#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
KLHL21	9903	broad.mit.edu	37	1	6655584	6655584	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:6655584C>A	ENST00000377658.4	-	3	1512	c.1461G>T	c.(1459-1461)ccG>ccT	p.P487P	KLHL21_ENST00000463043.1_Silent_p.P120P|KLHL21_ENST00000377663.3_Silent_p.P487P|KLHL21_ENST00000467612.1_Silent_p.P120P	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	487					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)		p.P487P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		CGTTCCTCGTCGGGTTGTACA	0.567																																							uc001aoa.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1459-1461)CCG>CCT		kelch-like 21							131.0	108.0	116.0					1																	6655584		2203	4300	6503	SO:0001819	synonymous_variant	9903				anaphase|cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|polar microtubule		g.chr1:6655584C>A	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1461G>T	1.37:g.6655584C>A			Somatic				KLHL21_uc001anz.1_Silent_p.P487P|KLHL21_uc009vme.2_Silent_p.P120P	p.P487P	NM_014851	NP_055666	WXS	Illumina HiSeq	Unspecified	Q9UJP4	KLH21_HUMAN		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)	3	1513	-	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)	487			Kelch 5.		B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Silent	SNP	ENST00000377658.4	37	c.1461G>T	CCDS30575.1																																																																																				0.567	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851		11	33	1	0	2.32078e-09	0.003163	3.56353e-09	11	33				
SLC45A1	50651	broad.mit.edu	37	1	8390292	8390292	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:8390292G>A	ENST00000471889.1	+	5	1124	c.739G>A	c.(739-741)Gtg>Atg	p.V247M	SLC45A1_ENST00000289877.8_Missense_Mutation_p.V247M|Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000377479.2_Missense_Mutation_p.V281M			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	247					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.V247M(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CTTTGGATACGTGGTCGGCGG	0.607																																							uc001apb.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|pancreas(1)|skin(1)	4						c.(739-741)GTG>ATG		DNB5							71.0	71.0	71.0					1																	8390292		2203	4300	6503	SO:0001583	missense	50651				carbohydrate transport	integral to membrane	symporter activity	g.chr1:8390292G>A	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.739G>A	1.37:g.8390292G>A	ENSP00000418096:p.Val247Met		Somatic				SLC45A1_uc001apc.2_Translation_Start_Site	p.V247M	NM_001080397	NP_001073866	WXS	Illumina HiSeq	Unspecified	Q9Y2W3	S45A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)	4	739	+	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)	247			Helical; (Potential).		Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	c.739G>A	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227370	0.39399	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.92249	-3.0;-3.0;-3.0	4.59	4.59	0.56863	Major facilitator superfamily domain, general substrate transporter (1);	0.178343	0.48767	D	0.000180	D	0.92388	0.7584	L	0.31065	0.9	0.53688	D	0.999978	D	0.71674	0.998	D	0.64042	0.921	D	0.91411	0.5151	10	0.30854	T	0.27	-28.1783	16.7663	0.85525	0.0:0.0:1.0:0.0	.	247	Q9Y2W3	S45A1_HUMAN	M	247;281;247	ENSP00000418096:V247M;ENSP00000366699:V281M;ENSP00000289877:V247M	ENSP00000289877:V247M	V	+	1	0	SLC45A1	8312879	1.000000	0.71417	0.917000	0.36280	0.486000	0.33341	5.120000	0.64685	2.262000	0.75019	0.462000	0.41574	GTG		0.607	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5			5	75	0	0	0	0.000602	0	5	75				
Unknown	0	broad.mit.edu	37	1	13183710	13183710	+	IGR	SNP	C	C	T	rs545465984	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:13183710C>T								RP13-221M14.3 (19242 upstream) : PRAMEF26 (32645 downstream)																							TCATATTGAACGAAGGCAAAG	0.473																																							uc010obg.1		NA																	0					0						c.(163-165)GTT>ATT		heterogeneous nuclear ribonucleoprotein C-like							19.0	16.0	17.0					1																	13183710		691	1585	2276	SO:0001628	intergenic_variant	440563					ribonucleoprotein complex	nucleic acid binding|nucleotide binding	g.chr1:13183710C>T																													1.37:g.13183710C>T			Somatic					p.V55I	NM_001136561	NP_001130033	WXS	Illumina HiSeq	Unspecified	B2RXH8	B2RXH8_HUMAN			1	258	-			55						Missense_Mutation	SNP		37	c.163G>A																																																																																				0	0.473									8	50	0	0	0	0.000673	0	8	50				
SH2D5	400745	broad.mit.edu	37	1	21050589	21050589	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:21050589C>T	ENST00000444387.2	-	7	1183	c.786G>A	c.(784-786)tcG>tcA	p.S262S	SH2D5_ENST00000460804.1_5'UTR|SH2D5_ENST00000375031.1_Silent_p.S178S	NM_001103161.1	NP_001096631.1	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5	262								p.S178S(1)		lung(4)|prostate(1)|upper_aerodigestive_tract(1)	6		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTCCCGAGCCGACAGCTGCA	0.667																																							uc001bdt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(532-534)TCG>TCA		SH2 domain containing 5 isoform 2							34.0	43.0	40.0					1																	21050589		2132	4213	6345	SO:0001819	synonymous_variant	400745							g.chr1:21050589C>T	AK124869, AK123236	CCDS41280.1, CCDS44080.1	1p36.12	2008-02-05			ENSG00000189410	ENSG00000189410			28819	protein-coding gene	gene with protein product							Standard	NM_001103161		Approved		uc009vpy.1	Q6ZV89	OTTHUMG00000002620	ENST00000444387.2:c.786G>A	1.37:g.21050589C>T			Somatic				SH2D5_uc009vpy.1_Silent_p.S262S|SH2D5_uc001bdu.1_RNA	p.S178S	NM_001103160	NP_001096630	WXS	Illumina HiSeq	Unspecified	Q6ZV89	SH2D5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	6	1159	-		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	178					B7Z3W3|Q5SSJ2	Silent	SNP	ENST00000444387.2	37	c.534G>A	CCDS44080.1																																																																																				0.667	SH2D5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007455.2	XM_375698		6	28	0	0	0	0.001984	0	6	28				
PHACTR4	65979	broad.mit.edu	37	1	28818172	28818172	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:28818172G>T	ENST00000373839.3	+	12	2150	c.1889G>T	c.(1888-1890)aGg>aTg	p.R630M	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.R640M	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	630					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)	p.R640M(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CTCAGTCAAAGGCCAACTGTC	0.448																																							uc001bpw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1888-1890)AGG>ATG		phosphatase and actin regulator 4 isoform 1							81.0	85.0	84.0					1																	28818172		1970	4152	6122	SO:0001583	missense	65979						actin binding|protein phosphatase inhibitor activity	g.chr1:28818172G>T	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1889G>T	1.37:g.28818172G>T	ENSP00000362945:p.Arg630Met		Somatic				PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Missense_Mutation_p.R614M|PHACTR4_uc001bpy.2_Missense_Mutation_p.R640M|PHACTR4_uc001bpz.2_RNA	p.R630M	NM_001048183	NP_001041648	WXS	Illumina HiSeq	Unspecified	Q8IZ21	PHAR4_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)	12	2171	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)	630			RPEL 3.		A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	37	c.1889G>T	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026421	0.93518	.	.	ENSG00000204138	ENST00000373839;ENST00000373836	T;T	0.57436	0.42;0.4	5.77	5.77	0.91146	.	0.042779	0.85682	D	0.000000	T	0.74015	0.3661	M	0.80183	2.485	0.80722	D	1	D;D	0.65815	0.995;0.984	D;D	0.64321	0.924;0.911	T	0.76759	-0.2841	10	0.87932	D	0	-5.9106	19.0261	0.92932	0.0:0.0:1.0:0.0	.	640;630	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	M	630;640	ENSP00000362945:R630M;ENSP00000362942:R640M	ENSP00000362942:R640M	R	+	2	0	PHACTR4	28690759	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.818000	0.99354	2.737000	0.93849	0.558000	0.71614	AGG		0.448	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923		35	82	1	0	1.836e-18	0.003755	3.24884e-18	35	82				
A3GALT2	127550	broad.mit.edu	37	1	33778171	33778171	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:33778171G>T	ENST00000442999.3	-	3	127	c.128C>A	c.(127-129)cCc>cAc	p.P43H	RP11-415J8.3_ENST00000457957.2_RNA|A3GALT2_ENST00000330379.5_5'Flank|RP11-415J8.3_ENST00000587696.1_RNA|RP11-415J8.3_ENST00000588828.1_RNA	NM_001080438.1	NP_001073907.1			alpha 1,3-galactosyltransferase 2									p.P43H(1)					Myeloproliferative disorder(586;0.0393)				GACGCCCATGGGGATGAGGGC	0.627																																							uc001bxd.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(127-129)CCC>CAC		RecName: Full=Alpha 1,3-galactosyltransferase 2;          Short=A3galt2;          EC=2.4.1.87; AltName: Full=Isoglobotriaosylceramide synthase; AltName: Full=iGb3 synthase;          Short=iGb3S; Flags: Precursor;							72.0	77.0	75.0					1																	33778171		1976	4170	6146	SO:0001583	missense	0							g.chr1:33778171G>T		CCDS60080.1	1p35.1	2013-09-05	2013-03-11	2013-03-11	ENSG00000184389	ENSG00000184389		"""Glycosyltransferase family 6 domain containing"""	30005	protein-coding gene	gene with protein product	"""iGb3 synthase"", ""isoglobotriaosylceramide synthase"""		"""alpha 1,3-galactosyltransferase 2, pseudogene"""	A3GALT2P		10854427, 18630988	Standard	NM_001080438		Approved	IGBS3S	uc031plq.1		OTTHUMG00000004125	ENST00000442999.3:c.128C>A	1.37:g.33778171G>T	ENSP00000475261:p.Pro43His		Somatic					p.P43H	NM_001080438	NP_001073907	WXS	Illumina HiSeq	Unspecified					3	128	-									Missense_Mutation	SNP	ENST00000442999.3	37	c.128C>A																																																																																					0.627	A3GALT2-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000011861.3	NM_001080438		5	77	1	0	8.12818e-05	0.001984	0.000105711	5	77				
MACF1	23499	broad.mit.edu	37	1	39852909	39852909	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:39852909C>T	ENST00000372915.3	+	57	14497	c.14410C>T	c.(14410-14412)Cag>Tag	p.Q4804*	MACF1_ENST00000564288.1_Nonsense_Mutation_p.Q4799*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.Q4836*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.Q2737*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.Q2737*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.Q2716*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.Q2737*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.Q3239*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4804					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Q2737*(1)|p.Q3239*(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCAGCAGTTCCAGCAAATGTT	0.443																																							uc010oiu.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(9715-9717)CAG>TAG		microfilament and actin filament cross-linker							136.0	153.0	147.0					1																	39852909		2203	4300	6503	SO:0001587	stop_gained	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39852909C>T	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14410C>T	1.37:g.39852909C>T	ENSP00000362006:p.Gln4804*		Somatic				MACF1_uc010ois.1_Nonsense_Mutation_p.Q2737*|MACF1_uc001cda.1_Nonsense_Mutation_p.Q2624*|MACF1_uc001cdc.1_Nonsense_Mutation_p.Q1803*	p.Q3239*	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		22	9846	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	4804			Spectrin 4.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	ENST00000372915.3	37	c.9715C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	45|45	11.759532|11.759532	0.99599|0.99599	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.56097	.|D	.|0.000021	T|.	0.82204|.	0.4986|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.82615|.	-0.0370|.	4|.	.|0.72032	.|D	.|0.01	.|.	20.6208|20.6208	0.99490|0.99490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	1849|2737;4804;2737;2737;2716;3239	.|.	.|ENSP00000289893:Q3239X	P|Q	+|+	2|1	0|0	MACF1|MACF1	39625496|39625496	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CCA|CAG		0.443	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		33	242	0	0	0	0.003755	0	33	242				
ASB17	127247	broad.mit.edu	37	1	76387904	76387904	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:76387904A>G	ENST00000284142.6	-	2	681	c.542T>C	c.(541-543)aTt>aCt	p.I181T		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	181					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.I181T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TGTTAAGACAATGTTGATAGG	0.358																																							uc001dhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(541-543)ATT>ACT		ankyrin repeat and SOCS box-containing 17							117.0	99.0	105.0					1																	76387904		2203	4300	6503	SO:0001583	missense	127247				intracellular signal transduction			g.chr1:76387904A>G	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.542T>C	1.37:g.76387904A>G	ENSP00000284142:p.Ile181Thr		Somatic				ASB17_uc001dhf.1_RNA	p.I181T	NM_080868	NP_543144	WXS	Illumina HiSeq	Unspecified	Q8WXJ9	ASB17_HUMAN			2	682	-			181					B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	37	c.542T>C	CCDS671.1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.964469	0.34659	.	.	ENSG00000154007	ENST00000284142	T	0.35421	1.31	4.81	4.81	0.61882	.	0.703487	0.12800	N	0.438100	T	0.11024	0.0269	N	0.19112	0.55	0.28823	N	0.897576	B	0.31318	0.319	B	0.23018	0.043	T	0.14699	-1.0463	10	0.87932	D	0	.	11.0751	0.48027	1.0:0.0:0.0:0.0	.	181	Q8WXJ9	ASB17_HUMAN	T	181	ENSP00000284142:I181T	ENSP00000284142:I181T	I	-	2	0	ASB17	76160492	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.250000	0.51445	1.945000	0.56424	0.378000	0.23410	ATT		0.358	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868		15	48	0	0	0	0.00245	0	15	48				
LPHN2	23266	broad.mit.edu	37	1	82456564	82456564	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:82456564A>T	ENST00000370728.1	+	25	4760	c.4115A>T	c.(4114-4116)tAt>tTt	p.Y1372F	LPHN2_ENST00000335786.5_Missense_Mutation_p.Y1329F|LPHN2_ENST00000370725.1_Missense_Mutation_p.Y1387F|LPHN2_ENST00000370727.1_Missense_Mutation_p.Y1344F|LPHN2_ENST00000370723.1_Missense_Mutation_p.Y1374F|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000370730.1_Missense_Mutation_p.Y1329F|LPHN2_ENST00000394879.1_Missense_Mutation_p.Y1374F|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000370721.1_Missense_Mutation_p.Y1297F|LPHN2_ENST00000271029.4_Missense_Mutation_p.Y1344F|LPHN2_ENST00000319517.6_Missense_Mutation_p.Y1316F|LPHN2_ENST00000370717.2_Missense_Mutation_p.Y1387F|LPHN2_ENST00000359929.3_Missense_Mutation_p.Y1316F			O95490	LPHN2_HUMAN	latrophilin 2	1372					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.Y1387F(1)|p.Y1316F(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GACTCTCTTTATACAAGCATG	0.517																																							uc001dit.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(3946-3948)TAT>TTT		latrophilin 2 precursor							87.0	85.0	85.0					1																	82456564		2203	4300	6503	SO:0001583	missense	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82456564A>T	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.4115A>T	1.37:g.82456564A>T	ENSP00000359763:p.Tyr1372Phe		Somatic				LPHN2_uc001dis.2_Missense_Mutation_p.Y296F|LPHN2_uc001diu.2_Missense_Mutation_p.Y1316F|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.Y943F	p.Y1316F	NM_012302	NP_036434	WXS	Illumina HiSeq	Unspecified	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	21	4128	+			1372			Cytoplasmic (Potential).		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37	c.3947A>T		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	15.73|15.73|15.73	2.920565|2.920565|2.920565	0.52653|0.52653|0.52653	.|.|.	.|.|.	ENSG00000117114|ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000402328|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T|T;T;D;T;T;T;T;T;T;T;T;D	.|0.56611|0.81739	.|0.45|-1.05;-1.06;-1.53;-1.49;-0.98;-0.93;-1.44;-1.44;-0.98;-0.93;-1.49;-1.53	5.25|5.25|5.25	5.25|5.25|5.25	0.73442|0.73442|0.73442	.|.|.	.|.|0.000000	.|.|0.64402	.|.|D	.|.|0.000001	D|D|D	0.86690|0.86690|0.86690	0.5993|0.5993|0.5993	M|M|M	0.74881|0.74881|0.74881	2.28|2.28|2.28	0.54753|0.54753|0.54753	D|D|D	0.999986|0.999986|0.999986	.|.|D;D	.|.|0.69078	.|.|0.997;0.972	.|.|D;P	.|.|0.69824	.|.|0.966;0.751	D|D|D	0.88874|0.88874|0.88874	0.3335|0.3335|0.3335	5|6|10	.|.|0.87932	.|.|D	.|.|0	.|.|.	15.1961|15.1961|15.1961	0.73088|0.73088|0.73088	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|1316;296	.|.|O95490-2;B3KVU1	.|.|.;.	L|F|F	1264|383|1297;1372;1329;1344;1387;1374;1316;1316;1387;1374;1344;1329	.|ENSP00000385853:L383F|ENSP00000359756:Y1297F;ENSP00000359763:Y1372F;ENSP00000359765:Y1329F;ENSP00000359762:Y1344F;ENSP00000359760:Y1387F;ENSP00000359758:Y1374F;ENSP00000353006:Y1316F;ENSP00000322270:Y1316F;ENSP00000359752:Y1387F;ENSP00000378344:Y1374F;ENSP00000271029:Y1344F;ENSP00000337306:Y1329F	.|.|ENSP00000271029:Y1344F	I|L|Y	+|+|+	1|3|2	0|2|0	LPHN2|LPHN2|LPHN2	82229152|82229152|82229152	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.013000|0.013000|0.013000	0.15412|0.15412|0.15412	0.873000|0.873000|0.873000	0.50193|0.50193|0.50193	8.730000|8.730000|8.730000	0.91510|0.91510|0.91510	1.999000|1.999000|1.999000	0.58509|0.58509|0.58509	0.459000|0.459000|0.459000	0.35465|0.35465|0.35465	ATA|TTA|TAT		0.517	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		7	91	0	0	0	0.001984	0	7	91				
ZNF644	84146	broad.mit.edu	37	1	91403192	91403192	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:91403192T>A	ENST00000370440.1	-	4	3755	c.3538A>T	c.(3538-3540)Atg>Ttg	p.M1180L	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.M1180L|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	1180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1180L(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTTCTCCCATCCTTTTATTT	0.353																																							uc001dnw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(3538-3540)ATG>TTG		zinc finger protein 644 isoform 1							83.0	86.0	85.0					1																	91403192		2203	4299	6502	SO:0001583	missense	84146				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:91403192T>A	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3538A>T	1.37:g.91403192T>A	ENSP00000359469:p.Met1180Leu		Somatic				ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron	p.M1180L	NM_201269	NP_958357	WXS	Illumina HiSeq	Unspecified	Q9H582	ZN644_HUMAN		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)	4	3680	-		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)	1180					A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	c.3538A>T	CCDS731.1	.	.	.	.	.	.	.	.	.	.	T	0.119	-1.127809	0.01770	.	.	ENSG00000122482	ENST00000370440;ENST00000337393	T;T	0.00543	6.68;6.68	6.06	3.62	0.41486	.	0.258254	0.47093	N	0.000246	T	0.00039	0.0001	N	0.00926	-1.1	0.27627	N	0.948158	B	0.02656	0.0	B	0.01281	0.0	T	0.31336	-0.9947	10	0.02654	T	1	-3.5697	1.8506	0.03168	0.2921:0.0853:0.1126:0.5101	.	1180	Q9H582	ZN644_HUMAN	L	1180	ENSP00000359469:M1180L;ENSP00000337008:M1180L	ENSP00000337008:M1180L	M	-	1	0	ZNF644	91175780	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.243000	0.43115	1.078000	0.41014	0.533000	0.62120	ATG		0.353	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186		19	95	0	0	0	0.007413	0	19	95				
SASS6	163786	broad.mit.edu	37	1	100572478	100572478	+	Silent	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:100572478A>G	ENST00000287482.5	-	12	1538	c.1398T>C	c.(1396-1398)aaT>aaC	p.N466N	SASS6_ENST00000535161.1_Silent_p.N299N|SASS6_ENST00000462159.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	466					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)		p.N466N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		ACTTTTCATTATTTTTTAGAA	0.308																																							uc001dsu.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1396-1398)AAT>AAC		spindle assembly abnormal protein 6							78.0	79.0	79.0					1																	100572478		2191	4294	6485	SO:0001819	synonymous_variant	163786				centriole replication	centriole		g.chr1:100572478A>G	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1398T>C	1.37:g.100572478A>G			Somatic				SASS6_uc009wdz.2_Silent_p.N299N	p.N466N	NM_194292	NP_919268	WXS	Illumina HiSeq	Unspecified	Q6UVJ0	SAS6_HUMAN		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)	12	1539	-		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	466			Potential.		D3DT55|Q8N3K0	Silent	SNP	ENST00000287482.5	37	c.1398T>C	CCDS764.1																																																																																				0.308	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292		5	26	0	0	0	0.001168	0	5	26				
ADORA3	140	broad.mit.edu	37	1	112028429	112028429	+	Silent	SNP	C	C	T	rs138501072		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:112028429C>T	ENST00000369716.4	-	5	1039	c.906G>A	c.(904-906)acG>acA	p.T302T	ADORA3_ENST00000369717.4_Silent_p.T221T	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.T302T(1)|p.T221T(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TTCCCAAACCCGTGATCAGTA	0.448																																							uc001ebf.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|large_intestine(1)|skin(1)	4						c.(904-906)ACG>ACA		adenosine A3 receptor isoform 1	Adenosine(DB00640)|Aminophylline(DB01223)	C	,	0,4406		0,0,2203	153.0	141.0	145.0		663,906	-5.4	0.0	1	dbSNP_134	145	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ADORA3	NM_001081976.1,NM_020683.6	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	221/267,302/348	112028429	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled	g.chr1:112028429C>T	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.906G>A	1.37:g.112028429C>T			Somatic				ADORA3_uc001ebg.3_Silent_p.T221T	p.T302T	NM_020683	NP_065734	WXS	Illumina HiSeq	Unspecified	P33765	AA3R_HUMAN		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	5	1673	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	Error:Variant_position_missing_in_P33765_after_alignment					A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000369716.4	37	c.906G>A	CCDS838.1	.	.	.	.	.	.	.	.	.	.	C	4.069	0.010695	0.07912	0.0	1.16E-4	ENSG00000121933	ENST00000414219;ENST00000442484	.	.	.	4.7	-5.42	0.02640	.	.	.	.	.	T	0.05593	0.0147	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30592	-0.9973	4	.	.	.	-14.1257	1.5023	0.02479	0.2014:0.1708:0.1499:0.4779	.	.	.	.	Q	162;115	.	.	R	-	2	0	ADORA3	111829952	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-3.734000	0.00380	-1.336000	0.02238	-0.123000	0.14984	CGG		0.448	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683		13	57	0	0	0	0.004007	0	13	57				
FAM19A3	284467	broad.mit.edu	37	1	113269262	113269262	+	Nonstop_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:113269262G>T	ENST00000361886.3	+	5	461	c.402G>T	c.(400-402)taG>taT	p.*134Y	FAM19A3_ENST00000369630.3_Missense_Mutation_p.S157I	NM_001004440.1|NM_182759.2	NP_001004440.1|NP_877436.1	Q7Z5A8	F19A3_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A3	0						extracellular region (GO:0005576)		p.S157I(1)		lung(4)|ovary(1)	5	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACACGATAGCTCTTGGGGG	0.502																																							uc001ecv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(400-402)TAG>TAT		family with sequence similarity 19 (chemokine							176.0	140.0	152.0					1																	113269262		2203	4300	6503	SO:0001578	stop_lost	284467					extracellular region		g.chr1:113269262G>T	AY325119	CCDS856.1, CCDS30806.1	1p13.2	2008-02-05			ENSG00000184599	ENSG00000184599			21590	protein-coding gene	gene with protein product						15028294	Standard	NM_182759		Approved	TAFA-3	uc001ecu.3	Q7Z5A8	OTTHUMG00000012020	ENST00000361886.3:c.402G>T	1.37:g.113269262G>T	ENSP00000355042:p.*134Tyrext*12		Somatic				FAM19A3_uc001ecu.2_Missense_Mutation_p.S157I|FAM19A3_uc010owk.1_RNA|FAM19A3_uc010owl.1_RNA	p.*134Y	NM_182759	NP_877436	WXS	Illumina HiSeq	Unspecified	Q7Z5A8	F19A3_HUMAN		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	5	471	+	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)	134					B7ZLU0|Q2M1P9|Q7Z5A6	Nonstop_Mutation	SNP	ENST00000361886.3	37	c.402G>T	CCDS856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.05|13.05	2.120831|2.120831	0.37436|0.37436	.|.	.|.	ENSG00000184599|ENSG00000184599	ENST00000369630|ENST00000361886	.|.	.|.	.|.	5.42|5.42	3.53|3.53	0.40419|0.40419	.|.	0.462498|.	0.20404|.	N|.	0.092982|.	T|.	0.18215|.	0.0437|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|.	0.57899|.	0.981|.	P|.	0.59012|.	0.85|.	T|.	0.16748|.	-1.0392|.	8|.	0.87932|.	D|.	0|.	-7.9289|-7.9289	8.7031|8.7031	0.34338|0.34338	0.1809:0.0:0.8191:0.0|0.1809:0.0:0.8191:0.0	.|.	157|.	Q7Z5A8-2|.	.|.	I|Y	157|134	.|.	ENSP00000358644:S157I|.	S|X	+|+	2|3	0|2	FAM19A3|FAM19A3	113070785|113070785	0.988000|0.988000	0.35896|0.35896	0.973000|0.973000	0.42090|0.42090	0.875000|0.875000	0.50365|0.50365	2.260000|2.260000	0.43267|0.43267	0.747000|0.747000	0.32809|0.32809	0.561000|0.561000	0.74099|0.74099	AGC|TAG		0.502	FAM19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033255.1	NM_182759		15	43	1	0	6.31663e-08	0.003163	9.25143e-08	15	43				
ZNF697	90874	broad.mit.edu	37	1	120166700	120166700	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:120166700C>G	ENST00000421812.2	-	3	385	c.266G>C	c.(265-267)gGg>gCg	p.G89A		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	89					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G89A(1)|p.G21R(1)		ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		ATCCTCTTCCCCACGGACAGA	0.547																																							uc001ehy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(265-267)GGG>GCG		zinc finger protein 697							57.0	64.0	61.0					1																	120166700		2090	4221	6311	SO:0001583	missense	90874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:120166700C>G	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.266G>C	1.37:g.120166700C>G	ENSP00000396857:p.Gly89Ala		Somatic					p.G89A	NM_001080470	NP_001073939	WXS	Illumina HiSeq	Unspecified	Q5TEC3	ZN697_HUMAN		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)	3	380	-	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)	89					Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	c.266G>C	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	C	2.063	-0.414962	0.04766	.	.	ENSG00000143067	ENST00000421812	T	0.07216	3.21	4.62	2.3	0.28687	.	.	.	.	.	T	0.01092	0.0036	N	0.14661	0.345	0.22479	N	0.999066	B	0.06786	0.001	B	0.09377	0.004	T	0.48468	-0.9033	9	0.09843	T	0.71	.	6.3649	0.21449	0.0:0.3151:0.0:0.6849	.	89	Q5TEC3	ZN697_HUMAN	A	89	ENSP00000396857:G89A	ENSP00000396857:G89A	G	-	2	0	ZNF697	119968223	.	.	0.394000	0.26270	0.029000	0.11900	.	.	0.265000	0.21872	-0.379000	0.06801	GGG		0.547	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286		4	21	0	0	0	0.000602	0	4	21				
THEM5	284486	broad.mit.edu	37	1	151820280	151820280	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:151820280G>A	ENST00000368817.5	-	5	765	c.634C>T	c.(634-636)Cag>Tag	p.Q212*	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	212					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)	p.Q212*(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TAAAGCTTCTGGTCCTCAATC	0.567																																							uc009wnd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(634-636)CAG>TAG		thioesterase superfamily member 5							129.0	117.0	121.0					1																	151820280		2203	4300	6503	SO:0001587	stop_gained	284486						hydrolase activity	g.chr1:151820280G>A	AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.634C>T	1.37:g.151820280G>A	ENSP00000357807:p.Gln212*		Somatic					p.Q212*	NM_182578	NP_872384	WXS	Illumina HiSeq	Unspecified	Q8N1Q8	THEM5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		5	766	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		212					Q5T1C3	Nonsense_Mutation	SNP	ENST00000368817.5	37	c.634C>T	CCDS1005.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.616896	0.66672	.	.	ENSG00000196407	ENST00000368817	.	.	.	5.19	5.19	0.71726	.	0.361985	0.28730	N	0.014339	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-10.392	14.2129	0.65776	0.0:0.0:1.0:0.0	.	.	.	.	X	212	.	ENSP00000357807:Q212X	Q	-	1	0	THEM5	150086904	1.000000	0.71417	0.999000	0.59377	0.695000	0.40330	2.271000	0.43364	2.427000	0.82271	0.655000	0.94253	CAG		0.567	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036678.2	NM_182578		27	59	0	0	0	0.00361	0	27	59				
HRNR	388697	broad.mit.edu	37	1	152188290	152188290	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:152188290G>A	ENST00000368801.2	-	3	5890	c.5815C>T	c.(5815-5817)Cat>Tat	p.H1939Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1939					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGACCCATGTTGGCCGTGG	0.587																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(5815-5817)CAT>TAT		hornerin							12.0	19.0	17.0					1																	152188290		1965	4158	6123	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152188290G>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5815C>T	1.37:g.152188290G>A	ENSP00000357791:p.His1939Tyr		Somatic					p.H1939Y	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5891	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1939			21.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.5815C>T	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	6.052	0.377933	0.11466	.	.	ENSG00000197915	ENST00000368801	T	0.03004	4.08	3.17	-2.09	0.07232	.	.	.	.	.	T	0.00666	0.0022	L	0.42245	1.32	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.49234	-0.8961	9	0.02654	T	1	.	3.1277	0.06413	0.4999:0.0:0.2957:0.2044	.	1939	Q86YZ3	HORN_HUMAN	Y	1939	ENSP00000357791:H1939Y	ENSP00000357791:H1939Y	H	-	1	0	HRNR	150454914	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.124000	0.10595	-0.293000	0.08986	0.558000	0.71614	CAT		0.587	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		8	610	0	0	0	0.00308	0	8	610				
FLG	2312	broad.mit.edu	37	1	152279834	152279834	+	Missense_Mutation	SNP	A	A	T	rs574926550	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:152279834A>T	ENST00000368799.1	-	3	7563	c.7528T>A	c.(7528-7530)Tcc>Acc	p.S2510T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2510	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2510T(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCACTTCTGGATCCTGAGTGC	0.557									Ichthyosis				A|||	2	0.000399361	0.0	0.0	5008	,	,		20876	0.0		0.0	False		,,,				2504	0.002						uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(7528-7530)TCC>ACC		filaggrin							348.0	331.0	337.0					1																	152279834		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152279834A>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7528T>A	1.37:g.152279834A>T	ENSP00000357789:p.Ser2510Thr		Somatic					p.S2510T	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7564	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2510			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.7528T>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	4.141	0.024594	0.08054	.	.	ENSG00000143631	ENST00000368799	T	0.03635	3.86	2.43	-3.14	0.05250	.	.	.	.	.	T	0.01320	0.0043	M	0.80028	2.48	0.09310	N	1	B	0.28026	0.198	B	0.27608	0.081	T	0.46048	-0.9219	9	0.12430	T	0.62	.	4.8188	0.13379	0.2855:0.5558:0.0:0.1588	.	2510	P20930	FILA_HUMAN	T	2510	ENSP00000357789:S2510T	ENSP00000357789:S2510T	S	-	1	0	FLG	150546458	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.405000	0.02492	-1.086000	0.03084	-1.552000	0.00895	TCC		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		15	674	0	0	0	0.003163	0	15	674				
