	AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1313A>G	14.37:g.57752960A>G	ENSP00000261558:p.Asp438Gly		Somatic				MUDENG_uc010tri.1_Missense_Mutation_p.D192G|MUDENG_uc010trj.1_Missense_Mutation_p.D335G	p.D438G	NM_018229	NP_060699	WXS	Illumina HiSeq	Unspecified	Q9H0R1	MUDEN_HUMAN			7	1740	+			438			MHD.		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	ENST00000261558.3	37	c.1313A>G	CCDS9729.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.501385	0.85176	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.17854	2.25;2.25	5.65	5.65	0.86999	Clathrin adaptor, mu subunit, C-terminal (3);	0.042538	0.85682	D	0.000000	T	0.33381	0.0861	L	0.43757	1.38	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.01940	-1.1243	10	0.27082	T	0.32	.	15.8539	0.78960	1.0:0.0:0.0:0.0	.	438	Q9H0R1	MUDEN_HUMAN	G	438;452	ENSP00000261558:D438G;ENSP00000390531:D452G	ENSP00000261558:D438G	D	+	2	0	MUDENG	56822713	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.495000	0.90481	2.143000	0.66587	0.477000	0.44152	GAT		0.338	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1	NM_018229		19	33	0	0	0	0.016522	0	19	33				
YLPM1	56252	broad.mit.edu	37	14	75248810	75248810	+	Silent	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr14:75248810G>T	ENST00000552421.1	+	4	2188	c.2064G>T	c.(2062-2064)ccG>ccT	p.P688P	YLPM1_ENST00000325680.7_Silent_p.P688P|YLPM1_ENST00000238571.3_Silent_p.P493P			P49750	YLPM1_HUMAN	YLP motif containing 1	493					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ACCATCCTCCGTTGCAATCAG	0.493																																							uc001xqj.3		NA																	0				ovary(2)|pancreas(1)	3						c.(2062-2064)CCG>CCT		YLP motif containing 1							104.0	100.0	101.0					14																	75248810		1983	4166	6149	SO:0001819	synonymous_variant	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75248810G>T	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.2064G>T	14.37:g.75248810G>T			Somatic				YLPM1_uc001xql.3_RNA	p.P688P	NM_019589	NP_062535	WXS	Illumina HiSeq	Unspecified	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	4	2188	+			493					P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000552421.1	37	c.2064G>T																																																																																					0.493	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589		12	25	1	0	4.3838e-07	0.016723	4.90795e-07	12	25				
SLC24A4	123041	broad.mit.edu	37	14	92922777	92922777	+	Silent	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr14:92922777T>A	ENST00000532405.1	+	12	1306	c.1080T>A	c.(1078-1080)ggT>ggA	p.G360G	SLC24A4_ENST00000351924.5_Silent_p.G324G|SLC24A4_ENST00000556739.1_3'UTR|SLC24A4_ENST00000393265.2_Silent_p.G296G|SLC24A4_ENST00000531433.1_Silent_p.G341G|SLC24A4_ENST00000298877.1_Silent_p.G343G			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	360					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CGGCCAATGGTGTGAGCAGTA	0.527											OREG0022876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(10;315 435 10383 28450 38798)	NSCLC(10;315 435 10383 28450 38798)	uc001yak.2		NA																	0				breast(2)|ovary(1)	3						c.(1027-1029)GGT>GGA		solute carrier family 24 member 4 isoform 1							95.0	74.0	81.0					14																	92922777		2203	4300	6503	SO:0001819	synonymous_variant	123041					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr14:92922777T>A	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1080T>A	14.37:g.92922777T>A			Somatic	OREG0022876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1293	SLC24A4_uc001yai.2_Silent_p.G296G|SLC24A4_uc010twm.1_Silent_p.G341G|SLC24A4_uc001yaj.2_Silent_p.G324G|SLC24A4_uc010auj.2_Silent_p.G232G|SLC24A4_uc010twn.1_Silent_p.G116G|SLC24A4_uc001yan.2_Silent_p.G54G	p.G343G	NM_153646	NP_705932	WXS	Illumina HiSeq	Unspecified	Q8NFF2	NCKX4_HUMAN		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)	12	1053	+		all_cancers(154;0.0347)|all_epithelial(191;0.163)	360			Extracellular (Potential).		B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Silent	SNP	ENST00000532405.1	37	c.1029T>A	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	T	0.896	-0.723729	0.03158	.	.	ENSG00000140090	ENST00000525557	.	.	.	4.81	-9.62	0.00547	.	.	.	.	.	T	0.35451	0.0932	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42378	-0.9455	4	.	.	.	.	3.9588	0.09401	0.3115:0.4369:0.097:0.1546	.	.	.	.	S	226	.	.	C	+	1	0	SLC24A4	91992530	0.001000	0.12720	0.031000	0.17742	0.016000	0.09150	-2.270000	0.01167	-1.965000	0.01010	-0.441000	0.05720	TGT		0.527	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646		17	32	0	0	0	0.006122	0	17	32				
AHNAK2	113146	broad.mit.edu	37	14	105421945	105421945	+	Missense_Mutation	SNP	G	G	A	rs200025024		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr14:105421945G>A	ENST00000333244.5	-	5	460	c.341C>T	c.(340-342)aCg>aTg	p.T114M	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	114	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.T114M(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCTTCAGCGTCACCTCTGT	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19951	0.0		0.0	False		,,,				2504	0.0						uc010axc.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)	1						c.(340-342)ACG>ATG		AHNAK nucleoprotein 2							74.0	81.0	78.0					14																	105421945		2155	4250	6405	SO:0001583	missense	113146					nucleus		g.chr14:105421945G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.341C>T	14.37:g.105421945G>A	ENSP00000353114:p.Thr114Met		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.T14M	p.T114M	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		5	461	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	114			PDZ.		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.341C>T	CCDS45177.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.36	1.614704	0.28712	.	.	ENSG00000185567	ENST00000333244	T	0.03065	4.06	4.72	2.9	0.33743	PDZ/DHR/GLGF (2);	0.163218	0.41294	U	0.000903	T	0.10035	0.0246	M	0.72118	2.19	0.23204	N	0.998123	D	0.65815	0.995	P	0.54100	0.742	T	0.05451	-1.0884	10	0.52906	T	0.07	.	9.6648	0.39977	0.1413:0.0:0.8587:0.0	.	114	Q8IVF2	AHNK2_HUMAN	M	114	ENSP00000353114:T114M	ENSP00000353114:T114M	T	-	2	0	AHNAK2	104492990	0.872000	0.30054	0.741000	0.31004	0.872000	0.50106	1.667000	0.37471	0.617000	0.30160	0.650000	0.86243	ACG		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		35	54	0	0	0	0.010771	0	35	54				
OCA2	4948	broad.mit.edu	37	15	28090122	28090122	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr15:28090122G>A	ENST00000354638.3	-	23	2570	c.2415C>T	c.(2413-2415)tcC>tcT	p.S805S	OCA2_ENST00000353809.5_Silent_p.S781S	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	805					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ATTCCATGAAGGAGAACCCAT	0.358									Oculocutaneous Albinism																														uc001zbh.3		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(2413-2415)TCC>TCT		oculocutaneous albinism II							57.0	58.0	57.0					15																	28090122		2203	4300	6503	SO:0001819	synonymous_variant	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28090122G>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2415C>T	15.37:g.28090122G>A			Somatic				OCA2_uc010ayv.2_Silent_p.S781S	p.S805S	NM_000275	NP_000266	WXS	Illumina HiSeq	Unspecified	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	23	2525	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	805			Extracellular (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	ENST00000354638.3	37	c.2415C>T	CCDS10020.1																																																																																				0.358	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		8	21	0	0	0	0.004482	0	8	21				
ATP8B4	79895	broad.mit.edu	37	15	50215688	50215688	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr15:50215688C>T	ENST00000284509.6	-	17	1787	c.1646G>A	c.(1645-1647)cGa>cAa	p.R549Q	ATP8B4_ENST00000559829.1_Missense_Mutation_p.R549Q	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	549						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TTCTGGGTTTCGAACTGAAAA	0.378																																							uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(1645-1647)CGA>CAA		ATPase class I type 8B member 4							49.0	48.0	49.0					15																	50215688		2196	4294	6490	SO:0001583	missense	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50215688C>T	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1646G>A	15.37:g.50215688C>T	ENSP00000284509:p.Arg549Gln		Somatic				ATP8B4_uc010ber.2_Missense_Mutation_p.R422Q|ATP8B4_uc010ufd.1_Missense_Mutation_p.R359Q|ATP8B4_uc010ufe.1_RNA	p.R549Q	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	17	1788	-		all_lung(180;0.00183)	549			Cytoplasmic (Potential).		Q9H727	Missense_Mutation	SNP	ENST00000284509.6	37	c.1646G>A	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725539	0.68959	.	.	ENSG00000104043	ENST00000284509	D	0.82803	-1.65	4.93	0.368	0.16146	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.243076	0.32314	N	0.006270	T	0.78451	0.4285	M	0.67517	2.055	0.34306	D	0.684884	P	0.42785	0.79	B	0.40066	0.318	T	0.80034	-0.1551	10	0.59425	D	0.04	.	9.0797	0.36545	0.0:0.606:0.0:0.394	.	549	Q8TF62	AT8B4_HUMAN	Q	549	ENSP00000284509:R549Q	ENSP00000284509:R549Q	R	-	2	0	ATP8B4	48002980	0.100000	0.21855	0.999000	0.59377	0.868000	0.49771	0.662000	0.25038	0.107000	0.17824	-0.751000	0.03497	CGA		0.378	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		6	11	0	0	0	0.038147	0	6	11				
AP3B2	8120	broad.mit.edu	37	15	83331888	83331888	+	Silent	SNP	C	C	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr15:83331888C>G	ENST00000261722.3	-	21	2745	c.2538G>C	c.(2536-2538)ctG>ctC	p.L846L	AP3B2_ENST00000535359.1_Silent_p.L865L|AP3B2_ENST00000535348.1_Silent_p.L814L|RP11-752G15.3_ENST00000560650.1_RNA	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	846					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCGACGGTACCAGGGTGGAGT	0.632																																							uc010uoh.1		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(2536-2538)CTG>CTC		adaptor-related protein complex 3, beta 2							27.0	30.0	29.0					15																	83331888		2040	4180	6220	SO:0001819	synonymous_variant	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83331888C>G	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2538G>C	15.37:g.83331888C>G			Somatic				AP3B2_uc010uoi.1_Silent_p.L865L|AP3B2_uc010uoj.1_Silent_p.L814L|AP3B2_uc010bmp.2_5'Flank|AP3B2_uc010uog.1_Silent_p.L482L	p.L846L	NM_004644	NP_004635	WXS	Illumina HiSeq	Unspecified	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		21	2715	-			846					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	c.2538G>C	CCDS45331.1																																																																																				0.632	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			4	20	0	0	0	0.009096	0	4	20				
GSE1	23199	broad.mit.edu	37	16	85682236	85682236	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr16:85682236G>T	ENST00000253458.7	+	3	481	c.305G>T	c.(304-306)cGc>cTc	p.R102L	GSE1_ENST00000405402.2_5'UTR|GSE1_ENST00000393243.1_Missense_Mutation_p.R29L	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	102																	ACACCCAAGCGCGTGCCCATG	0.677																																							uc002fix.2		NA																	0				large_intestine(3)|ovary(1)|skin(1)	5						c.(304-306)CGC>CTC		genetic suppressor element 1 isoform 1							67.0	73.0	71.0					16																	85682236		2198	4298	6496	SO:0001583	missense	23199						protein binding	g.chr16:85682236G>T	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.305G>T	16.37:g.85682236G>T	ENSP00000253458:p.Arg102Leu		Somatic				KIAA0182_uc002fiw.2_5'UTR|KIAA0182_uc002fiy.2_Missense_Mutation_p.R29L	p.R102L	NM_014615	NP_055430	WXS	Illumina HiSeq	Unspecified	Q14687	GSE1_HUMAN			3	379	+			102					D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	ENST00000253458.7	37	c.305G>T	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649771	0.67358	.	.	ENSG00000131149	ENST00000253458;ENST00000393243	T;T	0.39997	1.05;1.05	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.60125	-0.7324	10	0.66056	D	0.02	-19.395	16.8318	0.85946	0.0:0.0:1.0:0.0	.	29;102	Q14687-3;Q14687	.;GSE1_HUMAN	L	102;29	ENSP00000253458:R102L;ENSP00000376934:R29L	ENSP00000253458:R102L	R	+	2	0	KIAA0182	84239737	1.000000	0.71417	0.904000	0.35570	0.537000	0.34900	9.238000	0.95380	1.971000	0.57363	0.313000	0.20887	CGC		0.677	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615		35	80	1	0	6.29468e-14	0.021022	8.42016e-14	35	80				
YBX2	51087	broad.mit.edu	37	17	7194462	7194462	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:7194462T>A	ENST00000007699.5	-	4	472	c.409A>T	c.(409-411)Agc>Tgc	p.S137C	YBX2_ENST00000570627.1_5'UTR	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	137	CSD.|Required for cytoplasmic retention. {ECO:0000250}.				mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						TCTCCAACGCTGCGCAGAAAC	0.502																																							uc002gfq.2		NA																	0					0						c.(409-411)AGC>TGC		Y box binding protein 2							127.0	121.0	123.0					17																	7194462		2203	4300	6503	SO:0001583	missense	51087				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter|translational attenuation	cytoplasm|nucleus	DNA binding	g.chr17:7194462T>A	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.409A>T	17.37:g.7194462T>A	ENSP00000007699:p.Ser137Cys		Somatic					p.S137C	NM_015982	NP_057066	WXS	Illumina HiSeq	Unspecified	Q9Y2T7	YBOX2_HUMAN			4	466	-			137			CSD.|Required for cytoplasmic retention (By similarity).		D3DTP1|Q8N4P0	Missense_Mutation	SNP	ENST00000007699.5	37	c.409A>T	CCDS11098.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.786512	0.90367	.	.	ENSG00000006047	ENST00000007699	T	0.38401	1.14	5.63	5.63	0.86233	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (2);Nucleic acid-binding, OB-fold (1);	0.088635	0.85682	D	0.000000	T	0.67618	0.2912	M	0.91459	3.21	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.75596	-0.3263	10	0.87932	D	0	-30.5605	14.0999	0.65049	0.0:0.0:0.0:1.0	.	137	Q9Y2T7	YBOX2_HUMAN	C	137	ENSP00000007699:S137C	ENSP00000007699:S137C	S	-	1	0	YBX2	7135186	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.818000	0.75257	2.279000	0.76181	0.533000	0.62120	AGC		0.502	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440172.2	NM_015982		20	50	0	0	0	0.021523	0	20	50				