UBE2Q1	55585	broad.mit.edu	37	1	154530853	154530853	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:154530853G>A	ENST00000292211.4	-	1	256	c.177C>T	c.(175-177)ttC>ttT	p.F59F	UBE2Q1_ENST00000497453.1_Intron	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	59					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.F59F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGCAATGCGGAAGCGCTCGT	0.781																																							uc001fff.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(175-177)TTC>TTT		ubiquitin-conjugating enzyme E2Q							3.0	4.0	4.0					1																	154530853		1856	3697	5553	SO:0001819	synonymous_variant	55585						ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr1:154530853G>A	AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.177C>T	1.37:g.154530853G>A			Somatic					p.F59F	NM_017582	NP_060052	WXS	Illumina HiSeq	Unspecified	Q7Z7E8	UB2Q1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		1	268	-	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		59					B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Silent	SNP	ENST00000292211.4	37	c.177C>T	CCDS1069.1																																																																																				0.781	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090704.1	NM_017582		3	6	0	0	0	0.004672	0	3	6				
CLK2	1196	broad.mit.edu	37	1	155237843	155237843	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:155237843T>C	ENST00000368361.4	-	6	944	c.629A>G	c.(628-630)aAc>aGc	p.N210S	CLK2_ENST00000355560.4_Missense_Mutation_p.N208S|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000361168.5_Missense_Mutation_p.N209S|CLK2_ENST00000536801.1_Missense_Mutation_p.N210S			P49760	CLK2_HUMAN	CDC-like kinase 2	210	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.N210S(1)		endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTCTAGCACGTTGATCTCAAG	0.498								Other conserved DNA damage response genes																															uc001fjy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(628-630)AAC>AGC	Other_conserved_DNA_damage_response_genes	CDC-like kinase 2							226.0	203.0	211.0					1																	155237843		2203	4300	6503	SO:0001583	missense	1196					nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr1:155237843T>C	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.629A>G	1.37:g.155237843T>C	ENSP00000357345:p.Asn210Ser		Somatic				RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Missense_Mutation_p.N209S|CLK2_uc001fjx.2_5'UTR|CLK2_uc009wqm.2_Missense_Mutation_p.N210S	p.N210S	NM_003993	NP_003984	WXS	Illumina HiSeq	Unspecified	P49760	CLK2_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		6	919	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		210			Protein kinase.		B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	37	c.629A>G		.	.	.	.	.	.	.	.	.	.	.	14.66	2.603116	0.46423	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38585	0.1046	N	0.17723	0.515	0.80722	D	1	P;B	0.39060	0.657;0.122	B;B	0.39706	0.307;0.068	T	0.52193	-0.8608	10	0.72032	D	0.01	.	14.5968	0.68413	0.0:0.0:0.0:1.0	.	210;209	P49760;P49760-3	CLK2_HUMAN;.	S	209;210;208;210	ENSP00000354856:N209S;ENSP00000357345:N210S;ENSP00000347759:N208S;ENSP00000441023:N210S	ENSP00000347759:N208S	N	-	2	0	CLK2	153504467	1.000000	0.71417	0.945000	0.38365	0.162000	0.22319	7.868000	0.87116	2.317000	0.78254	0.459000	0.35465	AAC		0.498	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	NM_003993		85	125	0	0	0	0.00361	0	85	125				
CD1D	912	broad.mit.edu	37	1	158152851	158152851	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:158152851G>T	ENST00000368171.3	+	5	1290	c.791G>T	c.(790-792)cGa>cTa	p.R264L		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	264	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)	p.R264L(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TGGTATCTCCGAGCAACCCTG	0.617																																							uc001frr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(790-792)CGA>CTA		CD1D antigen precursor							119.0	105.0	110.0					1																	158152851		2203	4300	6503	SO:0001583	missense	912				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding	g.chr1:158152851G>T	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.791G>T	1.37:g.158152851G>T	ENSP00000357153:p.Arg264Leu		Somatic				CD1D_uc009wss.2_Intron	p.R264L	NM_001766	NP_001757	WXS	Illumina HiSeq	Unspecified	P15813	CD1D_HUMAN			5	1290	+	all_hematologic(112;0.0378)		264			Ig-like.|Extracellular (Potential).		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	37	c.791G>T	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021094	0.54576	.	.	ENSG00000158473	ENST00000368171	T	0.10573	2.86	5.18	-0.862	0.10673	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.179363	0.26840	N	0.022236	T	0.07188	0.0182	L	0.60904	1.88	0.09310	N	1	D	0.55385	0.971	P	0.50970	0.655	T	0.16364	-1.0405	10	0.66056	D	0.02	-5.8751	9.1773	0.37120	0.4689:0.0:0.5311:0.0	.	264	P15813	CD1D_HUMAN	L	264	ENSP00000357153:R264L	ENSP00000357153:R264L	R	+	2	0	CD1D	156419475	0.374000	0.25081	0.721000	0.30653	0.544000	0.35116	0.499000	0.22546	-0.103000	0.12175	-0.794000	0.03295	CGA		0.617	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766		49	95	1	0	4.86159e-25	0.00361	9.29365e-25	49	95				
OR6K6	128371	broad.mit.edu	37	1	158725166	158725166	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:158725166G>T	ENST00000368144.2	+	1	657	c.561G>T	c.(559-561)gaG>gaT	p.E187D		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E187D(1)		endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TGCTTCCTGAGATTGCATGGA	0.483																																							uc001fsw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(559-561)GAG>GAT		olfactory receptor, family 6, subfamily K,							145.0	118.0	127.0					1																	158725166		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158725166G>T	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.561G>T	1.37:g.158725166G>T	ENSP00000357126:p.Glu187Asp		Somatic					p.E187D	NM_001005184	NP_001005184	WXS	Illumina HiSeq	Unspecified	Q8NGW6	OR6K6_HUMAN			1	561	+	all_hematologic(112;0.0378)		187			Helical; Name=4; (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.561G>T	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877779	0.33162	.	.	ENSG00000180433	ENST00000368144	T	0.00123	8.7	5.48	-1.26	0.09376	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000447	T	0.00109	0.0003	L	0.47190	1.495	0.09310	N	0.999994	D	0.76494	0.999	D	0.75484	0.986	T	0.42189	-0.9466	10	0.72032	D	0.01	-11.9651	10.6652	0.45726	0.4229:0.0:0.5771:0.0	.	187	Q8NGW6	OR6K6_HUMAN	D	187	ENSP00000357126:E187D	ENSP00000357126:E187D	E	+	3	2	OR6K6	156991790	0.000000	0.05858	0.729000	0.30791	0.266000	0.26442	-1.249000	0.02888	-0.381000	0.07882	-0.137000	0.14449	GAG		0.483	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		51	96	1	0	8.00217e-19	0.00361	1.4266e-18	51	96				
IGSF8	93185	broad.mit.edu	37	1	160063849	160063849	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:160063849G>T	ENST00000368086.1	-	3	771	c.555C>A	c.(553-555)ggC>ggA	p.G185G	IGSF8_ENST00000460351.1_5'UTR|IGSF8_ENST00000314485.7_Silent_p.G185G			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	185	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G185G(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TCGCCAGGCAGCCCAGTGCCA	0.672																																							uc001fva.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(553-555)GGC>GGA		immunoglobulin superfamily, member 8							59.0	57.0	58.0					1																	160063849		2203	4300	6503	SO:0001819	synonymous_variant	93185				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding	g.chr1:160063849G>T	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.555C>A	1.37:g.160063849G>T			Somatic				IGSF8_uc001fuz.2_Silent_p.G185G|IGSF8_uc009wtf.2_Silent_p.G185G	p.G185G	NM_052868	NP_443100	WXS	Illumina HiSeq	Unspecified	Q969P0	IGSF8_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		3	600	-	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		185			Extracellular (Potential).|Ig-like C2-type 2.		Q8NG09|Q96DP4|Q9BTG9	Silent	SNP	ENST00000368086.1	37	c.555C>A	CCDS1195.1																																																																																				0.672	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868		5	75	1	0	0.000602214	0.000602	0.000760356	5	75				
RGS4	5999	broad.mit.edu	37	1	163039313	163039313	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:163039313G>C	ENST00000367909.6	+	1	379	c.39G>C	c.(37-39)ttG>ttC	p.L13F	RGS4_ENST00000421743.2_Missense_Mutation_p.L110F|RGS4_ENST00000367908.4_Missense_Mutation_p.L13F|RGS4_ENST00000367906.3_5'Flank|RGS4_ENST00000531057.1_Missense_Mutation_p.L13F|RGS4_ENST00000527809.1_Intron|RGS4_ENST00000491263.1_3'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	13					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.L110F(1)|p.L13F(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CTTCTTGCTTGAGGAGGTAAG	0.428											OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(76;1257 1738 3039 6086)	Ovarian(76;1257 1738 3039 6086)	uc009wuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(37-39)TTG>TTC		regulator of G-protein signaling 4 isoform 2							60.0	56.0	57.0					1																	163039313		2203	4300	6503	SO:0001583	missense	5999				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:163039313G>C	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.39G>C	1.37:g.163039313G>C	ENSP00000356885:p.Leu13Phe		Somatic	OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1828	RGS4_uc001gcl.3_Missense_Mutation_p.L110F|RGS4_uc009wuz.2_Missense_Mutation_p.L13F|RGS4_uc009wva.2_5'Flank	p.L13F	NM_005613	NP_005604	WXS	Illumina HiSeq	Unspecified	P49798	RGS4_HUMAN			1	550	+			13					A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	c.39G>C	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535250	0.45176	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000367908	T;T;D	0.89939	0.08;0.14;-2.59	4.57	0.534	0.17127	.	0.000000	0.64402	D	0.000002	D	0.91088	0.7195	M	0.83223	2.63	0.46061	D	0.998840	D;D;P	0.76494	0.999;0.999;0.803	D;D;P	0.87578	0.998;0.946;0.564	D	0.89715	0.3915	9	0.72032	D	0.01	.	9.2287	0.37423	0.3449:0.0:0.6551:0.0	.	13;13;110	B1APZ3;P49798;A7XA59	.;RGS4_HUMAN;.	F	110;13;13;13	ENSP00000397181:L110F;ENSP00000356885:L13F;ENSP00000436106:L13F	ENSP00000356884:L13F	L	+	3	2	RGS4	161305937	1.000000	0.71417	0.966000	0.40874	0.641000	0.38312	2.394000	0.44450	-0.192000	0.10432	-1.945000	0.00491	TTG		0.428	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		5	62	0	0	0	0.000602	0	5	62				
PRRC2C	23215	broad.mit.edu	37	1	171504670	171504670	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:171504670G>T	ENST00000338920.4	+	13	2208	c.1971G>T	c.(1969-1971)ccG>ccT	p.P657P	PRRC2C_ENST00000392078.3_Silent_p.P659P|PRRC2C_ENST00000426496.2_Silent_p.P657P|PRRC2C_ENST00000367742.3_Silent_p.P659P	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	657					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.P659P(2)									AACCTCGGCCGGCTGTATTAT	0.443																																							uc010pmg.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1969-1971)CCG>CCT		HBxAg transactivated protein 2							121.0	132.0	128.0					1																	171504670		2203	4300	6503	SO:0001819	synonymous_variant	23215						protein C-terminus binding	g.chr1:171504670G>T	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1971G>T	1.37:g.171504670G>T			Somatic					p.P657P	NM_015172	NP_055987	WXS	Illumina HiSeq	Unspecified	Q9Y520	PRC2C_HUMAN			13	2237	+			657					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	ENST00000338920.4	37	c.1971G>T	CCDS1296.2																																																																																				0.443	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		61	189	1	0	2.81305e-35	0.00361	5.67378e-35	61	189				
ASTN1	460	broad.mit.edu	37	1	176845701	176845701	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:176845701G>A	ENST00000367654.3	-	21	3670	c.3459C>T	c.(3457-3459)tgC>tgT	p.C1153C	ASTN1_ENST00000367657.3_Silent_p.C1145C|ASTN1_ENST00000361833.2_Silent_p.C1145C|ASTN1_ENST00000424564.2_Silent_p.C1145C	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1153					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.C1145C(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCACCACGGGGCATGGGGTCT	0.577																																							uc001glc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(3433-3435)TGC>TGT		astrotactin isoform 1							149.0	113.0	125.0					1																	176845701		2203	4300	6503	SO:0001819	synonymous_variant	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176845701G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3459C>T	1.37:g.176845701G>A			Somatic				ASTN1_uc001glb.1_Silent_p.C1145C|ASTN1_uc001gld.1_Silent_p.C1145C	p.C1145C	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			21	3647	-			1153					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37	c.3435C>T																																																																																					0.577	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		25	64	0	0	0	0.005443	0	25	64				
ASTN1	460	broad.mit.edu	37	1	176927584	176927584	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:176927584G>T	ENST00000367654.3	-	10	1868	c.1657C>A	c.(1657-1659)Ccc>Acc	p.P553T	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.P545T|ASTN1_ENST00000361833.2_Missense_Mutation_p.P545T|ASTN1_ENST00000424564.2_Missense_Mutation_p.P545T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	553					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.P545T(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TTGCTGAGGGGCAACCACATG	0.557																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(1633-1635)CCC>ACC		astrotactin isoform 1							94.0	72.0	80.0					1																	176927584		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176927584G>T	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1657C>A	1.37:g.176927584G>T	ENSP00000356626:p.Pro553Thr		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.P545T|ASTN1_uc001gld.1_Missense_Mutation_p.P545T|ASTN1_uc009wwx.1_Missense_Mutation_p.P545T	p.P545T	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			10	1845	-			553					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.1633C>A		.	.	.	.	.	.	.	.	.	.	G	28.7	4.945525	0.92593	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.19806	2.12;2.53;2.53;2.12	5.5	5.5	0.81552	.	0.050289	0.85682	D	0.000000	T	0.37758	0.1015	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.16217	-1.0410	10	0.72032	D	0.01	-29.328	18.9852	0.92766	0.0:0.0:1.0:0.0	.	553;545;545	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	T	545;545;553;545;545	ENSP00000356629:P545T;ENSP00000354536:P545T;ENSP00000356626:P553T;ENSP00000395041:P545T	ENSP00000354536:P545T	P	-	1	0	ASTN1	175194207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.572000	0.86782	0.655000	0.94253	CCC		0.557	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		9	28	1	0	5.4927e-09	0.004482	8.30008e-09	9	28				
BRINP3	339479	broad.mit.edu	37	1	190067324	190067324	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:190067324G>T	ENST00000367462.3	-	8	2356	c.2125C>A	c.(2125-2127)Cgt>Agt	p.R709S	BRINP3_ENST00000534846.1_Missense_Mutation_p.R607S	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	709					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.R709S(1)									TTATTTACACGGTCTCTGATC	0.483																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2125-2127)CGT>AGT		family with sequence similarity 5, member C							104.0	100.0	102.0					1																	190067324		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067324G>T	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2125C>A	1.37:g.190067324G>T	ENSP00000356432:p.Arg709Ser		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.R607S	p.R709S	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2357	-	Prostate(682;0.198)		709					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2125C>A	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209262	0.58343	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.25912	2.01;1.77	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.49813	0.1579	M	0.73962	2.25	0.58432	D	0.999996	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	T	0.53947	-0.8366	10	0.87932	D	0	.	12.3677	0.55238	0.0814:0.0:0.9185:0.0	.	607;709	B7Z260;Q76B58	.;FAM5C_HUMAN	S	709;607	ENSP00000356432:R709S;ENSP00000438022:R607S	ENSP00000356432:R709S	R	-	1	0	FAM5C	188333947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.614000	0.74197	1.422000	0.47177	0.650000	0.86243	CGT		0.483	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		31	76	1	0	8.16721e-17	0.002096	1.41883e-16	31	76				
PKP1	5317	broad.mit.edu	37	1	201293709	201293709	+	Splice_Site	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:201293709G>T	ENST00000352845.3	+	11	1897	c.1897G>T	c.(1897-1899)Ggg>Tgg	p.G633W	PKP1_ENST00000263946.3_Splice_Site_p.G633W|PKP1_ENST00000367324.3_Splice_Site_p.G612W			Q13835	PKP1_HUMAN	plakophilin 1	633					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)	p.G633W(1)|p.G612W(1)		NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CAGAGTGATGGGTAAGGTCCC	0.572																																							uc001gwd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1897-1899)GGG>TGG		plakophilin 1 isoform 1b							65.0	57.0	60.0					1																	201293709		2203	4300	6503	SO:0001630	splice_region_variant	5317				cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis	g.chr1:201293709G>T	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1897+1G>T	1.37:g.201293709G>T			Somatic				PKP1_uc001gwe.2_Missense_Mutation_p.G612W|PKP1_uc009wzm.2_Missense_Mutation_p.G220W	p.G633W	NM_000299	NP_000290	WXS	Illumina HiSeq	Unspecified	Q13835	PKP1_HUMAN			11	2148	+			633			ARM 8.		O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	c.1897G>T	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112007	0.77210	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.50548	0.74;0.74;0.74	5.54	4.63	0.57726	Armadillo-like helical (1);Armadillo-type fold (1);	0.159172	0.53938	D	0.000052	T	0.60287	0.2257	L	0.52573	1.65	0.58432	D	0.999999	D;D;D	0.67145	0.99;0.996;0.995	P;P;P	0.62885	0.908;0.895;0.849	T	0.64136	-0.6478	10	0.87932	D	0	-19.1552	14.2143	0.65783	0.0716:0.0:0.9284:0.0	.	220;612;633	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	W	612;633;633	ENSP00000356293:G612W;ENSP00000263946:G633W;ENSP00000295597:G633W	ENSP00000263946:G633W	G	+	1	0	PKP1	199560332	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.813000	0.91963	1.330000	0.45394	0.655000	0.94253	GGG		0.572	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	Missense_Mutation	11	21	1	0	4.68919e-08	0.000673	6.93185e-08	11	21				
CR1	1378	broad.mit.edu	37	1	207758146	207758146	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:207758146C>A	ENST00000367049.4	+	33	5455	c.5455C>A	c.(5455-5457)Cgc>Agc	p.R1819S	CR1_ENST00000367052.1_Missense_Mutation_p.R1369S|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000400960.2_Missense_Mutation_p.R1369S|CR1_ENST00000367053.1_Missense_Mutation_p.R1369S|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367051.1_Missense_Mutation_p.R1369S	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1369	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1374S(1)|p.R1819S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GAGCACCATCCGCTGCACAAG	0.522																																							uc001hfy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(4105-4107)CGC>AGC		complement receptor 1 isoform F precursor							152.0	152.0	152.0					1																	207758146		1944	4145	6089	SO:0001583	missense	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207758146C>A	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5455C>A	1.37:g.207758146C>A	ENSP00000356016:p.Arg1819Ser		Somatic				CR1_uc009xcl.1_Missense_Mutation_p.R919S|CR1_uc001hfx.2_Missense_Mutation_p.R1819S	p.R1369S	NM_000573	NP_000564	WXS	Illumina HiSeq	Unspecified	P17927	CR1_HUMAN			25	4245	+			1369			Extracellular (Potential).|Sushi 21.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	c.4105C>A	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710343	0.48517	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	3.03	0.0159	0.14106	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.51193	0.1660	N	0.16602	0.42	0.21290	N	0.999731	D;D;D	0.63046	0.971;0.992;0.982	P;D;D	0.65987	0.843;0.94;0.91	T	0.46105	-0.9215	9	0.07030	T	0.85	.	2.6221	0.04919	0.2283:0.5085:0.0:0.2632	.	1369;1369;1819	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	S	1369;1369;1369;1369;919;1819	ENSP00000356019:R1369S;ENSP00000356018:R1369S;ENSP00000356020:R1369S;ENSP00000383744:R1369S;ENSP00000436139:R919S;ENSP00000356016:R1819S	ENSP00000356016:R1819S	R	+	1	0	CR1	205824769	0.130000	0.22417	0.798000	0.32154	0.936000	0.57629	0.260000	0.18424	-0.002000	0.14469	0.655000	0.94253	CGC		0.522	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		13	212	1	0	0.000308642	0.003163	0.000390728	13	212				
USH2A	7399	broad.mit.edu	37	1	216592004	216592004	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:216592004G>A	ENST00000307340.3	-	3	889	c.503C>T	c.(502-504)aCa>aTa	p.T168I	USH2A_ENST00000366942.3_Missense_Mutation_p.T168I|USH2A_ENST00000366943.2_Missense_Mutation_p.T168I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	168					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.T168I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCCATCTACTGTCTTTTCTAT	0.383										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(502-504)ACA>ATA		usherin isoform B							117.0	109.0	112.0					1																	216592004		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216592004G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.503C>T	1.37:g.216592004G>A	ENSP00000305941:p.Thr168Ile	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.T168I	p.T168I	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	3	890	-			168			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.503C>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	7.698	0.692547	0.15039	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.73681	-0.77;-0.77;-0.77	5.62	2.77	0.32553	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.177681	0.27043	U	0.021204	T	0.61400	0.2344	L	0.34521	1.04	0.09310	N	1	B;B	0.31503	0.021;0.326	B;B	0.31946	0.02;0.138	T	0.48703	-0.9012	10	0.31617	T	0.26	.	10.4097	0.44285	0.2096:0.0:0.7904:0.0	.	168;168	O75445-2;O75445	.;USH2A_HUMAN	I	168	ENSP00000305941:T168I;ENSP00000355910:T168I;ENSP00000355909:T168I	ENSP00000305941:T168I	T	-	2	0	USH2A	214658627	0.985000	0.35326	0.012000	0.15200	0.439000	0.31926	2.441000	0.44864	0.328000	0.23435	0.655000	0.94253	ACA		0.383	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		8	107	0	0	0	0.00308	0	8	107				
OBSCN	84033	broad.mit.edu	37	1	228557766	228557766	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:228557766C>T	ENST00000422127.1	+	91	20135	c.20091C>T	c.(20089-20091)ttC>ttT	p.F6697F	OBSCN_ENST00000570156.2_Silent_p.F7654F|OBSCN_ENST00000366707.4_Silent_p.F4331F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6697	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.F7409F(1)|p.F7279F(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCAAAGACTTCATCAAGGCTA	0.682																																							uc009xez.1		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(20089-20091)TTC>TTT		obscurin, cytoskeletal calmodulin and							57.0	60.0	59.0					1																	228557766		1972	4156	6128	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228557766C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.20091C>T	1.37:g.228557766C>T			Somatic				OBSCN_uc001hsr.1_Silent_p.F1326F	p.F6697F	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			91	20135	+		Prostate(94;0.0405)	6697			Protein kinase 1.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.20091C>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.396851	0.25205	.	.	ENSG00000154358	ENST00000441106	.	.	.	4.72	-2.21	0.06973	.	.	.	.	.	T	0.63082	0.2481	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61192	-0.7112	4	.	.	.	.	12.7076	0.57070	0.0:0.5988:0.0:0.4012	.	.	.	.	Y	1314	.	.	H	+	1	0	OBSCN	226624389	0.208000	0.23494	0.981000	0.43875	0.350000	0.29205	-0.570000	0.05895	-0.283000	0.09115	0.455000	0.32223	CAT		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		5	77	0	0	0	0.001168	0	5	77				
HEATR1	55127	broad.mit.edu	37	1	236761272	236761272	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:236761272C>A	ENST00000366582.3	-	5	623	c.509G>T	c.(508-510)gGa>gTa	p.G170V	HEATR1_ENST00000366581.2_Missense_Mutation_p.G170V|HEATR1_ENST00000483073.1_5'UTR	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	170					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.G170V(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TAACGGCACTCCAGATTGCTG	0.378																																							uc001hyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(508-510)GGA>GTA		protein BAP28							136.0	123.0	128.0					1																	236761272		2203	4300	6503	SO:0001583	missense	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236761272C>A	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.509G>T	1.37:g.236761272C>A	ENSP00000355541:p.Gly170Val		Somatic					p.G170V	NM_018072	NP_060542	WXS	Illumina HiSeq	Unspecified	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		5	634	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	170					Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	c.509G>T	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635051	0.87760	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.42900	0.96;0.96	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66408	-0.5931	10	0.33141	T	0.24	.	19.8243	0.96610	0.0:1.0:0.0:0.0	.	170	Q9H583	HEAT1_HUMAN	V	170	ENSP00000355541:G170V;ENSP00000355540:G170V	ENSP00000355540:G170V	G	-	2	0	HEATR1	234827895	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.057000	0.76669	2.692000	0.91855	0.467000	0.42956	GGA		0.378	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		26	54	1	0	1.04121e-07	0.005443	1.51565e-07	26	54				
RYR2	6262	broad.mit.edu	37	1	237789031	237789031	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:237789031C>A	ENST00000366574.2	+	40	6410	c.6093C>A	c.(6091-6093)tcC>tcA	p.S2031S	RYR2_ENST00000542537.1_Silent_p.S2015S|RYR2_ENST00000360064.6_Silent_p.S2029S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2031	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.S2029S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTCTGCTATCCCTGGTAGAAA	0.423																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(6091-6093)TCC>TCA		cardiac muscle ryanodine receptor							114.0	108.0	110.0					1																	237789031		1869	4108	5977	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237789031C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6093C>A	1.37:g.237789031C>A			Somatic					p.S2031S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		40	6213	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2031			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.6093C>A	CCDS55691.1																																																																																				0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		26	81	1	0	1.42536e-11	0.004656	2.27674e-11	26	81				
NLRP3	114548	broad.mit.edu	37	1	247592928	247592928	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:247592928T>G	ENST00000336119.3	+	4	2944	c.2198T>G	c.(2197-2199)cTc>cGc	p.L733R	NLRP3_ENST00000366496.2_Missense_Mutation_p.L733R|NLRP3_ENST00000366497.2_Missense_Mutation_p.L733R|NLRP3_ENST00000391827.2_Intron|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000391828.3_Missense_Mutation_p.L733R	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	733					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.L733R(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGCCGGGGCCTCTTTTCAGTT	0.478																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2197-2199)CTC>CGC		NLR family, pyrin domain containing 3 isoform a							93.0	96.0	95.0					1																	247592928		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247592928T>G	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2198T>G	1.37:g.247592928T>G	ENSP00000337383:p.Leu733Arg		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.L733R|NLRP3_uc001icu.2_Missense_Mutation_p.L733R|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Missense_Mutation_p.L731R	p.L733R	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		6	2336	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	733					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.2198T>G	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371304	0.42003	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000366496	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	4.31	4.31	0.51392	.	0.194731	0.25726	N	0.028711	D	0.95579	0.8563	M	0.84511	2.7	0.24216	N	0.995451	D;P;D	0.89917	1.0;0.867;0.992	D;P;P	0.72982	0.979;0.466;0.905	D	0.89491	0.3757	10	0.87932	D	0	.	10.1302	0.42674	0.0:0.0:0.0:1.0	.	733;733;733	B7ZKS9;Q96P20-5;Q96P20	.;.;NALP3_HUMAN	R	733	ENSP00000375704:L733R;ENSP00000355453:L733R;ENSP00000337383:L733R;ENSP00000355452:L733R	ENSP00000337383:L733R	L	+	2	0	NLRP3	245659551	0.434000	0.25570	0.393000	0.26258	0.225000	0.24961	3.364000	0.52328	1.973000	0.57446	0.439000	0.28862	CTC		0.478	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		4	186	0	0	0	0.000248	0	4	186				