ARHGEF15	22899	broad.mit.edu	37	17	8219099	8219099	+	Missense_Mutation	SNP	T	T	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:8219099T>G	ENST00000361926.3	+	8	1558	c.1448T>G	c.(1447-1449)gTg>gGg	p.V483G	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.V483G|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	483	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CTGTCCCGTGTGCGCTCTTCC	0.572																																							uc002glc.2		NA																	0				ovary(2)|skin(1)	3						c.(1447-1449)GTG>GGG		Rho guanine exchange factor 15							80.0	74.0	76.0					17																	8219099		2203	4300	6503	SO:0001583	missense	22899				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr17:8219099T>G	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1448T>G	17.37:g.8219099T>G	ENSP00000355026:p.Val483Gly		Somatic				ARHGEF15_uc002gld.2_Missense_Mutation_p.V483G|ARHGEF15_uc010vuw.1_Missense_Mutation_p.V372G	p.V483G	NM_173728	NP_776089	WXS	Illumina HiSeq	Unspecified	O94989	ARHGF_HUMAN			8	1569	+			483			DH.		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	37	c.1448T>G	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	t	21.4	4.139411	0.77775	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.32272	1.46;1.46	5.14	5.14	0.70334	Dbl homology (DH) domain (5);	0.181726	0.49305	D	0.000146	T	0.46927	0.1418	L	0.49126	1.545	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.971	T	0.44544	-0.9321	10	0.66056	D	0.02	-16.8529	11.2713	0.49140	0.0:0.0:0.0:1.0	.	483;483	D3DTR7;O94989	.;ARHGF_HUMAN	G	483;273;483	ENSP00000355026:V483G;ENSP00000412505:V483G	ENSP00000355026:V483G	V	+	2	0	ARHGEF15	8159824	0.987000	0.35691	0.992000	0.48379	0.929000	0.56500	2.547000	0.45786	2.169000	0.68431	0.459000	0.35465	GTG		0.572	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		13	31	0	0	0	0.028581	0	13	31				
MYH3	4621	broad.mit.edu	37	17	10543512	10543512	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:10543512C>A	ENST00000583535.1	-	22	2570	c.2483G>T	c.(2482-2484)tGg>tTg	p.W828L	MYH3_ENST00000226209.7_Missense_Mutation_p.W828L	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	828					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CATCCAGGGCCAGTGCTTGAC	0.458																																							uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(2482-2484)TGG>TTG		myosin, heavy chain 3, skeletal muscle,							131.0	123.0	125.0					17																	10543512		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10543512C>A		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2483G>T	17.37:g.10543512C>A	ENSP00000464317:p.Trp828Leu		Somatic					p.W828L	NM_002470	NP_002461	WXS	Illumina HiSeq	Unspecified	P11055	MYH3_HUMAN			21	2560	-			828					Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.2483G>T	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592580	0.86953	.	.	ENSG00000109063	ENST00000226209	T	0.69561	-0.41	5.4	5.4	0.78164	.	.	.	.	.	D	0.86385	0.5920	H	0.96777	3.88	0.58432	D	0.999998	D	0.52996	0.957	P	0.55965	0.788	D	0.90793	0.4688	9	0.87932	D	0	.	19.5451	0.95291	0.0:1.0:0.0:0.0	.	828	P11055	MYH3_HUMAN	L	828	ENSP00000226209:W828L	ENSP00000226209:W828L	W	-	2	0	MYH3	10484237	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	2.685000	0.91497	0.561000	0.74099	TGG		0.458	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		14	34	1	0	4.7546e-09	0.028581	5.83005e-09	14	34				
KRTAP4-8	728224	broad.mit.edu	37	17	39253953	39253953	+	Missense_Mutation	SNP	G	G	T	rs200963489	byFrequency	TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:39253953G>T	ENST00000333822.4	-	1	440	c.384C>A	c.(382-384)agC>agA	p.S128R		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	128	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						agatgctgcagctggggcggc	0.672													G|||	312	0.0623003	0.0787	0.0865	5008	,	,		14532	0.0278		0.0616	False		,,,				2504	0.0593						uc010wfo.1		NA																	0					0						c.(382-384)AGC>AGA		keratin associated protein 4.8							4.0	5.0	5.0					17																	39253953		621	1476	2097	SO:0001583	missense	728224					keratin filament		g.chr17:39253953G>T	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.384C>A	17.37:g.39253953G>T	ENSP00000328444:p.Ser128Arg		Somatic					p.S128R	NM_031960	NP_114166	WXS	Illumina HiSeq	Unspecified	Q9BYQ9	KRA48_HUMAN			1	423	-			128			21.|25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].		A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	c.384C>A	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	12.91	2.079596	0.36662	.	.	ENSG00000204880	ENST00000333822	T	0.01821	4.62	3.65	1.52	0.23074	.	.	.	.	.	T	0.03520	0.0101	M	0.84433	2.695	0.09310	N	0.999997	B	0.18166	0.026	B	0.14578	0.011	T	0.32929	-0.9888	9	0.33940	T	0.23	.	6.69	0.23165	0.1125:0.2502:0.6373:0.0	.	128	Q9BYQ9	KRA48_HUMAN	R	128	ENSP00000328444:S128R	ENSP00000328444:S128R	S	-	3	2	KRTAP4-8	36507479	0.397000	0.25270	0.030000	0.17652	0.631000	0.37964	0.355000	0.20163	0.143000	0.18926	0.449000	0.29647	AGC		0.672	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960		3	17	1	0	5.18039e-06	0.038147	5.67639e-06	3	17				
TANC2	26115	broad.mit.edu	37	17	61391778	61391778	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:61391778A>G	ENST00000424789.2	+	8	971	c.967A>G	c.(967-969)Atc>Gtc	p.I323V	TANC2_ENST00000389520.4_Missense_Mutation_p.I323V|RP11-269G24.2_ENST00000580253.1_RNA|AC037445.1_ENST00000581421.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	323					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GCCTCCAGATATCTCCTTGAA	0.428																																							uc002jal.3		NA																	0				ovary(2)	2						c.(967-969)ATC>GTC		tetratricopeptide repeat, ankyrin repeat and							88.0	81.0	83.0					17																	61391778		1925	4148	6073	SO:0001583	missense	26115						binding	g.chr17:61391778A>G	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.967A>G	17.37:g.61391778A>G	ENSP00000387593:p.Ile323Val		Somatic				TANC2_uc010wpe.1_Missense_Mutation_p.I233V	p.I323V	NM_025185	NP_079461	WXS	Illumina HiSeq	Unspecified	Q9HCD6	TANC2_HUMAN			8	990	+			323					Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	37	c.967A>G	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357486	0.61293	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.21734	1.99;1.99	5.26	5.26	0.73747	.	.	.	.	.	T	0.25382	0.0617	L	0.56769	1.78	0.42599	D	0.993274	P;P	0.36990	0.537;0.577	B;B	0.37091	0.155;0.241	T	0.04103	-1.0977	9	0.51188	T	0.08	.	15.4757	0.75478	1.0:0.0:0.0:0.0	.	323;323	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	V	323	ENSP00000374171:I323V;ENSP00000387593:I323V	ENSP00000374171:I323V	I	+	1	0	TANC2	58745510	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.424000	0.80242	2.116000	0.64780	0.528000	0.53228	ATC		0.428	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1			11	32	0	0	0	0.028581	0	11	32				
MISP	126353	broad.mit.edu	37	19	757800	757800	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:757800C>G	ENST00000215582.6	+	2	957	c.854C>G	c.(853-855)cCg>cGg	p.P285R		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	285					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GTGGAGTCCCCGGGGACCCCC	0.657																																							uc002lpo.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(853-855)CCG>CGG		hypothetical protein LOC126353							46.0	47.0	46.0					19																	757800		2203	4300	6503	SO:0001583	missense	126353							g.chr19:757800C>G	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.854C>G	19.37:g.757800C>G	ENSP00000215582:p.Pro285Arg		Somatic					p.P285R	NM_173481	NP_775752	WXS	Illumina HiSeq	Unspecified	Q8IVT2	CS021_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	937	+		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)	285						Missense_Mutation	SNP	ENST00000215582.6	37	c.854C>G	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857260	0.51376	.	.	ENSG00000099812	ENST00000215582	T	0.18810	2.19	4.46	3.4	0.38934	.	1.018910	0.07874	N	0.968458	T	0.25754	0.0627	L	0.60455	1.87	0.09310	N	1	B	0.21905	0.062	B	0.23419	0.046	T	0.28554	-1.0040	10	0.59425	D	0.04	-9.2775	10.5741	0.45217	0.0:0.8044:0.1956:0.0	.	285	Q8IVT2	CS021_HUMAN	R	285	ENSP00000215582:P285R	ENSP00000215582:P285R	P	+	2	0	C19orf21	708800	0.001000	0.12720	0.098000	0.21074	0.344000	0.29017	0.246000	0.18160	0.847000	0.35167	0.491000	0.48974	CCG		0.657	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481		3	56	0	0	0	0.009096	0	3	56				
ARRDC5	645432	broad.mit.edu	37	19	4902698	4902698	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:4902698C>T	ENST00000381781.2	-	1	181	c.182G>A	c.(181-183)aGg>aAg	p.R61K	UHRF1_ENST00000592666.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	61										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		GACGTAACCCCTTCCCACGAG	0.498																																							uc002mbm.2		NA																	0					0						c.(181-183)AGG>AAG		arrestin domain containing 5							167.0	153.0	157.0					19																	4902698		1909	4124	6033	SO:0001583	missense	645432				signal transduction			g.chr19:4902698C>T		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.182G>A	19.37:g.4902698C>T	ENSP00000371200:p.Arg61Lys		Somatic					p.R61K	NM_001080523	NP_001073992	WXS	Illumina HiSeq	Unspecified	A6NEK1	ARRD5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)	1	182	-			61						Missense_Mutation	SNP	ENST00000381781.2	37	c.182G>A	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995346	0.74703	.	.	ENSG00000205784	ENST00000381781	T	0.13778	2.56	5.07	4.04	0.47022	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.124479	0.36303	N	0.002679	T	0.12603	0.0306	L	0.41573	1.285	0.28367	N	0.920179	B	0.20887	0.049	B	0.30716	0.119	T	0.13495	-1.0507	10	0.29301	T	0.29	-35.3775	9.2179	0.37360	0.0:0.9025:0.0:0.0975	.	61	A6NEK1	ARRD5_HUMAN	K	61	ENSP00000371200:R61K	ENSP00000371200:R61K	R	-	2	0	ARRDC5	4853698	0.940000	0.31905	0.913000	0.36048	0.940000	0.58332	1.564000	0.36375	1.503000	0.48686	0.650000	0.86243	AGG		0.498	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450443.1	XM_292803		8	113	0	0	0	0.004482	0	8	113				
ZNF91	7644	broad.mit.edu	37	19	23543480	23543480	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:23543480C>T	ENST00000300619.7	-	4	2506	c.2301G>A	c.(2299-2301)gaG>gaA	p.E767E	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Silent_p.E735E	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	767					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGAAGGGTTTCTCTCTAGTAT	0.373																																							uc002nre.2		NA																	0					0						c.(2299-2301)GAG>GAA		zinc finger protein 91							58.0	64.0	62.0					19																	23543480		2167	4274	6441	SO:0001819	synonymous_variant	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23543480C>T	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2301G>A	19.37:g.23543480C>T			Somatic				ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Silent_p.E735E	p.E767E	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			4	2414	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	767					A8K5E1|B7Z6G6	Silent	SNP	ENST00000300619.7	37	c.2301G>A	CCDS42541.1																																																																																				0.373	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		14	18	0	0	0	0.008871	0	14	18				
LGI4	163175	broad.mit.edu	37	19	35617312	35617312	+	Silent	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:35617312G>T	ENST00000310123.3	-	8	1680	c.1161C>A	c.(1159-1161)ccC>ccA	p.P387P	LGI4_ENST00000392225.3_Missense_Mutation_p.P413Q|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	387					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			GGAAGAGCACGGGCCGCTGGG	0.706																																							uc002nxx.2		NA																	0				pancreas(1)	1						c.(1159-1161)CCC>CCA		leucine-rich repeat LGI family, member 4							13.0	16.0	15.0					19																	35617312		2196	4293	6489	SO:0001819	synonymous_variant	163175					extracellular region		g.chr19:35617312G>T	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.1161C>A	19.37:g.35617312G>T			Somatic				LGI4_uc002nxy.1_Silent_p.P215P|LGI4_uc002nxz.1_Silent_p.P215P	p.P387P	NM_139284	NP_644813	WXS	Illumina HiSeq	Unspecified	Q8N135	LGI4_HUMAN	Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)		8	1755	-	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		387			EAR 2.		B2RN53|B9EGS7|Q5M8T1	Silent	SNP	ENST00000310123.3	37	c.1161C>A	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373437	0.24857	.	.	ENSG00000153902	ENST00000392225	T	0.70749	-0.51	4.51	-8.15	0.01065	.	0.000000	0.64402	D	0.000019	T	0.65354	0.2683	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66854	-0.5818	7	0.87932	D	0	.	4.8039	0.13310	0.4023:0.0:0.1769:0.4207	.	.	.	.	Q	413	ENSP00000376059:P413Q	ENSP00000376059:P413Q	P	-	2	0	LGI4	40309152	0.000000	0.05858	0.856000	0.33681	0.992000	0.81027	-3.564000	0.00429	-1.612000	0.01579	-0.225000	0.12378	CCG		0.706	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1			7	13	1	0	1.06961e-07	0.038147	1.25193e-07	7	13				
LTBP4	8425	broad.mit.edu	37	19	41115743	41115743	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:41115743C>T	ENST00000308370.7	+	14	1851	c.1851C>T	c.(1849-1851)ggC>ggT	p.G617G	LTBP4_ENST00000602240.1_3'UTR|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000396819.3_Silent_p.G550G|LTBP4_ENST00000545697.1_Silent_p.G70G|LTBP4_ENST00000204005.9_Silent_p.G580G	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	617	Cys-rich.|EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGGCCCGGGCTTCCGAGCCG	0.697																																							uc002ooh.1		NA																	0				central_nervous_system(1)	1						c.(1849-1851)GGC>GGT		latent transforming growth factor beta binding							6.0	8.0	8.0					19																	41115743		1782	3912	5694	SO:0001819	synonymous_variant	8425				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr19:41115743C>T	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1851C>T	19.37:g.41115743C>T			Somatic				LTBP4_uc002oog.1_Silent_p.G580G|LTBP4_uc002ooi.1_Silent_p.G550G|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc010xvo.1_5'Flank|LTBP4_uc010ehb.1_5'Flank|LTBP4_uc002ook.1_5'Flank	p.G617G	NM_001042544	NP_001036009	WXS	Illumina HiSeq	Unspecified	Q8N2S1	LTBP4_HUMAN	Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)		14	1851	+			617			Cys-rich.|EGF-like 4; calcium-binding (Potential).		O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37	c.1851C>T																																																																																					0.697	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573		5	10	0	0	0	0.014758	0	5	10				
CRX	1406	broad.mit.edu	37	19	48342877	48342877	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:48342877T>C	ENST00000221996.7	+	4	759	c.553T>C	c.(553-555)Tct>Cct	p.S185P	CRX_ENST00000539067.1_Missense_Mutation_p.S185P|TPRX2P_ENST00000535362.1_Intron	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	185					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		CTCAGGGCCGTCTCTGACCTC	0.672																																					Pancreas(57;461 1196 22201 40716 47188)	Pancreas(57;461 1196 22201 40716 47188)	uc002phq.3		NA																	0				breast(1)|central_nervous_system(1)	2						c.(553-555)TCT>CCT		cone-rod homeobox protein							46.0	46.0	46.0					19																	48342877		2203	4300	6503	SO:0001583	missense	1406				organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:48342877T>C	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.553T>C	19.37:g.48342877T>C	ENSP00000221996:p.Ser185Pro		Somatic					p.S185P	NM_000554	NP_000545	WXS	Illumina HiSeq	Unspecified	O43186	CRX_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)	4	757	+		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)	185					Q0QD45	Missense_Mutation	SNP	ENST00000221996.7	37	c.553T>C	CCDS12706.1	.	.	.	.	.	.	.	.	.	.	T	2.556	-0.303037	0.05495	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.85773	-2.03;-2.03	3.93	-1.24	0.09435	Transcription factor Otx, C-terminal (1);	0.712043	0.11616	N	0.546279	T	0.64538	0.2607	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50056	-0.8872	10	0.23302	T	0.38	-2.247	4.9512	0.14015	0.0:0.27:0.4629:0.267	.	185	O43186	CRX_HUMAN	P	185	ENSP00000221996:S185P;ENSP00000445565:S185P	ENSP00000221996:S185P	S	+	1	0	CRX	53034689	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.064000	0.14437	-0.105000	0.12132	0.383000	0.25322	TCT		0.672	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409812.4	NM_000554		9	29	0	0	0	0.004482	0	9	29				
SLC17A7	57030	broad.mit.edu	37	19	49933995	49933995	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:49933995G>A	ENST00000221485.3	-	12	1635	c.1464C>T	c.(1462-1464)gtC>gtT	p.V488V	SLC17A7_ENST00000600601.1_Silent_p.V421V|SLC17A7_ENST00000543531.1_Silent_p.V476V	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	488					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CAGAAGCAAAGACCCCGTAGA	0.582																																							uc002pnp.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1462-1464)GTC>GTT		solute carrier family 17, member 7							79.0	70.0	73.0					19																	49933995		2203	4300	6503	SO:0001819	synonymous_variant	57030				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity	g.chr19:49933995G>A	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1464C>T	19.37:g.49933995G>A			Somatic				SLC17A7_uc002pno.2_Silent_p.V150V	p.V488V	NM_020309	NP_064705	WXS	Illumina HiSeq	Unspecified	Q9P2U7	VGLU1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)	12	1636	-		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)	488			Helical; (Potential).		B4DFR9|B4DG46|Q6PCD0	Silent	SNP	ENST00000221485.3	37	c.1464C>T	CCDS12764.1																																																																																				0.582	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2			21	54	0	0	0	0.01892	0	21	54				
ZNF761	388561	broad.mit.edu	37	19	53959831	53959831	+	RNA	SNP	T	T	C			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:53959831T>C	ENST00000454407.1	+	0	2523							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AGAAACCTTATAAGTGTAATG	0.393																																							uc010eqp.2		NA																	0				ovary(1)	1						c.(2068-2070)TAT>TAC		zinc finger protein 761							92.0	95.0	94.0					19																	53959831		2202	4300	6502			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53959831T>C	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959831T>C			Somatic				ZNF761_uc010ydy.1_Silent_p.Y636Y|ZNF761_uc002qbt.1_Silent_p.Y636Y	p.Y690Y	NM_001008401	NP_001008401	WXS	Illumina HiSeq	Unspecified	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	7	2528	+			690			C2H2-type 18.		Q6ZNB9	Silent	SNP	ENST00000454407.1	37	c.2070T>C																																																																																					0.393	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		4	64	0	0	0	0.02938	0	4	64				
ZNF329	79673	broad.mit.edu	37	19	58640680	58640680	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr19:58640680C>T	ENST00000598312.1	-	4	424	c.191G>A	c.(190-192)tGt>tAt	p.C64Y	ZNF329_ENST00000358067.4_Missense_Mutation_p.C64Y	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	64					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		AGGATATTCACAAATTGCTTC	0.473																																							uc002qrn.2		NA																	0				skin(1)	1						c.(190-192)TGT>TAT		zinc finger protein 329							129.0	116.0	121.0					19																	58640680		2203	4300	6503	SO:0001583	missense	79673				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58640680C>T	AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.191G>A	19.37:g.58640680C>T	ENSP00000470008:p.Cys64Tyr		Somatic				ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	p.C64Y	NM_024620	NP_078896	WXS	Illumina HiSeq	Unspecified	Q86UD4	ZN329_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)	4	428	-		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)	64					B3KR32|Q9H9R7	Missense_Mutation	SNP	ENST00000598312.1	37	c.191G>A	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.653906	0.00779	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.06768	3.26;3.26	4.51	-0.111	0.13576	.	0.416078	0.20928	N	0.083141	T	0.03520	0.0101	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44982	-0.9292	10	0.02654	T	1	-3.4917	4.3011	0.10925	0.0:0.4033:0.3255:0.2713	.	64	Q86UD4	ZN329_HUMAN	Y	64	ENSP00000350773:C64Y;ENSP00000439527:C64Y	ENSP00000350773:C64Y	C	-	2	0	ZNF329	63332492	0.018000	0.18449	0.036000	0.18154	0.578000	0.36192	0.039000	0.13884	0.100000	0.17581	0.655000	0.94253	TGT		0.473	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620		8	34	0	0	0	0.004482	0	8	34				
MEMO1	51072	broad.mit.edu	37	2	32117109	32117109	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:32117109C>A	ENST00000295065.5	-	6	841	c.532G>T	c.(532-534)Gcg>Tcg	p.A178S	MEMO1_ENST00000404530.1_Missense_Mutation_p.A178S|MEMO1_ENST00000379383.3_Missense_Mutation_p.A181S|MEMO1_ENST00000490459.1_Intron|DPY30_ENST00000446765.1_5'UTR|MEMO1_ENST00000426310.2_Missense_Mutation_p.A155S	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	178					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					CTAGGATCCGCTAGATATTTA	0.363																																							uc002rnx.2		NA																	0				ovary(1)|skin(1)	2						c.(532-534)GCG>TCG		mediator of cell motility 1 isoform 1							106.0	113.0	110.0					2																	32117109		2203	4300	6503	SO:0001583	missense	51072				regulation of microtubule-based process	cytosol|nucleus		g.chr2:32117109C>A	AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.532G>T	2.37:g.32117109C>A	ENSP00000295065:p.Ala178Ser		Somatic				MEMO1_uc010ymu.1_Missense_Mutation_p.A155S|MEMO1_uc010ezq.2_Missense_Mutation_p.A178S|MEMO1_uc002rny.2_Intron|MEMO1_uc002rnz.2_RNA	p.A178S	NM_015955	NP_057039	WXS	Illumina HiSeq	Unspecified	Q9Y316	MEMO1_HUMAN			6	914	-	Acute lymphoblastic leukemia(172;0.155)		178					B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Missense_Mutation	SNP	ENST00000295065.5	37	c.532G>T	CCDS1776.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136983	0.37728	.	.	ENSG00000162959	ENST00000295065;ENST00000379383;ENST00000404530;ENST00000426310	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.60011	0.2236	L	0.38649	1.16	0.80722	D	1	B;B	0.24963	0.109;0.115	B;B	0.38562	0.061;0.276	T	0.52563	-0.8559	9	0.09590	T	0.72	-1.631	19.497	0.95077	0.0:1.0:0.0:0.0	.	155;178	Q9Y316-2;Q9Y316	.;MEMO1_HUMAN	S	178;181;178;155	.	ENSP00000295065:A178S	A	-	1	0	MEMO1	31970613	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.687000	0.84139	2.698000	0.92095	0.591000	0.81541	GCG		0.363	MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250251.2	NM_015955		16	39	1	0	5.3912e-06	0.006122	5.8452e-06	16	39				
BIRC6	57448	broad.mit.edu	37	2	32738056	32738056	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:32738056G>T	ENST00000421745.2	+	54	10537	c.10403G>T	c.(10402-10404)aGa>aTa	p.R3468I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3468					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTATGAAGAGAAGTGGCAGG	0.413																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(10402-10404)AGA>ATA		baculoviral IAP repeat-containing 6							157.0	143.0	147.0					2																	32738056		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32738056G>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.10403G>T	2.37:g.32738056G>T	ENSP00000393596:p.Arg3468Ile		Somatic					p.R3468I	NM_016252	NP_057336	WXS	Illumina HiSeq	Unspecified	Q9NR09	BIRC6_HUMAN			54	10537	+	Acute lymphoblastic leukemia(172;0.155)		3468					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.10403G>T	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	14.28	2.488735	0.44249	.	.	ENSG00000115760	ENST00000421745	T	0.74737	-0.87	5.29	4.42	0.53409	.	0.228496	0.45126	D	0.000397	T	0.59865	0.2225	N	0.22421	0.69	0.47905	D	0.99954	B	0.16396	0.017	B	0.19391	0.025	T	0.56811	-0.7917	10	0.48119	T	0.1	.	9.2897	0.37780	0.2098:0.0:0.7902:0.0	.	3468	Q9NR09	BIRC6_HUMAN	I	3468	ENSP00000393596:R3468I	ENSP00000393596:R3468I	R	+	2	0	BIRC6	32591560	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.384000	0.59607	1.345000	0.45676	-0.300000	0.09419	AGA		0.413	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		8	17	1	0	7.48243e-07	0.006214	8.28699e-07	8	17				
DDX18	8886	broad.mit.edu	37	2	118586916	118586916	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:118586916G>A	ENST00000263239.2	+	13	1872	c.1744G>A	c.(1744-1746)Gca>Aca	p.A582T		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	582					ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGCCCAGGAAGCATATAAGTC	0.323																																							uc002tlh.1		NA																	0				breast(2)|ovary(1)|lung(1)	4						c.(1744-1746)GCA>ACA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 18							101.0	103.0	102.0					2																	118586916		2203	4300	6503	SO:0001583	missense	8886						ATP binding|ATP-dependent RNA helicase activity|RNA binding	g.chr2:118586916G>A	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1744G>A	2.37:g.118586916G>A	ENSP00000263239:p.Ala582Thr		Somatic					p.A582T	NM_006773	NP_006764	WXS	Illumina HiSeq	Unspecified	Q9NVP1	DDX18_HUMAN			13	1843	+			582					Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	ENST00000263239.2	37	c.1744G>A	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940744	0.92526	.	.	ENSG00000088205	ENST00000263239;ENST00000539346	T	0.03094	4.05	4.67	4.67	0.58626	.	1.449150	0.03870	N	0.275440	T	0.40015	0.1100	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.33394	-0.9870	10	0.87932	D	0	-18.4095	16.2848	0.82714	0.0:0.0:1.0:0.0	.	582	Q9NVP1	DDX18_HUMAN	T	582;321	ENSP00000263239:A582T	ENSP00000263239:A582T	A	+	1	0	DDX18	118303386	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.946000	0.92992	2.595000	0.87683	0.650000	0.86243	GCA		0.323	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3	NM_006773		3	53	0	0	0	0.02938	0	3	53				
PTPN4	5775	broad.mit.edu	37	2	120639678	120639678	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:120639678C>T	ENST00000263708.2	+	7	1190	c.419C>T	c.(418-420)cCc>cTc	p.P140L		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	140	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	ATTAGATTACCCTGTCCTTCT	0.333																																							uc002tmf.1		NA																	0				ovary(2)	2						c.(418-420)CCC>CTC		protein tyrosine phosphatase, non-receptor type	Alendronate(DB00630)						156.0	158.0	157.0					2																	120639678		2202	4300	6502	SO:0001583	missense	5775					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity	g.chr2:120639678C>T		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.419C>T	2.37:g.120639678C>T	ENSP00000263708:p.Pro140Leu		Somatic				PTPN4_uc010flj.1_5'UTR	p.P140L	NM_002830	NP_002821	WXS	Illumina HiSeq	Unspecified	P29074	PTN4_HUMAN			7	1190	+			140			FERM.		B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	c.419C>T	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202932	0.38905	.	.	ENSG00000088179	ENST00000263708;ENST00000488279	T;T	0.78595	-1.19;-1.19	5.53	5.53	0.82687	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.163511	0.56097	D	0.000035	T	0.73450	0.3588	L	0.42245	1.32	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.69007	-0.5259	10	0.54805	T	0.06	.	17.6441	0.88144	0.0:1.0:0.0:0.0	.	140	P29074	PTN4_HUMAN	L	140;147	ENSP00000263708:P140L;ENSP00000438445:P147L	ENSP00000263708:P140L	P	+	2	0	PTPN4	120356148	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	5.536000	0.67180	2.585000	0.87301	0.460000	0.39030	CCC		0.333	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			22	55	0	0	0	0.016522	0	22	55				