OR11L1	391189	broad.mit.edu	37	1	248005039	248005039	+	Nonsense_Mutation	SNP	G	G	A	rs376918027		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:248005039G>A	ENST00000355784.2	-	1	215	c.160C>T	c.(160-162)Cga>Tga	p.R54*		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	54						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R54*(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGTGCAGTCGCAGGCCCTGG	0.537																																							uc001idn.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(160-162)CGA>TGA		olfactory receptor, family 11, subfamily L,		G	stop/ARG	0,4406		0,0,2203	71.0	63.0	66.0		160	3.3	0.0	1		66	2,8598	2.2+/-6.3	0,2,4298	no	stop-gained	OR11L1	NM_001001959.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		54/323	248005039	2,13004	2203	4300	6503	SO:0001587	stop_gained	391189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248005039G>A	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.160C>T	1.37:g.248005039G>A	ENSP00000348033:p.Arg54*		Somatic					p.R54*	NM_001001959	NP_001001959	WXS	Illumina HiSeq	Unspecified	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	160	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		54			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000355784.2	37	c.160C>T	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789632	0.50102	0.0	2.33E-4	ENSG00000197591	ENST00000355784	.	.	.	4.2	3.29	0.37713	.	0.515297	0.14376	U	0.323483	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0216	0.30412	0.0868:0.0:0.7556:0.1577	.	.	.	.	X	54	.	ENSP00000348033:R54X	R	-	1	2	OR11L1	246071662	0.000000	0.05858	0.002000	0.10522	0.260000	0.26232	-0.165000	0.09968	1.115000	0.41800	0.543000	0.68304	CGA		0.537	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		6	24	0	0	0	0.001168	0	6	24				
OR2L3	391192	broad.mit.edu	37	1	248224863	248224863	+	Missense_Mutation	SNP	A	A	C	rs572434514		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:248224863A>C	ENST00000359959.3	+	1	880	c.880A>C	c.(880-882)Aag>Cag	p.K294Q	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K294Q(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCTGAGGAACAAGGAGGTGAT	0.498																																							uc001idx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(880-882)AAG>CAG		olfactory receptor, family 2, subfamily L,							56.0	58.0	57.0					1																	248224863		2203	4300	6503	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224863A>C	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.880A>C	1.37:g.248224863A>C	ENSP00000353044:p.Lys294Gln		Somatic				OR2L13_uc001ids.2_Intron	p.K294Q	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	880	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		294			Cytoplasmic (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.880A>C	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607462	0.28623	.	.	ENSG00000198128	ENST00000359959	T	0.44482	0.92	2.01	2.01	0.26516	.	.	.	.	.	T	0.49372	0.1553	M	0.65975	2.015	0.24132	N	0.995763	D	0.54964	0.969	P	0.52710	0.707	T	0.34329	-0.9833	9	0.62326	D	0.03	.	7.2901	0.26362	0.7773:0.2227:0.0:0.0	.	294	Q8NG85	OR2L3_HUMAN	Q	294	ENSP00000353044:K294Q	ENSP00000353044:K294Q	K	+	1	0	OR2L3	246291486	0.001000	0.12720	0.960000	0.40013	0.593000	0.36681	1.309000	0.33539	0.924000	0.37069	0.374000	0.22700	AAG		0.498	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		27	79	0	0	0	0.00632	0	27	79				
OR2M5	127059	broad.mit.edu	37	1	248308490	248308490	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:248308490T>C	ENST00000366476.1	+	1	41	c.41T>C	c.(40-42)cTc>cCc	p.L14P		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L14P(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GACTTCATCCTCCTGGGAATC	0.438																																							uc010pze.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(40-42)CTC>CCC		olfactory receptor, family 2, subfamily M,							225.0	223.0	223.0					1																	248308490		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308490T>C		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.41T>C	1.37:g.248308490T>C	ENSP00000355432:p.Leu14Pro		Somatic					p.L14P	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	41	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		14			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.41T>C	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	t	13.25	2.182311	0.38511	.	.	ENSG00000162727	ENST00000366476	T	0.01215	5.16	3.14	1.93	0.25924	.	0.000000	0.28042	U	0.016823	T	0.11623	0.0283	H	0.98965	4.385	0.19775	N	0.999954	D	0.89917	1.0	D	0.83275	0.996	T	0.15350	-1.0440	10	0.87932	D	0	.	8.1369	0.31061	0.1808:0.0:0.0:0.8192	.	14	A3KFT3	OR2M5_HUMAN	P	14	ENSP00000355432:L14P	ENSP00000355432:L14P	L	+	2	0	OR2M5	246375113	0.052000	0.20516	0.344000	0.25628	0.741000	0.42261	3.154000	0.50693	0.190000	0.20209	0.403000	0.27427	CTC		0.438	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		9	449	0	0	0	0.000673	0	9	449				
FAM208B	54906	broad.mit.edu	37	10	5788306	5788306	+	Silent	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:5788306A>G	ENST00000328090.5	+	15	3547	c.2922A>G	c.(2920-2922)caA>caG	p.Q974Q	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	974								p.Q974Q(1)									CTGTTACTCAAGCCACATTCA	0.463																																							uc001iij.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2920-2922)CAA>CAG		hypothetical protein LOC54906							75.0	78.0	77.0					10																	5788306		1998	4171	6169	SO:0001819	synonymous_variant	54906							g.chr10:5788306A>G	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2922A>G	10.37:g.5788306A>G			Somatic				C10orf18_uc001iik.2_Intron	p.Q974Q	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			15	3547	+			974					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	37	c.2922A>G	CCDS41485.1																																																																																				0.463	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		6	85	0	0	0	0.001168	0	6	85				
CACNB2	783	broad.mit.edu	37	10	18795447	18795447	+	Missense_Mutation	SNP	G	G	C	rs149253719	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:18795447G>C	ENST00000324631.7	+	6	701	c.641G>C	c.(640-642)aGt>aCt	p.S214T	CACNB2_ENST00000377315.4_Missense_Mutation_p.S166T|CACNB2_ENST00000377331.2_Missense_Mutation_p.S186T|CACNB2_ENST00000396576.2_Missense_Mutation_p.S159T|CACNB2_ENST00000352115.6_Missense_Mutation_p.S214T|CACNB2_ENST00000282343.8_Missense_Mutation_p.S186T|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000377329.4_Missense_Mutation_p.S160T|CACNB2_ENST00000377319.3_Missense_Mutation_p.S159T	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	214					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)	p.S160T(1)|p.S159T(1)|p.S214T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATAGTACCTAGTTCCAGAAAA	0.373													G|||	9	0.00179712	0.0	0.0	5008	,	,		15889	0.0		0.006	False		,,,				2504	0.0031						uc001ipr.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(1)|central_nervous_system(1)|skin(1)	3						c.(640-642)AGT>ACT		calcium channel, voltage-dependent, beta 2	Magnesium Sulfate(DB00653)|Verapamil(DB00661)	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,THR/SER	1,4405	2.1+/-5.4	0,1,2202	122.0	111.0	115.0		476,557,497,557,557,479,641,641,641	5.9	1.0	10	dbSNP_134	115	10,8590	7.7+/-29.5	0,10,4290	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense	CACNB2	NM_000724.3,NM_001167945.1,NM_201570.2,NM_201571.3,NM_201572.3,NM_201590.2,NM_201593.2,NM_201596.2,NM_201597.2	58,58,58,58,58,58,58,58,58	0,11,6492	CC,CG,GG		0.1163,0.0227,0.0846	benign,benign,benign,benign,benign,benign,benign,benign,benign	159/606,186/595,166/613,186/633,186/609,160/607,214/623,214/661,214/637	18795447	11,12995	2203	4300	6503	SO:0001583	missense	783				axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chr10:18795447G>C	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.641G>C	10.37:g.18795447G>C	ENSP00000320025:p.Ser214Thr		Somatic				CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Missense_Mutation_p.S214T|CACNB2_uc001ipt.2_Missense_Mutation_p.S214T|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Missense_Mutation_p.S186T|CACNB2_uc001ipv.2_Missense_Mutation_p.S186T|CACNB2_uc009xka.1_Missense_Mutation_p.S186T|CACNB2_uc001ipw.2_Missense_Mutation_p.S159T|CACNB2_uc001ipx.2_Missense_Mutation_p.S159T|CACNB2_uc009xkb.1_Missense_Mutation_p.S160T|CACNB2_uc010qcm.1_Missense_Mutation_p.S160T|CACNB2_uc001ipz.2_Missense_Mutation_p.S160T|CACNB2_uc001ipy.2_Missense_Mutation_p.S160T|CACNB2_uc010qcn.1_Missense_Mutation_p.S166T|CACNB2_uc010qco.1_Missense_Mutation_p.S166T|CACNB2_uc001iqa.2_Missense_Mutation_p.S166T	p.S214T	NM_201596	NP_963890	WXS	Illumina HiSeq	Unspecified	Q08289	CACB2_HUMAN			6	701	+			214					A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	c.641G>C	CCDS7125.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	G	16.11	3.030424	0.54790	2.27E-4	0.001163	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D	0.82984	-1.67;-1.62;-1.66;-1.62;-1.67;-1.62;-1.67;-1.67	5.9	5.9	0.94986	Src homology-3 domain (1);	0.036871	0.85682	D	0.000000	T	0.75759	0.3893	L	0.36672	1.1	0.53005	D	0.999966	B;B;B;B;B;B;B;B;B;B;B;B;P;B;B	0.42692	0.004;0.001;0.005;0.181;0.003;0.006;0.048;0.004;0.005;0.048;0.021;0.001;0.787;0.022;0.001	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.42522	0.002;0.002;0.006;0.027;0.006;0.009;0.027;0.014;0.004;0.023;0.027;0.004;0.39;0.037;0.005	T	0.79902	-0.1607	10	0.56958	D	0.05	-16.0817	20.2626	0.98452	0.0:0.0:1.0:0.0	.	166;166;160;160;186;166;160;160;170;159;186;186;214;214;214	B7Z1U5;B7Z2U3;Q5QJ99;Q6TME0;Q5QJA0;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	T	214;214;186;186;159;159;160;166	ENSP00000320025:S214T;ENSP00000344474:S214T;ENSP00000282343:S186T;ENSP00000366548:S186T;ENSP00000379821:S159T;ENSP00000366536:S159T;ENSP00000366546:S160T;ENSP00000366532:S166T	ENSP00000282343:S186T	S	+	2	0	CACNB2	18835453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.935000	0.75886	2.802000	0.96397	0.650000	0.86243	AGT		0.373	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724		9	43	0	0	0	0.000673	0	9	43				
CACNB2	783	broad.mit.edu	37	10	18795465	18795465	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:18795465C>A	ENST00000324631.7	+	6	719	c.659C>A	c.(658-660)cCt>cAt	p.P220H	CACNB2_ENST00000377315.4_Missense_Mutation_p.P172H|CACNB2_ENST00000377331.2_Missense_Mutation_p.P192H|CACNB2_ENST00000396576.2_Missense_Mutation_p.P165H|CACNB2_ENST00000352115.6_Missense_Mutation_p.P220H|CACNB2_ENST00000282343.8_Missense_Mutation_p.P192H|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000377329.4_Missense_Mutation_p.P166H|CACNB2_ENST00000377319.3_Missense_Mutation_p.P165H	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	220					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)	p.P220H(1)|p.P166H(1)|p.P165H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AAATCAACACCTCCATCATCT	0.363																																							uc001ipr.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(1)|central_nervous_system(1)|skin(1)	3						c.(658-660)CCT>CAT		calcium channel, voltage-dependent, beta 2	Magnesium Sulfate(DB00653)|Verapamil(DB00661)						115.0	105.0	109.0					10																	18795465		2203	4300	6503	SO:0001583	missense	783				axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chr10:18795465C>A	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.659C>A	10.37:g.18795465C>A	ENSP00000320025:p.Pro220His		Somatic				CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Missense_Mutation_p.P220H|CACNB2_uc001ipt.2_Missense_Mutation_p.P220H|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Missense_Mutation_p.P192H|CACNB2_uc001ipv.2_Missense_Mutation_p.P192H|CACNB2_uc009xka.1_Missense_Mutation_p.P192H|CACNB2_uc001ipw.2_Missense_Mutation_p.P165H|CACNB2_uc001ipx.2_Missense_Mutation_p.P165H|CACNB2_uc009xkb.1_Missense_Mutation_p.P166H|CACNB2_uc010qcm.1_Missense_Mutation_p.P166H|CACNB2_uc001ipz.2_Missense_Mutation_p.P166H|CACNB2_uc001ipy.2_Missense_Mutation_p.P166H|CACNB2_uc010qcn.1_Missense_Mutation_p.P172H|CACNB2_uc010qco.1_Missense_Mutation_p.P172H|CACNB2_uc001iqa.2_Missense_Mutation_p.P172H	p.P220H	NM_201596	NP_963890	WXS	Illumina HiSeq	Unspecified	Q08289	CACB2_HUMAN			6	719	+			220					A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	c.659C>A	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775790	0.90195	.	.	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D	0.84873	-1.91;-1.7;-1.89;-1.7;-1.87;-1.7;-1.88;-1.88	5.9	5.9	0.94986	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.93390	0.7892	M	0.83118	2.625	0.80722	D	1	D;D;D;D;D;D;D;D;D;B;D;D;D;D;D	0.89917	0.994;1.0;0.997;1.0;1.0;0.999;1.0;1.0;0.999;0.122;0.999;0.992;1.0;1.0;0.998	P;D;D;D;D;D;D;D;D;B;D;D;D;D;D	0.97110	0.873;0.996;0.947;0.996;0.982;0.971;0.985;0.987;0.957;0.066;0.977;0.972;1.0;0.99;0.957	D	0.93437	0.6790	10	0.87932	D	0	-16.3254	20.2626	0.98452	0.0:1.0:0.0:0.0	.	172;172;166;166;192;172;166;166;176;165;192;192;220;220;220	B7Z1U5;B7Z2U3;Q5QJ99;Q6TME0;Q5QJA0;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	H	220;220;192;192;165;165;166;172	ENSP00000320025:P220H;ENSP00000344474:P220H;ENSP00000282343:P192H;ENSP00000366548:P192H;ENSP00000379821:P165H;ENSP00000366536:P165H;ENSP00000366546:P166H;ENSP00000366532:P172H	ENSP00000282343:P192H	P	+	2	0	CACNB2	18835471	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.280000	0.78610	2.802000	0.96397	0.650000	0.86243	CCT		0.363	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724		18	28	1	0	1.50039e-11	0.001882	2.37271e-11	18	28				
ANKRD26	22852	broad.mit.edu	37	10	27375513	27375513	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:27375513T>G	ENST00000376087.4	-	5	829	c.664A>C	c.(664-666)Aaa>Caa	p.K222Q	RNU6-490P_ENST00000362985.1_RNA|ANKRD26_ENST00000436985.2_Missense_Mutation_p.K222Q	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	222					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.K222Q(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CTTTCTTCTTTATATTCTGAA	0.264																																							uc001ith.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(664-666)AAA>CAA		ankyrin repeat domain 26							79.0	80.0	79.0					10																	27375513		1792	4043	5835	SO:0001583	missense	22852					centrosome		g.chr10:27375513T>G	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.664A>C	10.37:g.27375513T>G	ENSP00000365255:p.Lys222Gln		Somatic				ANKRD26_uc009xku.1_Missense_Mutation_p.K222Q	p.K222Q	NM_014915	NP_055730	WXS	Illumina HiSeq	Unspecified	Q9UPS8	ANR26_HUMAN			5	836	-			222					A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.664A>C	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	T	7.269	0.606736	0.14002	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.31510	4.27;1.49	3.57	-0.314	0.12750	.	.	.	.	.	T	0.16685	0.0401	L	0.29908	0.895	0.09310	N	1	P;P	0.38020	0.615;0.48	B;B	0.37304	0.246;0.124	T	0.16217	-1.0410	9	0.20046	T	0.44	.	2.2519	0.04045	0.2214:0.2613:0.0:0.5173	.	222;222	Q9UPS8-3;Q9UPS8	.;ANR26_HUMAN	Q	222	ENSP00000365255:K222Q;ENSP00000405112:K222Q	ENSP00000365255:K222Q	K	-	1	0	ANKRD26	27415519	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.022000	0.12480	-0.253000	0.09514	0.482000	0.46254	AAA		0.264	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			36	121	0	0	0	0.006999	0	36	121				
NPY4R	5540	broad.mit.edu	37	10	47087519	47087519	+	Missense_Mutation	SNP	C	C	A	rs151042454	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:47087519C>A	ENST00000395716.1	+	2	821	c.736C>A	c.(736-738)Cgc>Agc	p.R246S	NPY4R_ENST00000374312.1_Missense_Mutation_p.R246S			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	246					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)	p.R246S(1)									GAGGCAGGGGCGCGTGTTTCA	0.592																																							uc001jee.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(736-738)CGC>AGC		pancreatic polypeptide receptor 1							157.0	124.0	135.0					10																	47087519		2203	4300	6503	SO:0001583	missense	5540				blood circulation|digestion|feeding behavior	integral to plasma membrane		g.chr10:47087519C>A		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.736C>A	10.37:g.47087519C>A	ENSP00000379066:p.Arg246Ser		Somatic				ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Missense_Mutation_p.R246S	p.R246S	NM_005972	NP_005963	WXS	Illumina HiSeq	Unspecified	P50391	NPY4R_HUMAN			3	1155	+			246			Cytoplasmic (Potential).		Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	ENST00000395716.1	37	c.736C>A	CCDS31193.1	.	.	.	.	.	.	.	.	.	.	C	5.529	0.282469	0.10458	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.41400	1.0;1.0	5.12	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.634744	0.15885	N	0.239827	T	0.25082	0.0609	L	0.31157	0.91	0.23101	N	0.998298	B	0.13145	0.007	B	0.15484	0.013	T	0.21109	-1.0255	10	0.09084	T	0.74	.	6.9907	0.24753	0.0:0.595:0.3043:0.1007	.	246	P50391	NPY4R_HUMAN	S	246	ENSP00000363431:R246S;ENSP00000379066:R246S	ENSP00000363431:R246S	R	+	1	0	PPYR1	46507525	1.000000	0.71417	0.014000	0.15608	0.151000	0.21798	4.125000	0.57931	1.317000	0.45149	0.609000	0.83330	CGC		0.592	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1			12	70	1	0	0.00010058	0.001368	0.000130452	12	70				
DNA2	1763	broad.mit.edu	37	10	70202766	70202766	+	Silent	SNP	G	G	A	rs535129572		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:70202766G>A	ENST00000358410.3	-	9	1373	c.1323C>T	c.(1321-1323)ttC>ttT	p.F441F	DNA2_ENST00000399179.2_Silent_p.F441F|DNA2_ENST00000399180.2_Silent_p.F527F	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	441	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.F527F(1)|p.F441F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						ACCAAAGGCTGAAATATTCTA	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		20107	0.001		0.0	False		,,,				2504	0.0						uc001jof.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1579-1581)TTC>TTT		DNA replication helicase 2 homolog							109.0	99.0	102.0					10																	70202766		1860	4103	5963	SO:0001819	synonymous_variant	1763				base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base	g.chr10:70202766G>A	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.1323C>T	10.37:g.70202766G>A			Somatic				DNA2_uc001jog.1_Silent_p.F441F|DNA2_uc001joh.1_RNA	p.F527F	NM_001080449	NP_001073918	WXS	Illumina HiSeq	Unspecified	P51530	DNA2L_HUMAN			9	1581	-			441					Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Silent	SNP	ENST00000358410.3	37	c.1581C>T																																																																																					0.398	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2			9	24	0	0	0	0.004482	0	9	24				
HTR7	3363	broad.mit.edu	37	10	92616928	92616928	+	Silent	SNP	C	C	A	rs367606495		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:92616928C>A	ENST00000336152.3	-	1	527	c.501G>T	c.(499-501)acG>acT	p.T167T	HTR7_ENST00000371721.3_Silent_p.T167T|HTR7_ENST00000371719.2_Silent_p.T167T|HTR7_ENST00000277874.6_Silent_p.T167T	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	167					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.T167T(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TGATCGAGGCCGTGCAGCACA	0.617																																							uc001kha.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(499-501)ACG>ACT		5-hydroxytryptamine receptor 7 isoform d	Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)						49.0	36.0	41.0					10																	92616928		2203	4300	6503	SO:0001819	synonymous_variant	3363				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity	g.chr10:92616928C>A	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.501G>T	10.37:g.92616928C>A			Somatic				HTR7_uc001kgz.2_Silent_p.T167T|HTR7_uc001khb.2_Silent_p.T167T	p.T167T	NM_019859	NP_062873	WXS	Illumina HiSeq	Unspecified	P34969	5HT7R_HUMAN			1	744	-			167			Helical; Name=3; (By similarity).		B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Silent	SNP	ENST00000336152.3	37	c.501G>T	CCDS7408.1																																																																																				0.617	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872		17	7	1	0	5.3912e-06	0.006122	7.26973e-06	17	7				
DNTT	1791	broad.mit.edu	37	10	98078206	98078206	+	Missense_Mutation	SNP	C	C	A	rs201835824		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:98078206C>A	ENST00000371174.2	+	2	403	c.301C>A	c.(301-303)Ctc>Atc	p.L101I	DNTT_ENST00000419175.1_Missense_Mutation_p.L101I			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	101	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.L101I(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		ACAACCAGAGCTCCTCGATGT	0.488																																							uc001kmf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(301-303)CTC>ATC		terminal deoxynucleotidyltransferase isoform 1							162.0	150.0	154.0					10																	98078206		2203	4300	6503	SO:0001583	missense	1791				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding	g.chr10:98078206C>A	AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.301C>A	10.37:g.98078206C>A	ENSP00000360216:p.Leu101Ile		Somatic				DNTT_uc001kmg.2_Missense_Mutation_p.L101I	p.L101I	NM_004088	NP_004079	WXS	Illumina HiSeq	Unspecified	P04053	TDT_HUMAN		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)	2	471	+		Colorectal(252;0.0815)|all_hematologic(284;0.224)	101			BRCT.		Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	c.301C>A	CCDS7447.1	.	.	.	.	.	.	.	.	.	.	C	4.388	0.071647	0.08436	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.36157	1.27;1.27	5.62	2.67	0.31697	BRCT (4);	0.269959	0.37053	N	0.002272	T	0.25827	0.0629	L	0.38649	1.16	0.33802	D	0.626778	B;B	0.10296	0.003;0.003	B;B	0.26094	0.039;0.066	T	0.18587	-1.0332	10	0.33141	T	0.24	-11.6873	5.5883	0.17287	0.1455:0.6363:0.1405:0.0776	.	101;101	P04053-2;P04053	.;TDT_HUMAN	I	101	ENSP00000401169:L101I;ENSP00000360216:L101I	ENSP00000360216:L101I	L	+	1	0	DNTT	98068196	0.746000	0.28272	0.186000	0.23195	0.020000	0.10135	0.880000	0.28159	0.285000	0.22329	-0.300000	0.09419	CTC		0.488	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088		39	116	1	0	2.19358e-23	0.005524	4.12705e-23	39	116				
R3HCC1L	27291	broad.mit.edu	37	10	99969246	99969246	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:99969246A>G	ENST00000298999.3	+	5	1678	c.1375A>G	c.(1375-1377)Aca>Gca	p.T459A	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.T459A	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	459							nucleotide binding (GO:0000166)	p.T459A(1)									TACAGAGTCAACAGGAAAGTT	0.378																																							uc001kow.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(1375-1377)ACA>GCA		growth inhibition and differentiation related							72.0	70.0	71.0					10																	99969246		2203	4300	6503	SO:0001583	missense	27291						nucleotide binding	g.chr10:99969246A>G	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1375A>G	10.37:g.99969246A>G	ENSP00000298999:p.Thr459Ala		Somatic				C10orf28_uc001kox.3_Missense_Mutation_p.T459A|C10orf28_uc001koy.3_Missense_Mutation_p.T459A|C10orf28_uc009xvx.2_Missense_Mutation_p.T459A|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	p.T459A	NM_014472	NP_055287	WXS	Illumina HiSeq	Unspecified	Q4KMY3	Q4KMY3_HUMAN		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)	4	1670	+		Colorectal(252;0.234)	459					O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	c.1375A>G	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	A	7.954	0.745548	0.15710	.	.	ENSG00000166024	ENST00000370584;ENST00000298999	T;T	0.07688	3.17;3.17	5.38	3.06	0.35304	.	0.329234	0.27531	N	0.018954	T	0.08447	0.0210	M	0.64997	1.995	0.80722	D	1	B;B	0.19583	0.037;0.015	B;B	0.15052	0.012;0.012	T	0.15178	-1.0446	9	.	.	.	-12.3363	5.006	0.14288	0.7194:0.1873:0.0932:0.0	.	459;459	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	A	459	ENSP00000359616:T459A;ENSP00000298999:T459A	.	T	+	1	0	C10orf28	99959236	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.743000	0.26231	0.876000	0.35872	-0.291000	0.09656	ACA		0.378	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472		8	70	0	0	0	0.004482	0	8	70				
SH3PXD2A	9644	broad.mit.edu	37	10	105362429	105362429	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:105362429C>G	ENST00000369774.4	-	15	2822	c.2546G>C	c.(2545-2547)aGc>aCc	p.S849T	SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.S684T|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.S821T|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.S716T			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	849	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.S821T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTGGTAGGCGCTGCATGTCAT	0.612																																							uc001kxj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2461-2463)AGC>ACC		SH3 multiple domains 1							70.0	69.0	69.0					10																	105362429		2203	4300	6503	SO:0001583	missense	9644				cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding	g.chr10:105362429C>G	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2546G>C	10.37:g.105362429C>G	ENSP00000358789:p.Ser849Thr		Somatic				SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Missense_Mutation_p.S656T|SH3PXD2A_uc010qqt.1_Missense_Mutation_p.S698T|SH3PXD2A_uc009xxn.1_Missense_Mutation_p.S656T|SH3PXD2A_uc010qqu.1_Missense_Mutation_p.S764T	p.S821T	NM_014631	NP_055446	WXS	Illumina HiSeq	Unspecified	Q5TCZ1	SPD2A_HUMAN		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)	14	2602	-		Colorectal(252;0.0815)|Breast(234;0.131)	849			SH3 4.		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37	c.2462G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.166|4.166	0.029387|0.029387	0.08054|0.08054	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000420222|ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	.|T;T;T;T	.|0.29142	.|1.58;1.58;1.58;1.58	4.83|4.83	3.8|3.8	0.43715|0.43715	.|Src homology-3 domain (2);	.|0.323099	.|0.37715	.|N	.|0.001971	T|T	0.23572|0.23572	0.0570|0.0570	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	0.999994|0.999994	.|B;P;P;B	.|0.36027	.|0.334;0.472;0.533;0.287	.|B;B;B;B	.|0.42771	.|0.322;0.322;0.397;0.215	T|T	0.09751|0.09751	-1.0660|-1.0660	5|10	.|0.21014	.|T	.|0.42	-19.0441|-19.0441	5.7598|5.7598	0.18192|0.18192	0.0:0.7468:0.0:0.2532|0.0:0.7468:0.0:0.2532	.|.	.|849;698;694;821	.|Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	.|SPD2A_HUMAN;.;.;.	H|T	775|849;821;656;764;716;684	.|ENSP00000358789:S849T;ENSP00000348215:S821T;ENSP00000443663:S716T;ENSP00000441514:S684T	.|ENSP00000318135:S656T	Q|S	-|-	3|2	2|0	SH3PXD2A|SH3PXD2A	105352419|105352419	1.000000|1.000000	0.71417|0.71417	0.045000|0.045000	0.18777|0.18777	0.479000|0.479000	0.33129|0.33129	4.107000|4.107000	0.57811|0.57811	2.255000|2.255000	0.74692|0.74692	0.555000|0.555000	0.69702|0.69702	CAG|AGC		0.612	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631		11	65	0	0	0	0.000978	0	11	65				
SPRN	503542	broad.mit.edu	37	10	135367822	135367822	+	Intron	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr10:135367822G>T	ENST00000541506.1	-	1	141				SYCE1_ENST00000432597.2_Missense_Mutation_p.P274Q|SYCE1_ENST00000368517.3_Missense_Mutation_p.P274Q			Q5BIV9	SPRN_HUMAN	shadow of prion protein homolog (zebrafish)						protein import into nucleus (GO:0006606)	anchored component of membrane (GO:0031225)|cytosol (GO:0005829)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	nucleic acid binding (GO:0003676)	p.P274Q(1)					all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGGTCTACCTGGTCTGGGAGC	0.468																																							uc009ybn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(928-930)CCA>CAA		synaptonemal complex central element protein 1							217.0	163.0	181.0					10																	135367822		2203	4300	6503	SO:0001627	intron_variant	93426				cell division	central element		g.chr10:135367822G>T		CCDS53589.1	10q26.3	2011-02-09			ENSG00000203772	ENSG00000203772			16871	protein-coding gene	gene with protein product	"""hypothetical protein BC004409"""	610447				14527721	Standard	NM_001012508		Approved	Shadoo, Sprn, bA108K14.1, FLJ41197	uc001lnf.4	Q5BIV9	OTTHUMG00000019324	ENST00000541506.1:c.15+14953C>A	10.37:g.135367822G>T			Somatic				CYP2E1_uc001lnl.1_Intron|SYCE1_uc001lnm.2_Missense_Mutation_p.P182Q|SYCE1_uc001lnn.2_Missense_Mutation_p.P274Q	p.P310Q	NM_001143763	NP_001137235	WXS	Illumina HiSeq	Unspecified	Q8N0S2	SYCE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	13	1034	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	311						Missense_Mutation	SNP	ENST00000541506.1	37	c.929C>A	CCDS53589.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.668968	0.29604	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517	T;T;T	0.37752	1.18;1.2;1.2	2.23	1.3	0.21679	.	.	.	.	.	T	0.35740	0.0942	.	.	.	0.09310	N	1	P;P	0.45768	0.752;0.866	B;P	0.47705	0.221;0.555	T	0.20207	-1.0282	8	0.72032	D	0.01	.	4.7123	0.12879	0.1853:0.0:0.8147:0.0	.	182;274	Q8N0S2-3;Q8N0S2-2	.;.	Q	310;274;274	ENSP00000303978:P310Q;ENSP00000411779:P274Q;ENSP00000357503:P274Q	ENSP00000303978:P310Q	P	-	2	0	SYCE1	135217812	0.000000	0.05858	0.001000	0.08648	0.071000	0.16799	0.400000	0.20932	0.520000	0.28426	0.561000	0.74099	CCA		0.468	SPRN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051175.2	NM_001012508		25	71	1	0	1.5548e-18	0.005443	2.76151e-18	25	71				
OR52E2	119678	broad.mit.edu	37	11	5080209	5080209	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:5080209G>C	ENST00000321522.2	-	1	648	c.649C>G	c.(649-651)Ctt>Gtt	p.L217V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L217V(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACATAAGAAAGGGCAATGACT	0.408																																							uc010qyw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(649-651)CTT>GTT		olfactory receptor, family 52, subfamily E,							96.0	83.0	87.0					11																	5080209		2201	4298	6499	SO:0001583	missense	119678				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5080209G>C	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.649C>G	11.37:g.5080209G>C	ENSP00000322088:p.Leu217Val		Somatic					p.L217V	NM_001005164	NP_001005164	WXS	Illumina HiSeq	Unspecified	Q8NGJ4	O52E2_HUMAN		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)	1	649	-		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	217			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000321522.2	37	c.649C>G	CCDS31371.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.499150	0.00157	.	.	ENSG00000176787	ENST00000321522	T	0.35421	1.31	3.76	-0.456	0.12190	GPCR, rhodopsin-like superfamily (1);	0.616903	0.14405	N	0.321647	T	0.15565	0.0375	N	0.25789	0.76	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.28522	-1.0041	10	0.02654	T	1	.	1.4806	0.02436	0.2643:0.1355:0.4471:0.1531	.	217	Q8NGJ4	O52E2_HUMAN	V	217	ENSP00000322088:L217V	ENSP00000322088:L217V	L	-	1	0	OR52E2	5036785	0.000000	0.05858	0.073000	0.20177	0.030000	0.12068	-1.192000	0.03052	-0.054000	0.13266	0.644000	0.83932	CTT		0.408	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164		4	75	0	0	0	0.000602	0	4	75				