LRP2	4036	broad.mit.edu	37	2	170002321	170002321	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:170002321C>T	ENST00000263816.3	-	70	13209	c.12924G>A	c.(12922-12924)acG>acA	p.T4308T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4308					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCACTACCAGCGTTTTCTCTT	0.388																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(12922-12924)ACG>ACA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						108.0	99.0	102.0					2																	170002321		2203	4300	6503	SO:0001819	synonymous_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170002321C>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12924G>A	2.37:g.170002321C>T			Somatic					p.T4308T	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	70	13137	-			4308			Extracellular (Potential).		O00711|Q16215	Silent	SNP	ENST00000263816.3	37	c.12924G>A	CCDS2232.1																																																																																				0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		13	37	0	0	0	0.020292	0	13	37				
ZNF804A	91752	broad.mit.edu	37	2	185801342	185801342	+	Missense_Mutation	SNP	G	G	T	rs568988606		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:185801342G>T	ENST00000302277.6	+	4	1813	c.1219G>T	c.(1219-1221)Gtt>Ttt	p.V407F		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	407							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TACTGAAGAGGTTAACATAAC	0.393													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18554	0.0		0.0	False		,,,				2504	0.0						uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1219-1221)GTT>TTT		zinc finger protein 804A							82.0	88.0	86.0					2																	185801342		2203	4299	6502	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801342G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1219G>T	2.37:g.185801342G>T	ENSP00000303252:p.Val407Phe		Somatic					p.V407F	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1813	+			407					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1219G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	8.995	0.978620	0.18812	.	.	ENSG00000170396	ENST00000302277	T	0.05855	3.38	5.6	4.71	0.59529	.	1.289500	0.05278	N	0.518868	T	0.05914	0.0154	N	0.14661	0.345	0.22954	N	0.998516	P	0.41748	0.761	B	0.34722	0.188	T	0.50189	-0.8857	10	0.59425	D	0.04	-0.0223	13.933	0.64007	0.0736:0.0:0.9264:0.0	.	407	Q7Z570	Z804A_HUMAN	F	407	ENSP00000303252:V407F	ENSP00000303252:V407F	V	+	1	0	ZNF804A	185509587	0.345000	0.24835	0.003000	0.11579	0.012000	0.07955	1.882000	0.39648	1.356000	0.45884	0.591000	0.81541	GTT		0.393	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		14	19	1	0	3.27435e-08	0.020292	3.87653e-08	14	19				
TRAK2	66008	broad.mit.edu	37	2	202252542	202252542	+	Missense_Mutation	SNP	G	G	A	rs142579315		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:202252542G>A	ENST00000332624.3	-	13	2008	c.1580C>T	c.(1579-1581)cCg>cTg	p.P527L		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	527					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GCTCTCTGTCGGGGTGACACA	0.488																																							uc002uyb.3		NA																	0					0						c.(1579-1581)CCG>CTG		trafficking protein, kinesin binding 2		G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	106.0	101.0	103.0		1580	4.1	0.2	2	dbSNP_134	103	0,8600		0,0,4300	no	missense	TRAK2	NM_015049.2	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	527/915	202252542	1,13005	2203	4300	6503	SO:0001583	missense	66008					early endosome|plasma membrane	GABA receptor binding	g.chr2:202252542G>A	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.1580C>T	2.37:g.202252542G>A	ENSP00000328875:p.Pro527Leu		Somatic					p.P527L	NM_015049	NP_055864	WXS	Illumina HiSeq	Unspecified	O60296	TRAK2_HUMAN			13	2026	-			527	Missing (in Ref. 2).				E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	ENST00000332624.3	37	c.1580C>T	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689468	0.29962	2.27E-4	0.0	ENSG00000115993	ENST00000332624;ENST00000542292	D	0.85861	-2.04	4.94	4.06	0.47325	Trafficking kinesin-binding protein domain (1);	0.129399	0.52532	N	0.000061	D	0.85596	0.5733	M	0.82823	2.61	0.80722	D	1	B	0.27932	0.194	B	0.25506	0.061	D	0.85071	0.0940	10	0.59425	D	0.04	.	13.7519	0.62912	0.0749:0.0:0.9251:0.0	.	527	O60296	TRAK2_HUMAN	L	527;433	ENSP00000328875:P527L	ENSP00000328875:P527L	P	-	2	0	TRAK2	201960787	1.000000	0.71417	0.158000	0.22627	0.070000	0.16714	7.749000	0.85096	1.300000	0.44818	0.655000	0.94253	CCG		0.488	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049		35	56	0	0	0	0.017118	0	35	56				
CHRNG	1146	broad.mit.edu	37	2	233408313	233408313	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr2:233408313G>A	ENST00000389494.3	+	9	960	c.939G>A	c.(937-939)ctG>ctA	p.L313L	CHRNG_ENST00000389492.3_Silent_p.L261L	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	313					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	CCTTCCTCCTGGTGGTGACCA	0.617																																							uc002vsx.1		NA																	0					0						c.(937-939)CTG>CTA		cholinergic receptor, nicotinic, gamma							182.0	134.0	150.0					2																	233408313		2203	4300	6503	SO:0001819	synonymous_variant	1146				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity	g.chr2:233408313G>A	X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.939G>A	2.37:g.233408313G>A			Somatic				CHRNG_uc010fye.1_Silent_p.L261L	p.L313L	NM_005199	NP_005190	WXS	Illumina HiSeq	Unspecified	P07510	ACHG_HUMAN		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	9	960	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	313			Helical; (Potential).		B3KWM8|Q14DU4|Q53RG2	Silent	SNP	ENST00000389494.3	37	c.939G>A	CCDS33400.1																																																																																				0.617	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199		13	25	0	0	0	0.028581	0	13	25				
PLCB1	23236	broad.mit.edu	37	20	8737710	8737710	+	Silent	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr20:8737710A>G	ENST00000338037.6	+	24	2568	c.2541A>G	c.(2539-2541)acA>acG	p.T847T	PLCB1_ENST00000378641.3_Silent_p.T847T|PLCB1_ENST00000378637.2_Silent_p.T847T|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	847					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CTGGAGAAACACCATCAGAGG	0.433																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2539-2541)ACA>ACG		phosphoinositide-specific phospholipase C beta 1							61.0	65.0	64.0					20																	8737710		2203	4300	6503	SO:0001819	synonymous_variant	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8737710A>G	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2541A>G	20.37:g.8737710A>G			Somatic				PLCB1_uc010zrb.1_Silent_p.T746T|PLCB1_uc002wna.2_Silent_p.T847T|PLCB1_uc002wnc.1_Silent_p.T746T|PLCB1_uc002wnd.1_Silent_p.T424T	p.T847T	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			24	2544	+			847					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	c.2541A>G	CCDS13102.1																																																																																				0.433	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			6	28	0	0	0	0.021553	0	6	28				
MKKS	8195	broad.mit.edu	37	20	10389284	10389284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr20:10389284C>A	ENST00000347364.3	-	4	1915	c.1153G>T	c.(1153-1155)Gag>Tag	p.E385*	MKKS_ENST00000399054.2_Nonsense_Mutation_p.E385*	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	385					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)	p.E385K(1)		kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						ACCTTCAGCTCATCCCAGGCA	0.388																																					Melanoma(79;1979 2212 6640)	Melanoma(79;1979 2212 6640)	uc002wnt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1153-1155)GAG>TAG		McKusick-Kaufman syndrome protein							79.0	74.0	75.0					20																	10389284		2203	4300	6503	SO:0001587	stop_gained	8195	Bardet-Biedl_syndrome			brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding	g.chr20:10389284C>A	AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1153G>T	20.37:g.10389284C>A	ENSP00000246062:p.Glu385*		Somatic				MKKS_uc002wnu.1_Nonsense_Mutation_p.E385*|MKKS_uc010zrd.1_RNA	p.E385*	NM_018848	NP_061336	WXS	Illumina HiSeq	Unspecified	Q9NPJ1	MKKS_HUMAN			4	2040	-			385					A8K7B0|D3DW18	Nonsense_Mutation	SNP	ENST00000347364.3	37	c.1153G>T	CCDS13111.1	.	.	.	.	.	.	.	.	.	.	C	46	12.749899	0.99693	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.8608	20.5948	0.99439	0.0:1.0:0.0:0.0	.	.	.	.	X	385	.	ENSP00000246062:E385X	E	-	1	0	MKKS	10337284	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.298000	0.78815	2.873000	0.98535	0.563000	0.77884	GAG		0.388	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3			11	32	1	0	0.000151284	0.016723	0.000159003	11	32				
ZNF341	84905	broad.mit.edu	37	20	32341111	32341111	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr20:32341111G>T	ENST00000375200.1	+	5	988	c.623G>T	c.(622-624)gGg>gTg	p.G208V	ZNF341_ENST00000342427.2_Missense_Mutation_p.G208V	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						GGCCCCCCTGGGCGTCCCAAC	0.692																																							uc002wzy.2		NA																	0				ovary(2)	2						c.(622-624)GGG>GTG		zinc finger protein 341							38.0	33.0	35.0					20																	32341111		2201	4298	6499	SO:0001583	missense	84905				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:32341111G>T	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.623G>T	20.37:g.32341111G>T	ENSP00000364346:p.Gly208Val		Somatic				ZNF341_uc002wzx.2_Missense_Mutation_p.G208V|ZNF341_uc010geq.2_Missense_Mutation_p.G118V|ZNF341_uc010ger.2_RNA	p.G208V	NM_032819	NP_116208	WXS	Illumina HiSeq	Unspecified	Q9BYN7	ZN341_HUMAN			5	643	+			208					A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37	c.623G>T		.	.	.	.	.	.	.	.	.	.	G	12.69	2.013750	0.35511	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.10192	3.13;2.9	5.05	5.05	0.67936	.	0.289522	0.34879	N	0.003618	T	0.09291	0.0229	L	0.43152	1.355	0.58432	D	0.999999	B;B;B	0.32653	0.379;0.125;0.021	B;B;B	0.28709	0.093;0.093;0.028	T	0.21827	-1.0234	10	0.16896	T	0.51	-19.9725	12.264	0.54668	0.0:0.0:0.7026:0.2974	.	149;208;208	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	V	208	ENSP00000344308:G208V;ENSP00000364346:G208V	ENSP00000344308:G208V	G	+	2	0	ZNF341	31804772	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	5.170000	0.64990	2.377000	0.81083	0.456000	0.33151	GGG		0.692	ZNF341-201	KNOWN	basic	protein_coding	protein_coding				3	9	1	0	6.4e-05	0.004672	6.79588e-05	3	9				
CHD6	84181	broad.mit.edu	37	20	40049350	40049350	+	Silent	SNP	G	G	A	rs113638490	byFrequency	TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr20:40049350G>A	ENST00000373233.3	-	31	6102	c.5925C>T	c.(5923-5925)atC>atT	p.I1975I		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1975					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCTCCATGGCGATAGTATTGG	0.438																																							uc002xka.1		NA																	0				ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(5923-5925)ATC>ATT		chromodomain helicase DNA binding protein 6							151.0	153.0	153.0					20																	40049350		2203	4300	6503	SO:0001819	synonymous_variant	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40049350G>A	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5925C>T	20.37:g.40049350G>A			Somatic					p.I1975I	NM_032221	NP_115597	WXS	Illumina HiSeq	Unspecified	Q8TD26	CHD6_HUMAN			31	6103	-		Myeloproliferative disorder(115;0.00425)	1975					Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	c.5925C>T	CCDS13317.1																																																																																				0.438	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			38	86	0	0	0	0.033182	0	38	86				
ZNRF3	84133	broad.mit.edu	37	22	29446751	29446751	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr22:29446751C>T	ENST00000544604.2	+	8	2757	c.2582C>T	c.(2581-2583)cCg>cTg	p.P861L	ZNRF3_ENST00000406323.3_Missense_Mutation_p.P761L|ZNRF3_ENST00000402174.1_Missense_Mutation_p.P761L|ZNRF3_ENST00000332811.4_Missense_Mutation_p.P761L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	861					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						ACGCGAGGCCCGGATACCCCA	0.701																																							uc003aeg.2		NA																	0				ovary(1)	1						c.(2281-2283)CCG>CTG		zinc and ring finger 3							10.0	13.0	12.0					22																	29446751		1886	4104	5990	SO:0001583	missense	84133					integral to membrane	zinc ion binding	g.chr22:29446751C>T	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.2582C>T	22.37:g.29446751C>T	ENSP00000443824:p.Pro861Leu		Somatic				ZNRF3_uc003aeh.1_Missense_Mutation_p.P761L	p.P761L	NM_032173	NP_115549	WXS	Illumina HiSeq	Unspecified	Q9ULT6	ZNRF3_HUMAN			8	2447	+			861			Cytoplasmic (Potential).		B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	c.2282C>T	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.675649	0.00104	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.07114	3.37;3.22;3.22;3.22	5.83	-1.58	0.08479	.	1.073350	0.07325	N	0.878219	T	0.04588	0.0125	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.46373	-0.9196	10	0.23302	T	0.38	-0.3416	11.0925	0.48123	0.0:0.3184:0.0:0.6816	.	861	Q9ULT6	ZNRF3_HUMAN	L	861;761;568;761;761	ENSP00000443824:P861L;ENSP00000328614:P761L;ENSP00000384456:P761L;ENSP00000384553:P761L	ENSP00000328614:P761L	P	+	2	0	ZNRF3	27776751	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.063000	0.11655	-0.464000	0.06963	-0.140000	0.14226	CCG		0.701	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972		5	9	0	0	0	0.014758	0	5	9				
FOXRED2	80020	broad.mit.edu	37	22	36902321	36902321	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr22:36902321T>A	ENST00000397224.4	-	2	242	c.149A>T	c.(148-150)cAg>cTg	p.Q50L	FOXRED2_ENST00000216187.6_Missense_Mutation_p.Q50L|FOXRED2_ENST00000397223.4_Missense_Mutation_p.Q50L	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	50					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCCAGCGCGCTGCAGGAAGTA	0.711																																							uc003apn.3		NA																	0				lung(1)|kidney(1)	2						c.(148-150)CAG>CTG		FAD-dependent oxidoreductase domain containing 2							22.0	19.0	20.0					22																	36902321		2200	4296	6496	SO:0001583	missense	80020				ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chr22:36902321T>A	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.149A>T	22.37:g.36902321T>A	ENSP00000380401:p.Gln50Leu		Somatic				FOXRED2_uc003apo.3_Missense_Mutation_p.Q50L|FOXRED2_uc003app.3_Missense_Mutation_p.Q50L	p.Q50L	NM_024955	NP_079231	WXS	Illumina HiSeq	Unspecified	Q8IWF2	FXRD2_HUMAN			1	257	-			50					B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	c.149A>T	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.144913	0.77888	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223;ENST00000423980	T;T;T;T	0.16743	2.39;2.39;2.39;2.32	5.14	3.88	0.44766	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.412539	0.26514	N	0.023947	T	0.13670	0.0331	N	0.11892	0.195	0.27176	N	0.96079	P	0.39044	0.656	P	0.46299	0.511	T	0.07233	-1.0783	10	0.52906	T	0.07	-18.3948	10.0738	0.42349	0.0:0.0912:0.0:0.9088	.	50	Q8IWF2	FXRD2_HUMAN	L	50	ENSP00000380401:Q50L;ENSP00000216187:Q50L;ENSP00000380400:Q50L;ENSP00000409692:Q50L	ENSP00000216187:Q50L	Q	-	2	0	FOXRED2	35232267	1.000000	0.71417	0.996000	0.52242	0.690000	0.40134	5.189000	0.65098	1.935000	0.56089	0.459000	0.35465	CAG		0.711	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955		7	11	0	0	0	0.038147	0	7	11				
CHCHD4	131474	broad.mit.edu	37	3	14154427	14154427	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:14154427A>G	ENST00000396914.3	-	3	570	c.389T>C	c.(388-390)aTt>aCt	p.I130T	CHCHD4_ENST00000295767.5_Missense_Mutation_p.I143T	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	130					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						AGTGGCCTCAATGGGAGCTGT	0.498																																							uc003byj.3		NA																	0					0						c.(388-390)ATT>ACT		coiled-coil-helix-coiled-coil-helix domain							101.0	88.0	92.0					3																	14154427		2203	4300	6503	SO:0001583	missense	131474				protein transport|transmembrane transport	mitochondrial intermembrane space		g.chr3:14154427A>G	BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.389T>C	3.37:g.14154427A>G	ENSP00000380122:p.Ile130Thr		Somatic				CHCHD4_uc003byi.3_Missense_Mutation_p.I143T	p.I130T	NM_001098502	NP_001091972	WXS	Illumina HiSeq	Unspecified	Q8N4Q1	MIA40_HUMAN			3	584	-			130					A8K3Z9|Q96AI2|Q96MY6	Missense_Mutation	SNP	ENST00000396914.3	37	c.389T>C	CCDS43054.1	.	.	.	.	.	.	.	.	.	.	.	1.099	-0.661803	0.03454	.	.	ENSG00000163528	ENST00000295767;ENST00000396914	.	.	.	5.55	4.66	0.58398	.	1.054490	0.07267	N	0.868371	T	0.09335	0.0230	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33033	-0.9884	9	0.02654	T	1	1.2437	6.4446	0.21869	0.1986:0.1622:0.6392:0.0	.	130;143	Q8N4Q1;Q8N4Q1-2	MIA40_HUMAN;.	T	143;130	.	ENSP00000295767:I143T	I	-	2	0	CHCHD4	14129428	0.010000	0.17322	0.002000	0.10522	0.095000	0.18619	1.621000	0.36986	0.694000	0.31654	-0.246000	0.11932	ATT		0.498	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340423.1	NM_144636		4	10	0	0	0	0.014758	0	4	10				
MAP4	4134	broad.mit.edu	37	3	47958147	47958147	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:47958147C>T	ENST00000360240.6	-	7	1688	c.1170G>A	c.(1168-1170)ttG>ttA	p.L390L	MAP4_ENST00000395734.3_Silent_p.L390L|MAP4_ENST00000426837.2_Silent_p.L407L|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	390	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.L390L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TGGAAGGAGCCAAGTCCATTT	0.448																																							uc003csb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1168-1170)TTG>TTA		microtubule-associated protein 4 isoform 1							148.0	146.0	146.0					3																	47958147		2203	4300	6503	SO:0001819	synonymous_variant	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47958147C>T		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1170G>A	3.37:g.47958147C>T			Somatic				MAP4_uc003csc.3_Silent_p.L390L|MAP4_uc011bbf.1_Silent_p.L367L|MAP4_uc003csf.3_Silent_p.L407L	p.L390L	NM_002375	NP_002366	WXS	Illumina HiSeq	Unspecified	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	1696	-			390			17 X 14 AA tandem repeats.|26 residues 2.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	c.1170G>A	CCDS33750.1																																																																																				0.448	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		4	118	0	0	0	0.014758	0	4	118				
PHF7	51533	broad.mit.edu	37	3	52448547	52448547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:52448547G>T	ENST00000327906.3	+	4	790	c.130G>T	c.(130-132)Gaa>Taa	p.E44*	PHF7_ENST00000347025.2_Nonsense_Mutation_p.E44*|PHF7_ENST00000482327.1_3'UTR	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	44						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TGGGGATCCCGAAAAATTAGG	0.433																																							uc003ddy.2		NA																	0				breast(1)	1						c.(130-132)GAA>TAA		PHD finger protein 7 isoform 1							126.0	129.0	128.0					3																	52448547		2203	4300	6503	SO:0001587	stop_gained	51533					nucleus	zinc ion binding	g.chr3:52448547G>T	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.130G>T	3.37:g.52448547G>T	ENSP00000333024:p.Glu44*		Somatic				PHF7_uc003ddz.2_Nonsense_Mutation_p.E44*	p.E44*	NM_016483	NP_057567	WXS	Illumina HiSeq	Unspecified	Q9BWX1	PHF7_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)	4	936	+			44					K4DI82	Nonsense_Mutation	SNP	ENST00000327906.3	37	c.130G>T	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	G	36	5.775657	0.96922	.	.	ENSG00000010318	ENST00000478707;ENST00000327906;ENST00000347025;ENST00000454052	.	.	.	5.24	5.24	0.73138	.	0.329096	0.33346	N	0.005019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-19.6987	14.3218	0.66491	0.0:0.0:1.0:0.0	.	.	.	.	X	44;44;44;9	.	ENSP00000333024:E44X	E	+	1	0	PHF7	52423587	0.999000	0.42202	0.973000	0.42090	0.998000	0.95712	4.415000	0.59809	2.451000	0.82905	0.563000	0.77884	GAA		0.433	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483		21	72	1	0	5.26018e-13	0.012319	6.77248e-13	21	72				
PIK3CA	5290	broad.mit.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2		57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		8	Substitution - Missense(8)	p.E726K(2)	lung(4)|large_intestine(2)|breast(2)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(2176-2178)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							89.0	78.0	82.0					3																	178938934		1917	4118	6035	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178938934G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E726K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		14	2333	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		726					Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.2176G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			14	27	0	0	0	0.028581	0	14	27				
TENM3	55714	broad.mit.edu	37	4	183696138	183696138	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr4:183696138G>A	ENST00000511685.1	+	24	5259	c.5136G>A	c.(5134-5136)ctG>ctA	p.L1712L	RP11-18D7.2_ENST00000513255.1_RNA|TENM3_ENST00000406950.2_Silent_p.L1712L			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1712					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCAGTGGCCTGGACTCACACT	0.473																																							uc003ivd.1		NA																	0					0						c.(5134-5136)CTG>CTA		odz, odd Oz/ten-m homolog 3							44.0	44.0	44.0					4																	183696138		1911	4126	6037	SO:0001819	synonymous_variant	55714				signal transduction	integral to membrane		g.chr4:183696138G>A	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5136G>A	4.37:g.183696138G>A			Somatic					p.L1712L	NM_001080477	NP_001073946	WXS	Illumina HiSeq	Unspecified	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	23	5173	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	1712			Extracellular (Potential).		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	37	c.5136G>A	CCDS47165.1																																																																																				0.473	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			3	17	0	0	0	0.004672	0	3	17				
PCDHGA5	56110	broad.mit.edu	37	5	140743981	140743981	+	Silent	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr5:140743981C>T	ENST00000518069.1	+	1	84	c.84C>T	c.(82-84)tcC>tcT	p.S28S	PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	28					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAGGATCCGGGCAGATCC	0.657																																							uc003lju.1		NA																	0				ovary(4)	4						c.(82-84)TCC>TCT		protocadherin gamma subfamily A, 5 isoform 1							31.0	40.0	37.0					5																	140743981		2140	4274	6414	SO:0001819	synonymous_variant	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140743981C>T	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.84C>T	5.37:g.140743981C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Silent_p.S28S	p.S28S	NM_018918	NP_061741	WXS	Illumina HiSeq	Unspecified	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	84	+			28					Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	37	c.84C>T	CCDS54925.1																																																																																				0.657	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		10	14	0	0	0	0.008291	0	10	14				
SPRY4	81848	broad.mit.edu	37	5	141694060	141694060	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr5:141694060C>T	ENST00000434127.2	-	2	857	c.614G>A	c.(613-615)gGc>gAc	p.G205D	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Missense_Mutation_p.G228D	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	205	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAGAAGATGCCCTGCACCAA	0.622									Testicular Cancer, Familial Clustering of																														uc003lml.2		NA																	0				ovary(1)|lung(1)	2						c.(613-615)GGC>GAC		sprouty homolog 4 isoform 2							85.0	72.0	76.0					5																	141694060		2203	4300	6503	SO:0001583	missense	81848	Testicular_Cancer_Familial_Clustering_of	Familial Cancer Database		multicellular organismal development	cytoplasm|ruffle membrane	protein binding	g.chr5:141694060C>T	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.614G>A	5.37:g.141694060C>T	ENSP00000399468:p.Gly205Asp		Somatic				SPRY4_uc010jgi.1_Missense_Mutation_p.G228D	p.G205D	NM_001127496	NP_001120968	WXS	Illumina HiSeq	Unspecified	Q9C004	SPY4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	873	-		all_hematologic(541;0.118)	205			Cys-rich.|SPR.		A4FVB2|A4FVB3|Q6QIX2|Q9C003	Missense_Mutation	SNP	ENST00000434127.2	37	c.614G>A	CCDS47296.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273082	0.80580	.	.	ENSG00000187678	ENST00000344120;ENST00000434127	T;T	0.65364	-0.15;-0.15	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.82472	0.5044	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84639	0.0694	10	0.72032	D	0.01	-35.4735	19.5966	0.95541	0.0:1.0:0.0:0.0	.	205	Q9C004	SPY4_HUMAN	D	228;205	ENSP00000344967:G228D;ENSP00000399468:G205D	ENSP00000344967:G228D	G	-	2	0	SPRY4	141674244	1.000000	0.71417	0.988000	0.46212	0.994000	0.84299	7.487000	0.81328	2.622000	0.88805	0.561000	0.74099	GGC		0.622	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1			13	26	0	0	0	0.020292	0	13	26				
MOG	4340	broad.mit.edu	37	6	29640660	29640660	+	IGR	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr6:29640660G>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Missense_Mutation_p.P390T|ZFP57_ENST00000488757.1_Missense_Mutation_p.P410T|ZFP57_ENST00000376881.3_Missense_Mutation_p.P390T	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						TAGTTGGGCGGCTCTGTGAGG	0.512																																							uc011dlw.1		NA																	0				ovary(3)|skin(2)	5						c.(1228-1230)CCG>ACG		zinc finger protein 57 homolog							242.0	264.0	256.0					6																	29640660		1301	2585	3886	SO:0001628	intergenic_variant	346171				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr6:29640660G>T		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640660G>T			Somatic				ZFP57_uc003nnl.3_Missense_Mutation_p.P390T	p.P410T	NM_001109809	NP_001103279	WXS	Illumina HiSeq	Unspecified	Q9NU63	ZFP57_HUMAN			4	1379	-			326					A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	ENST00000376917.3	37	c.1228C>A	CCDS34370.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259716	0.23051	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.27557	1.66;1.66;1.66	4.36	3.46	0.39613	.	0.578594	0.14416	N	0.320992	T	0.07593	0.0191	N	0.16790	0.44	0.09310	N	1	B;B	0.29805	0.257;0.257	B;B	0.29077	0.098;0.098	T	0.18840	-1.0324	10	0.72032	D	0.01	-2.0183	7.3821	0.26862	0.0:0.1865:0.6209:0.1925	.	410;390	Q9NU63-3;Q9NU63-2	.;.	T	410;390;390	ENSP00000418259:P410T;ENSP00000366078:P390T;ENSP00000366080:P390T	ENSP00000366078:P390T	P	-	1	0	ZFP57	29748639	0.000000	0.05858	0.055000	0.19348	0.079000	0.17450	-0.514000	0.06298	1.126000	0.42016	0.563000	0.77884	CCG		0.512	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		15	148	1	0	3.32936e-07	0.006122	3.7684e-07	15	148				