UBQLN3	50613	broad.mit.edu	37	11	5529784	5529784	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:5529784G>C	ENST00000311659.4	-	2	1152	c.1005C>G	c.(1003-1005)aaC>aaG	p.N335K	HBG2_ENST00000380252.1_5'Flank|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	335								p.N335K(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACCCAGAAAGTTTGGAAACC	0.512																																					Ovarian(72;684 1260 12332 41642 52180)	Ovarian(72;684 1260 12332 41642 52180)	uc001may.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1003-1005)AAC>AAG		ubiquilin 3							86.0	82.0	83.0					11																	5529784		2201	4297	6498	SO:0001583	missense	50613							g.chr11:5529784G>C	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1005C>G	11.37:g.5529784G>C	ENSP00000347997:p.Asn335Lys		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	p.N335K	NM_017481	NP_059509	WXS	Illumina HiSeq	Unspecified	Q9H347	UBQL3_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	1091	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	335					Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	c.1005C>G	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	3.031	-0.199693	0.06219	.	.	ENSG00000175520	ENST00000311659	T	0.36878	1.23	5.0	1.79	0.24919	.	0.495245	0.16962	N	0.192446	T	0.34337	0.0894	M	0.75447	2.3	0.18873	N	0.999987	B	0.06786	0.001	B	0.01281	0.0	T	0.29549	-1.0008	10	0.44086	T	0.13	-15.0056	6.2857	0.21031	0.3747:0.0:0.6253:0.0	.	335	Q9H347	UBQL3_HUMAN	K	335	ENSP00000347997:N335K	ENSP00000347997:N335K	N	-	3	2	UBQLN3	5486360	0.038000	0.19896	0.205000	0.23548	0.206000	0.24218	0.080000	0.14802	0.257000	0.21650	0.591000	0.81541	AAC		0.512	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		3	118	0	0	0	0.004672	0	3	118				
OLFML1	283298	broad.mit.edu	37	11	7530834	7530834	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:7530834C>A	ENST00000329293.3	+	3	1018	c.624C>A	c.(622-624)atC>atA	p.I208I	OLFML1_ENST00000528758.1_3'UTR|CTD-2516F10.2_ENST00000530201.1_RNA|OLFML1_ENST00000530135.1_Silent_p.I208I	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	208	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)		p.I208I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GGAAGCAAATCCTAACACTTT	0.403																																							uc001mfi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(622-624)ATC>ATA		olfactomedin-like 1 precursor							82.0	79.0	80.0					11																	7530834		2201	4296	6497	SO:0001819	synonymous_variant	283298					extracellular region		g.chr11:7530834C>A	AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.624C>A	11.37:g.7530834C>A			Somatic				OLFML1_uc010raz.1_Silent_p.I72I|OLFML1_uc010rba.1_Silent_p.I208I	p.I208I	NM_198474	NP_940876	WXS	Illumina HiSeq	Unspecified	Q6UWY5	OLFL1_HUMAN		Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)	3	976	+			208			Olfactomedin-like.		B4DP03|Q569G4	Silent	SNP	ENST00000329293.3	37	c.624C>A	CCDS7779.1																																																																																				0.403	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474		24	36	1	0	3.7963e-18	0.00333	6.69274e-18	24	36				
USP47	55031	broad.mit.edu	37	11	11976665	11976665	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:11976665G>T	ENST00000399455.2	+	28	4027	c.3907G>T	c.(3907-3909)Gtc>Ttc	p.V1303F	USP47_ENST00000305481.6_3'UTR|USP47_ENST00000339865.5_Missense_Mutation_p.V1215F|USP47_ENST00000527733.1_Missense_Mutation_p.V1283F|USP47_ENST00000539466.1_Missense_Mutation_p.V85F	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1303					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)	p.V1215F(1)		breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TACCCTGAATGTCTGGCCTCT	0.358																																							uc001mjs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3847-3849)GTC>TTC		ubiquitin specific protease 47							179.0	163.0	168.0					11																	11976665		1850	4111	5961	SO:0001583	missense	55031				base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding	g.chr11:11976665G>T	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3907G>T	11.37:g.11976665G>T	ENSP00000382382:p.Val1303Phe		Somatic				USP47_uc001mjr.2_Missense_Mutation_p.V1215F|USP47_uc009ygi.2_Missense_Mutation_p.V85F	p.V1283F	NM_017944	NP_060414	WXS	Illumina HiSeq	Unspecified	Q96K76	UBP47_HUMAN		Epithelial(150;0.000339)	27	4610	+			1303					B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37	c.3847G>T		.	.	.	.	.	.	.	.	.	.	G	28.1	4.889172	0.91889	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000539466;ENST00000399455	T;T;T	0.04603	3.59;3.59;3.59	5.95	5.95	0.96441	.	0.057127	0.64402	D	0.000001	T	0.07999	0.0200	N	0.22421	0.69	0.80722	D	1	P;P	0.48503	0.856;0.911	B;P	0.47705	0.353;0.555	T	0.18650	-1.0330	10	0.51188	T	0.08	.	19.9763	0.97309	0.0:0.0:1.0:0.0	.	1283;1215	E9PM46;Q96K76-2	.;.	F	1215;1283;85;1303	ENSP00000339957:V1215F;ENSP00000433146:V1283F;ENSP00000382382:V1303F	ENSP00000339957:V1215F	V	+	1	0	USP47	11933241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.821000	0.97095	0.650000	0.86243	GTC		0.358	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944		46	101	1	0	2.56662e-36	0.003214	5.19876e-36	46	101				
TPH1	7166	broad.mit.edu	37	11	18047172	18047172	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:18047172C>A	ENST00000250018.2	-	7	1442	c.880G>T	c.(880-882)Ggc>Tgc	p.G294C	RP1-59M18.2_ENST00000525523.1_RNA|TPH1_ENST00000525406.1_5'Flank|TPH1_ENST00000341556.2_Missense_Mutation_p.G294C	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	294					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.G294C(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	GAAGCCAAGCCAATTTCTTGG	0.453																																							uc001mnp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(880-882)GGC>TGC		tryptophan hydroxylase 1	L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)						92.0	93.0	93.0					11																	18047172		2200	4293	6493	SO:0001583	missense	7166				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr11:18047172C>A	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.880G>T	11.37:g.18047172C>A	ENSP00000250018:p.Gly294Cys		Somatic				TPH1_uc009yhe.2_RNA	p.G294C	NM_004179	NP_004170	WXS	Illumina HiSeq	Unspecified	P17752	TPH1_HUMAN			7	906	-			294					D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	c.880G>T	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096270	0.94197	.	.	ENSG00000129167	ENST00000250018;ENST00000341556	D;D	0.99942	-8.47;-8.47	5.71	5.71	0.89125	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	H	0.97491	4.015	0.80722	D	1	D	0.62365	0.991	D	0.66716	0.946	D	0.96277	0.9203	10	0.87932	D	0	-14.1284	19.8342	0.96648	0.0:1.0:0.0:0.0	.	294	P17752	TPH1_HUMAN	C	294	ENSP00000250018:G294C;ENSP00000343550:G294C	ENSP00000250018:G294C	G	-	1	0	TPH1	18003748	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.773000	0.85462	2.692000	0.91855	0.561000	0.74099	GGC		0.453	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179		42	83	1	0	3.43241e-23	0.002222	6.40717e-23	42	83				
DCDC1	341019	broad.mit.edu	37	11	31329334	31329334	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:31329334C>G	ENST00000452803.1	-	4	487	c.286G>C	c.(286-288)Gat>Cat	p.D96H	DCDC1_ENST00000597505.1_Missense_Mutation_p.D96H|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	96					intracellular signal transduction (GO:0035556)			p.D96H(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTGGAGCAATCTTGAAGTCCT	0.388																																							uc001msv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(286-288)GAT>CAT		doublecortin domain containing 1							333.0	308.0	316.0					11																	31329334		2202	4299	6501	SO:0001583	missense	341019				intracellular signal transduction			g.chr11:31329334C>G	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.286G>C	11.37:g.31329334C>G	ENSP00000389792:p.Asp96His		Somatic				DCDC1_uc001msu.1_5'UTR	p.D96H	NM_181807	NP_861523	WXS	Illumina HiSeq	Unspecified	P59894	DCDC1_HUMAN			4	488	-	Lung SC(675;0.225)		96					A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	c.286G>C	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682353	0.68042	.	.	ENSG00000188682	ENST00000452803	T	0.53206	0.63	5.9	4.99	0.66335	.	0.104584	0.41823	D	0.000816	T	0.46347	0.1388	L	0.32530	0.975	0.34024	D	0.652962	D	0.57571	0.98	P	0.50934	0.654	T	0.62595	-0.6821	10	0.62326	D	0.03	.	11.971	0.53063	0.0:0.8119:0.1219:0.0662	.	96	P59894	DCDC1_HUMAN	H	96	ENSP00000389792:D96H	ENSP00000343496:D96H	D	-	1	0	DCDC1	31285910	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.139000	0.50577	1.496000	0.48567	0.650000	0.86243	GAT		0.388	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807		5	279	0	0	0	0.001984	0	5	279				
AMBRA1	55626	broad.mit.edu	37	11	46455071	46455071	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:46455071G>A	ENST00000458649.2	-	14	3347	c.2929C>T	c.(2929-2931)Cag>Tag	p.Q977*	AMBRA1_ENST00000533727.1_Nonsense_Mutation_p.Q858*|AMBRA1_ENST00000534300.1_Nonsense_Mutation_p.Q917*|AMBRA1_ENST00000426438.1_Nonsense_Mutation_p.Q948*|AMBRA1_ENST00000314845.3_Nonsense_Mutation_p.Q887*|AMBRA1_ENST00000298834.3_Nonsense_Mutation_p.Q917*|AMBRA1_ENST00000528950.1_Nonsense_Mutation_p.Q948*			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	977					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)		p.Q977*(1)|p.Q887*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CTGAAGACCTGGGCCACCATG	0.582																																							uc010rgu.1		NA																	2	Substitution - Nonsense(2)		lung(2)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(2929-2931)CAG>TAG		activating molecule in beclin-1-regulated							84.0	68.0	73.0					11																	46455071		2201	4299	6500	SO:0001587	stop_gained	55626				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle		g.chr11:46455071G>A	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2929C>T	11.37:g.46455071G>A	ENSP00000415327:p.Gln977*		Somatic				AMBRA1_uc010rgt.1_Nonsense_Mutation_p.Q543*|AMBRA1_uc009ylc.1_Nonsense_Mutation_p.Q948*|AMBRA1_uc001ncu.1_Nonsense_Mutation_p.Q887*|AMBRA1_uc001ncv.2_Nonsense_Mutation_p.Q980*|AMBRA1_uc001ncw.2_Nonsense_Mutation_p.Q858*|AMBRA1_uc001ncx.2_Nonsense_Mutation_p.Q917*	p.Q977*	NM_017749	NP_060219	WXS	Illumina HiSeq	Unspecified	Q9C0C7	AMRA1_HUMAN		GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)	14	3289	-			977					A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Nonsense_Mutation	SNP	ENST00000458649.2	37	c.2929C>T		.	.	.	.	.	.	.	.	.	.	G	43	10.214529	0.99361	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	.	.	.	X	887;858;917;948;917;977;948	.	ENSP00000298834:Q917X	Q	-	1	0	AMBRA1	46411647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.682000	0.98655	2.806000	0.96561	0.655000	0.94253	CAG		0.582	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		8	20	0	0	0	0.00308	0	8	20				
MS4A14	84689	broad.mit.edu	37	11	60184410	60184410	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:60184410C>A	ENST00000300187.6	+	5	2246	c.1969C>A	c.(1969-1971)Cac>Aac	p.H657N	MS4A14_ENST00000531783.1_Missense_Mutation_p.H690N|MS4A14_ENST00000395005.2_Missense_Mutation_p.H640N|MS4A14_ENST00000531787.1_Missense_Mutation_p.H545N	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	657	Gln-rich.					integral component of membrane (GO:0016021)		p.H657N(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CTGGCAATTCCACAAAGGCAA	0.453																																							uc001npj.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1969-1971)CAC>AAC		membrane-spanning 4-domains, subfamily A, member							81.0	85.0	84.0					11																	60184410		2203	4300	6503	SO:0001583	missense	84689					integral to membrane	receptor activity	g.chr11:60184410C>A	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1969C>A	11.37:g.60184410C>A	ENSP00000300187:p.His657Asn		Somatic				MS4A14_uc001npi.2_Missense_Mutation_p.H545N|MS4A14_uc001npn.2_Missense_Mutation_p.H395N|MS4A14_uc001npk.2_Missense_Mutation_p.H640N|MS4A14_uc001npl.2_Missense_Mutation_p.H395N|MS4A14_uc001npm.2_Missense_Mutation_p.H395N	p.H657N	NM_032597	NP_115986	WXS	Illumina HiSeq	Unspecified	Q96JA4	M4A14_HUMAN			5	2534	+			657			Gln-rich.		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	c.1969C>A	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.245656	0.01481	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.34472	1.36;2.58;1.37;2.92	3.12	-2.21	0.06973	.	9.404650	0.00166	N	0.000000	T	0.18841	0.0452	N	0.14661	0.345	0.09310	N	1	B;B	0.34161	0.439;0.312	B;B	0.27380	0.079;0.036	T	0.08534	-1.0717	10	0.42905	T	0.14	.	3.51	0.07704	0.2064:0.5533:0.1324:0.1079	.	640;657	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	N	545;657;640;690	ENSP00000437222:H545N;ENSP00000300187:H657N;ENSP00000378453:H640N;ENSP00000433761:H690N	ENSP00000300187:H657N	H	+	1	0	MS4A14	59940986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.739000	0.04866	-0.454000	0.07066	-0.182000	0.12963	CAC		0.453	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2			34	85	1	0	1.62565e-12	0.002445	2.62308e-12	34	85				
INTS5	80789	broad.mit.edu	37	11	62416483	62416483	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:62416483C>A	ENST00000330574.2	-	2	1121	c.1069G>T	c.(1069-1071)Gga>Tga	p.G357*	GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000534779.1_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	357					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.G357*(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						ACAAGCTCTCCAGAGACAGTG	0.602																																							uc001nud.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(1069-1071)GGA>TGA		integrator complex subunit 5							49.0	53.0	52.0					11																	62416483		2202	4299	6501	SO:0001587	stop_gained	80789				snRNA processing	integral to membrane|integrator complex	protein binding	g.chr11:62416483C>A	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.1069G>T	11.37:g.62416483C>A	ENSP00000327889:p.Gly357*		Somatic				GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	p.G357*	NM_030628	NP_085131	WXS	Illumina HiSeq	Unspecified	Q6P9B9	INT5_HUMAN			2	1122	-			357					Q8N6W5|Q9C0G5	Nonsense_Mutation	SNP	ENST00000330574.2	37	c.1069G>T	CCDS8027.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679723	0.68042	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.73	4.73	0.59995	.	0.205117	0.42964	D	0.000638	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	10.9991	0.47593	0.0:0.8114:0.1886:0.0	.	.	.	.	X	357	.	ENSP00000327889:G357X	G	-	1	0	INTS5	62173059	0.083000	0.21467	1.000000	0.80357	0.984000	0.73092	0.795000	0.26972	2.462000	0.83206	0.650000	0.86243	GGA		0.602	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628		25	56	1	0	5.35047e-06	0.00333	7.25591e-06	25	56				
ZBTB3	79842	broad.mit.edu	37	11	62519947	62519947	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:62519947A>T	ENST00000394807.3	-	2	1465	c.1340T>A	c.(1339-1341)cTg>cAg	p.L447Q		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	447					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L447Q(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						TGGCTCATGCAGGGATGCGGG	0.552																																							uc001nuz.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(1339-1341)CTG>CAG		zinc finger and BTB domain containing 3							70.0	64.0	66.0					11																	62519947		2202	4299	6501	SO:0001583	missense	79842				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:62519947A>T	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1340T>A	11.37:g.62519947A>T	ENSP00000378286:p.Leu447Gln		Somatic					p.L447Q	NM_024784	NP_079060	WXS	Illumina HiSeq	Unspecified	Q9H5J0	ZBTB3_HUMAN			2	1462	-			447						Missense_Mutation	SNP	ENST00000394807.3	37	c.1340T>A	CCDS8034.1	.	.	.	.	.	.	.	.	.	.	A	9.793	1.178476	0.21787	.	.	ENSG00000185670	ENST00000394807	T	0.16073	2.37	4.72	4.72	0.59763	.	0.851305	0.10386	N	0.681004	T	0.12689	0.0308	L	0.27053	0.805	0.24546	N	0.994043	B	0.17038	0.02	B	0.16289	0.015	T	0.14364	-1.0475	10	0.44086	T	0.13	.	7.0561	0.25099	0.8985:0.0:0.1015:0.0	.	447	Q9H5J0	ZBTB3_HUMAN	Q	447	ENSP00000378286:L447Q	ENSP00000378286:L447Q	L	-	2	0	ZBTB3	62276523	0.996000	0.38824	0.997000	0.53966	0.313000	0.28021	2.621000	0.46418	1.770000	0.52166	0.459000	0.35465	CTG		0.552	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395342.1	NM_024784		21	54	0	0	0	0.00278	0	21	54				
NXF1	10482	broad.mit.edu	37	11	62568674	62568674	+	Splice_Site	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:62568674C>A	ENST00000532297.1	-	10	1428		c.e10-1		NXF1_ENST00000294172.2_Splice_Site|NXF1_ENST00000531709.2_Splice_Site|NXF1_ENST00000531131.1_Splice_Site|NXF1_ENST00000439713.2_Splice_Site			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGGACAATAGCTGTGAGGAGA	0.493																																							uc001nvf.1		NA																	1	Unknown(1)		lung(1)	skin(3)	3						c.e9-1		nuclear RNA export factor 1 isoform 1							108.0	92.0	97.0					11																	62568674		2201	4299	6500	SO:0001630	splice_region_variant	10482				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding	g.chr11:62568674C>A	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.799-1G>T	11.37:g.62568674C>A			Somatic				NXF1_uc001nvg.1_Splice_Site_p.L267_splice|NXF1_uc009yog.1_Splice_Site_p.L310_splice|NXF1_uc010rmh.1_Splice_Site_p.L130_splice	p.L267_splice	NM_006362	NP_006353	WXS	Illumina HiSeq	Unspecified	Q9UBU9	NXF1_HUMAN			9	935	-								B4E269|Q99799|Q9UQL2	Splice_Site	SNP	ENST00000532297.1	37	c.799_splice	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911587	0.72983	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0666	0.71999	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NXF1	62325250	1.000000	0.71417	0.938000	0.37757	0.900000	0.52787	7.165000	0.77544	2.480000	0.83734	0.655000	0.94253	.		0.493	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	Intron	13	44	1	0	0.000151284	0.001855	0.000194625	13	44				
NXF1	10482	broad.mit.edu	37	11	62571288	62571288	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:62571288G>A	ENST00000532297.1	-	3	820	c.191C>T	c.(190-192)gCc>gTc	p.A64V	NXF1_ENST00000294172.2_Missense_Mutation_p.A64V|NXF1_ENST00000531709.2_Missense_Mutation_p.A64V|NXF1_ENST00000531131.1_Intron|NXF1_ENST00000439713.2_Missense_Mutation_p.A64V			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	64	Interaction with ALYREF/THOC4.|Major non-specific RNA-binding.|RNA-binding (RBD).				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A64V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACCATCCTGGGCATCACTCAT	0.483																																							uc001nvf.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(190-192)GCC>GTC		nuclear RNA export factor 1 isoform 1							155.0	138.0	144.0					11																	62571288		2201	4299	6500	SO:0001583	missense	10482				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding	g.chr11:62571288G>A	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.191C>T	11.37:g.62571288G>A	ENSP00000436679:p.Ala64Val		Somatic				NXF1_uc001nvg.1_Missense_Mutation_p.A64V|NXF1_uc009yog.1_Missense_Mutation_p.A107V|NXF1_uc010rmh.1_Intron	p.A64V	NM_006362	NP_006353	WXS	Illumina HiSeq	Unspecified	Q9UBU9	NXF1_HUMAN			2	327	-			64			Interaction with THOC4.		B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	c.191C>T	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594318	0.28445	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713;ENST00000533671;ENST00000531474	T;T;T;T	0.45668	0.92;0.92;0.89;0.89	4.82	3.91	0.45181	.	0.438446	0.24323	N	0.039529	T	0.27489	0.0675	N	0.20845	0.615	0.32138	N	0.585931	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.12837	0.008;0.002;0.0	T	0.23833	-1.0177	10	0.34782	T	0.22	-7.3444	10.8908	0.46994	0.0908:0.0:0.9092:0.0	.	107;77;64	E9PIN3;Q59E96;Q9UBU9	.;.;NXF1_HUMAN	V	64;64;107;64;4;4	ENSP00000294172:A64V;ENSP00000436679:A64V;ENSP00000435742:A107V;ENSP00000408864:A64V	ENSP00000294172:A64V	A	-	2	0	NXF1	62327864	0.749000	0.28305	0.989000	0.46669	0.889000	0.51656	1.740000	0.38228	1.263000	0.44181	0.655000	0.94253	GCC		0.483	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362		16	153	0	0	0	0.007413	0	16	153				
SART1	9092	broad.mit.edu	37	11	65743992	65743992	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:65743992C>G	ENST00000312397.5	+	13	1791	c.1699C>G	c.(1699-1701)Ccc>Gcc	p.P567A		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	567					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P567A(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGGGGAGATCCCCACCTACGG	0.697																																							uc001ogl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1699-1701)CCC>GCC		squamous cell carcinoma antigen recognized by T							38.0	38.0	38.0					11																	65743992		2201	4296	6497	SO:0001583	missense	9092				cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol		g.chr11:65743992C>G	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1699C>G	11.37:g.65743992C>G	ENSP00000310448:p.Pro567Ala		Somatic					p.P567A	NM_005146	NP_005137	WXS	Illumina HiSeq	Unspecified	O43290	SNUT1_HUMAN			13	1791	+			567					A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	37	c.1699C>G	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075593	0.76415	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.21932	1.98	4.88	3.02	0.34903	.	0.065647	0.64402	D	0.000008	T	0.29882	0.0747	M	0.89287	3.02	0.58432	D	0.999992	P	0.40360	0.714	B	0.38500	0.275	T	0.16512	-1.0400	10	0.87932	D	0	-20.3175	8.7834	0.34804	0.0:0.8165:0.0:0.1835	.	567	O43290	SNUT1_HUMAN	A	567;409	ENSP00000310448:P567A	ENSP00000310448:P567A	P	+	1	0	SART1	65500568	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.040000	0.57333	0.669000	0.31146	0.491000	0.48974	CCC		0.697	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1			8	32	0	0	0	0.000978	0	8	32				
SHANK2	22941	broad.mit.edu	37	11	70507767	70507767	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:70507767C>G	ENST00000423696.2	-	6	769	c.733G>C	c.(733-735)Gag>Cag	p.E245Q	SHANK2_ENST00000409161.1_Missense_Mutation_p.E35Q|SHANK2_ENST00000449116.2_Missense_Mutation_p.E36Q|SHANK2_ENST00000449833.2_Missense_Mutation_p.E36Q|SHANK2_ENST00000357171.3_Missense_Mutation_p.E36Q|SHANK2_ENST00000409530.1_Missense_Mutation_p.E35Q|SHANK2_ENST00000338508.4_Missense_Mutation_p.E625Q			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	245					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.E36Q(2)|p.E625Q(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ACCGTCTTCTCCTCAATAATG	0.547																																							uc001oqc.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(1870-1872)GAG>CAG		SH3 and multiple ankyrin repeat domains 2							165.0	156.0	159.0					11																	70507767		2200	4294	6494	SO:0001583	missense	22941				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding	g.chr11:70507767C>G	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.733G>C	11.37:g.70507767C>G	ENSP00000394536:p.Glu245Gln		Somatic				SHANK2_uc010rqn.1_Missense_Mutation_p.E36Q|SHANK2_uc001opz.2_Missense_Mutation_p.E36Q|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Missense_Mutation_p.E36Q	p.E624Q	NM_012309	NP_036441	WXS	Illumina HiSeq	Unspecified	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)		13	1948	-			245					C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37	c.1870G>C		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	18.60|18.60|18.60	3.658161|3.658161|3.658161	0.67586|0.67586|0.67586	.|.|.	.|.|.	ENSG00000162105|ENSG00000162105|ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000409530;ENST00000449116;ENST00000357171|ENST00000412252|ENST00000426687	T;T;T;T;T;T;T;T|.|.	0.45276|.|.	0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9|.|.	4.76|4.76|4.76	4.76|4.76|4.76	0.60689|0.60689|0.60689	PDZ/DHR/GLGF (1);|.|.	0.120872|.|.	0.53938|.|.	D|.|.	0.000053|.|.	T|T|T	0.69015|0.69015|0.69015	0.3064|0.3064|0.3064	L|L|L	0.50333|0.50333|0.50333	1.59|1.59|1.59	0.49213|0.49213|0.49213	D|D|D	0.999764|0.999764|0.999764	B;P;B;B|.|.	0.36535|.|.	0.249;0.557;0.017;0.305|.|.	B;B;B;B|.|.	0.40825|.|.	0.063;0.341;0.026;0.281|.|.	T|T|T	0.67237|0.67237|0.67237	-0.5721|-0.5721|-0.5721	10|5|5	0.46703|.|.	T|.|.	0.11|.|.	.|.|.	17.7826|17.7826|17.7826	0.88528|0.88528|0.88528	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	36;245;624;36|.|.	B7ZKU9;Q9UPX8;Q9UPX8-3;Q9UPX8-4|.|.	.;SHAN2_HUMAN;.;.|.|.	Q|A|S	36;35;625;245;259;255;35;36;36|34|33	ENSP00000399423:E36Q;ENSP00000386491:E35Q;ENSP00000345193:E625Q;ENSP00000394536:E245Q;ENSP00000294018:E255Q;ENSP00000387324:E35Q;ENSP00000394939:E36Q;ENSP00000349694:E36Q|.|.	ENSP00000294018:E255Q|.|.	E|G|R	-|-|-	1|2|3	0|0|2	SHANK2|SHANK2|SHANK2	70185415|70185415|70185415	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.987000|0.987000|0.987000	0.75469|0.75469|0.75469	7.049000|7.049000|7.049000	0.76613|0.76613|0.76613	2.189000|2.189000|2.189000	0.69895|0.69895|0.69895	0.491000|0.491000|0.491000	0.48974|0.48974|0.48974	GAG|GGA|AGG		0.547	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		27	202	0	0	0	0.00632	0	27	202				
LRRC32	2615	broad.mit.edu	37	11	76371671	76371671	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:76371671C>G	ENST00000407242.2	-	3	1208	c.966G>C	c.(964-966)ttG>ttC	p.L322F	AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Missense_Mutation_p.L322F|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Missense_Mutation_p.L322F	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	322					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.L322F(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CATTGTAGCTCAAATCCAGAT	0.597																																							uc001oxq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(964-966)TTG>TTC		leucine rich repeat containing 32 precursor							25.0	29.0	27.0					11																	76371671		2200	4292	6492	SO:0001583	missense	2615					integral to plasma membrane		g.chr11:76371671C>G	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.966G>C	11.37:g.76371671C>G	ENSP00000384126:p.Leu322Phe		Somatic				LRRC32_uc001oxr.3_Missense_Mutation_p.L322F|LRRC32_uc010rsf.1_Missense_Mutation_p.L322F	p.L322F	NM_005512	NP_005503	WXS	Illumina HiSeq	Unspecified	Q14392	LRC32_HUMAN			3	1209	-			322			LRR 11.|Extracellular (Potential).		Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	c.966G>C	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986162	0.53934	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.10382	2.88;2.88;2.88	4.35	3.34	0.38264	.	0.143965	0.47455	D	0.000233	T	0.33702	0.0872	M	0.87269	2.87	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.14980	-1.0453	10	0.72032	D	0.01	.	9.7736	0.40605	0.0:0.8456:0.0:0.1544	.	322	Q14392	LRC32_HUMAN	F	322	ENSP00000260061:L322F;ENSP00000384126:L322F;ENSP00000385766:L322F	ENSP00000260061:L322F	L	-	3	2	LRRC32	76049319	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.434000	0.52841	2.264000	0.75181	0.555000	0.69702	TTG		0.597	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512		22	45	0	0	0	0.002299	0	22	45				
CADM1	23705	broad.mit.edu	37	11	115049441	115049441	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:115049441C>A	ENST00000452722.3	-	9	1153	c.1133G>T	c.(1132-1134)gGt>gTt	p.G378V	CADM1_ENST00000536727.1_Missense_Mutation_p.G379V|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000537058.1_Missense_Mutation_p.G389V|CADM1_ENST00000542447.2_Missense_Mutation_p.G350V|CADM1_ENST00000331581.6_Missense_Mutation_p.G407V	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.G378V(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CACGACGCCACCGATCACGGC	0.512																																							uc001ppi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1132-1134)GGT>GTT		immunoglobulin superfamily, member 4D isoform 1							133.0	114.0	121.0					11																	115049441		2201	4296	6497	SO:0001583	missense	23705				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding	g.chr11:115049441C>A	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1133G>T	11.37:g.115049441C>A	ENSP00000395359:p.Gly378Val		Somatic				CADM1_uc001ppf.3_Missense_Mutation_p.G350V|CADM1_uc001ppk.3_Missense_Mutation_p.G350V|CADM1_uc001ppj.3_Missense_Mutation_p.G379V|CADM1_uc001pph.3_Missense_Mutation_p.G141V	p.G378V	NM_014333	NP_055148	WXS	Illumina HiSeq	Unspecified	Q9BY67	CADM1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)	9	1262	-	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)	378			Helical; (Potential).			Missense_Mutation	SNP	ENST00000452722.3	37	c.1133G>T	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765450	0.69878	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.86539	0.5957	M	0.86502	2.82	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.998	D	0.88649	0.3181	10	0.72032	D	0.01	.	18.4828	0.90818	0.0:1.0:0.0:0.0	.	389;351;378;350	F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;CADM1_HUMAN;.	V	350;378;389;379;309;407;63	ENSP00000439176:G350V;ENSP00000395359:G378V;ENSP00000439817:G389V;ENSP00000440322:G379V;ENSP00000329797:G407V	ENSP00000329797:G407V	G	-	2	0	CADM1	114554651	1.000000	0.71417	0.981000	0.43875	0.986000	0.74619	7.320000	0.79064	2.617000	0.88574	0.655000	0.94253	GGT		0.512	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333		10	131	1	0	7.48243e-07	0.006214	1.03536e-06	10	131				
ZNF202	7753	broad.mit.edu	37	11	123597329	123597329	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:123597329G>A	ENST00000529691.1	-	7	1542	c.1323C>T	c.(1321-1323)gcC>gcT	p.A441A	ZNF202_ENST00000530393.1_Silent_p.A441A|ZNF202_ENST00000336139.4_Silent_p.A441A			O95125	ZN202_HUMAN	zinc finger protein 202	441					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A441A(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TTTGGTGCCTGGCAAGATGTG	0.468																																							uc001pzd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1321-1323)GCC>GCT		zinc finger protein 202							131.0	127.0	129.0					11																	123597329		2202	4299	6501	SO:0001819	synonymous_variant	7753				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr11:123597329G>A	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.1323C>T	11.37:g.123597329G>A			Somatic				ZNF202_uc001pzc.1_Silent_p.A217A|ZNF202_uc001pze.1_Silent_p.A441A|ZNF202_uc001pzf.1_Silent_p.A441A	p.A441A	NM_003455	NP_003446	WXS	Illumina HiSeq	Unspecified	O95125	ZN202_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)	9	1723	-		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	441			C2H2-type 2.		B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Silent	SNP	ENST00000529691.1	37	c.1323C>T	CCDS8443.1																																																																																				0.468	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455		47	96	0	0	0	0.00361	0	47	96				
ROBO3	64221	broad.mit.edu	37	11	124740965	124740965	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:124740965C>A	ENST00000397801.1	+	7	1281	c.1089C>A	c.(1087-1089)agC>agA	p.S363R	ROBO3_ENST00000538940.1_Missense_Mutation_p.S341R	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	363	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.S363R(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTGGAGAGAGCGTGGCTTTCC	0.602																																							uc001qbc.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1087-1089)AGC>AGA		roundabout, axon guidance receptor, homolog 3							46.0	51.0	50.0					11																	124740965		1972	4145	6117	SO:0001583	missense	64221				axon midline choice point recognition	integral to membrane	receptor activity	g.chr11:124740965C>A	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1089C>A	11.37:g.124740965C>A	ENSP00000380903:p.Ser363Arg		Somatic					p.S363R	NM_022370	NP_071765	WXS	Illumina HiSeq	Unspecified	Q96MS0	ROBO3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)	7	1281	+	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)	363			Ig-like C2-type 4.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000397801.1	37	c.1089C>A	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512566	0.27123	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.75821	-0.97;-0.97	4.3	-7.92	0.01160	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.534882	0.14878	N	0.293142	T	0.71660	0.3366	L	0.28776	0.89	0.58432	D	0.999999	P	0.45396	0.857	P	0.62298	0.9	T	0.78823	-0.2052	10	0.49607	T	0.09	.	12.4594	0.55723	0.0916:0.1015:0.0:0.8069	.	363	Q96MS0	ROBO3_HUMAN	R	363;341	ENSP00000380903:S363R;ENSP00000441797:S341R	ENSP00000380903:S363R	S	+	3	2	ROBO3	124246175	0.001000	0.12720	0.001000	0.08648	0.527000	0.34593	-1.424000	0.02448	-1.898000	0.01100	-1.280000	0.01385	AGC		0.602	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663		22	46	1	0	1.22574e-08	0.002299	1.83475e-08	22	46				
DCPS	28960	broad.mit.edu	37	11	126215396	126215396	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:126215396T>C	ENST00000263579.4	+	6	1231	c.902T>C	c.(901-903)gTg>gCg	p.V301A	DCPS_ENST00000530860.1_3'UTR	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	301					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)	p.V301A(1)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		CTGGCTGAGGTGATCGAGAAC	0.652																																							uc001qdp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(901-903)GTG>GCG		mRNA decapping enzyme							133.0	115.0	121.0					11																	126215396		2201	4298	6499	SO:0001583	missense	28960				deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding	g.chr11:126215396T>C	AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.902T>C	11.37:g.126215396T>C	ENSP00000263579:p.Val301Ala		Somatic				uc001qdq.1_Intron	p.V301A	NM_014026	NP_054745	WXS	Illumina HiSeq	Unspecified	Q96C86	DCPS_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)	6	1231	+	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)	301					Q8NHL8|Q9Y2S5	Missense_Mutation	SNP	ENST00000263579.4	37	c.902T>C	CCDS8473.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.288458	0.80914	.	.	ENSG00000110063	ENST00000263579	T	0.60548	0.18	5.45	5.45	0.79879	Histidine triad-like motif (1);	0.000000	0.85682	D	0.000000	T	0.77405	0.4125	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81109	-0.1082	10	0.87932	D	0	-11.2055	15.5762	0.76387	0.0:0.0:0.0:1.0	.	301	Q96C86	DCPS_HUMAN	A	301	ENSP00000263579:V301A	ENSP00000263579:V301A	V	+	2	0	DCPS	125720606	1.000000	0.71417	0.984000	0.44739	0.473000	0.32948	7.691000	0.84191	2.080000	0.62538	0.529000	0.55759	GTG		0.652	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026		19	108	0	0	0	0.001216	0	19	108				
PRDM10	56980	broad.mit.edu	37	11	129784679	129784679	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:129784679G>T	ENST00000360871.3	-	17	2992	c.2761C>A	c.(2761-2763)Cag>Aag	p.Q921K	PRDM10_ENST00000423662.2_Missense_Mutation_p.Q839K|PRDM10_ENST00000526082.1_Missense_Mutation_p.Q839K|PRDM10_ENST00000304538.6_Missense_Mutation_p.Q835K|PRDM10_ENST00000528746.1_Missense_Mutation_p.Q895K|PRDM10_ENST00000358825.5_Missense_Mutation_p.Q925K	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	925	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.Q921K(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GGGATGTACTGAATTCTCTGG	0.562																																							uc001qfm.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2773-2775)CAG>AAG		PR domain containing 10 isoform 1							279.0	247.0	258.0					11																	129784679		2201	4297	6498	SO:0001583	missense	56980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:129784679G>T	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2761C>A	11.37:g.129784679G>T	ENSP00000354118:p.Gln921Lys		Somatic				PRDM10_uc001qfj.2_Missense_Mutation_p.Q839K|PRDM10_uc001qfk.2_Missense_Mutation_p.Q835K|PRDM10_uc001qfl.2_Missense_Mutation_p.Q839K|PRDM10_uc010sbx.1_Missense_Mutation_p.Q835K|PRDM10_uc001qfn.2_Missense_Mutation_p.Q921K|PRDM10_uc009zcs.1_Missense_Mutation_p.Q108K	p.Q925K	NM_020228	NP_064613	WXS	Illumina HiSeq	Unspecified	Q9NQV6	PRD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)	18	3005	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	925			Gln-rich.		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	c.2773C>A	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104517	0.77096	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.12879	2.73;2.79;2.73;2.64;2.71;2.71;2.83	5.44	5.44	0.79542	.	0.109676	0.64402	D	0.000005	T	0.28167	0.0695	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D	0.69078	0.969;0.997;0.982;0.969;0.982;0.982;0.982	D;D;D;D;D;D;D	0.73380	0.93;0.98;0.968;0.93;0.968;0.968;0.968	T	0.00780	-1.1569	10	0.51188	T	0.08	-30.7411	19.4586	0.94906	0.0:0.0:1.0:0.0	.	835;895;921;925;839;835;839	B7ZL72;E9PLV1;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	K	925;835;921;839;895;839;638	ENSP00000351686:Q925K;ENSP00000302669:Q835K;ENSP00000354118:Q921K;ENSP00000398431:Q839K;ENSP00000431262:Q895K;ENSP00000432237:Q839K;ENSP00000435940:Q638K	ENSP00000302669:Q835K	Q	-	1	0	PRDM10	129289889	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.997000	0.93544	2.828000	0.97474	0.655000	0.94253	CAG		0.562	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437		78	123	1	0	4.75426e-39	0.00361	9.67105e-39	78	123				
ACAD8	27034	broad.mit.edu	37	11	134131719	134131719	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:134131719G>T	ENST00000281182.4	+	9	1133	c.1027G>T	c.(1027-1029)Gag>Tag	p.E343*	ACAD8_ENST00000537423.1_Nonsense_Mutation_p.E266*|ACAD8_ENST00000374752.4_Nonsense_Mutation_p.E216*|ACAD8_ENST00000543332.1_3'UTR|ACAD8_ENST00000524547.1_3'UTR	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	343					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.E343*(1)|p.E343K(1)		endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	TCTGCAGGAGGAGAGGAAGGA	0.567																																					GBM(65;238 1125 33403 41853 48889)	GBM(65;238 1125 33403 41853 48889)	uc001qhk.2		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		urinary_tract(1)|lung(1)		0						c.(1027-1029)GAG>TAG		acyl-Coenzyme A dehydrogenase family, member 8							138.0	102.0	114.0					11																	134131719		2201	4297	6498	SO:0001587	stop_gained	27034				branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding	g.chr11:134131719G>T	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.1027G>T	11.37:g.134131719G>T	ENSP00000281182:p.Glu343*		Somatic				ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Nonsense_Mutation_p.E266*|ACAD8_uc001qhl.2_Nonsense_Mutation_p.E216*	p.E343*	NM_014384	NP_055199	WXS	Illumina HiSeq	Unspecified	Q9UKU7	ACAD8_HUMAN		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	9	1088	+	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)	343					B7Z5W4|Q6ZWP6|Q9BUS8	Nonsense_Mutation	SNP	ENST00000281182.4	37	c.1027G>T	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.612366	0.66672	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000374752	.	.	.	5.69	4.78	0.61160	.	0.534779	0.21110	N	0.080019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	16.5046	0.84266	0.0:0.1387:0.8613:0.0	.	.	.	.	X	343;266;216	.	ENSP00000281182:E343X	E	+	1	0	ACAD8	133636929	1.000000	0.71417	0.640000	0.29408	0.005000	0.04900	4.421000	0.59848	1.395000	0.46643	0.561000	0.74099	GAG		0.567	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384		16	31	1	0	2.62699e-14	0.003163	4.37219e-14	16	31				
WNK1	65125	broad.mit.edu	37	12	977030	977030	+	Intron	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:977030A>G	ENST00000315939.6	+	9	2782				WNK1_ENST00000535572.1_Intron|WNK1_ENST00000574564.1_Missense_Mutation_p.Q12R|WNK1_ENST00000340908.4_Intron|WNK1_ENST00000530271.2_Splice_Site|WNK1_ENST00000537687.1_Splice_Site	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATGTTGATACAGCCTCAGTCC	0.413																																					Colon(19;451 567 6672 12618 28860)		uc001qiq.2		NA																	1	Unknown(1)		lung(1)		0						c.(34-36)CAG>CGG		hereditary sensory neuropathy, type II							44.0	47.0	46.0					12																	977030		1936	4121	6057	SO:0001627	intron_variant	378465							g.chr12:977030A>G	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-3401A>G	12.37:g.977030A>G			Somatic				WNK1_uc001qio.3_Intron|WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	p.Q12R	NM_213655	NP_998820	WXS	Illumina HiSeq	Unspecified			OV - Ovarian serous cystadenocarcinoma(31;0.000967)|BRCA - Breast invasive adenocarcinoma(9;0.0178)		1	161	+	all_cancers(10;0.0107)|all_epithelial(11;0.0151)|Ovarian(42;0.0512)|all_lung(10;0.0521)|Lung NSC(10;0.0987)							A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	c.35A>G	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918706	0.52546	.	.	ENSG00000060237	ENST00000537687;ENST00000530271	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1293	0.81414	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WNK1	847291	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.754000	0.85163	2.212000	0.71576	0.460000	0.39030	.		0.413	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		14	30	0	0	0	0.00245	0	14	30				
SPSB2	84727	broad.mit.edu	37	12	6981812	6981812	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:6981812G>T	ENST00000524270.1	-	2	440	c.254C>A	c.(253-255)tCa>tAa	p.S85*	SPSB2_ENST00000519357.1_Nonsense_Mutation_p.S85*|RPL13P5_ENST00000412023.1_RNA|LRRC23_ENST00000433346.1_5'Flank|SPSB2_ENST00000523102.1_Nonsense_Mutation_p.S85*	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	85	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.S85*(1)		kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CAGGCCCCTTGAATAGCCCCT	0.662											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qrl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	kidney(1)	1						c.(253-255)TCA>TAA		splA/ryanodine receptor domain and SOCS box							35.0	42.0	39.0					12																	6981812		2203	4300	6503	SO:0001587	stop_gained	84727				intracellular signal transduction	cytoplasm	protein binding	g.chr12:6981812G>T	AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.254C>A	12.37:g.6981812G>T	ENSP00000428338:p.Ser85*		Somatic	OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	638	SPSB2_uc001qrm.2_Nonsense_Mutation_p.S85*|SPSB2_uc010sfp.1_Nonsense_Mutation_p.S85*|LRRC23_uc001qrn.1_5'Flank	p.S85*	NM_001146316	NP_001139788	WXS	Illumina HiSeq	Unspecified	Q99619	SPSB2_HUMAN			2	410	-			85			B30.2/SPRY.		B7Z4W1|D3DUT0	Nonsense_Mutation	SNP	ENST00000524270.1	37	c.254C>A	CCDS8567.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938742	0.73557	.	.	ENSG00000111671	ENST00000523102;ENST00000524270;ENST00000519357	.	.	.	3.84	3.84	0.44239	.	0.345102	0.22261	N	0.062415	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6347	0.62215	0.0:0.0:1.0:0.0	.	.	.	.	X	85	.	ENSP00000431037:S85X	S	-	2	0	SPSB2	6852073	1.000000	0.71417	0.991000	0.47740	0.569000	0.35902	5.419000	0.66435	2.122000	0.65172	0.563000	0.77884	TCA		0.662	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375721.1	NM_032641		23	31	1	0	1.10513e-12	0.002299	1.78926e-12	23	31				
A2M	2	broad.mit.edu	37	12	9231857	9231857	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:9231857C>A	ENST00000318602.7	-	25	3409	c.3102G>T	c.(3100-3102)agG>agT	p.R1034S	A2M_ENST00000542567.1_5'UTR	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1034					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.R1034S(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TGCCCTGGTTCCTGCCATATC	0.423																																							uc001qvk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(1)	5						c.(3100-3102)AGG>AGT		alpha-2-macroglobulin precursor	Bacitracin(DB00626)|Becaplermin(DB00102)						108.0	114.0	112.0					12																	9231857		2203	4300	6503	SO:0001583	missense	2				blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding	g.chr12:9231857C>A	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3102G>T	12.37:g.9231857C>A	ENSP00000323929:p.Arg1034Ser		Somatic				A2M_uc001qvj.1_Missense_Mutation_p.R76S|A2M_uc009zgk.1_Missense_Mutation_p.R884S	p.R1034S	NM_000014	NP_000005	WXS	Illumina HiSeq	Unspecified	P01023	A2MG_HUMAN			25	3215	-			1034					Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	c.3102G>T	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	C	7.508	0.653978	0.14580	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.28069	1.63	5.35	-2.86	0.05717	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	2.522110	0.00970	N	0.003233	T	0.21022	0.0506	L	0.43152	1.355	0.09310	N	1	B	0.25272	0.122	B	0.26310	0.068	T	0.06588	-1.0818	10	0.09338	T	0.73	.	1.9571	0.03378	0.184:0.3301:0.2923:0.1937	.	1034	P01023	A2MG_HUMAN	S	1034;1049	ENSP00000323929:R1034S	ENSP00000323929:R1034S	R	-	3	2	A2M	9123124	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	-3.244000	0.00542	-0.162000	0.10964	-1.057000	0.02308	AGG		0.423	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		20	61	1	0	5.26018e-13	0.001882	8.57481e-13	20	61				
SLCO1A2	6579	broad.mit.edu	37	12	21471751	21471751	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:21471751G>C	ENST00000307378.6	-	4	887	c.167C>G	c.(166-168)tCt>tGt	p.S56C	SLCO1A2_ENST00000537524.1_De_novo_Start_InFrame|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.S56C|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.S54C|SLCO1A2_ENST00000458504.1_Intron|SLCO1A2_ENST00000473830.1_5'UTR	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	56					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.S56C(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	TCCAACTAGAGATGTTGGGAT	0.338																																							uc001rer.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(166-168)TCT>TGT		organic anion transporting polypeptide A							106.0	105.0	106.0					12																	21471751		2202	4298	6500	SO:0001583	missense	6579				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21471751G>C		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.167C>G	12.37:g.21471751G>C	ENSP00000305974:p.Ser56Cys		Somatic				SLCO1A2_uc001res.2_Missense_Mutation_p.S56C|SLCO1A2_uc010siq.1_Translation_Start_Site|SLCO1A2_uc010sio.1_Translation_Start_Site|SLCO1A2_uc010sip.1_Intron|SLCO1A2_uc001ret.2_Missense_Mutation_p.S54C|SLCO1A2_uc001reu.2_Missense_Mutation_p.S36C	p.S56C	NM_021094	NP_066580	WXS	Illumina HiSeq	Unspecified	P46721	SO1A2_HUMAN			2	418	-			56			Extracellular (Potential).		Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	c.167C>G	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692447	0.68271	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000390670;ENST00000422327;ENST00000453443;ENST00000421294;ENST00000450590;ENST00000435179;ENST00000445053	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.68	4.77	0.60923	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.173661	0.52532	D	0.000061	T	0.73713	0.3622	H	0.94503	3.545	0.36319	D	0.858139	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.989;0.982;0.994	D	0.85786	0.1364	10	0.72032	D	0.01	.	15.5353	0.75998	0.0:0.0:0.8607:0.1393	.	36;54;56	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	C	56;56;54;56;56;56;56;56;54	ENSP00000305974:S56C;ENSP00000393973:S56C;ENSP00000375088:S54C;ENSP00000416190:S56C;ENSP00000409314:S56C;ENSP00000390572:S56C;ENSP00000407462:S56C;ENSP00000401195:S56C;ENSP00000409691:S54C	ENSP00000305974:S56C	S	-	2	0	SLCO1A2	21363018	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.666000	0.54540	1.355000	0.45865	0.655000	0.94253	TCT		0.338	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094		37	90	0	0	0	0.00623	0	37	90				
ABCC9	10060	broad.mit.edu	37	12	22068791	22068791	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:22068791C>G	ENST00000261201.4	-	5	626	c.627G>C	c.(625-627)caG>caC	p.Q209H	ABCC9_ENST00000345162.2_Missense_Mutation_p.Q209H|ABCC9_ENST00000261200.4_Missense_Mutation_p.Q209H	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	209					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.Q209H(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CTCCCAGATCCTGGAGGTCTT	0.363																																							uc001rfi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(625-627)CAG>CAC		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						63.0	62.0	62.0					12																	22068791		2203	4300	6503	SO:0001583	missense	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:22068791C>G	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.627G>C	12.37:g.22068791C>G	ENSP00000261201:p.Gln209His		Somatic				ABCC9_uc001rfh.2_Missense_Mutation_p.Q209H|ABCC9_uc001rfj.1_Missense_Mutation_p.Q209H	p.Q209H	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			5	647	-			209			Cytoplasmic (Potential).		O60707	Missense_Mutation	SNP	ENST00000261201.4	37	c.627G>C	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221708	0.58560	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162	D;D;D	0.92495	-3.03;-3.05;-3.03	5.01	3.03	0.35002	.	0.115834	0.64402	D	0.000012	D	0.94807	0.8323	M	0.81682	2.555	0.45284	D	0.998284	D;D	0.69078	0.997;0.994	D;P	0.65987	0.94;0.861	D	0.94446	0.7663	10	0.72032	D	0.01	-12.7836	9.6157	0.39690	0.0:0.7371:0.0:0.2629	.	209;209	O60706;O60706-2	ABCC9_HUMAN;.	H	209	ENSP00000261200:Q209H;ENSP00000261201:Q209H;ENSP00000261202:Q209H	ENSP00000261200:Q209H	Q	-	3	2	ABCC9	21960058	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.559000	0.36320	1.339000	0.45563	0.650000	0.86243	CAG		0.363	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		28	57	0	0	0	0.007291	0	28	57				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		15	16	1	0	8.60227e-14	0.004007	1.42176e-13	15	16				
ANO6	196527	broad.mit.edu	37	12	45781954	45781954	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:45781954T>A	ENST00000320560.8	+	11	1378	c.1176T>A	c.(1174-1176)ttT>ttA	p.F392L	ANO6_ENST00000423947.3_Missense_Mutation_p.F413L|ANO6_ENST00000441606.2_Missense_Mutation_p.F374L|ANO6_ENST00000435642.1_Missense_Mutation_p.F392L|ANO6_ENST00000425752.2_Missense_Mutation_p.F392L|ANO6_ENST00000426898.2_3'UTR	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	392					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)	p.F392L(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTACCTTGTTTTTGGAGTTTT	0.398																																							uc001roo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)	2						c.(1174-1176)TTT>TTA		anoctamin 6 isoform a							177.0	163.0	167.0					12																	45781954		2203	4300	6503	SO:0001583	missense	196527				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity	g.chr12:45781954T>A	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.1176T>A	12.37:g.45781954T>A	ENSP00000320087:p.Phe392Leu		Somatic				ANO6_uc010sld.1_Missense_Mutation_p.F392L|ANO6_uc010sle.1_Missense_Mutation_p.F392L|ANO6_uc010slf.1_Missense_Mutation_p.F413L|ANO6_uc010slg.1_Missense_Mutation_p.F374L	p.F392L	NM_001025356	NP_001020527	WXS	Illumina HiSeq	Unspecified	Q4KMQ2	ANO6_HUMAN			11	1511	+			392			Helical; (Potential).		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	c.1176T>A	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.202620	0.79127	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	4.59	2.16	0.27623	.	0.109197	0.64402	D	0.000005	T	0.80497	0.4634	M	0.78916	2.43	0.58432	D	0.999994	D;D;D;D	0.89917	0.999;0.998;0.995;1.0	D;D;D;D	0.79784	0.993;0.98;0.981;0.975	T	0.77778	-0.2460	10	0.56958	D	0.05	.	7.5245	0.27647	0.0:0.2643:0.0:0.7357	.	374;413;392;392	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	L	392;413;392;392;374	ENSP00000391417:F392L;ENSP00000409126:F413L;ENSP00000413840:F392L;ENSP00000320087:F392L;ENSP00000413137:F374L	ENSP00000320087:F392L	F	+	3	2	ANO6	44068221	0.830000	0.29337	0.920000	0.36463	0.954000	0.61252	0.833000	0.27504	0.324000	0.23333	0.528000	0.53228	TTT		0.398	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743		7	136	0	0	0	0.004482	0	7	136				
KRT6B	3854	broad.mit.edu	37	12	52843583	52843583	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:52843583G>C	ENST00000252252.3	-	4	918	c.871C>G	c.(871-873)Ctt>Gtt	p.L291V		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	291	Coil 1B.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.L291V(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCATCTGTAAGAGTGTCTGCC	0.498																																							uc001sak.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(871-873)CTT>GTT		keratin 6B							183.0	170.0	174.0					12																	52843583		2203	4300	6503	SO:0001583	missense	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52843583G>C	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.871C>G	12.37:g.52843583G>C	ENSP00000252252:p.Leu291Val		Somatic					p.L291V	NM_005555	NP_005546	WXS	Illumina HiSeq	Unspecified	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	4	919	-			291			Coil 1B.|Rod.		P48669	Missense_Mutation	SNP	ENST00000252252.3	37	c.871C>G	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234203	0.58886	.	.	ENSG00000185479	ENST00000252252	D	0.92699	-3.09	3.05	2.12	0.27331	Filament (1);	0.000000	0.46442	D	0.000299	D	0.95956	0.8683	H	0.95079	3.62	0.26646	N	0.972198	D	0.60575	0.988	P	0.61722	0.893	D	0.89899	0.4043	10	0.87932	D	0	.	7.4817	0.27408	0.0947:0.0:0.7419:0.1634	.	291	P04259	K2C6B_HUMAN	V	291	ENSP00000252252:L291V	ENSP00000252252:L291V	L	-	1	0	KRT6B	51129850	1.000000	0.71417	0.002000	0.10522	0.549000	0.35272	3.186000	0.50942	0.844000	0.35094	0.298000	0.19748	CTT		0.498	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		6	148	0	0	0	0.001984	0	6	148				
NPFF	8620	broad.mit.edu	37	12	53899014	53899014	+	IGR	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:53899014G>A	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Missense_Mutation_p.E237K|TARBP2_ENST00000394357.2_Missense_Mutation_p.E216K|TARBP2_ENST00000456234.2_Missense_Mutation_p.E216K|TARBP2_ENST00000552857.1_Intron	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)	p.E237K(1)		haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GGATGGCAATGAGGTGGAGCC	0.602																																							uc001sdo.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(709-711)GAG>AAG		TAR RNA binding protein 2 isoform a							102.0	93.0	96.0					12																	53899014		2203	4300	6503	SO:0001628	intergenic_variant	6895				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding	g.chr12:53899014G>A	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899014G>A			Somatic				TARBP2_uc001sdp.2_Missense_Mutation_p.E216K|TARBP2_uc001sdq.2_Missense_Mutation_p.E93K|TARBP2_uc001sdr.2_Missense_Mutation_p.E93K|TARBP2_uc001sds.2_Intron|TARBP2_uc001sdt.2_Missense_Mutation_p.E216K|TARBP2_uc001sdu.2_Missense_Mutation_p.E93K|TARBP2_uc001sdv.2_RNA	p.E237K	NM_134323	NP_599150	WXS	Illumina HiSeq	Unspecified	Q15633	TRBP2_HUMAN			7	1197	+			237			Sufficient for interaction with DICER1.		Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	c.709G>A	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545698	0.65198	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000394357	T;T;T	0.65549	-0.16;-0.14;-0.14	4.98	4.08	0.47627	.	0.050236	0.85682	D	0.000000	T	0.40222	0.1108	N	0.08118	0	0.80722	D	1	P	0.46987	0.888	B	0.41374	0.355	T	0.27262	-1.0079	10	0.15066	T	0.55	-9.5961	14.1384	0.65303	0.0:0.0:0.8486:0.1514	.	237	Q15633	TRBP2_HUMAN	K	237;216;216	ENSP00000266987:E237K;ENSP00000416077:E216K;ENSP00000377885:E216K	ENSP00000266987:E237K	E	+	1	0	TARBP2	52185281	1.000000	0.71417	0.821000	0.32701	0.896000	0.52359	8.932000	0.92897	1.458000	0.47871	0.561000	0.74099	GAG		0.602	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717		6	86	0	0	0	0.001984	0	6	86				
ARHGAP9	64333	broad.mit.edu	37	12	57867885	57867885	+	Silent	SNP	G	G	T	rs61758883	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:57867885G>T	ENST00000356411.2	-	16	2053	c.1915C>A	c.(1915-1917)Cgg>Agg	p.R639R	ARHGAP9_ENST00000393791.3_Silent_p.R620R|ARHGAP9_ENST00000430041.2_Silent_p.R436R|ARHGAP9_ENST00000424809.2_Silent_p.R620R|ARHGAP9_ENST00000393797.2_Silent_p.R710R|ARHGAP9_ENST00000550288.1_Silent_p.R699R|ARHGAP9_ENST00000550454.1_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	639	Lipid binding.|Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.R639R(1)		endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GGCAGCTCCCGGAGAAAAAGC	0.572																																							uc001sod.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(2128-2130)CGG>AGG		Rho GTPase activating protein 9 isoform 1							34.0	38.0	37.0					12																	57867885		2203	4300	6503	SO:0001819	synonymous_variant	64333				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr12:57867885G>T	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1915C>A	12.37:g.57867885G>T			Somatic				ARHGAP9_uc001sny.2_Intron|ARHGAP9_uc001snz.2_Silent_p.R436R|ARHGAP9_uc001soa.2_Silent_p.R309R|ARHGAP9_uc001sob.2_Silent_p.R620R|ARHGAP9_uc001soc.2_Silent_p.R620R|ARHGAP9_uc001soe.1_Silent_p.R699R	p.R710R	NM_032496	NP_115885	WXS	Illumina HiSeq	Unspecified	Q9BRR9	RHG09_HUMAN	GBM - Glioblastoma multiforme(3;3.37e-34)		19	2321	-			639			Rho-GAP.		B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Silent	SNP	ENST00000356411.2	37	c.2128C>A																																																																																					0.572	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496		5	42	1	0	1.23904e-05	0.000602	1.63375e-05	5	42				
KIF5A	3798	broad.mit.edu	37	12	57972080	57972080	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:57972080C>A	ENST00000455537.2	+	23	2767	c.2493C>A	c.(2491-2493)tcC>tcA	p.S831S	KIF5A_ENST00000286452.5_Silent_p.S742S	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	831					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.S831S(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						AGAAGATTTCCTTTCTTGAGA	0.483																																							uc001sor.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(2491-2493)TCC>TCA		kinesin family member 5A							84.0	83.0	83.0					12																	57972080		2203	4300	6503	SO:0001819	synonymous_variant	3798				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity	g.chr12:57972080C>A	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2493C>A	12.37:g.57972080C>A			Somatic				KIF5A_uc010srr.1_Silent_p.S742S	p.S831S	NM_004984	NP_004975	WXS	Illumina HiSeq	Unspecified	Q12840	KIF5A_HUMAN			23	2701	+			831					A6H8M5|Q4LE26	Silent	SNP	ENST00000455537.2	37	c.2493C>A	CCDS8945.1																																																																																				0.483	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984		49	105	1	0	2.74695e-27	0.00361	5.31524e-27	49	105				
KCNC2	3747	broad.mit.edu	37	12	75444758	75444758	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:75444758C>A	ENST00000549446.1	-	3	1707	c.1027G>T	c.(1027-1029)Gtg>Ttg	p.V343L	KCNC2_ENST00000341669.3_Missense_Mutation_p.V343L|KCNC2_ENST00000298972.1_Missense_Mutation_p.V343L|KCNC2_ENST00000393288.2_Missense_Mutation_p.V343L|KCNC2_ENST00000550433.1_Missense_Mutation_p.V343L|KCNC2_ENST00000548243.1_5'Flank|KCNC2_ENST00000350228.2_Missense_Mutation_p.V343L|KCNC2_ENST00000540018.1_Missense_Mutation_p.V343L|KCNC2_ENST00000548513.1_Missense_Mutation_p.V343L	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	343					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.V343L(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AAGCCAAGCACATCTTTAGCA	0.458																																							uc001sxg.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(1027-1029)GTG>TTG		Shaw-related voltage-gated potassium channel							78.0	70.0	72.0					12																	75444758		2203	4300	6503	SO:0001583	missense	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75444758C>A	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1027G>T	12.37:g.75444758C>A	ENSP00000449253:p.Val343Leu		Somatic				KCNC2_uc009zry.2_Missense_Mutation_p.V343L|KCNC2_uc001sxe.2_Missense_Mutation_p.V343L|KCNC2_uc001sxf.2_Missense_Mutation_p.V343L|KCNC2_uc010stw.1_Missense_Mutation_p.V343L	p.V343L	NM_139137	NP_631875	WXS	Illumina HiSeq	Unspecified	Q96PR1	KCNC2_HUMAN			3	1571	-			343					B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	c.1027G>T	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588343	0.86851	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.98135	-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74	6.06	6.06	0.98353	Ion transport (1);	0.000000	0.64402	D	0.000015	D	0.97848	0.9293	L	0.38733	1.17	0.80722	D	1	D;D;P;D;B	0.60160	0.987;0.987;0.62;0.987;0.198	D;D;B;D;B	0.64687	0.928;0.928;0.326;0.928;0.113	D	0.98366	1.0551	10	0.62326	D	0.03	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	343;343;343;343;343	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	L	343	ENSP00000448301:V343L;ENSP00000449941:V343L;ENSP00000449253:V343L;ENSP00000340121:V343L;ENSP00000298972:V343L;ENSP00000319877:V343L;ENSP00000438423:V343L;ENSP00000376966:V343L	ENSP00000298972:V343L	V	-	1	0	KCNC2	73731025	1.000000	0.71417	0.962000	0.40283	0.982000	0.71751	7.792000	0.85828	2.880000	0.98712	0.650000	0.86243	GTG		0.458	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		16	53	1	0	1.01871e-10	0.001216	1.59509e-10	16	53				
TBX5	6910	broad.mit.edu	37	12	114793673	114793673	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:114793673G>T	ENST00000310346.4	-	9	1887	c.1221C>A	c.(1219-1221)taC>taA	p.Y407*	TBX5_ENST00000349716.5_Nonsense_Mutation_p.Y357*|TBX5_ENST00000405440.2_Nonsense_Mutation_p.Y407*	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	407					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y407*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TGCAGCTGCTGTAGGAAGGCA	0.647																																					NSCLC(152;1358 1980 4050 23898 40356)	NSCLC(152;1358 1980 4050 23898 40356)	uc001tvo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|pancreas(1)|skin(1)	8						c.(1219-1221)TAC>TAA		T-box 5 isoform 1							55.0	46.0	49.0					12																	114793673		2203	4300	6503	SO:0001587	stop_gained	6910				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr12:114793673G>T	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1221C>A	12.37:g.114793673G>T	ENSP00000309913:p.Tyr407*		Somatic				TBX5_uc001tvp.2_Nonsense_Mutation_p.Y407*|TBX5_uc001tvq.2_Nonsense_Mutation_p.Y357*	p.Y407*	NM_181486	NP_852259	WXS	Illumina HiSeq	Unspecified	Q99593	TBX5_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0893)	9	1716	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		407					A6ND77|O15301|Q96TB0|Q9Y4I2	Nonsense_Mutation	SNP	ENST00000310346.4	37	c.1221C>A	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	G	40	8.419035	0.98803	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	.	.	.	5.27	2.39	0.29439	.	0.124300	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0947	0.42469	0.2224:0.0:0.7776:0.0	.	.	.	.	X	357;407;304;407	.	ENSP00000309913:Y407X	Y	-	3	2	TBX5	113278056	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.008000	0.29872	0.206000	0.20587	0.655000	0.94253	TAC		0.647	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717		18	52	1	0	3.32936e-07	0.006122	4.67485e-07	18	52				