NOTCH4	4855	broad.mit.edu	37	6	32163539	32163539	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr6:32163539T>A	ENST00000375023.3	-	30	5825	c.5687A>T	c.(5686-5688)cAt>cTt	p.H1896L	GPSM3_ENST00000375043.3_5'Flank|GPSM3_ENST00000487761.1_5'Flank|NOTCH4_ENST00000443903.2_3'UTR|GPSM3_ENST00000375040.3_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1896					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GCTCCGGCAATGAGAATAGGC	0.692																																							uc003obb.2		NA																	0				lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(5686-5688)CAT>CTT		notch4 preproprotein							16.0	21.0	19.0					6																	32163539		1504	2696	4200	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32163539T>A		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.5687A>T	6.37:g.32163539T>A	ENSP00000364163:p.His1896Leu		Somatic				GPSM3_uc003oax.3_5'Flank|GPSM3_uc003oay.3_5'Flank|GPSM3_uc003oaz.2_5'Flank|NOTCH4_uc011dpt.1_3'UTR|NOTCH4_uc003oba.2_Missense_Mutation_p.H556L|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.H1896L	NM_004557	NP_004548	WXS	Illumina HiSeq	Unspecified	Q99466	NOTC4_HUMAN			30	5826	-			1896			Cytoplasmic (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.5687A>T	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	T	8.897	0.955452	0.18507	.	.	ENSG00000204301	ENST00000375023	T	0.80480	-1.38	4.14	-2.2	0.06994	.	1.431880	0.04986	N	0.466475	T	0.35158	0.0922	N	0.14661	0.345	0.18873	N	0.999983	B;B	0.23650	0.023;0.089	B;B	0.14578	0.005;0.011	T	0.14587	-1.0467	10	0.10111	T	0.7	.	5.3798	0.16186	0.0:0.4938:0.1899:0.3163	.	1896;1895	Q99466;B0S882	NOTC4_HUMAN;.	L	1896	ENSP00000364163:H1896L	ENSP00000364163:H1896L	H	-	2	0	NOTCH4	32271517	0.000000	0.05858	0.001000	0.08648	0.383000	0.30230	-0.276000	0.08514	-0.283000	0.09115	0.454000	0.30748	CAT		0.692	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			9	29	0	0	0	0.004482	0	9	29				
DST	667	broad.mit.edu	37	6	56351986	56351986	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr6:56351986A>T	ENST00000361203.3	-	82	20010	c.20003T>A	c.(20002-20004)cTg>cAg	p.L6668Q	DST_ENST00000446842.2_Missense_Mutation_p.L6453Q|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.L4582Q|DST_ENST00000370754.5_Missense_Mutation_p.L6957Q|DST_ENST00000421834.2_Missense_Mutation_p.L4691Q|DST_ENST00000370769.4_Missense_Mutation_p.L6779Q|DST_ENST00000244364.6_Missense_Mutation_p.L4365Q			Q03001	DYST_HUMAN	dystonin	6667					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTCATCAGCCAGGGAGGTTTT	0.423																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(14605-14607)CTG>CAG		dystonin isoform 2							126.0	124.0	125.0					6																	56351986		1925	4144	6069	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56351986A>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20003T>A	6.37:g.56351986A>T	ENSP00000354508:p.Leu6668Gln		Somatic				DST_uc003pcz.3_Missense_Mutation_p.L4691Q|DST_uc011dxj.1_Missense_Mutation_p.L4720Q|DST_uc011dxk.1_Missense_Mutation_p.L4731Q|DST_uc003pcy.3_Missense_Mutation_p.L4365Q|DST_uc003pda.3_Missense_Mutation_p.L61Q	p.L4869Q	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		81	14634	-	Lung NSC(77;0.103)		6777			Spectrin 18.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.14606T>A		.	.	.	.	.	.	.	.	.	.	A	19.02	3.745819	0.69418	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.63255	0.81;0.81;0.81;0.81;0.9;0.05;-0.03	4.88	4.88	0.63580	.	0.000000	0.35615	N	0.003091	T	0.65668	0.2713	M	0.64997	1.995	0.36695	D	0.879780	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.987	D;D;D;D;D;P	0.97110	1.0;1.0;0.999;0.989;0.999;0.882	T	0.64343	-0.6430	9	0.13853	T	0.58	.	14.7828	0.69779	1.0:0.0:0.0:0.0	.	4691;6779;6957;61;6777;4365	Q5TBT1;E7ERU2;E9PEB9;Q9H722;Q03001;Q03001-8	.;.;.;.;DYST_HUMAN;.	Q	4365;6957;6779;4691;6453;4582;6668	ENSP00000244364:L4365Q;ENSP00000359790:L6957Q;ENSP00000359805:L6779Q;ENSP00000400883:L4691Q;ENSP00000393645:L6453Q;ENSP00000359824:L4582Q;ENSP00000354508:L6668Q	ENSP00000244364:L4365Q	L	-	2	0	DST	56459945	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.444000	0.80532	1.960000	0.56953	0.455000	0.32223	CTG		0.423	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		16	20	0	0	0	0.028581	0	16	20				
ABCB5	340273	broad.mit.edu	37	7	20778661	20778661	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:20778661G>T	ENST00000404938.2	+	24	3575	c.2923G>T	c.(2923-2925)Gct>Tct	p.A975S	ABCB5_ENST00000258738.6_Missense_Mutation_p.A530S	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	975	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GCTCGTTTTGGCTCCTGAATA	0.433																																							uc003suw.3		NA																	0				skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(1588-1590)GCT>TCT		ATP-binding cassette, sub-family B, member 5							64.0	61.0	62.0					7																	20778661		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20778661G>T	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2923G>T	7.37:g.20778661G>T	ENSP00000384881:p.Ala975Ser		Somatic				ABCB5_uc010kuh.2_Missense_Mutation_p.A975S	p.A530S	NM_178559	NP_848654	WXS	Illumina HiSeq	Unspecified	Q2M3G0	ABCB5_HUMAN			15	2134	+			530			Cytoplasmic (Potential).|ABC transmembrane type-1.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.1588G>T	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142673	0.57044	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.73258	-0.73;-0.73	4.99	4.11	0.48088	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.091758	0.43919	D	0.000503	T	0.78007	0.4216	M	0.76727	2.345	0.38223	D	0.940807	D;P	0.56035	0.974;0.899	P;P	0.55615	0.78;0.607	T	0.80964	-0.1147	10	0.46703	T	0.11	.	11.2259	0.48884	0.089:0.0:0.911:0.0	.	975;530	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	S	975;530	ENSP00000384881:A975S;ENSP00000258738:A530S	ENSP00000258738:A530S	A	+	1	0	ABCB5	20745186	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	1.493000	0.35605	1.486000	0.48398	0.484000	0.47621	GCT		0.433	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		14	16	1	0	1.67942e-08	0.006122	2.01139e-08	14	16				
PHKG1	5260	broad.mit.edu	37	7	56155447	56155447	+	Missense_Mutation	SNP	G	G	C	rs552608919		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:56155447G>C	ENST00000297373.2	-	3	300	c.106C>G	c.(106-108)Cga>Gga	p.R36G	PHKG1_ENST00000537360.1_5'UTR|PHKG1_ENST00000452681.2_Missense_Mutation_p.R36G|PHKG1_ENST00000489604.1_5'UTR	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	36	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGGATGCATCGCCTGACCACA	0.657																																					Melanoma(184;580 2064 5329 24177 35303)	Melanoma(184;580 2064 5329 24177 35303)	uc003trz.1		NA																	0				large_intestine(1)	1						c.(106-108)CGA>GGA		phosphorylase kinase gamma subunit 1							57.0	47.0	50.0					7																	56155447		2203	4300	6503	SO:0001583	missense	5260				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity	g.chr7:56155447G>C	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.106C>G	7.37:g.56155447G>C	ENSP00000297373:p.Arg36Gly		Somatic				PSPH_uc003trj.2_Intron|PHKG1_uc011kdb.1_Missense_Mutation_p.R36G|PHKG1_uc011kdc.1_Missense_Mutation_p.R36G|PHKG1_uc011kdd.1_5'UTR	p.R36G	NM_006213	NP_006204	WXS	Illumina HiSeq	Unspecified	Q16816	PHKG1_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		3	301	-	Breast(14;0.214)		36			Protein kinase.		B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	ENST00000297373.2	37	c.106C>G	CCDS5525.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093274	0.76756	.	.	ENSG00000164776	ENST00000452681;ENST00000297373	T;T	0.42900	3.2;0.96	5.42	4.53	0.55603	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.56863	0.2014	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.999	T	0.59952	-0.7357	10	0.62326	D	0.03	-32.7593	15.1354	0.72562	0.0:0.0:0.858:0.142	.	36;36;36	B7Z6U2;F5H2S1;Q16816	.;.;PHKG1_HUMAN	G	36	ENSP00000445440:R36G;ENSP00000297373:R36G	ENSP00000297373:R36G	R	-	1	2	PHKG1	56122941	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.268000	0.51585	1.404000	0.46819	0.563000	0.77884	CGA		0.657	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251587.1	NM_006213		18	52	0	0	0	0.010504	0	18	52				
TRRAP	8295	broad.mit.edu	37	7	98506438	98506438	+	Silent	SNP	C	C	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:98506438C>G	ENST00000359863.4	+	14	1412	c.1203C>G	c.(1201-1203)ctC>ctG	p.L401L	TRRAP_ENST00000446306.3_Silent_p.L401L|TRRAP_ENST00000355540.3_Silent_p.L401L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	401					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCGTCCAGCTCTTCGCCAAGA	0.647																																							uc003upp.2		NA																	0				ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(1201-1203)CTC>CTG		transformation/transcription domain-associated							81.0	54.0	63.0					7																	98506438		2203	4300	6503	SO:0001819	synonymous_variant	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98506438C>G	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.1203C>G	7.37:g.98506438C>G			Somatic				TRRAP_uc011kis.1_Silent_p.L401L|TRRAP_uc003upr.2_Silent_p.L93L	p.L401L	NM_003496	NP_003487	WXS	Illumina HiSeq	Unspecified	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		14	1412	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		401					A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	c.1203C>G	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	9.856	1.194956	0.22037	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.84	0.478	0.16789	.	.	.	.	.	T	0.52645	0.1747	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42832	-0.9428	4	.	.	.	.	6.8974	0.24262	0.1898:0.3133:0.4314:0.0654	.	.	.	.	C	116	.	.	S	+	2	0	TRRAP	98344374	0.918000	0.31147	1.000000	0.80357	0.991000	0.79684	-0.101000	0.10973	0.348000	0.23949	0.655000	0.94253	TCT		0.647	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		5	7	0	0	0	0.021553	0	5	7				
DOCK4	9732	broad.mit.edu	37	7	111462421	111462421	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:111462421T>C	ENST00000437633.1	-	27	3183	c.2927A>G	c.(2926-2928)aAc>aGc	p.N976S	DOCK4_ENST00000428084.1_Missense_Mutation_p.N976S|DOCK4-AS1_ENST00000452714.1_RNA	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	976					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GTCTTACTTGTTAGCAACCAA	0.373																																							uc003vfx.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(2926-2928)AAC>AGC		dedicator of cytokinesis 4							76.0	70.0	72.0					7																	111462421		1861	4093	5954	SO:0001583	missense	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111462421T>C		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2927A>G	7.37:g.111462421T>C	ENSP00000404179:p.Asn976Ser		Somatic				DOCK4_uc003vfw.2_Missense_Mutation_p.N417S|DOCK4_uc003vfy.2_Missense_Mutation_p.N1012S	p.N976S	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			27	3196	-		Acute lymphoblastic leukemia(1;0.0441)	976					O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.2927A>G	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.761|8.761	0.923562|0.923562	0.18056|0.18056	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000423057;ENST00000445943	T;T|.	0.65916|.	-0.18;-0.18|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62405|0.62405	0.2425|0.2425	L|L	0.46947|0.46947	1.48|1.48	0.80722|0.80722	D|D	1|1	B;B;B|.	0.27882|.	0.091;0.192;0.088|.	B;B;B|.	0.28553|.	0.062;0.062;0.091|.	T|T	0.59606|0.59606	-0.7423|-0.7423	10|5	0.29301|.	T|.	0.29|.	.|.	14.9177|14.9177	0.70810|0.70810	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1012;976;976|.	Q149N5;Q8N1I0;Q8N1I0-2|.	.;DOCK4_HUMAN;.|.	S|A	964;976;976;964;975|428;1000	ENSP00000410746:N976S;ENSP00000404179:N976S|.	ENSP00000345432:N964S|.	N|T	-|-	2|1	0|0	DOCK4|DOCK4	111249657|111249657	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.032000|0.032000	0.12392|0.12392	7.162000|7.162000	0.77515|0.77515	2.159000|2.159000	0.67721|0.67721	0.528000|0.528000	0.53228|0.53228	AAC|ACA		0.373	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		6	18	0	0	0	0.02938	0	6	18				
GPR85	54329	broad.mit.edu	37	7	112724502	112724502	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:112724502A>G	ENST00000297146.3	-	3	878	c.275T>C	c.(274-276)cTg>cCg	p.L92P	GPR85_ENST00000449591.1_Missense_Mutation_p.L92P|GPR85_ENST00000424100.1_Missense_Mutation_p.L92P|GPR85_ENST00000501255.2_Missense_Mutation_p.L92P|GPR85_ENST00000487573.1_5'Flank	NM_001146266.1	NP_001139738.1	P60893	GPR85_HUMAN	G protein-coupled receptor 85	92					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	17						TTTGCAAGTCAGAGTCCCATA	0.433																																							uc010ljv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(274-276)CTG>CCG		G protein-coupled receptor 85							102.0	101.0	101.0					7																	112724502		2203	4300	6503	SO:0001583	missense	54329					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr7:112724502A>G	AF250237	CCDS5758.1	7q31	2012-08-21			ENSG00000164604	ENSG00000164604		"""GPCR / Class A : Orphans"""	4536	protein-coding gene	gene with protein product		605188				10978537, 10833454	Standard	NM_018970		Approved	SREB2	uc003vgp.1	P60893	OTTHUMG00000156933	ENST00000297146.3:c.275T>C	7.37:g.112724502A>G	ENSP00000297146:p.Leu92Pro		Somatic				GPR85_uc003vgp.1_Missense_Mutation_p.L92P|GPR85_uc003vgq.2_Missense_Mutation_p.L92P|GPR85_uc010ljw.1_Missense_Mutation_p.L92P	p.L92P	NM_001146266	NP_001139738	WXS	Illumina HiSeq	Unspecified	P60893	GPR85_HUMAN			2	792	-			92			Extracellular (Potential).		Q9JHI6|Q9NPD1	Missense_Mutation	SNP	ENST00000297146.3	37	c.275T>C	CCDS5758.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951024	0.53186	.	.	ENSG00000164604	ENST00000501255;ENST00000297146;ENST00000424100;ENST00000449591;ENST00000449735	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.77294	0.4109	L	0.55213	1.73	0.80722	D	1	B	0.33777	0.425	B	0.43445	0.42	T	0.77542	-0.2549	10	0.52906	T	0.07	.	15.8848	0.79238	1.0:0.0:0.0:0.0	.	92	P60893	GPR85_HUMAN	P	92	ENSP00000445808:L92P;ENSP00000297146:L92P;ENSP00000396763:L92P;ENSP00000401178:L92P;ENSP00000415699:L92P	ENSP00000297146:L92P	L	-	2	0	GPR85	112511738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.156000	0.67533	0.533000	0.62120	CTG		0.433	GPR85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346650.2			21	46	0	0	0	0.027356	0	21	46				
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1798-1800)GTG>GAG		B-Raf	Sorafenib(DB00398)						112.0	104.0	107.0					7																	140453136		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140453136A>T	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu		Somatic					p.V600E	NM_004333	NP_004324	WXS	Illumina HiSeq	Unspecified	P15056	BRAF_HUMAN			15	1860	-	Melanoma(164;0.00956)		600		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).	Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1799T>A	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		13	25	0	0	0	0.0333	0	13	25				
SSPO	23145	broad.mit.edu	37	7	149503054	149503054	+	RNA	SNP	G	G	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr7:149503054G>T	ENST00000378016.2	+	0	8558							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATCCAGACACGTGGGCGCAGC	0.637																																							uc010lpk.2		NA																	0					0						c.(8557-8559)CGT>CTT		SCO-spondin precursor							50.0	57.0	54.0					7																	149503054		2107	4236	6343			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149503054G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149503054G>T			Somatic					p.R2853L	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		59	8558	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2853			TSP type-1 8.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.8558G>T																																																																																					0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				9	24	1	0	0.00621372	0.006214	0.00640013	9	24				
RP1L1	94137	broad.mit.edu	37	8	10469767	10469767	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr8:10469767C>A	ENST00000382483.3	-	4	2064	c.1841G>T	c.(1840-1842)gGc>gTc	p.G614V		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	614					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCAGGAAAGGCCCAGAACCAG	0.622																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1840-1842)GGC>GTC		retinitis pigmentosa 1-like 1							41.0	47.0	45.0					8																	10469767		2033	4187	6220	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10469767C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1841G>T	8.37:g.10469767C>A	ENSP00000371923:p.Gly614Val		Somatic					p.G614V	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	2070	-			614					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.1841G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401393	0.42613	.	.	ENSG00000183638	ENST00000382483	T	0.05649	3.41	4.48	0.508	0.16972	.	0.728501	0.11291	N	0.579243	T	0.11281	0.0275	L	0.29908	0.895	0.09310	N	1	D	0.76494	0.999	D	0.64042	0.921	T	0.27839	-1.0062	10	0.66056	D	0.02	-0.7775	7.1734	0.25730	0.0:0.6001:0.0:0.3999	.	614	A6NKC6	.	V	614	ENSP00000371923:G614V	ENSP00000371923:G614V	G	-	2	0	RP1L1	10507177	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.028000	0.13644	-0.129000	0.11620	0.455000	0.32223	GGC		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			21	49	1	0	5.45024e-15	0.01892	7.38651e-15	21	49				
NKX3-1	4824	broad.mit.edu	37	8	23538909	23538909	+	Missense_Mutation	SNP	T	T	C	rs373263457		TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr8:23538909T>C	ENST00000380871.4	-	2	567	c.530A>G	c.(529-531)tAt>tGt	p.Y177C	NKX3-1_ENST00000523261.1_Missense_Mutation_p.Y102C	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	177					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Y177C(2)		large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		CTTAGTCTTATAGCGTCTGTT	0.582																																							uc011kzx.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(529-531)TAT>TGT		NK3 homeobox 1		T	CYS/TYR	0,4406		0,0,2203	166.0	163.0	164.0		530	5.7	1.0	8		164	1,8599	1.2+/-3.3	0,1,4299	no	missense	NKX3-1	NM_006167.3	194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	177/235	23538909	1,13005	2203	4300	6503	SO:0001583	missense	4824				negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding	g.chr8:23538909T>C		CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.530A>G	8.37:g.23538909T>C	ENSP00000370253:p.Tyr177Cys		Somatic				NKX3-1_uc003xdv.1_Intron	p.Y177C	NM_006167	NP_006158	WXS	Illumina HiSeq	Unspecified	Q99801	NKX31_HUMAN		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)	2	578	-		Prostate(55;0.114)	177			Homeobox.		O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	c.530A>G	CCDS6042.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357538	0.82243	0.0	1.16E-4	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.96265	-3.96;-3.96	5.66	5.66	0.87406	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.084010	0.49305	D	0.000157	D	0.98027	0.9350	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98844	1.0756	10	0.87932	D	0	.	14.1488	0.65367	0.0:0.0:0.0:1.0	.	177	Q99801	NKX31_HUMAN	C	177;133;102	ENSP00000370253:Y177C;ENSP00000429729:Y102C	ENSP00000300332:Y133C	Y	-	2	0	NKX3-1	23594854	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.975000	0.88055	2.285000	0.76669	0.533000	0.62120	TAT		0.582	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2			31	60	0	0	0	0.021022	0	31	60				
RIC1	57589	broad.mit.edu	37	9	5753566	5753566	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr9:5753566A>T	ENST00000414202.2	+	14	1713	c.1522A>T	c.(1522-1524)Att>Ttt	p.I508F	KIAA1432_ENST00000418622.3_Missense_Mutation_p.I429F|KIAA1432_ENST00000449720.2_Intron|KIAA1432_ENST00000251879.6_Missense_Mutation_p.I508F|KIAA1432_ENST00000381532.2_Missense_Mutation_p.I429F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TGGACAGAATATTGCTGTGGT	0.313																																							uc003zji.2		NA																	0					0						c.(1285-1287)ATT>TTT		connexin 43-interacting protein 150 isoform a							104.0	103.0	103.0					9																	5753566		2203	4300	6503	SO:0001583	missense	57589					integral to membrane		g.chr9:5753566A>T																												ENST00000414202.2:c.1522A>T	9.37:g.5753566A>T	ENSP00000416696:p.Ile508Phe		Somatic				KIAA1432_uc003zjh.2_Missense_Mutation_p.I429F|KIAA1432_uc003zjl.3_Intron|KIAA1432_uc003zjj.1_Intron	p.I429F	NM_020829	NP_065880	WXS	Illumina HiSeq	Unspecified	Q4ADV7	RIC1_HUMAN		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)	13	1378	+		Acute lymphoblastic leukemia(23;0.154)	508						Missense_Mutation	SNP	ENST00000414202.2	37	c.1285A>T	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	A	16.24	3.067550	0.55539	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.92	3.6	0.41247	.	0.220902	0.47093	D	0.000244	T	0.29093	0.0723	N	0.25332	0.735	0.39688	D	0.971001	B;B	0.26258	0.026;0.145	B;B	0.32465	0.029;0.146	T	0.18178	-1.0345	10	0.72032	D	0.01	-12.5326	4.6923	0.12786	0.5225:0.0:0.4775:0.0	.	508;508	Q4ADV7;G5E932	RIC1_HUMAN;.	F	508;508;429;429	ENSP00000251879:I508F;ENSP00000416696:I508F;ENSP00000370943:I429F;ENSP00000402240:I429F	ENSP00000251879:I508F	I	+	1	0	KIAA1432	5743566	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.852000	0.55934	1.068000	0.40764	0.528000	0.53228	ATT		0.313	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			12	16	0	0	0	0.0333	0	12	16				
TMEM215	401498	broad.mit.edu	37	9	32784744	32784744	+	Missense_Mutation	SNP	A	A	C			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr9:32784744A>C	ENST00000342743.5	+	2	928	c.563A>C	c.(562-564)gAg>gCg	p.E188A		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	188						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						GACAGATCTGAGTGCCCTGAG	0.542																																							uc003zri.3		NA																	0					0						c.(562-564)GAG>GCG		transmembrane protein 215							73.0	60.0	64.0					9																	32784744		2203	4300	6503	SO:0001583	missense	401498					integral to membrane		g.chr9:32784744A>C		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.563A>C	9.37:g.32784744A>C	ENSP00000345468:p.Glu188Ala		Somatic					p.E188A	NM_212558	NP_997723	WXS	Illumina HiSeq	Unspecified	Q68D42	TM215_HUMAN			2	928	+			188					Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	37	c.563A>C	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	A	5.953	0.359776	0.11296	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.57	5.57	0.84162	.	1.219200	0.05740	N	0.601182	T	0.20251	0.0487	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.13522	-1.0506	9	0.25106	T	0.35	-2.7353	9.0522	0.36383	0.836:0.0:0.0:0.164	.	188	Q68D42	TM215_HUMAN	A	188	.	ENSP00000345468:E188A	E	+	2	0	TMEM215	32774744	0.171000	0.23029	0.117000	0.21633	0.872000	0.50106	2.754000	0.47532	2.119000	0.64992	0.533000	0.62120	GAG		0.542	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558		22	35	0	0	0	0.021523	0	22	35				
FOXD4L5	653427	broad.mit.edu	37	9	70177104	70177104	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr9:70177104C>A	ENST00000377420.1	-	1	1711	c.880G>T	c.(880-882)Gca>Tca	p.A294S		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	294					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|lung(2)	7						GGGAAGGGTGCCGGGGTCGCC	0.662																																							uc010moc.2		NA																	0					0						c.(880-882)GCA>TCA		forkhead box D4-like 5							3.0	4.0	4.0					9																	70177104		70	547	617	SO:0001583	missense	653427				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:70177104C>A		CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.880G>T	9.37:g.70177104C>A	ENSP00000366637:p.Ala294Ser		Somatic					p.A294S	NM_001126334	NP_001119806	WXS	Illumina HiSeq	Unspecified	Q5VV16	FX4L5_HUMAN			1	1712	-			294						Missense_Mutation	SNP	ENST00000377420.1	37	c.880G>T	CCDS47977.1	.	.	.	.	.	.	.	.	.	.	c	8.296	0.818868	0.16607	.	.	ENSG00000204779	ENST00000377420	D	0.93712	-3.27	.	.	.	.	68.420100	0.00397	U	0.000040	D	0.83862	0.5346	N	0.08118	0	0.20196	N	0.999923	B	0.21147	0.052	B	0.10450	0.005	T	0.74312	-0.3706	9	0.42905	T	0.14	.	4.6962	0.12804	0.3551:0.6448:0.0:1.0E-4	.	294	Q5VV16	FX4L5_HUMAN	S	294	ENSP00000366637:A294S	ENSP00000366637:A294S	A	-	1	0	FOXD4L5	69466924	0.000000	0.05858	0.042000	0.18584	0.375000	0.29983	-0.855000	0.04295	-0.756000	0.04703	0.074000	0.15403	GCA		0.662	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037122.1	NM_001126334		8	90	1	0	6.44725e-10	0.014323	8.00081e-10	8	90				
IL3RA	3563	broad.mit.edu	37	X	1464277	1464277	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chrX:1464277A>G	ENST00000331035.4	+	3	482	c.133A>G	c.(133-135)Aga>Gga	p.R45G	IL3RA_ENST00000381469.2_Intron	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	45					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGACCTTAACAGAAATGTGAC	0.388																																							uc004cps.2		NA																	0				skin(2)|lung(1)	3						c.(133-135)AGA>GGA		interleukin 3 receptor, alpha precursor	Sargramostim(DB00020)						292.0	278.0	283.0					X																	1464277		2200	4296	6496	SO:0001583	missense	3563					integral to membrane|plasma membrane	interleukin-3 receptor activity	g.chrX:1464277A>G	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.133A>G	X.37:g.1464277A>G	ENSP00000327890:p.Arg45Gly		Somatic				IL3RA_uc011mhd.1_Intron	p.R45G	NM_002183	NP_002174	WXS	Illumina HiSeq	Unspecified	P26951	IL3RA_HUMAN			3	482	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	45			Extracellular (Potential).		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	ENST00000331035.4	37	c.133A>G	CCDS14113.1	.	.	.	.	.	.	.	.	.	.	.	0.014	-1.602605	0.00849	.	.	ENSG00000185291	ENST00000331035	T	0.29917	1.55	0.739	-1.14	0.09741	.	5.381210	0.01658	N	0.024927	T	0.12475	0.0303	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12734	-1.0536	9	0.28530	T	0.3	-11.2339	.	.	.	.	45	P26951	IL3RA_HUMAN	G	45	ENSP00000327890:R45G	ENSP00000327890:R45G	R	+	1	2	IL3RA	1424277	0.008000	0.16893	0.007000	0.13788	0.021000	0.10359	0.360000	0.20250	-0.354000	0.08212	0.144000	0.16011	AGA		0.388	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3			46	93	0	0	0	0.01441	0	46	93				
TGIF2LX	90316	broad.mit.edu	37	X	89177720	89177720	+	Silent	SNP	C	C	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chrX:89177720C>A	ENST00000561129.2	+	1	766	c.636C>A	c.(634-636)gcC>gcA	p.A212A	TGIF2LX_ENST00000283891.5_Silent_p.A212A			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						AGGAGCACGCCGACTTCAGCA	0.527																																							uc004efe.2		NA																	0				ovary(1)|skin(1)	2						c.(634-636)GCC>GCA		TGFB-induced factor homeobox 2-like, X-linked							57.0	60.0	59.0					X																	89177720		2202	4297	6499	SO:0001819	synonymous_variant	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177720C>A	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.636C>A	X.37:g.89177720C>A			Somatic					p.A212A	NM_138960	NP_620410	WXS	Illumina HiSeq	Unspecified	Q8IUE1	TF2LX_HUMAN			2	685	+			212					Q5JRM9|Q8TD48	Silent	SNP	ENST00000561129.2	37	c.636C>A	CCDS14459.1																																																																																				0.527	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		13	16	1	0	1.5842e-08	0.016723	1.91968e-08	13	16				
MAGEC1	9947	broad.mit.edu	37	X	140994960	140994960	+	Silent	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chrX:140994960G>A	ENST00000285879.4	+	4	2056	c.1770G>A	c.(1768-1770)ctG>ctA	p.L590L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	590										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGGACTCCCTGTCTCCTCACT	0.567										HNSCC(15;0.026)																													uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1768-1770)CTG>CTA		melanoma antigen family C, 1							229.0	245.0	240.0					X																	140994960		2203	4300	6503	SO:0001819	synonymous_variant	9947						protein binding	g.chrX:140994960G>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1770G>A	X.37:g.140994960G>A		HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.L590L	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2056	+	Acute lymphoblastic leukemia(192;6.56e-05)		590					A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	c.1770G>A	CCDS35417.1																																																																																				0.567	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		10	417	0	0	0	0.010729	0	10	417				