ORAI1	84876	broad.mit.edu	37	12	122079355	122079355	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:122079355G>A	ENST00000330079.7	+	2	911	c.718G>A	c.(718-720)Gcc>Acc	p.A240T		NM_032790.3	NP_116179	Q96D31	CRCM1_HUMAN	ORAI calcium release-activated calcium modulator 1	238					blood coagulation (GO:0007596)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|regulation of calcium ion transport (GO:0051924)|store-operated calcium entry (GO:0002115)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|store-operated calcium channel activity (GO:0015279)	p.A240T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		AGCTGCCATCGCCTCGACCAC	0.642																																							uc010szz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(712-714)GCC>ACC		calcium release-activated calcium channel							57.0	73.0	67.0					12																	122079355		2195	4286	6481	SO:0001583	missense	84876				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr12:122079355G>A	AK027372		12q24.31	2014-09-17	2007-08-14	2007-08-14	ENSG00000182500	ENSG00000276045		"""ORAI calcium release-activated calcium modulators"""	25896	protein-coding gene	gene with protein product	"""calcium release-activated calcium modulator 1"""	610277	"""transmembrane protein 142A"""	TMEM142A		16582901	Standard	NM_032790		Approved	FLJ14466, CRACM1	uc021rff.1	Q96D31		ENST00000330079.7:c.718G>A	12.37:g.122079355G>A	ENSP00000328216:p.Ala240Thr		Somatic					p.A238T	NM_032790	NP_116179	WXS	Illumina HiSeq	Unspecified	Q96D31	CRCM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)	3	905	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		238			Helical; (Potential).		Q3MHV3|Q6DHX2|Q96BP7|Q96K71	Missense_Mutation	SNP	ENST00000330079.7	37	c.712G>A	CCDS41851.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503506	0.26949	.	.	ENSG00000182500	ENST00000330079;ENST00000537188	T;T	0.43294	0.95;0.95	5.22	5.22	0.72569	.	0.161042	0.56097	D	0.000032	T	0.41096	0.1144	M	0.72894	2.215	0.58432	D	0.999999	B	0.31519	0.327	B	0.26693	0.072	T	0.28267	-1.0049	10	0.31617	T	0.26	-25.0021	13.4519	0.61176	0.0758:0.0:0.9242:0.0	.	238	Q96D31	CRCM1_HUMAN	T	240;135	ENSP00000328216:A240T;ENSP00000441198:A135T	ENSP00000328216:A240T	A	+	1	0	ORAI1	120563738	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	4.180000	0.58296	2.609000	0.88269	0.591000	0.81541	GCC		0.642	ORAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402151.1	NM_032790		9	62	0	0	0	0.004482	0	9	62				
IL31	386653	broad.mit.edu	37	12	122657105	122657105	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:122657105G>A	ENST00000377035.1	-	3	375	c.349C>T	c.(349-351)Caa>Taa	p.Q117*		NM_001014336.1	NP_001014358.1	Q6EBC2	IL31_HUMAN	interleukin 31	117					immune system process (GO:0002376)	extracellular space (GO:0005615)		p.Q117*(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GGTGCATCTTGAAATATGAGT	0.433																																							uc001ubv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(349-351)CAA>TAA		interleukin 31 precursor							228.0	195.0	206.0					12																	122657105		2203	4300	6503	SO:0001587	stop_gained	386653					extracellular space	cytokine activity	g.chr12:122657105G>A	AY499343	CCDS31919.1	12q24.31	2011-07-21			ENSG00000204671	ENSG00000204671		"""Interleukins and interleukin receptors"""	19372	protein-coding gene	gene with protein product		609509				15184896	Standard	NM_001014336		Approved	IL-31	uc001ubv.3	Q6EBC2	OTTHUMG00000168916	ENST00000377035.1:c.349C>T	12.37:g.122657105G>A	ENSP00000366234:p.Gln117*		Somatic				LRRC43_uc001ubw.3_Intron|LRRC43_uc009zxl.1_Intron	p.Q117*	NM_001014336	NP_001014358	WXS	Illumina HiSeq	Unspecified	Q6EBC2	IL31_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)	3	376	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)	117					A2RUQ1	Nonsense_Mutation	SNP	ENST00000377035.1	37	c.349C>T	CCDS31919.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214422	0.58452	.	.	ENSG00000204671	ENST00000377035	.	.	.	4.18	3.29	0.37713	.	1.649010	0.03561	N	0.227023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-0.4455	8.1613	0.31201	0.1077:0.0:0.8923:0.0	.	.	.	.	X	117	.	ENSP00000366234:Q117X	Q	-	1	0	IL31	121223058	0.000000	0.05858	0.002000	0.10522	0.467000	0.32768	0.445000	0.21677	1.351000	0.45789	0.563000	0.77884	CAA		0.433	IL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401594.1	NM_001014336		18	116	0	0	0	0.007413	0	18	116				
ABCB9	23457	broad.mit.edu	37	12	123419912	123419912	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:123419912G>A	ENST00000542678.1	-	10	4648	c.1810C>T	c.(1810-1812)Ctg>Ttg	p.L604L	ABCB9_ENST00000442833.2_Silent_p.L604L|ABCB9_ENST00000346530.5_Silent_p.L561L|ABCB9_ENST00000344275.7_Silent_p.L604L|ABCB9_ENST00000392439.3_Silent_p.L604L|ABCB9_ENST00000442028.2_Silent_p.L604L|ABCB9_ENST00000540285.1_Silent_p.L541L|ABCB9_ENST00000280560.8_Silent_p.L604L			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	604	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)	p.L604L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		ACAGTGGGCAGGCCGTAGGAG	0.617																																					Ovarian(49;786 1333 9175 38236)	Ovarian(49;786 1333 9175 38236)	uc001udm.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1810-1812)CTG>TTG		ATP-binding cassette, sub-family B (MDR/TAP),							87.0	68.0	74.0					12																	123419912		2203	4300	6503	SO:0001819	synonymous_variant	23457				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr12:123419912G>A	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.1810C>T	12.37:g.123419912G>A			Somatic				ABCB9_uc010tai.1_Silent_p.L211L|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Silent_p.L561L|ABCB9_uc010taj.1_Silent_p.L541L|ABCB9_uc001udp.2_Silent_p.L604L|ABCB9_uc001udq.2_Silent_p.L323L	p.L604L	NM_019625	NP_062571	WXS	Illumina HiSeq	Unspecified	Q9NP78	ABCB9_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)	10	2120	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		604			ABC transporter.		B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Silent	SNP	ENST00000542678.1	37	c.1810C>T	CCDS9241.1																																																																																				0.617	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624		4	63	0	0	0	0.000602	0	4	63				
CHFR	55743	broad.mit.edu	37	12	133438086	133438086	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:133438086C>A	ENST00000432561.2	-	7	827	c.754G>T	c.(754-756)Gat>Tat	p.D252Y	CHFR_ENST00000443047.2_Missense_Mutation_p.D160Y|CHFR_ENST00000315585.7_Missense_Mutation_p.D211Y|CHFR_ENST00000450056.2_Missense_Mutation_p.D240Y|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000266880.7_Missense_Mutation_p.D252Y			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	252					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D211Y(1)|p.D252Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GGCTCCAAATCCTCCTGATCC	0.567																																							uc001ulf.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(754-756)GAT>TAT		checkpoint with forkhead and ring finger domains							214.0	182.0	193.0					12																	133438086		2203	4300	6503	SO:0001583	missense	55743				cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr12:133438086C>A	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.754G>T	12.37:g.133438086C>A	ENSP00000392395:p.Asp252Tyr		Somatic				CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Missense_Mutation_p.D240Y|CHFR_uc010tbs.1_Missense_Mutation_p.D252Y|CHFR_uc001uld.2_Missense_Mutation_p.D211Y|CHFR_uc010tbt.1_Missense_Mutation_p.D160Y	p.D252Y	NM_001161344	NP_001154816	WXS	Illumina HiSeq	Unspecified	Q96EP1	CHFR_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)	7	838	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)	252					A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	c.754G>T	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.239178	0.39598	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000541228;ENST00000432561;ENST00000541817	T;T;T;T;T	0.19105	2.4;2.17;2.43;2.18;2.43	5.56	4.67	0.58626	.	0.394295	0.29791	N	0.011189	T	0.35480	0.0933	L	0.53249	1.67	0.09310	N	1	D;D;D;D;D	0.63046	0.971;0.992;0.986;0.992;0.986	P;D;P;P;D	0.65987	0.739;0.91;0.815;0.889;0.94	T	0.13764	-1.0497	10	0.66056	D	0.02	-7.2293	7.3334	0.26596	0.1362:0.7209:0.0:0.1429	.	160;252;252;240;211	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	Y	211;160;240;252;52;252;112	ENSP00000320557:D211Y;ENSP00000416431:D160Y;ENSP00000398735:D240Y;ENSP00000266880:D252Y;ENSP00000392395:D252Y	ENSP00000266880:D252Y	D	-	1	0	CHFR	131948159	0.009000	0.17119	0.095000	0.20976	0.556000	0.35491	2.108000	0.41854	1.359000	0.45940	-0.136000	0.14681	GAT		0.567	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2			41	105	1	0	9.39024e-22	0.002222	1.71914e-21	41	105				
TUBA3C	7278	broad.mit.edu	37	13	19751729	19751729	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:19751729G>T	ENST00000400113.3	-	4	498	c.394C>A	c.(394-396)Ctg>Atg	p.L132M		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	132					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.L132M(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		AAGCCCTGCAGTCCCGTGCAC	0.582																																							uc009zzj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(394-396)CTG>ATG		tubulin, alpha 3c							54.0	52.0	52.0					13																	19751729		2203	4300	6503	SO:0001583	missense	7278				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr13:19751729G>T	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.394C>A	13.37:g.19751729G>T	ENSP00000382982:p.Leu132Met		Somatic					p.L132M	NM_006001	NP_005992	WXS	Illumina HiSeq	Unspecified	Q13748	TBA3C_HUMAN		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	4	443	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	132					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	c.394C>A	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	g	9.349	1.064965	0.20067	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.73575	-0.76	1.19	1.19	0.21007	.	0.000000	0.37857	U	0.001911	T	0.76983	0.4064	.	.	.	0.39535	D	0.968726	.	.	.	.	.	.	T	0.78342	-0.2241	7	0.87932	D	0	.	8.3041	0.32032	0.0:0.0:1.0:0.0	.	.	.	.	M	132	ENSP00000382982:L132M	ENSP00000354037:L132M	L	-	1	2	TUBA3C	18649729	1.000000	0.71417	0.958000	0.39756	0.417000	0.31264	6.077000	0.71275	0.966000	0.38159	0.162000	0.16502	CTG		0.582	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		15	52	1	0	1.49906e-05	0.00245	1.96571e-05	15	52				
SHISA2	387914	broad.mit.edu	37	13	26620766	26620766	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:26620766G>A	ENST00000319420.3	-	2	828	c.773C>T	c.(772-774)cCc>cTc	p.P258L		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	258					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P258L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						AGCTGTCATGGGCACAGAGTC	0.572																																							uc001uqm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(772-774)CCC>CTC		shisa homolog 2 precursor							128.0	104.0	112.0					13																	26620766		2203	4300	6503	SO:0001583	missense	387914				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane		g.chr13:26620766G>A		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.773C>T	13.37:g.26620766G>A	ENSP00000313079:p.Pro258Leu		Somatic					p.P258L	NM_001007538	NP_001007539	WXS	Illumina HiSeq	Unspecified	Q6UWI4	SHSA2_HUMAN			2	858	-			258			Cytoplasmic (Potential).		B9EH70|Q5W0G8	Missense_Mutation	SNP	ENST00000319420.3	37	c.773C>T	CCDS31951.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924847	0.73213	.	.	ENSG00000180730	ENST00000319420	T	0.45668	0.89	5.73	4.88	0.63580	.	0.137317	0.49305	D	0.000158	T	0.30262	0.0759	L	0.27053	0.805	0.80722	D	1	B	0.32245	0.361	B	0.30646	0.118	T	0.04915	-1.0918	10	0.15066	T	0.55	-31.1801	16.0734	0.80951	0.0:0.0:0.8649:0.1351	.	258	Q6UWI4	SHSA2_HUMAN	L	258	ENSP00000313079:P258L	ENSP00000313079:P258L	P	-	2	0	SHISA2	25518766	1.000000	0.71417	0.989000	0.46669	0.651000	0.38670	7.510000	0.81708	1.405000	0.46838	0.650000	0.86243	CCC		0.572	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538		20	52	0	0	0	0.001216	0	20	52				
TRPC4	7223	broad.mit.edu	37	13	38320115	38320115	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:38320115G>T	ENST00000379705.3	-	3	1713	c.856C>A	c.(856-858)Ctt>Att	p.L286I	TRPC4_ENST00000447043.1_Missense_Mutation_p.L286I|TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000379673.2_Missense_Mutation_p.L286I|TRPC4_ENST00000358477.2_Missense_Mutation_p.L286I|TRPC4_ENST00000379679.1_Intron|TRPC4_ENST00000426868.2_Missense_Mutation_p.L286I|TRPC4_ENST00000355779.2_Missense_Mutation_p.L286I|TRPC4_ENST00000379681.3_Missense_Mutation_p.L286I			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	286	Multimerization domain. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L286I(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AGTCTTGCAAGATCATTTCCA	0.388																																							uc001uws.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(856-858)CTT>ATT		transient receptor potential cation channel,							236.0	224.0	228.0					13																	38320115		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38320115G>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.856C>A	13.37:g.38320115G>T	ENSP00000369027:p.Leu286Ile		Somatic				TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.L286I|TRPC4_uc010tey.1_Missense_Mutation_p.L286I|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Missense_Mutation_p.L286I|TRPC4_uc010aby.2_Missense_Mutation_p.L286I	p.L286I	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	3	1091	-			286			Cytoplasmic (Potential).|Multimerization domain (By similarity).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.856C>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159192	0.78226	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.88829	0.6543	M	0.91406	3.205	0.54753	D	0.999987	D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.986;0.999;0.998	D	0.90402	0.4403	10	0.87932	D	0	-22.5936	14.7663	0.69642	0.0684:0.0:0.9316:0.0	.	286;286;286;286;286	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	I	286	ENSP00000369027:L286I;ENSP00000369003:L286I;ENSP00000410133:L286I;ENSP00000348025:L286I;ENSP00000351264:L286I;ENSP00000368995:L286I;ENSP00000414316:L286I	ENSP00000348025:L286I	L	-	1	0	TRPC4	37218115	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.746000	0.74866	2.885000	0.99019	0.655000	0.94253	CTT		0.388	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		10	203	1	0	0.000673444	0.000673	0.000848041	10	203				
RB1	5925	broad.mit.edu	37	13	48947605	48947606	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:48947605_48947606GA>TT	ENST00000267163.4	+	12	1330_1331	c.1192_1193GA>TT	c.(1192-1194)GAa>TTa	p.E398L		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	398	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.E398L(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCAACCTTCAGAAAATCTGATT	0.287		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		25	Whole gene deletion(15)|Unknown(8)|Substitution - Missense(2)	p.?(7)	bone(11)|breast(5)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358						c.(1192-1194)GAA>TTA		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)																																			SO:0001583	missense	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:48947605_48947606GA>TT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	Exception_encountered	13.37:g.48947605_48947606delinsTT	ENSP00000267163:p.Glu398Leu	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)	Somatic				RB1_uc010act.1_Missense_Mutation_p.E99L	p.E398L	NM_000321	NP_000312	WXS	Illumina HiSeq	Unspecified	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	12	1358_1359	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	398			Domain A.|Pocket; binds T and E1A.		A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	DNP	ENST00000267163.4	37	c.1192_1193GA>TT	CCDS31973.1																																																																																				0.287	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			5	197	0	0	0	0.004672	0	5	197				
KLHL1	57626	broad.mit.edu	37	13	70456453	70456453	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:70456453G>A	ENST00000377844.4	-	5	1948	c.1189C>T	c.(1189-1191)Ctt>Ttt	p.L397F	KLHL1_ENST00000545028.1_Missense_Mutation_p.L204F	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	397					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.L397F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AAGGCAAGAAGCATGCTCAGG	0.398																																							uc001vip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1189-1191)CTT>TTT		kelch-like 1 protein							172.0	141.0	152.0					13																	70456453		2203	4300	6503	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70456453G>A	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1189C>T	13.37:g.70456453G>A	ENSP00000367075:p.Leu397Phe		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.L336F	p.L397F	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	5	1983	-		Breast(118;0.000162)	397					A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.1189C>T	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315452	0.60524	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.74209	-0.82;-0.82	4.89	4.03	0.46877	BTB/Kelch-associated (2);	0.000000	0.52532	D	0.000068	D	0.89283	0.6671	H	0.97758	4.07	0.41039	D	0.985214	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90473	0.4454	10	0.87932	D	0	.	7.9382	0.29941	0.237:0.0:0.763:0.0	.	397;397	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	F	397;204	ENSP00000367075:L397F;ENSP00000439602:L204F	ENSP00000367075:L397F	L	-	1	0	KLHL1	69354454	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.188000	0.58351	2.406000	0.81754	0.591000	0.81541	CTT		0.398	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		5	94	0	0	0	0.001168	0	5	94				
UGGT2	55757	broad.mit.edu	37	13	96601613	96601613	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:96601613G>A	ENST00000376747.3	-	13	1501	c.1431C>T	c.(1429-1431)tcC>tcT	p.S477S		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	477					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.S477S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TGCGCCTTATGGAAGGTACAC	0.318																																							uc001vmt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1429-1431)TCC>TCT		UDP-glucose ceramide glucosyltransferase-like 2							42.0	45.0	44.0					13																	96601613		2203	4300	6503	SO:0001819	synonymous_variant	55757				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity	g.chr13:96601613G>A	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1431C>T	13.37:g.96601613G>A			Somatic					p.S477S	NM_020121	NP_064506	WXS	Illumina HiSeq	Unspecified	Q9NYU1	UGGG2_HUMAN			13	1601	-			477					A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	ENST00000376747.3	37	c.1431C>T	CCDS9480.1																																																																																				0.318	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121		21	35	0	0	0	0.001216	0	21	35				
MYO16	23026	broad.mit.edu	37	13	109699269	109699269	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:109699269G>A	ENST00000357550.2	+	23	2777	c.2736G>A	c.(2734-2736)atG>atA	p.M912I	MYO16_ENST00000251041.5_Missense_Mutation_p.M912I|MYO16_ENST00000457511.2_Missense_Mutation_p.M424I|MYO16_ENST00000356711.2_Missense_Mutation_p.M912I	NM_001198950.1	NP_001185879.1			myosin XVI									p.M912I(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCTAGGTAATGTATGATGTTG	0.318																																							uc001vqt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(2734-2736)ATG>ATA		myosin heavy chain Myr 8							140.0	141.0	141.0					13																	109699269		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109699269G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2736G>A	13.37:g.109699269G>A	ENSP00000350160:p.Met912Ile		Somatic				MYO16_uc010agk.1_Missense_Mutation_p.M934I|MYO16_uc001vqu.1_Missense_Mutation_p.M712I|MYO16_uc010tjh.1_Missense_Mutation_p.M424I	p.M912I	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		24	2862	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		912			Myosin head-like 2.			Missense_Mutation	SNP	ENST00000357550.2	37	c.2736G>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	7.619	0.676428	0.14841	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.62	2.42	0.29668	Myosin head, motor domain (2);	0.577071	0.13930	U	0.352987	T	0.70202	0.3197	N	0.12527	0.23	0.29616	N	0.846548	B;B;B	0.33000	0.225;0.054;0.393	B;B;B	0.31101	0.076;0.03;0.124	T	0.62286	-0.6886	9	.	.	.	.	3.7752	0.08657	0.0831:0.1155:0.3204:0.481	.	424;912;912	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	I	912;912;912;912;700;424	ENSP00000349145:M912I;ENSP00000350160:M912I;ENSP00000251041:M912I;ENSP00000401633:M424I	.	M	+	3	0	MYO16	108497270	1.000000	0.71417	0.985000	0.45067	0.934000	0.57294	2.615000	0.46368	0.803000	0.34113	0.650000	0.86243	ATG		0.318	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		13	113	0	0	0	0.00245	0	13	113				
COL4A1	1282	broad.mit.edu	37	13	110813626	110813626	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:110813626T>A	ENST00000375820.4	-	49	4674	c.4553A>T	c.(4552-4554)gAc>gTc	p.D1518V	COL4A1_ENST00000467182.1_5'UTR	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1518	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.D1518V(1)|p.D1161V(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GTACGAGTAGTCATTTCGTGA	0.517																																							uc001vqw.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(4552-4554)GAC>GTC		alpha 1 type IV collagen preproprotein							137.0	113.0	121.0					13																	110813626		2203	4300	6503	SO:0001583	missense	1282				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	g.chr13:110813626T>A	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4553A>T	13.37:g.110813626T>A	ENSP00000364979:p.Asp1518Val		Somatic				COL4A1_uc010agl.2_Intron	p.D1518V	NM_001845	NP_001836	WXS	Illumina HiSeq	Unspecified	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		49	4675	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	1518			Collagen IV NC1.		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	c.4553A>T	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111510	0.37242	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.94687	-3.49	4.56	4.56	0.56223	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98609	1.0662	10	0.87932	D	0	.	14.2173	0.65802	0.0:0.0:0.0:1.0	.	1518	P02462	CO4A1_HUMAN	V	1161;1518;1167	ENSP00000364979:D1518V	ENSP00000364973:D1161V	D	-	2	0	COL4A1	109611627	1.000000	0.71417	0.890000	0.34922	0.076000	0.17211	7.725000	0.84808	1.807000	0.52817	0.379000	0.24179	GAC		0.517	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			7	57	0	0	0	0.00308	0	7	57				
OR11H12	440153	broad.mit.edu	37	14	19378063	19378063	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:19378063C>A	ENST00000550708.1	+	1	542	c.470C>A	c.(469-471)gCc>gAc	p.A157D		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A157D(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATCTCTGTGCCAAACTGGTC	0.468																																							uc010tkp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(469-471)GCC>GAC		olfactory receptor, family 11, subfamily H,							168.0	179.0	175.0					14																	19378063		2201	4294	6495	SO:0001583	missense	440153				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:19378063C>A		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.470C>A	14.37:g.19378063C>A	ENSP00000449002:p.Ala157Asp		Somatic					p.A157D	NM_001013354	NP_001013372	WXS	Illumina HiSeq	Unspecified	B2RN74	O11HC_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	470	+	all_cancers(95;0.00108)		157			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000550708.1	37	c.470C>A	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	c	5.969	0.362739	0.11296	.	.	ENSG00000257115	ENST00000550708	T	0.38722	1.12	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	1.418070	0.05301	N	0.523033	T	0.43743	0.1261	L	0.61218	1.895	0.25913	N	0.98321	B	0.33345	0.409	B	0.41646	0.362	T	0.44787	-0.9305	9	0.37606	T	0.19	.	3.0137	0.06052	0.0:0.6523:0.0:0.3477	.	157	B2RN74	O11HC_HUMAN	D	157	ENSP00000449002:A157D	ENSP00000449002:A157D	A	+	2	0	CR383656.1	18448063	0.000000	0.05858	0.869000	0.34112	0.213000	0.24496	-2.442000	0.01014	0.619000	0.30197	0.064000	0.15345	GCC		0.468	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354		38	670	1	0	2.12129e-23	0.00361	4.00687e-23	38	670				
RNASE13	440163	broad.mit.edu	37	14	21502073	21502073	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:21502073G>T	ENST00000382951.3	-	2	512	c.375C>A	c.(373-375)taC>taA	p.Y125*	NDRG2_ENST00000403829.3_Intron	NM_001012264.3	NP_001012264.1	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 (non-active)	125						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.Y125*(1)		cervix(1)|endometrium(1)|lung(5)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	12	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		GGGTGCTATTGTAGTAGCAGC	0.498																																							uc001vzj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(373-375)TAC>TAA		ribonuclease, RNase A family, 13 precursor							250.0	196.0	214.0					14																	21502073		2203	4300	6503	SO:0001587	stop_gained	440163					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21502073G>T	AY665808	CCDS32039.1	14q11.1	2011-02-10			ENSG00000206150	ENSG00000206150		"""Ribonucleases, RNase A"""	25285	protein-coding gene	gene with protein product							Standard	NM_001012264		Approved		uc001vzj.3	Q5GAN3		ENST00000382951.3:c.375C>A	14.37:g.21502073G>T	ENSP00000372410:p.Tyr125*		Somatic				NDRG2_uc010tll.1_Intron	p.Y125*	NM_001012264	NP_001012264	WXS	Illumina HiSeq	Unspecified	Q5GAN3	RNS13_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)	2	513	-	all_cancers(95;0.000759)		125						Nonsense_Mutation	SNP	ENST00000382951.3	37	c.375C>A	CCDS32039.1	.	.	.	.	.	.	.	.	.	.	g	14.54	2.565165	0.45694	.	.	ENSG00000206150	ENST00000382951	.	.	.	5.28	0.267	0.15622	.	0.000000	0.49916	D	0.000128	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.585	8.4107	0.32642	0.4027:0.0:0.5973:0.0	.	.	.	.	X	125	.	ENSP00000372410:Y125X	Y	-	3	2	RNASE13	20571913	0.699000	0.27786	0.001000	0.08648	0.001000	0.01503	0.644000	0.24766	-0.230000	0.09840	-0.720000	0.03607	TAC		0.498	RNASE13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411744.1			21	171	1	0	1.55795e-14	0.001882	2.62043e-14	21	171				
RPGRIP1	57096	broad.mit.edu	37	14	21795901	21795901	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:21795901G>T	ENST00000400017.2	+	17	2830	c.2830G>T	c.(2830-2832)Ggg>Tgg	p.G944W	RPGRIP1_ENST00000557771.1_Missense_Mutation_p.G906W|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.G944W|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.G601W|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.G303W|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.G270W	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	944					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.G560W(1)|p.G944W(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		TCAGACTAAGGGGAAGGATAC	0.483																																							uc001wag.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(2)|pancreas(1)	7						c.(2830-2832)GGG>TGG		retinitis pigmentosa GTPase regulator							70.0	66.0	67.0					14																	21795901		1855	4106	5961	SO:0001583	missense	57096				response to stimulus|visual perception	cilium		g.chr14:21795901G>T	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2830G>T	14.37:g.21795901G>T	ENSP00000382895:p.Gly944Trp		Somatic				RPGRIP1_uc001wah.2_Missense_Mutation_p.G586W|RPGRIP1_uc001wai.2_Missense_Mutation_p.G270W|RPGRIP1_uc001wak.2_Missense_Mutation_p.G419W|RPGRIP1_uc010aim.2_Missense_Mutation_p.G327W|RPGRIP1_uc001wal.2_Missense_Mutation_p.G303W|RPGRIP1_uc001wam.2_Missense_Mutation_p.G261W	p.G944W	NM_020366	NP_065099	WXS	Illumina HiSeq	Unspecified	Q96KN7	RPGR1_HUMAN	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)	17	2830	+	all_cancers(95;0.0017)	all_cancers(140;0.0973)	944					Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	c.2830G>T	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072400	0.36566	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.78481	-0.09;-0.88;-0.91;-0.91;-0.43;-1.18;-1.16	4.02	2.16	0.27623	.	0.638263	0.15475	N	0.260421	T	0.73946	0.3652	N	0.22421	0.69	0.09310	N	0.999999	D;D;D;D;D;D	0.63046	0.984;0.992;0.984;0.992;0.984;0.985	P;P;P;P;P;P	0.58970	0.792;0.849;0.792;0.849;0.792;0.624	T	0.62334	-0.6876	10	0.37606	T	0.19	-2.7446	8.5167	0.33250	0.1931:0.0:0.8069:0.0	.	327;303;419;270;560;944	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	W	601;906;944;944;270;419;303	ENSP00000450445:G601W;ENSP00000451219:G906W;ENSP00000382895:G944W;ENSP00000206660:G944W;ENSP00000372391:G270W;ENSP00000451262:G419W;ENSP00000309721:G303W	ENSP00000206660:G944W	G	+	1	0	RPGRIP1	20865741	0.002000	0.14202	0.009000	0.14445	0.003000	0.03518	0.474000	0.22148	0.650000	0.30769	0.650000	0.86243	GGG		0.483	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		18	43	1	0	1.02788e-11	0.00499	1.65295e-11	18	43				
AKAP6	9472	broad.mit.edu	37	14	33292102	33292102	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:33292102G>A	ENST00000280979.4	+	13	5253	c.5083G>A	c.(5083-5085)Gac>Aac	p.D1695N	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1695	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.D1695N(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TAGCAGCAGTGACGAGCTCTC	0.463																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(5083-5085)GAC>AAC		A-kinase anchor protein 6							98.0	92.0	94.0					14																	33292102		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33292102G>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5083G>A	14.37:g.33292102G>A	ENSP00000280979:p.Asp1695Asn		Somatic					p.D1695N	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	5253	+	Breast(36;0.0388)|Prostate(35;0.15)		1695			Ser-rich.		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.5083G>A	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429171	0.83776	.	.	ENSG00000151320	ENST00000280979	T	0.07688	3.17	5.98	5.98	0.97165	.	0.104295	0.64402	D	0.000004	T	0.26085	0.0636	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	P	0.57425	0.82	T	0.00049	-1.2199	10	0.87932	D	0	-21.1608	20.4561	0.99145	0.0:0.0:1.0:0.0	.	1695	Q13023	AKAP6_HUMAN	N	1695	ENSP00000280979:D1695N	ENSP00000280979:D1695N	D	+	1	0	AKAP6	32361853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.922000	0.92789	2.843000	0.97960	0.650000	0.86243	GAC		0.463	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		7	132	0	0	0	0.00308	0	7	132				