MAGEA4	4103	broad.mit.edu	37	X	151092402	151092402	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chrX:151092402G>A	ENST00000360243.2	+	3	533	c.266G>A	c.(265-267)aGc>aAc	p.S89N	MAGEA4_ENST00000393920.1_Missense_Mutation_p.S89N|MAGEA4_ENST00000370337.4_Missense_Mutation_p.S89N|MAGEA4_ENST00000370340.3_Missense_Mutation_p.S89N|MAGEA4_ENST00000370335.1_Missense_Mutation_p.S89N|MAGEA4_ENST00000393921.1_Missense_Mutation_p.S89N|MAGEA4_ENST00000276344.2_Missense_Mutation_p.S89N	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	89										breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGTTCCAGCAGCCAAGAA	0.572																																							uc004fez.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(265-267)AGC>AAC		melanoma antigen family A, 4							71.0	66.0	68.0					X																	151092402		2203	4299	6502	SO:0001583	missense	4103						protein binding	g.chrX:151092402G>A		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.266G>A	X.37:g.151092402G>A	ENSP00000353379:p.Ser89Asn		Somatic				MAGEA4_uc004ffa.2_Missense_Mutation_p.S89N|MAGEA4_uc004ffb.2_Missense_Mutation_p.S89N|MAGEA4_uc004ffc.2_Missense_Mutation_p.S89N|MAGEA4_uc004ffd.2_Missense_Mutation_p.S89N	p.S89N	NM_002362	NP_002353	WXS	Illumina HiSeq	Unspecified	P43358	MAGA4_HUMAN			3	422	+	Acute lymphoblastic leukemia(192;6.56e-05)		89					Q14798	Missense_Mutation	SNP	ENST00000360243.2	37	c.266G>A	CCDS14702.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936310	0.34189	.	.	ENSG00000147381	ENST00000431963;ENST00000276344;ENST00000448295;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000416020;ENST00000425182;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.04917	3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53	2.3	0.276	0.15663	Melanoma associated antigen, MAGE, N-terminal (1);	1.338660	0.04357	N	0.356817	T	0.20414	0.0491	M	0.77406	2.37	0.09310	N	1	D	0.63880	0.993	D	0.65573	0.936	T	0.10590	-1.0623	10	0.34782	T	0.22	.	3.773	0.08649	0.0:0.284:0.4479:0.2681	.	89	P43358	MAGA4_HUMAN	N	89	ENSP00000387777:S89N;ENSP00000276344:S89N;ENSP00000391904:S89N;ENSP00000377498:S89N;ENSP00000394149:S89N;ENSP00000359362:S89N;ENSP00000402624:S89N;ENSP00000377497:S89N;ENSP00000359365:S89N;ENSP00000394073:S89N;ENSP00000400900:S89N;ENSP00000402186:S89N;ENSP00000359360:S89N;ENSP00000353379:S89N;ENSP00000390096:S89N	ENSP00000276344:S89N	S	+	2	0	MAGEA4	150843058	0.013000	0.17824	0.001000	0.08648	0.033000	0.12548	2.097000	0.41748	-0.030000	0.13804	0.436000	0.28706	AGC		0.572	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362		24	41	0	0	0	0.027356	0	24	41				
CAPN2	824	broad.mit.edu	37	1	223939704	223939713	+	Frame_Shift_Del	DEL	CAAGCTGGAA	CAAGCTGGAA	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	CAAGCTGGAA	CAAGCTGGAA	-	-	CAAGCTGGAA	CAAGCTGGAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr1:223939704_223939713delCAAGCTGGAA	ENST00000295006.5	+	8	1214_1223	c.905_914delCAAGCTGGAA	c.(904-915)ccaagctggaacfs	p.PSWN302fs	CAPN2_ENST00000433674.2_Frame_Shift_Del_p.PSWN224fs	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	302	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TCCAGCTGCCCAAGCTGGAACACTATAGAC	0.514																																							uc001hob.3		NA																	0				lung(3)|breast(1)|skin(1)	5						c.(904-915)CCAAGCTGGAACfs		calpain 2 isoform 1																																				SO:0001589	frameshift_variant	824				proteolysis	cytoplasm|plasma membrane		g.chr1:223939704_223939713delCAAGCTGGAA	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.905_914delCAAGCTGGAA	1.37:g.223939704_223939713delCAAGCTGGAA	ENSP00000295006:p.Pro302fs		Somatic				CAPN2_uc010puy.1_Frame_Shift_Del_p.P224fs	p.P302fs	NM_001748	NP_001739	WXS	Illumina HiSeq	Unspecified	P17655	CAN2_HUMAN		GBM - Glioblastoma multiforme(131;0.109)	8	1129_1138	+			302_305			Calpain catalytic.		A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Frame_Shift_Del	DEL	ENST00000295006.5	37	c.905_914delCAAGCTGGAA	CCDS31035.1																																																																																				0.514	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748		8	61	NA	NA	NA	NA	NA	8	61	---	---	---	---
PPP2R5B	5526	broad.mit.edu	37	11	64699334	64699334	+	Frame_Shift_Del	DEL	T	T	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr11:64699334delT	ENST00000164133.2	+	11	1732	c.1110delT	c.(1108-1110)catfs	p.H370fs		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	370					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CCAGCCCCCATTTCCAGGTAT	0.552																																							uc001oby.2		NA																	0				ovary(2)	2						c.(1108-1110)CATfs		beta isoform of regulatory subunit B56, protein							58.0	58.0	58.0					11																	64699334		2201	4297	6498	SO:0001589	frameshift_variant	5526				signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr11:64699334delT	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.1110delT	11.37:g.64699334delT	ENSP00000164133:p.His370fs		Somatic				PPP2R5B_uc001obz.2_Frame_Shift_Del_p.H370fs	p.H370fs	NM_006244	NP_006235	WXS	Illumina HiSeq	Unspecified	Q15173	2A5B_HUMAN			11	1695	+			370					Q13853	Frame_Shift_Del	DEL	ENST00000164133.2	37	c.1110delT	CCDS8085.1																																																																																				0.552	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244		30	66	NA	NA	NA	NA	NA	30	66	---	---	---	---
TXNRD1	7296	broad.mit.edu	37	12	104707093	104707093	+	Frame_Shift_Del	DEL	G	G	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr12:104707093delG	ENST00000529546.1	+	3	269	c.44delG	c.(43-45)tggfs	p.W15fs	TXNRD1_ENST00000427956.1_Frame_Shift_Del_p.W168fs|TXNRD1_ENST00000397736.2_Frame_Shift_Del_p.W97fs|TXNRD1_ENST00000429002.2_Frame_Shift_Del_p.W203fs|TXNRD1_ENST00000526950.1_Frame_Shift_Del_p.W122fs|TXNRD1_ENST00000503506.2_Frame_Shift_Del_p.W53fs|TXNRD1_ENST00000526390.1_Frame_Shift_Del_p.W97fs|TXNRD1_ENST00000526691.1_Frame_Shift_Del_p.W105fs|TXNRD1_ENST00000540716.1_Frame_Shift_Del_p.W15fs|TXNRD1_ENST00000542918.1_Frame_Shift_Del_p.W103fs|TXNRD1_ENST00000354940.6_Frame_Shift_Del_p.W53fs|TXNRD1_ENST00000524698.1_Frame_Shift_Del_p.W53fs|TXNRD1_ENST00000388854.3_Frame_Shift_Del_p.W105fs|TXNRD1_ENST00000378070.4_Frame_Shift_Del_p.W152fs|TXNRD1_ENST00000525566.1_Frame_Shift_Del_p.W203fs			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	203					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	GGAACTAGATGGGGTAAGCTT	0.403																																					Ovarian(139;555 1836 9186 9946 10884)	Ovarian(139;555 1836 9186 9946 10884)	uc010swk.1		NA																	0					0						c.(607-609)TGGfs		thioredoxin reductase 1 isoform 3							50.0	50.0	50.0					12																	104707093		1866	4097	5963	SO:0001589	frameshift_variant	7296				cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity	g.chr12:104707093delG		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.44delG	12.37:g.104707093delG	ENSP00000434919:p.Trp15fs		Somatic				TXNRD1_uc010swl.1_Frame_Shift_Del_p.W53fs|TXNRD1_uc010swm.1_Frame_Shift_Del_p.W105fs|TXNRD1_uc010swn.1_Frame_Shift_Del_p.W53fs|TXNRD1_uc010swo.1_Frame_Shift_Del_p.W53fs|TXNRD1_uc010swp.1_Frame_Shift_Del_p.W15fs|TXNRD1_uc010swq.1_Frame_Shift_Del_p.W103fs|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Frame_Shift_Del_p.W119fs|TXNRD1_uc001tko.1_RNA|TXNRD1_uc001tkp.1_RNA	p.W203fs	NM_001093771	NP_001087240	WXS	Illumina HiSeq	Unspecified	Q16881	TRXR1_HUMAN			6	630	+			203			FAD (By similarity).		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Frame_Shift_Del	DEL	ENST00000529546.1	37	c.608delG	CCDS58274.1																																																																																				0.403	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389969.1	NM_003330		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
GRIN2C	2905	broad.mit.edu	37	17	72842339	72842344	+	In_Frame_Del	DEL	TTGCCT	TTGCCT	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	TTGCCT	TTGCCT	-	-	TTGCCT	TTGCCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr17:72842339_72842344delTTGCCT	ENST00000293190.5	-	11	2357_2362	c.2211_2216delAGGCAA	c.(2209-2217)gcaggcaag>gcg	p.GK738del	GRIN2C_ENST00000347612.4_In_Frame_Del_p.GK738del	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	738					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCCTCGTCCTTGCCTGCCATGTAGT	0.597																																							uc002jlt.1		NA																	0				ovary(2)|breast(2)	4						c.(2209-2217)GCAGGCAAG>GCG		N-methyl-D-aspartate receptor subunit 2C	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)																																			SO:0001651	inframe_deletion	2905				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity	g.chr17:72842339_72842344delTTGCCT		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.2211_2216delAGGCAA	17.37:g.72842339_72842344delTTGCCT	ENSP00000293190:p.Gly738_Lys739del		Somatic				GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_In_Frame_Del_p.GK738del	p.GK738del	NM_000835	NP_000826	WXS	Illumina HiSeq	Unspecified	Q14957	NMDE3_HUMAN			11	2367_2372	-	all_lung(278;0.172)|Lung NSC(278;0.207)		738_739			Extracellular (Potential).		B2RTT1	In_Frame_Del	DEL	ENST00000293190.5	37	c.2211_2216delAGGCAA	CCDS32724.1																																																																																				0.597	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1			34	69	NA	NA	NA	NA	NA	34	69	---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47098880	47098881	+	Frame_Shift_Ins	INS	-	-	T			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:47098880_47098881insT	ENST00000409792.3	-	15	6435_6436	c.6393_6394insA	c.(6391-6396)caacggfs	p.R2132fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2132					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.R1629fs*15(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGAGCCTCCCGTTGAGCCACCT	0.455			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		1	Deletion - Frameshift(1)	p.R1629fs*15(1)	kidney(1)	kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(6391-6396)CAACGGfs		SET domain containing 2																																				SO:0001589	frameshift_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47098880_47098881insT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6394dupA	3.37:g.47098882_47098882dupT	ENSP00000386759:p.Arg2132fs		Somatic				SETD2_uc003cqv.2_Frame_Shift_Ins_p.Q2198fs|SETD2_uc003cqt.1_RNA	p.Q2131fs	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	15	6446_6447	-		Acute lymphoblastic leukemia(5;0.0169)	2131_2132			Potential.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	c.6393_6394insA	CCDS2749.2																																																																																				0.455	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		28	88	NA	NA	NA	NA	NA	28	88	---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47163361	47163361	+	Frame_Shift_Del	DEL	T	T	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:47163361delT	ENST00000409792.3	-	3	2807	c.2765delA	c.(2764-2766)aagfs	p.K922fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	922					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCCTGCATGCTTTAAAAACTC	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(2764-2766)AAGfs		SET domain containing 2							111.0	116.0	114.0					3																	47163361		2203	4300	6503	SO:0001589	frameshift_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47163361delT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2765delA	3.37:g.47163361delT	ENSP00000386759:p.Lys922fs		Somatic				SETD2_uc003cqv.2_Frame_Shift_Del_p.K911fs	p.K922fs	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	3	2818	-		Acute lymphoblastic leukemia(5;0.0169)	922					O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	c.2765delA	CCDS2749.2																																																																																				0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		22	43	NA	NA	NA	NA	NA	22	43	---	---	---	---
C3orf58	205428	broad.mit.edu	37	3	143691464	143691472	+	In_Frame_Del	DEL	GCGAGCCCC	GCGAGCCCC	-			TCGA-86-7714-01A-12D-2167-08	TCGA-86-7714-10A-01D-2167-08	GCGAGCCCC	GCGAGCCCC	-	-	GCGAGCCCC	GCGAGCCCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	75da25e4-927d-4bf6-ba40-54ac5c109b3c	53d2a678-c2c3-46ac-9b69-9e29bb392037	g.chr3:143691464_143691472delGCGAGCCCC	ENST00000315691.3	+	1	825_833	c.290_298delGCGAGCCCC	c.(289-300)ggcgagccccgc>ggc	p.EPR98del	C3orf58_ENST00000495414.1_5'Flank|C3orf58_ENST00000441925.2_5'Flank	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	98					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCGCAGTACGGCGAGCCCCGCGAGGGCGG	0.708																																							uc003evo.2		NA																	0				ovary(1)	1						c.(289-300)GGCGAGCCCCGC>GGC		hypothetical protein LOC205428 isoform a																																				SO:0001651	inframe_deletion	205428					COPI vesicle coat|extracellular region		g.chr3:143691464_143691472delGCGAGCCCC	AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.290_298delGCGAGCCCC	3.37:g.143691464_143691472delGCGAGCCCC	ENSP00000320081:p.Glu98_Arg100del		Somatic				C3orf58_uc011bnl.1_5'Flank	p.EPR98del	NM_173552	NP_775823	WXS	Illumina HiSeq	Unspecified	Q8NDZ4	CC058_HUMAN			1	825_833	+			98_100					B2RCF2|B7Z1W3	In_Frame_Del	DEL	ENST00000315691.3	37	c.290_298delGCGAGCCCC	CCDS3130.1																																																																																				0.708	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1	NM_173552		8	67	NA	NA	NA	NA	NA	8	67	---	---	---	---