PPP2R3C	55012	broad.mit.edu	37	14	35554835	35554835	+	Silent	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:35554835T>G	ENST00000261475.5	-	13	1676	c.1323A>C	c.(1321-1323)gcA>gcC	p.A441A		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	441					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.A441A(1)		central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		CACTGTCATTTGCAACAAGAG	0.383																																							uc001wss.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1321-1323)GCA>GCC		serine/threonine-protein phosphatase 2A							138.0	129.0	132.0					14																	35554835		2202	4300	6502	SO:0001819	synonymous_variant	55012					centrosome|nucleus	calcium ion binding	g.chr14:35554835T>G	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.1323A>C	14.37:g.35554835T>G			Somatic				PPP2R3C_uc001wst.2_Silent_p.A325A|PPP2R3C_uc010tpr.1_Silent_p.A325A|PPP2R3C_uc001wsu.2_RNA	p.A441A	NM_017917	NP_060387	WXS	Illumina HiSeq	Unspecified	Q969Q6	P2R3C_HUMAN	Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)	13	1677	-	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		441					B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Silent	SNP	ENST00000261475.5	37	c.1323A>C	CCDS9654.1																																																																																				0.383	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917		19	73	0	0	0	0.001882	0	19	73				
MDGA2	161357	broad.mit.edu	37	14	47351411	47351411	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:47351411C>A	ENST00000399232.2	-	11	2409	c.2045G>T	c.(2044-2046)cGc>cTc	p.R682L	MDGA2_ENST00000357362.3_Missense_Mutation_p.R453L|MDGA2_ENST00000426342.1_Missense_Mutation_p.R453L|MDGA2_ENST00000399222.3_5'Flank|MDGA2_ENST00000439988.3_Missense_Mutation_p.R751L	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	682	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R453L(2)|p.R751L(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CTCCCACCAGCGCTGCTGTCC	0.323																																							uc001wwj.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(4)|large_intestine(1)|pancreas(1)	6						c.(2044-2046)CGC>CTC		MAM domain containing 1 isoform 1							54.0	51.0	52.0					14																	47351411		1816	4079	5895	SO:0001583	missense	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47351411C>A	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2045G>T	14.37:g.47351411C>A	ENSP00000382178:p.Arg682Leu		Somatic				MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.R453L|MDGA2_uc010ani.2_Missense_Mutation_p.R242L	p.R682L	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			11	2241	-			682					F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37	c.2045G>T		.	.	.	.	.	.	.	.	.	.	C	21.8	4.204831	0.79127	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.4	5.4	0.78164	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000064	T	0.54631	0.1870	L	0.51422	1.61	0.80722	D	1	P;B	0.42649	0.786;0.427	P;B	0.49708	0.62;0.229	T	0.47446	-0.9117	10	0.31617	T	0.26	.	17.7371	0.88396	0.0:1.0:0.0:0.0	.	453;682	F6W3S7;Q7Z553	.;MDGA2_HUMAN	L	682;453;751;453	ENSP00000400011:R682L;ENSP00000405456:R453L;ENSP00000382178:R751L;ENSP00000349925:R453L	ENSP00000349925:R453L	R	-	2	0	MDGA2	46421161	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	7.466000	0.80914	2.547000	0.85894	0.467000	0.42956	CGC		0.323	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		11	49	1	0	0.000151284	0.001855	0.000194625	11	49				
ATL1	51062	broad.mit.edu	37	14	51058328	51058328	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:51058328G>A	ENST00000358385.6	+	4	734	c.493G>A	c.(493-495)Gcc>Acc	p.A165T	ATL1_ENST00000441560.2_Missense_Mutation_p.A165T|ATL1_ENST00000357032.3_Missense_Mutation_p.A165T|ATL1_ENST00000354525.4_Missense_Mutation_p.A165T	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	165	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.A165T(1)		central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						CACAGTATTTGCCCTTAGCAC	0.353																																							uc001wyf.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(493-495)GCC>ACC		atlastin GTPase 1 isoform a							147.0	139.0	142.0					14																	51058328		2203	4300	6503	SO:0001583	missense	51062				axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding	g.chr14:51058328G>A	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.493G>A	14.37:g.51058328G>A	ENSP00000351155:p.Ala165Thr		Somatic				ATL1_uc001wyd.3_Missense_Mutation_p.A165T|ATL1_uc001wye.3_Missense_Mutation_p.A165T	p.A165T	NM_015915	NP_056999	WXS	Illumina HiSeq	Unspecified	Q8WXF7	ATLA1_HUMAN			4	734	+			165			Cytoplasmic.		A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000358385.6	37	c.493G>A	CCDS9700.1	.	.	.	.	.	.	.	.	.	.	G	35	5.509175	0.96386	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525;ENST00000554886	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	5.49	5.49	0.81192	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92538	0.7630	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	D	0.93776	0.7079	10	0.59425	D	0.04	-9.3469	18.3741	0.90430	0.0:0.0:1.0:0.0	.	165;165	Q8WXF7;G5E9T1	ATLA1_HUMAN;.	T	165;165;165;165;21	ENSP00000413675:A165T;ENSP00000351155:A165T;ENSP00000349534:A165T;ENSP00000346522:A165T;ENSP00000452074:A21T	ENSP00000346522:A165T	A	+	1	0	ATL1	50128078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.743000	0.98849	2.583000	0.87209	0.585000	0.79938	GCC		0.353	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2			20	61	0	0	0	0.001523	0	20	61				
SAMD4A	23034	broad.mit.edu	37	14	55231189	55231189	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:55231189G>T	ENST00000554335.1	+	8	2190	c.1527G>T	c.(1525-1527)ttG>ttT	p.L509F	SAMD4A_ENST00000555192.1_Missense_Mutation_p.L100F|SAMD4A_ENST00000392067.3_Missense_Mutation_p.L509F|SAMD4A_ENST00000357634.3_Missense_Mutation_p.L508F|SAMD4A_ENST00000251091.5_Missense_Mutation_p.L421F			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	509					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)	p.L508F(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CACAGCTCTTGGTCTCCAGAC	0.388																																							uc001xbb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1522-1524)TTG>TTT		sterile alpha motif domain containing 4 isoform							169.0	176.0	174.0					14																	55231189		2203	4300	6503	SO:0001583	missense	23034				positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity	g.chr14:55231189G>T	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1527G>T	14.37:g.55231189G>T	ENSP00000452535:p.Leu509Phe		Somatic				SAMD4A_uc001xbc.2_Missense_Mutation_p.L420F|SAMD4A_uc001xbg.2_Missense_Mutation_p.L100F	p.L508F	NM_015589	NP_056404	WXS	Illumina HiSeq	Unspecified	Q9UPU9	SMAG1_HUMAN			7	1525	+			509					A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	c.1524G>T	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266488	0.59540	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	4.78	4.78	0.61160	Smaug, pseudo-HEAT analogous topology (1);	0.000000	0.64402	D	0.000003	T	0.71290	0.3322	M	0.73962	2.25	0.47094	D	0.999312	D;D;D	0.89917	1.0;0.998;0.991	D;D;P	0.80764	0.994;0.964;0.804	T	0.73688	-0.3904	9	0.72032	D	0.01	-6.9042	7.3449	0.26658	0.0927:0.0:0.7359:0.1714	.	100;421;509	G3V2R1;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	F	509;509;421;420;508;100	.	ENSP00000251091:L138F	L	+	3	2	SAMD4A	54300939	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.242000	0.43106	2.492000	0.84095	0.514000	0.50259	TTG		0.388	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589		127	205	1	0	1.8369e-69	0.00361	3.78513e-69	127	205				
LGMN	5641	broad.mit.edu	37	14	93199091	93199091	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:93199091C>A	ENST00000393218.2	-	3	378	c.41G>T	c.(40-42)gGc>gTc	p.G14V	LGMN_ENST00000334869.4_Missense_Mutation_p.G14V|LGMN_ENST00000557434.1_Missense_Mutation_p.G14V|LGMN_ENST00000555699.1_Missense_Mutation_p.G14V	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	14					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)	p.G14V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		GGCACCAATGCCCAGGGCCAC	0.483																																							uc001yav.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(40-42)GGC>GTC		legumain preproprotein							141.0	114.0	123.0					14																	93199091		2203	4300	6503	SO:0001583	missense	5641				hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity	g.chr14:93199091C>A	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.41G>T	14.37:g.93199091C>A	ENSP00000376911:p.Gly14Val		Somatic				LGMN_uc001yat.2_Missense_Mutation_p.G14V|LGMN_uc001yau.2_Missense_Mutation_p.G14V|LGMN_uc001yaw.2_Missense_Mutation_p.G14V|LGMN_uc010aul.2_5'UTR|LGMN_uc001yax.2_Missense_Mutation_p.G14V|LGMN_uc001yay.2_Missense_Mutation_p.G14V	p.G14V	NM_001008530	NP_001008530	WXS	Illumina HiSeq	Unspecified	Q99538	LGMN_HUMAN		COAD - Colon adenocarcinoma(157;0.224)	3	367	-		all_cancers(154;0.0706)	14					O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	ENST00000393218.2	37	c.41G>T	CCDS9904.1	.	.	.	.	.	.	.	.	.	.	C	9.960	1.222512	0.22457	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000535855;ENST00000553802;ENST00000554397;ENST00000554919;ENST00000554080;ENST00000553371;ENST00000553918	T;T;T;T;T;T;T;T;T;D	0.84223	0.89;0.94;0.93;0.94;0.9;0.88;0.88;0.77;0.75;-1.82	4.41	1.32	0.21799	.	0.277067	0.40728	N	0.001031	T	0.78585	0.4306	M	0.66506	2.035	0.30429	N	0.77732	B;B;B	0.32693	0.38;0.038;0.256	B;B;B	0.28553	0.091;0.015;0.051	T	0.68492	-0.5394	10	0.15066	T	0.55	-13.5585	9.781	0.40649	0.1471:0.5687:0.2842:0.0	.	14;14;14	Q99538;Q86TV2;Q86TV3	LGMN_HUMAN;.;.	V	14	ENSP00000451861:G14V;ENSP00000334052:G14V;ENSP00000452572:G14V;ENSP00000376911:G14V;ENSP00000450854:G14V;ENSP00000450677:G14V;ENSP00000451916:G14V;ENSP00000452268:G14V;ENSP00000451797:G14V;ENSP00000450619:G14V	ENSP00000262004:G14V	G	-	2	0	LGMN	92268844	0.968000	0.33430	0.022000	0.16811	0.008000	0.06430	1.331000	0.33793	0.307000	0.22880	-0.678000	0.03780	GGC		0.483	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606		32	121	1	0	1.06801e-11	0.001786	1.7117e-11	32	121				
UNC79	57578	broad.mit.edu	37	14	94048570	94048570	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:94048570G>C	ENST00000393151.2	+	20	2683	c.2683G>C	c.(2683-2685)Gat>Cat	p.D895H	UNC79_ENST00000256339.4_Missense_Mutation_p.D718H|UNC79_ENST00000555664.1_Missense_Mutation_p.D895H|UNC79_ENST00000553484.1_Missense_Mutation_p.D895H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	895					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D718H(1)|p.D895H(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAGCCTGGAGGATAGCCTCCT	0.562																																							uc001ybv.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(2152-2154)GAT>CAT		hypothetical protein LOC57578							78.0	76.0	76.0					14																	94048570		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94048570G>C	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2683G>C	14.37:g.94048570G>C	ENSP00000376858:p.Asp895His		Somatic				KIAA1409_uc001ybs.1_Missense_Mutation_p.D718H	p.D718H	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	17	2235	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	895					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.2152G>C		.	.	.	.	.	.	.	.	.	.	G	28.0	4.880858	0.91740	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.20738	2.05;2.06;2.05;2.06	5.26	5.26	0.73747	.	0.167180	0.51477	D	0.000099	T	0.39517	0.1081	L	0.46157	1.445	0.58432	D	0.999996	D	0.53885	0.963	P	0.60473	0.875	T	0.15407	-1.0438	10	0.87932	D	0	-17.3353	18.8774	0.92343	0.0:0.0:1.0:0.0	.	895	C9JQL1	.	H	718;895;895;895;895	ENSP00000256339:D718H;ENSP00000450868:D895H;ENSP00000451360:D895H;ENSP00000376858:D895H	ENSP00000256339:D718H	D	+	1	0	KIAA1409	93118323	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.131000	0.94446	2.459000	0.83118	0.655000	0.94253	GAT		0.562	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		3	108	0	0	0	0.004672	0	3	108				
SERPINA4	5267	broad.mit.edu	37	14	95030054	95030054	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:95030054C>A	ENST00000557004.1	+	2	656	c.235C>A	c.(235-237)Ccg>Acg	p.P79T	SERPINA4_ENST00000555095.1_Missense_Mutation_p.P79T|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Missense_Mutation_p.P79T			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	79					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P79T(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		CTTTTTCTCCCCGCTGAGCAT	0.612																																							uc001ydk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(235-237)CCG>ACG		serine (or cysteine) proteinase inhibitor, clade							52.0	51.0	52.0					14																	95030054		2203	4300	6503	SO:0001583	missense	5267				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chr14:95030054C>A	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.235C>A	14.37:g.95030054C>A	ENSP00000450838:p.Pro79Thr		Somatic				SERPINA4_uc010avd.2_Missense_Mutation_p.P116T|SERPINA4_uc001ydl.2_Missense_Mutation_p.P79T	p.P79T	NM_006215	NP_006206	WXS	Illumina HiSeq	Unspecified	P29622	KAIN_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	301	+			79					Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	c.235C>A	CCDS9927.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978978	0.74360	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.97209	-4.29;-4.29;-4.29	4.38	4.38	0.52667	Serpin domain (3);	0.000000	0.53938	D	0.000041	D	0.99036	0.9670	H	0.97390	3.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99232	1.0882	10	0.87932	D	0	.	16.312	0.82874	0.0:1.0:0.0:0.0	.	79;79	B2R815;P29622	.;KAIN_HUMAN	T	79	ENSP00000450838:P79T;ENSP00000451172:P79T;ENSP00000298841:P79T	ENSP00000298841:P79T	P	+	1	0	SERPINA4	94099807	0.998000	0.40836	0.992000	0.48379	0.895000	0.52256	5.410000	0.66381	2.153000	0.67306	0.563000	0.77884	CCG		0.612	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		40	71	1	0	2.59497e-14	0.007835	4.33406e-14	40	71				
DYNC1H1	1778	broad.mit.edu	37	14	102508450	102508450	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:102508450C>T	ENST00000360184.4	+	66	12367	c.12203C>T	c.(12202-12204)tCa>tTa	p.S4068L	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4068	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.S4068L(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAGATCACTTCAATTGCAATC	0.542																																							uc001yks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(12202-12204)TCA>TTA		cytoplasmic dynein 1 heavy chain 1							100.0	82.0	88.0					14																	102508450		2203	4300	6503	SO:0001583	missense	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102508450C>T	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12203C>T	14.37:g.102508450C>T	ENSP00000348965:p.Ser4068Leu		Somatic					p.S4068L	NM_001376	NP_001367	WXS	Illumina HiSeq	Unspecified	Q14204	DYHC1_HUMAN			66	12367	+			4068			AAA 6 (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.12203C>T	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869685	0.91587	.	.	ENSG00000197102	ENST00000360184	T	0.11169	2.8	5.91	5.91	0.95273	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	M	0.91510	3.215	0.80722	D	1	D	0.55800	0.973	P	0.61003	0.882	T	0.42783	-0.9431	10	0.51188	T	0.08	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	4068	Q14204	DYHC1_HUMAN	L	4068	ENSP00000348965:S4068L	ENSP00000348965:S4068L	S	+	2	0	DYNC1H1	101578203	1.000000	0.71417	0.108000	0.21378	0.296000	0.27459	7.818000	0.86416	2.808000	0.96608	0.655000	0.94253	TCA		0.542	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		24	45	0	0	0	0.004656	0	24	45				
TRAF3	7187	broad.mit.edu	37	14	103371649	103371649	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:103371649C>T	ENST00000560371.1	+	11	1452	c.1235C>T	c.(1234-1236)gCc>gTc	p.A412V	TRAF3_ENST00000539721.1_Missense_Mutation_p.A329V|TRAF3_ENST00000347662.4_Missense_Mutation_p.A387V|TRAF3_ENST00000351691.5_Missense_Mutation_p.A387V|TRAF3_ENST00000392745.2_Missense_Mutation_p.A412V	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	412					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A412V(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		CTGGAGACCGCCAGCTACAAT	0.612																																							uc001ymc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1234-1236)GCC>GTC		TNF receptor-associated factor 3 isoform 1							80.0	77.0	78.0					14																	103371649		2203	4300	6503	SO:0001583	missense	7187				apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:103371649C>T	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1235C>T	14.37:g.103371649C>T	ENSP00000454207:p.Ala412Val		Somatic				TRAF3_uc001yme.1_Missense_Mutation_p.A387V|TRAF3_uc001ymd.1_Missense_Mutation_p.A412V|TRAF3_uc010txy.1_Missense_Mutation_p.A329V	p.A412V	NM_145725	NP_663777	WXS	Illumina HiSeq	Unspecified	Q13114	TRAF3_HUMAN		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)	12	1588	+		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)	412					B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	ENST00000560371.1	37	c.1235C>T	CCDS9975.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821925	0.50633	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	T;T;T	0.46063	2.19;2.17;0.88	5.34	5.34	0.76211	TRAF-type (1);	0.203209	0.51477	D	0.000085	T	0.48750	0.1517	L	0.38531	1.155	0.80722	D	1	D;P;D	0.69078	0.997;0.894;0.984	P;B;P	0.55222	0.771;0.334;0.477	T	0.29336	-1.0015	10	0.26408	T	0.33	-25.9597	19.0547	0.93058	0.0:1.0:0.0:0.0	.	329;387;412	Q13114-2;A6NHG8;Q13114	.;.;TRAF3_HUMAN	V	412;387;412;329	ENSP00000376500:A412V;ENSP00000328003:A387V;ENSP00000445998:A329V	ENSP00000328003:A387V	A	+	2	0	TRAF3	102441402	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	6.037000	0.70956	2.486000	0.83907	0.655000	0.94253	GCC		0.612	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	NM_145725		22	50	0	0	0	0.001523	0	22	50				
IGHD1-26	28506	broad.mit.edu	37	14	106349907	106349907	+	RNA	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr14:106349907G>A	ENST00000390567.1	-	0	0				IGHD6-25_ENST00000452198.1_RNA|IGHD5-24_ENST00000390569.1_RNA|IGHD3-22_ENST00000390571.1_RNA|IGHD4-23_ENST00000437320.1_RNA					immunoglobulin heavy diversity 1-26																		AGAGAGCCTGGGGGCTGCTCA	0.677																																							uc010tyt.1		NA																	0					0						c.e3173-1		Parts of antibodies, mostly variable regions.																																						8755							g.chr14:106349907G>A	X97051		14q32.33	2012-02-08			ENSG00000211907	ENSG00000211907		"""Immunoglobulins / IGH locus"""	5485	other	immunoglobulin gene							Standard	NG_001019		Approved	IGHD126			OTTHUMG00000152429		14.37:g.106349907G>A			Somatic								WXS	Illumina HiSeq	Unspecified					3173		-									Splice_Site	SNP	ENST00000390567.1	37	c.50075_splice																																																																																					0.677	IGHD1-26-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_D_gene	IG_D_gene	OTTHUMT00000326207.1	NG_001019		4	18	0	0	0	0.000248	0	4	18				
ARHGAP11A	9824	broad.mit.edu	37	15	32915737	32915737	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:32915737C>A	ENST00000361627.3	+	3	967	c.245C>A	c.(244-246)aCc>aAc	p.T82N	ARHGAP11A_ENST00000543522.1_5'UTR|ARHGAP11A_ENST00000565905.1_5'UTR|ARHGAP11A_ENST00000567348.1_Missense_Mutation_p.T82N|ARHGAP11A_ENST00000563864.1_Missense_Mutation_p.T82N	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	82	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.T82N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		CATATTCATACCGAAGGGCTT	0.378																																					Colon(45;757 1134 30003 36652)	Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|breast(2)|urinary_tract(1)	6						c.(244-246)ACC>AAC		Rho GTPase activating protein 11A isoform 1							132.0	130.0	131.0					15																	32915737		2201	4300	6501	SO:0001583	missense	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32915737C>A	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.245C>A	15.37:g.32915737C>A	ENSP00000355090:p.Thr82Asn		Somatic				ARHGAP11A_uc010ubw.1_5'UTR|ARHGAP11A_uc001zgw.2_Missense_Mutation_p.T82N|ARHGAP11A_uc001zgx.2_Missense_Mutation_p.T82N|ARHGAP11A_uc010ubx.1_5'UTR	p.T82N	NM_014783	NP_055598	WXS	Illumina HiSeq	Unspecified	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	3	967	+		all_lung(180;1.3e-11)	82			Rho-GAP.		B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	c.245C>A	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	18.84	3.709848	0.68730	.	.	ENSG00000198826	ENST00000361627	T	0.20463	2.07	4.76	3.82	0.43975	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.271003	0.26082	N	0.026450	T	0.51466	0.1676	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61787	-0.6991	10	0.87932	D	0	.	13.8266	0.63354	0.0:0.9216:0.0:0.0784	.	82	Q6P4F7	RHGBA_HUMAN	N	82	ENSP00000355090:T82N	ENSP00000355090:T82N	T	+	2	0	ARHGAP11A	30703029	1.000000	0.71417	0.611000	0.29010	0.672000	0.39443	5.474000	0.66781	2.347000	0.79759	0.655000	0.94253	ACC		0.378	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783		5	74	1	0	0.000157383	0.00308	0.000201383	5	74				
PML	5371	broad.mit.edu	37	15	74290522	74290522	+	Missense_Mutation	SNP	G	G	T	rs570405596		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:74290522G>T	ENST00000268058.3	+	2	403	c.307G>T	c.(307-309)Gcc>Tcc	p.A103S	PML_ENST00000395132.2_Missense_Mutation_p.A103S|PML_ENST00000268059.6_Missense_Mutation_p.A103S|PML_ENST00000563500.1_Missense_Mutation_p.A103S|PML_ENST00000564428.1_Missense_Mutation_p.A103S|PML_ENST00000565898.1_Missense_Mutation_p.A103S|PML_ENST00000354026.6_Missense_Mutation_p.A103S|PML_ENST00000436891.3_Missense_Mutation_p.A103S|PML_ENST00000567543.1_Missense_Mutation_p.A103S|PML_ENST00000569965.1_Missense_Mutation_p.A103S|PML_ENST00000569477.1_Missense_Mutation_p.A103S|PML_ENST00000435786.2_Missense_Mutation_p.A103S|PML_ENST00000359928.4_Missense_Mutation_p.A103S|PML_ENST00000395135.3_Missense_Mutation_p.A103S	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	103					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A103S(3)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						AGACACACCCGCCCTGGATAA	0.647			T	"""RARA, PAX5"""	"""APL, ALL"""																																		uc002awv.2		NA		Dom	yes		15	15q22	5371	T	promyelocytic leukemia			L	RARA|PAX5		APL|ALL		3	Substitution - Missense(3)		lung(3)	central_nervous_system(2)|kidney(2)|breast(1)	5						c.(307-309)GCC>TCC		promyelocytic leukemia protein isoform 1							49.0	44.0	45.0					15																	74290522		2198	4297	6495	SO:0001583	missense	5371				cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding	g.chr15:74290522G>T	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.307G>T	15.37:g.74290522G>T	ENSP00000268058:p.Ala103Ser		Somatic				PML_uc002awm.2_Missense_Mutation_p.A103S|PML_uc002awl.2_Missense_Mutation_p.A103S|PML_uc002awj.1_Missense_Mutation_p.A103S|PML_uc002awk.2_Missense_Mutation_p.A103S|PML_uc002awn.2_Missense_Mutation_p.A103S|PML_uc002awo.2_Missense_Mutation_p.A103S|PML_uc002awp.2_Missense_Mutation_p.A103S|PML_uc002awq.2_Missense_Mutation_p.A103S|PML_uc002awr.2_Missense_Mutation_p.A103S|PML_uc002aws.2_Missense_Mutation_p.A103S|PML_uc002awt.2_Missense_Mutation_p.A103S|PML_uc002awu.2_Missense_Mutation_p.A103S|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.A18S	p.A103S	NM_033238	NP_150241	WXS	Illumina HiSeq	Unspecified	P29590	PML_HUMAN			2	447	+			103					E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	c.307G>T	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	3.341	-0.134686	0.06711	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T	0.43688	0.94	4.25	-0.447	0.12234	.	2.854450	0.01044	N	0.004343	T	0.32704	0.0838	L	0.37697	1.125	0.09310	N	1	B;B;P;B;B;B;P;P;P;B;P;B	0.44521	0.04;0.34;0.47;0.182;0.108;0.095;0.511;0.47;0.47;0.289;0.837;0.105	B;B;B;B;B;B;B;B;B;B;B;B	0.43575	0.012;0.055;0.118;0.081;0.105;0.022;0.22;0.184;0.256;0.079;0.424;0.023	T	0.12785	-1.0534	10	0.25751	T	0.34	-8.1754	1.117	0.01716	0.2013:0.3039:0.3177:0.1771	.	53;103;103;103;103;103;103;103;103;103;103;106	Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	S	103	ENSP00000268058:A103S	ENSP00000268058:A103S	A	+	1	0	PML	72077575	0.005000	0.15991	0.001000	0.08648	0.006000	0.05464	1.495000	0.35627	0.091000	0.17302	-0.304000	0.09214	GCC		0.647	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675		6	37	1	0	1.06961e-07	0.00308	1.55224e-07	6	37				
NTRK3	4916	broad.mit.edu	37	15	88669523	88669523	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:88669523G>C	ENST00000360948.2	-	12	1536	c.1375C>G	c.(1375-1377)Cgg>Ggg	p.R459G	NTRK3_ENST00000540489.2_Missense_Mutation_p.R459G|NTRK3_ENST00000394480.2_Missense_Mutation_p.R459G|NTRK3_ENST00000317501.3_Missense_Mutation_p.R459G|NTRK3_ENST00000355254.2_Missense_Mutation_p.R459G|NTRK3_ENST00000542733.2_Missense_Mutation_p.R361G|NTRK3_ENST00000557856.1_Missense_Mutation_p.R451G|NTRK3_ENST00000558676.1_Missense_Mutation_p.R451G|NTRK3_ENST00000558306.1_Intron|NTRK3_ENST00000357724.2_Missense_Mutation_p.R451G	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	459					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R459W(3)|p.R459G(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AATTTGGACCGTCGACCATAT	0.433			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	6	Substitution - Missense(6)		large_intestine(3)|lung(3)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1375-1377)CGG>GGG		neurotrophic tyrosine kinase, receptor, type 3							111.0	96.0	101.0					15																	88669523		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88669523G>C	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1375C>G	15.37:g.88669523G>C	ENSP00000354207:p.Arg459Gly	TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Missense_Mutation_p.R451G|NTRK3_uc002bmf.1_Missense_Mutation_p.R459G|NTRK3_uc010upl.1_Missense_Mutation_p.R361G|NTRK3_uc010bnh.1_Missense_Mutation_p.R451G|NTRK3_uc002bmg.2_Missense_Mutation_p.R459G	p.R459G	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		12	1537	-			459			Cytoplasmic (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1375C>G	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569870	0.86542	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74737	-0.87;-0.83;-0.86;-0.87;-0.76;-0.05;-0.05	5.39	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.83695	0.5310	M	0.64404	1.975	0.58432	D	0.999999	D;D;P;D;D;P	0.89917	1.0;0.997;0.955;1.0;0.999;0.955	D;D;P;D;D;P	0.85130	0.997;0.987;0.773;0.997;0.996;0.773	D	0.85036	0.0920	10	0.66056	D	0.02	.	14.0241	0.64575	0.0:0.0:0.8361:0.1639	.	361;451;451;459;459;459	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	G	459;459;451;459;361;459;459	ENSP00000377990:R459G;ENSP00000354207:R459G;ENSP00000350356:R451G;ENSP00000347397:R459G;ENSP00000437773:R361G;ENSP00000444673:R459G;ENSP00000318328:R459G	ENSP00000318328:R459G	R	-	1	2	NTRK3	86470527	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	6.303000	0.72794	1.213000	0.43380	0.655000	0.94253	CGG		0.433	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				14	33	0	0	0	0.001855	0	14	33				
MFGE8	4240	broad.mit.edu	37	15	89450563	89450563	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:89450563A>G	ENST00000566497.1	-	3	311	c.250T>C	c.(250-252)Tca>Cca	p.S84P	MFGE8_ENST00000542878.1_Missense_Mutation_p.S40P|MFGE8_ENST00000268151.7_Missense_Mutation_p.S84P|MFGE8_ENST00000268150.8_Missense_Mutation_p.S84P|MFGE8_ENST00000559997.1_5'UTR|MFGE8_ENST00000539437.1_Missense_Mutation_p.S76P			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	84	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)	p.S84P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					GCGATCTGTGAGTTGGCAATG	0.632																																							uc002bng.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(250-252)TCA>CCA		milk fat globule-EGF factor 8 protein isoform a							124.0	88.0	100.0					15																	89450563		2200	4299	6499	SO:0001583	missense	4240				angiogenesis|cell adhesion|interspecies interaction between organisms|single fertilization			g.chr15:89450563A>G	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.250T>C	15.37:g.89450563A>G	ENSP00000456281:p.Ser84Pro		Somatic				MFGE8_uc002bnf.3_5'UTR|MFGE8_uc002bnh.3_Missense_Mutation_p.S84P|MFGE8_uc010bnn.2_Missense_Mutation_p.S76P|MFGE8_uc010upq.1_Missense_Mutation_p.S40P|MFGE8_uc010upr.1_Missense_Mutation_p.S84P|MFGE8_uc010bno.2_Missense_Mutation_p.S40P	p.S84P	NM_005928	NP_005919	WXS	Illumina HiSeq	Unspecified	Q08431	MFGM_HUMAN			3	363	-	Lung NSC(78;0.0392)|all_lung(78;0.077)		84			F5/8 type C 1.		B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	ENST00000566497.1	37	c.250T>C	CCDS10347.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.164513	0.38217	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437;ENST00000542878	D;D;D;D	0.97642	-4.47;-4.47;-4.47;-1.78	5.32	-7.84	0.01196	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.732533	0.13639	N	0.373134	D	0.97660	0.9233	M	0.84846	2.72	0.09310	N	1	D;D;D;D;D;D	0.62365	0.984;0.982;0.984;0.982;0.991;0.984	P;P;P;P;P;P	0.59889	0.737;0.83;0.737;0.865;0.865;0.737	D	0.95250	0.8359	10	0.56958	D	0.05	-0.0724	18.1022	0.89509	0.142:0.7894:0.0686:0.0	.	76;40;40;76;84;84	B3KTQ2;F5GZN3;B4E396;F5H7N9;Q08431-3;Q08431	.;.;.;.;.;MFGM_HUMAN	P	84;84;76;40	ENSP00000268150:S84P;ENSP00000268151:S84P;ENSP00000442386:S76P;ENSP00000444332:S40P	ENSP00000268150:S84P	S	-	1	0	MFGE8	87251567	0.990000	0.36364	0.000000	0.03702	0.011000	0.07611	1.161000	0.31773	-1.216000	0.02607	0.379000	0.24179	TCA		0.632	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928		5	31	0	0	0	0.001168	0	5	31				
ABHD2	11057	broad.mit.edu	37	15	89698682	89698682	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:89698682A>G	ENST00000352732.5	+	5	975	c.455A>G	c.(454-456)aAa>aGa	p.K152R	ABHD2_ENST00000565973.1_Missense_Mutation_p.K152R|ABHD2_ENST00000355100.3_Missense_Mutation_p.K152R	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	152					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.K152R(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					TACGCCCAGAAAAATGGCTAT	0.507																																					Colon(11;252 417 24570 33239 41878)	Colon(11;252 417 24570 33239 41878)	uc002bnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(454-456)AAA>AGA		alpha/beta hydrolase domain containing protein							168.0	138.0	148.0					15																	89698682		2200	4299	6499	SO:0001583	missense	11057					integral to membrane	carboxylesterase activity	g.chr15:89698682A>G	X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.455A>G	15.37:g.89698682A>G	ENSP00000268129:p.Lys152Arg		Somatic				ABHD2_uc002bnk.2_Missense_Mutation_p.K152R	p.K152R	NM_007011	NP_008942	WXS	Illumina HiSeq	Unspecified	P08910	ABHD2_HUMAN			10	1372	+	Lung NSC(78;0.0472)|all_lung(78;0.089)		152					Q53G48|Q53GU0|Q5FVD9|Q8TC79	Missense_Mutation	SNP	ENST00000352732.5	37	c.455A>G	CCDS10348.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096644	0.36952	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	T;T	0.42513	0.97;0.97	5.49	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	L	0.45581	1.43	0.52099	D	0.999941	B	0.06786	0.001	B	0.08055	0.003	T	0.09100	-1.0690	10	0.23302	T	0.38	-0.0074	11.8535	0.52425	0.8688:0.0:0.0:0.1312	.	152	P08910	ABHD2_HUMAN	R	152	ENSP00000268129:K152R;ENSP00000347217:K152R	ENSP00000268129:K152R	K	+	2	0	ABHD2	87499686	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.921000	0.56454	0.964000	0.38108	0.533000	0.62120	AAA		0.507	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309074.2			18	113	0	0	0	0.006122	0	18	113				
LRRK1	79705	broad.mit.edu	37	15	101464888	101464888	+	Silent	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr15:101464888G>C	ENST00000388948.3	+	2	410	c.51G>C	c.(49-51)ccG>ccC	p.P17P	LRRK1_ENST00000284395.5_5'UTR|LRRK1_ENST00000532029.2_Silent_p.P17P	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.P17P(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTGTGGGGCCGGAGGAGTCAG	0.592																																							uc002bwr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(49-51)CCG>CCC		leucine-rich repeat kinase 1							115.0	134.0	128.0					15																	101464888		2203	4300	6503	SO:0001819	synonymous_variant	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101464888G>C	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.51G>C	15.37:g.101464888G>C			Somatic				LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Silent_p.P17P	p.P17P	NM_024652	NP_078928	WXS	Illumina HiSeq	Unspecified	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		2	370	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		17						Silent	SNP	ENST00000388948.3	37	c.51G>C	CCDS42086.1																																																																																				0.592	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		12	29	0	0	0	0.00245	0	12	29				
ERCC4	2072	broad.mit.edu	37	16	14029250	14029250	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:14029250G>C	ENST00000311895.7	+	8	1470	c.1461G>C	c.(1459-1461)aaG>aaC	p.K487N	CTD-2135D7.2_ENST00000575137.1_RNA|CTD-2135D7.2_ENST00000570663.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	487					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.K487N(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						CCCTCAAAAAGAAAAAACGGA	0.408			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc002dce.2		NA	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""			E		skin basal cell|skin squamous cell|melanoma			1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(1459-1461)AAG>AAC	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							53.0	55.0	54.0					16																	14029250		2197	4300	6497	SO:0001583	missense	2072	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr16:14029250G>C	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1461G>C	16.37:g.14029250G>C	ENSP00000310520:p.Lys487Asn		Somatic				ERCC4_uc010uyz.1_Missense_Mutation_p.K37N	p.K487N	NM_005236	NP_005227	WXS	Illumina HiSeq	Unspecified	Q92889	XPF_HUMAN			8	1470	+			487			Nuclear localization signal (Potential).		A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	c.1461G>C	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	4.196	0.035128	0.08148	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	T	0.60040	0.22	5.51	3.55	0.40652	.	0.235256	0.36665	N	0.002473	T	0.43897	0.1268	L	0.41236	1.265	0.37829	D	0.928649	B	0.02656	0.0	B	0.06405	0.002	T	0.28490	-1.0042	10	0.19590	T	0.45	-22.92	9.002	0.36088	0.1366:0.0:0.7417:0.1217	.	487	Q92889	XPF_HUMAN	N	487;476	ENSP00000310520:K487N	ENSP00000310520:K487N	K	+	3	2	ERCC4	13936751	1.000000	0.71417	0.464000	0.27143	0.034000	0.12701	1.231000	0.32624	0.305000	0.22832	-1.814000	0.00607	AAG		0.408	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236		3	46	0	0	0	0.000248	0	3	46				
XYLT1	64131	broad.mit.edu	37	16	17228489	17228489	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:17228489C>G	ENST00000261381.6	-	9	1952	c.1868G>C	c.(1867-1869)gGt>gCt	p.G623A	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	623					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.G623A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCCCGGGGTACCTGCAGGGTA	0.572																																							uc002dfa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1867-1869)GGT>GCT		xylosyltransferase I							126.0	121.0	122.0					16																	17228489		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17228489C>G	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1868G>C	16.37:g.17228489C>G	ENSP00000261381:p.Gly623Ala		Somatic					p.G623A	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			9	1953	-			623			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.1868G>C	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702707	0.88924	.	.	ENSG00000103489	ENST00000261381	T	0.48836	0.8	4.88	4.88	0.63580	.	0.094097	0.64402	D	0.000001	T	0.65760	0.2722	M	0.63428	1.95	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.66276	-0.5964	10	0.46703	T	0.11	-32.2471	17.3873	0.87420	0.0:1.0:0.0:0.0	.	623	Q86Y38	XYLT1_HUMAN	A	623	ENSP00000261381:G623A	ENSP00000261381:G623A	G	-	2	0	XYLT1	17135990	1.000000	0.71417	0.991000	0.47740	0.951000	0.60555	4.904000	0.63279	2.408000	0.81797	0.561000	0.74099	GGT		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		46	120	0	0	0	0.00361	0	46	120				
DNAH3	55567	broad.mit.edu	37	16	20996905	20996905	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:20996905C>T	ENST00000261383.3	-	48	7158	c.7159G>A	c.(7159-7161)Gtg>Atg	p.V2387M	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2387					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.V2387M(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCCATGACCACAGTCAGCTGT	0.448																																							uc010vbe.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(7159-7161)GTG>ATG		dynein, axonemal, heavy chain 3							155.0	134.0	141.0					16																	20996905		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20996905C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7159G>A	16.37:g.20996905C>T	ENSP00000261383:p.Val2387Met		Somatic				DNAH3_uc010vbd.1_5'Flank	p.V2387M	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	48	7159	-			2387					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.7159G>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	7.184	0.590165	0.13812	.	.	ENSG00000158486	ENST00000261383	T	0.22336	1.96	4.94	-1.03	0.10102	.	0.886779	0.09468	N	0.798028	T	0.10294	0.0252	N	0.12887	0.27	0.09310	N	1	B	0.32203	0.36	B	0.34418	0.182	T	0.32508	-0.9904	10	0.41790	T	0.15	.	3.6312	0.08133	0.5006:0.28:0.1013:0.1181	.	2387	Q8TD57	DYH3_HUMAN	M	2387	ENSP00000261383:V2387M	ENSP00000261383:V2387M	V	-	1	0	DNAH3	20904406	0.000000	0.05858	0.004000	0.12327	0.828000	0.46876	-0.490000	0.06482	0.185000	0.20105	0.655000	0.94253	GTG		0.448	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		8	142	0	0	0	0.00308	0	8	142				
OTOA	146183	broad.mit.edu	37	16	21698947	21698947	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:21698947C>G	ENST00000286149.4	+	7	614	c.613C>G	c.(613-615)Cgc>Ggc	p.R205G	OTOA_ENST00000388958.3_Missense_Mutation_p.R205G|OTOA_ENST00000388956.4_Missense_Mutation_p.R126G			Q7RTW8	OTOAN_HUMAN	otoancorin	205					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.R205G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TCGGGACCTGCGCGAGGATGC	0.542																																							uc002djh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(613-615)CGC>GGC		otoancorin isoform 1							33.0	31.0	32.0					16																	21698947		2199	4300	6499	SO:0001583	missense	146183				sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix		g.chr16:21698947C>G	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.613C>G	16.37:g.21698947C>G	ENSP00000286149:p.Arg205Gly		Somatic				uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.R126G	p.R205G	NM_144672	NP_653273	WXS	Illumina HiSeq	Unspecified	Q7RTW8	OTOAN_HUMAN		GBM - Glioblastoma multiforme(48;0.0414)	7	614	+			205					A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37	c.613C>G		.	.	.	.	.	.	.	.	.	.	C	3.501	-0.101848	0.06967	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	T;T;T	0.12465	2.68;2.68;2.68	4.36	1.24	0.21308	.	0.331976	0.25192	N	0.032444	T	0.10551	0.0258	L	0.40543	1.245	0.09310	N	1	B;B	0.19331	0.035;0.035	B;B	0.25987	0.065;0.065	T	0.26224	-1.0109	10	0.37606	T	0.19	-0.245	6.0997	0.20041	0.0:0.6637:0.1542:0.1821	.	126;205	B3KWU3;E9PF51	.;.	G	205;205;126	ENSP00000373610:R205G;ENSP00000286149:R205G;ENSP00000373608:R126G	ENSP00000286149:R205G	R	+	1	0	OTOA	21606448	0.033000	0.19621	0.033000	0.17914	0.134000	0.20937	0.725000	0.25970	-0.001000	0.14495	-0.262000	0.10625	CGC		0.542	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			7	17	0	0	0	0.001984	0	7	17				
IL21R	50615	broad.mit.edu	37	16	27459937	27459937	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:27459937A>G	ENST00000337929.3	+	9	1423	c.950A>G	c.(949-951)tAc>tGc	p.Y317C	IL21R_ENST00000564089.1_Missense_Mutation_p.Y317C|IL21R_ENST00000395754.4_Missense_Mutation_p.Y317C|IL21R_ENST00000564583.1_3'UTR|IL21R_ENST00000395755.1_Missense_Mutation_p.Y317C|IL21R-AS1_ENST00000563191.1_RNA	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	317					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)	p.Y317C(1)		breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTGGAGGTGTACAGCTGCCAC	0.632			T	BCL6	NHL																																		uc002doq.1		NA		Dom	yes		16	16p11	50615	T	interleukin 21 receptor			L	BCL6		NHL		1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|breast(1)	4						c.(949-951)TAC>TGC		interleukin 21 receptor precursor							22.0	25.0	24.0					16																	27459937		2196	4288	6484	SO:0001583	missense	50615				natural killer cell activation	integral to membrane	interleukin-21 receptor activity	g.chr16:27459937A>G	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.950A>G	16.37:g.27459937A>G	ENSP00000338010:p.Tyr317Cys		Somatic				IL21R_uc002dor.1_Missense_Mutation_p.Y317C|IL21R_uc002dos.1_Missense_Mutation_p.Y317C|uc002dot.2_RNA	p.Y317C	NM_181078	NP_851564	WXS	Illumina HiSeq	Unspecified	Q9HBE5	IL21R_HUMAN			9	1183	+			317			Cytoplasmic (Potential).		A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	c.950A>G	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	A	9.210	1.030758	0.19512	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.35048	1.33;1.33;1.33	4.64	-4.51	0.03483	.	3.888380	0.01443	U	0.015164	T	0.18593	0.0446	N	0.10874	0.06	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.14008	-1.0488	10	0.39692	T	0.17	1.421	4.4791	0.11759	0.2553:0.0:0.4372:0.3075	.	317	Q9HBE5	IL21R_HUMAN	C	317	ENSP00000338010:Y317C;ENSP00000379104:Y317C;ENSP00000379103:Y317C	ENSP00000338010:Y317C	Y	+	2	0	IL21R	27367438	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-1.306000	0.02735	-0.836000	0.04229	-0.441000	0.05720	TAC		0.632	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078		8	49	0	0	0	0.00308	0	8	49				
NUPR1	26471	broad.mit.edu	37	16	28550162	28550162	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:28550162T>G	ENST00000324873.6	-	1	333	c.67A>C	c.(67-69)Agc>Cgc	p.S23R	NUPR1_ENST00000395641.2_Missense_Mutation_p.S23R	NM_001042483.1|NM_012385.2	NP_001035948.1|NP_036517.1	O60356	NUPR1_HUMAN	nuclear protein, transcriptional regulator, 1	23					acute inflammatory response (GO:0002526)|cell growth (GO:0016049)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male gonad development (GO:0008584)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein modification process (GO:0031401)|protein acetylation (GO:0006473)|protein complex assembly (GO:0006461)|regulation of female gonad development (GO:2000194)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S23R(1)		breast(1)|large_intestine(1)|lung(1)	3						TCATCCAGGCTGGAGTCCTCG	0.627																																							uc002dqe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(67-69)AGC>CGC		p8 protein isoform b							94.0	83.0	87.0					16																	28550162		2197	4300	6497	SO:0001583	missense	26471				cell growth|induction of apoptosis	nucleus		g.chr16:28550162T>G	AF069073	CCDS10634.1, CCDS42137.1	16p11.2	2012-07-04	2012-07-04		ENSG00000176046	ENSG00000176046			29990	protein-coding gene	gene with protein product	"""candidate of metastasis 1"""	614812				9405444, 10493524, 10092851	Standard	NM_012385		Approved	COM1, p8	uc002dqd.1	O60356	OTTHUMG00000131764	ENST00000324873.6:c.67A>C	16.37:g.28550162T>G	ENSP00000315559:p.Ser23Arg		Somatic				uc010vct.1_Intron|NUPR1_uc002dqd.1_Missense_Mutation_p.S23R	p.S23R	NM_012385	NP_036517	WXS	Illumina HiSeq	Unspecified	O60356	NUPR1_HUMAN			1	334	-			23					B2R5C4|O60357|Q6FGG3	Missense_Mutation	SNP	ENST00000324873.6	37	c.67A>C	CCDS10634.1	.	.	.	.	.	.	.	.	.	.	T	15.76	2.929696	0.52759	.	.	ENSG00000176046	ENST00000324873;ENST00000395641	.	.	.	5.44	0.0137	0.14097	.	0.992284	0.08199	N	0.982538	T	0.25606	0.0623	.	.	.	0.09310	N	1	B	0.33777	0.425	B	0.41236	0.351	T	0.32771	-0.9894	8	0.25751	T	0.34	-0.5967	0.7143	0.00929	0.1626:0.1941:0.1683:0.475	.	23	O60356	NUPR1_HUMAN	R	23	.	ENSP00000315559:S23R	S	-	1	0	NUPR1	28457663	0.001000	0.12720	0.004000	0.12327	0.854000	0.48673	0.112000	0.15479	0.079000	0.16929	0.523000	0.50628	AGC		0.627	NUPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254692.2	NM_012385		18	56	0	0	0	0.006122	0	18	56				
KCTD13	253980	broad.mit.edu	37	16	29934554	29934554	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:29934554T>G	ENST00000568000.1	-	2	1372	c.371A>C	c.(370-372)tAc>tCc	p.Y124S	CTD-2574D22.4_ENST00000567795.1_RNA|KCTD13_ENST00000561540.1_Missense_Mutation_p.Y124S|KCTD13_ENST00000568721.1_5'Flank	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	124					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)	p.Y124S(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						CTGCACCAGGTAGTAGCGTGC	0.607																																							uc002duv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)TAC>TCC		potassium channel tetramerisation domain							51.0	45.0	47.0					16																	29934554		2197	4300	6497	SO:0001583	missense	253980				cell migration|DNA replication|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity	g.chr16:29934554T>G	AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.371A>C	16.37:g.29934554T>G	ENSP00000455785:p.Tyr124Ser		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KCTD13_uc010vee.1_RNA	p.Y124S	NM_178863	NP_849194	WXS	Illumina HiSeq	Unspecified	Q8WZ19	BACD1_HUMAN			2	562	-			124					A8K0R5|Q96P93|Q96SA1	Missense_Mutation	SNP	ENST00000568000.1	37	c.371A>C	CCDS10661.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.105688	0.77096	.	.	ENSG00000174943	ENST00000308768	D	0.82619	-1.63	5.02	5.02	0.67125	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.53938	D	0.000045	D	0.94640	0.8272	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96480	0.9355	10	0.87932	D	0	-0.0052	13.8643	0.63578	0.0:0.0:0.0:1.0	.	124	Q8WZ19	BACD1_HUMAN	S	124	ENSP00000311202:Y124S	ENSP00000311202:Y124S	Y	-	2	0	KCTD13	29842055	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.759000	0.68785	2.098000	0.63641	0.460000	0.39030	TAC		0.607	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255162.2	NM_178863		9	31	0	0	0	0.000673	0	9	31				
FAM57B	83723	broad.mit.edu	37	16	30041831	30041831	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:30041831C>A	ENST00000380495.4	-	1	749	c.18G>T	c.(16-18)gtG>gtT	p.V6V	FAM57B_ENST00000567037.1_5'Flank|FAM57B_ENST00000564806.1_5'Flank|FAM57B_ENST00000279389.4_5'Flank	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	6					ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)	p.V6V(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CCCCCCCGGCCACCATCGGGG	0.672																																							uc002dvt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(16-18)GTG>GTT		hypothetical protein LOC83723							12.0	14.0	14.0					16																	30041831		1865	4080	5945	SO:0001819	synonymous_variant	83723					endoplasmic reticulum|integral to membrane		g.chr16:30041831C>A	AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.18G>T	16.37:g.30041831C>A			Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|FAM57B_uc002dvu.2_5'Flank	p.V6V	NM_031478	NP_113666	WXS	Illumina HiSeq	Unspecified	Q71RH2	FA57B_HUMAN			1	356	-			6					Q9H0J1	Silent	SNP	ENST00000380495.4	37	c.18G>T	CCDS10667.2																																																																																				0.672	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255142.2	NM_031478		14	22	1	0	7.93312e-07	0.00245	1.09454e-06	14	22				
PRR14	78994	broad.mit.edu	37	16	30667570	30667570	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:30667570G>A	ENST00000542965.2	+	11	2152	c.1696G>A	c.(1696-1698)Gag>Aag	p.E566K	PRR14_ENST00000300835.4_Missense_Mutation_p.E566K|FBRS_ENST00000356166.6_5'Flank			Q9BWN1	PRR14_HUMAN	proline rich 14	566								p.E566K(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			GCGGCTGGAGGAGCTAGATGC	0.642																																							uc002dyy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1696-1698)GAG>AAG		proline rich 14							33.0	39.0	37.0					16																	30667570		2192	4285	6477	SO:0001583	missense	78994							g.chr16:30667570G>A	AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.1696G>A	16.37:g.30667570G>A	ENSP00000441641:p.Glu566Lys		Somatic				PRR14_uc002dyz.2_Missense_Mutation_p.E411K|PRR14_uc002dza.2_Missense_Mutation_p.E566K	p.E566K	NM_024031	NP_076936	WXS	Illumina HiSeq	Unspecified	Q9BWN1	PRR14_HUMAN	Colorectal(24;0.103)		12	1954	+			566					Q8WTX2	Missense_Mutation	SNP	ENST00000542965.2	37	c.1696G>A	CCDS10687.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399031	0.83120	.	.	ENSG00000156858	ENST00000287463;ENST00000300835;ENST00000542965	T;T	0.52526	0.66;0.66	5.98	5.98	0.97165	.	0.060295	0.64402	D	0.000003	T	0.67571	0.2907	M	0.63843	1.955	0.39208	D	0.963262	D	0.89917	1.0	D	0.85130	0.997	T	0.69658	-0.5086	10	0.72032	D	0.01	-14.7425	17.346	0.87309	0.0:0.0:1.0:0.0	.	566	Q9BWN1	PRR14_HUMAN	K	539;566;566	ENSP00000300835:E566K;ENSP00000441641:E566K	ENSP00000287463:E539K	E	+	1	0	PRR14	30575071	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	3.604000	0.54081	2.839000	0.97877	0.650000	0.86243	GAG		0.642	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031		6	72	0	0	0	0.001168	0	6	72				
PRSS36	146547	broad.mit.edu	37	16	31157117	31157117	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:31157117G>C	ENST00000268281.4	-	6	771	c.713C>G	c.(712-714)aCc>aGc	p.T238S	PRSS36_ENST00000569305.1_Missense_Mutation_p.T238S|PRSS36_ENST00000418068.2_Missense_Mutation_p.T238S	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	238	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.T238S(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						CACCTGGCAGGTGTCCCTGCG	0.577																																							uc002ebd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(712-714)ACC>AGC		protease, serine, 36 precursor							66.0	70.0	69.0					16																	31157117		2197	4299	6496	SO:0001583	missense	146547				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity	g.chr16:31157117G>C	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.713C>G	16.37:g.31157117G>C	ENSP00000268281:p.Thr238Ser		Somatic				PRSS36_uc010vff.1_Missense_Mutation_p.T13S|PRSS36_uc010vfg.1_Missense_Mutation_p.T238S|PRSS36_uc010vfh.1_Missense_Mutation_p.T238S	p.T238S	NM_173502	NP_775773	WXS	Illumina HiSeq	Unspecified	Q5K4E3	POLS2_HUMAN			6	772	-			238			Peptidase S1 1.		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	c.713C>G	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983983	0.74474	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.81499	-1.5;-1.5	5.07	4.11	0.48088	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.70263	0.3204	N	0.01874	-0.695	0.32039	N	0.598556	P;D;D	0.76494	0.945;0.999;0.999	P;D;D	0.79784	0.56;0.993;0.992	T	0.64533	-0.6385	9	0.08837	T	0.75	.	10.5339	0.44992	0.0942:0.0:0.9058:0.0	.	238;238;238	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	S	238	ENSP00000268281:T238S;ENSP00000407160:T238S	ENSP00000268281:T238S	T	-	2	0	PRSS36	31064618	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.742000	0.68646	2.368000	0.80403	0.313000	0.20887	ACC		0.577	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502		33	102	0	0	0	0.004289	0	33	102				
BRD7	29117	broad.mit.edu	37	16	50388360	50388360	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:50388360T>C	ENST00000394688.3	-	4	581	c.422A>G	c.(421-423)aAt>aGt	p.N141S	snoU13_ENST00000459559.1_RNA|BRD7_ENST00000394689.2_Missense_Mutation_p.N141S|BRD7_ENST00000401491.3_5'UTR			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	141					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.N141S(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CATCAGTTGATTCAAAGCTTC	0.328																																							uc002egf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)AAT>AGT		bromodomain containing 7							111.0	125.0	120.0					16																	50388360		2197	4297	6494	SO:0001583	missense	29117				cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr16:50388360T>C	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.422A>G	16.37:g.50388360T>C	ENSP00000378180:p.Asn141Ser		Somatic				BRD7_uc002ege.1_Missense_Mutation_p.N141S	p.N141S	NM_013263	NP_037395	WXS	Illumina HiSeq	Unspecified	Q9NPI1	BRD7_HUMAN			5	489	-		all_cancers(37;0.0127)	141					Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	ENST00000394688.3	37	c.422A>G	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	T	12.64	1.999552	0.35320	.	.	ENSG00000166164	ENST00000394688;ENST00000394689;ENST00000401491	T;T	0.26957	1.7;1.7	5.78	4.68	0.58851	Bromodomain (4);	0.083432	0.85682	N	0.000000	T	0.14787	0.0357	N	0.04705	-0.18	0.52501	D	0.999951	B;B	0.26602	0.154;0.127	B;B	0.34452	0.183;0.115	T	0.13072	-1.0523	10	0.23302	T	0.38	-7.2998	11.599	0.50990	0.0:0.0694:0.0:0.9306	.	141;141	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	S	141	ENSP00000378180:N141S;ENSP00000378181:N141S	ENSP00000378180:N141S	N	-	2	0	BRD7	48945861	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.478000	0.45189	1.012000	0.39366	0.533000	0.62120	AAT		0.328	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263		31	328	0	0	0	0.001512	0	31	328				
BCAR1	9564	broad.mit.edu	37	16	75269174	75269174	+	Silent	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:75269174A>T	ENST00000162330.5	-	5	1749	c.1623T>A	c.(1621-1623)ctT>ctA	p.L541L	BCAR1_ENST00000542031.2_Silent_p.L539L|BCAR1_ENST00000420641.3_Silent_p.L559L|BCAR1_ENST00000538440.2_Silent_p.L541L|BCAR1_ENST00000546196.1_Silent_p.L512L|BCAR1_ENST00000393422.2_Silent_p.L559L|BCAR1_ENST00000393420.6_Silent_p.L559L|BCAR1_ENST00000535626.2_Silent_p.L393L|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000418647.3_Silent_p.L587L	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	541	Ser-rich.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.L559L(1)|p.L587L(1)|p.L541L(1)		breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCTGCCGGCTAAGCTTGGCAT	0.662																																							uc002fdv.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(5)|breast(2)|prostate(1)	8						c.(1621-1623)CTT>CTA		breast cancer anti-estrogen resistance 1							37.0	39.0	38.0					16																	75269174		2198	4299	6497	SO:0001819	synonymous_variant	9564				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity	g.chr16:75269174A>T	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.1623T>A	16.37:g.75269174A>T			Somatic				BCAR1_uc002fdt.2_5'UTR|BCAR1_uc002fdu.2_Silent_p.L331L|BCAR1_uc010cgu.2_Silent_p.L530L|BCAR1_uc010vna.1_Silent_p.L539L|BCAR1_uc010vnb.1_Silent_p.L587L|BCAR1_uc002fdw.2_Silent_p.L541L|BCAR1_uc010vnc.1_Silent_p.L393L|BCAR1_uc010vnd.1_Silent_p.L559L|BCAR1_uc002fdx.2_Silent_p.L559L	p.L541L	NM_014567	NP_055382	WXS	Illumina HiSeq	Unspecified	P56945	BCAR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	5	1746	-			541			Ser-rich.		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	ENST00000162330.5	37	c.1623T>A	CCDS10915.1																																																																																				0.662	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567		14	33	0	0	0	0.003163	0	14	33				
KLHDC4	54758	broad.mit.edu	37	16	87743082	87743082	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr16:87743082C>A	ENST00000270583.5	-	10	1294	c.1236G>T	c.(1234-1236)cgG>cgT	p.R412R	KLHDC4_ENST00000347925.5_Silent_p.R381R|KLHDC4_ENST00000353170.5_Silent_p.R355R|KLHDC4_ENST00000566349.1_5'UTR	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	412								p.R412R(1)		breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CGTCCTCAGACCGGGGCTGCC	0.682																																							uc002fki.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)	2						c.(1234-1236)CGG>CGT		kelch domain containing 4							32.0	34.0	33.0					16																	87743082		2197	4298	6495	SO:0001819	synonymous_variant	54758							g.chr16:87743082C>A	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.1236G>T	16.37:g.87743082C>A			Somatic				KLHDC4_uc002fkh.1_RNA|KLHDC4_uc010cht.1_Intron|KLHDC4_uc002fkj.2_Silent_p.R381R|KLHDC4_uc002fkk.2_Silent_p.R231R|KLHDC4_uc002fkl.2_Silent_p.R355R|KLHDC4_uc010chu.1_Silent_p.R231R	p.R412R	NM_017566	NP_060036	WXS	Illumina HiSeq	Unspecified	Q8TBB5	KLDC4_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0283)	10	1282	-			412					D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Silent	SNP	ENST00000270583.5	37	c.1236G>T	CCDS10963.1																																																																																				0.682	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566		7	15	1	0	0.000274275	0.004482	0.000348147	7	15				
MYOCD	93649	broad.mit.edu	37	17	12666716	12666716	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:12666716C>G	ENST00000343344.4	+	13	2572	c.2572C>G	c.(2572-2574)Cca>Gca	p.P858A	RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000425538.1_Missense_Mutation_p.P906A			Q8IZQ8	MYCD_HUMAN	myocardin	858					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.P858A(1)|p.P906A(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TGAGATCTTGCCAGGCCCCCT	0.498																																							uc002gnn.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)	5						c.(2572-2574)CCA>GCA		myocardin isoform 2							84.0	70.0	75.0					17																	12666716		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12666716C>G	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2572C>G	17.37:g.12666716C>G	ENSP00000341835:p.Pro858Ala		Somatic				MYOCD_uc002gno.2_Missense_Mutation_p.P906A|MYOCD_uc002gnq.2_Missense_Mutation_p.P582A	p.P858A	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	13	2871	+			858					Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.2572C>G	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255177	0.39896	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.40476	1.03;1.03	6.08	6.08	0.98989	.	0.338675	0.32444	N	0.006100	T	0.41259	0.1151	L	0.44542	1.39	0.80722	D	1	P;P;P	0.52692	0.86;0.955;0.495	B;P;B	0.46026	0.243;0.501;0.084	T	0.07578	-1.0765	10	0.28530	T	0.3	-22.5077	14.9782	0.71293	0.0:0.8575:0.1425:0.0	.	582;906;858	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	A	582;906;858;568	ENSP00000341835:P858A;ENSP00000400148:P568A	ENSP00000341835:P858A	P	+	1	0	MYOCD	12607441	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	3.073000	0.50057	2.894000	0.99253	0.655000	0.94253	CCA		0.498	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		6	61	0	0	0	0.001168	0	6	61				
KRT35	3886	broad.mit.edu	37	17	39633867	39633867	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:39633867G>A	ENST00000393989.1	-	6	1165	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	KRT35_ENST00000246639.2_Missense_Mutation_p.R345W	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	375	Coil 2.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R375W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				TGGTTCTGCCGCTCCAGGTCA	0.652																																							uc002hws.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1123-1125)CGG>TGG		keratin 35							66.0	65.0	65.0					17																	39633867		2203	4300	6503	SO:0001583	missense	3886				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity	g.chr17:39633867G>A	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.1123C>T	17.37:g.39633867G>A	ENSP00000377558:p.Arg375Trp		Somatic					p.R375W	NM_002280	NP_002271	WXS	Illumina HiSeq	Unspecified	Q92764	KRT35_HUMAN			6	1166	-		Breast(137;0.000286)	375			Rod.|Coil 2.		O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	c.1123C>T	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598254	0.66332	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.90444	-2.67;-2.67	4.95	2.92	0.33932	Filament (1);	0.000000	0.56097	D	0.000034	D	0.95765	0.8622	H	0.96048	3.76	0.39007	D	0.959469	D	0.89917	1.0	D	0.97110	1.0	D	0.93823	0.7120	10	0.87932	D	0	.	4.6448	0.12566	0.1626:0.0:0.4112:0.4262	.	375	Q92764	KRT35_HUMAN	W	345;375	ENSP00000246639:R345W;ENSP00000377558:R375W	ENSP00000246639:R345W	R	-	1	2	KRT35	36887393	0.150000	0.22732	1.000000	0.80357	0.825000	0.46686	0.469000	0.22067	0.648000	0.30732	0.563000	0.77884	CGG		0.652	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280		7	97	0	0	0	0.001984	0	7	97				
NFE2L1	4779	broad.mit.edu	37	17	46128597	46128597	+	Silent	SNP	C	C	T	rs141933946	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:46128597C>T	ENST00000362042.3	+	2	733	c.117C>T	c.(115-117)ctC>ctT	p.L39L	NFE2L1_ENST00000357480.5_Silent_p.L39L|NFE2L1_ENST00000585291.1_Silent_p.L39L|NFE2L1_ENST00000361665.3_Silent_p.L39L	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	39					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.L39L(1)		cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCCCCCACTCCGGGAGATCA	0.522													C|||	6	0.00119808	0.0038	0.0014	5008	,	,		17978	0.0		0.0	False		,,,				2504	0.0						uc002imz.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(115-117)CTC>CTT		nuclear factor erythroid 2-like 1		C		66,4340	61.7+/-98.7	0,66,2137	102.0	98.0	99.0		117	-1.4	1.0	17	dbSNP_134	99	0,8600		0,0,4300	no	coding-synonymous	NFE2L1	NM_003204.2		0,66,6437	TT,TC,CC		0.0,1.498,0.5075		39/773	46128597	66,12940	2203	4300	6503	SO:0001819	synonymous_variant	4779				anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr17:46128597C>T	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.117C>T	17.37:g.46128597C>T			Somatic				NFE2L1_uc002ina.3_Silent_p.L39L|NFE2L1_uc002inb.3_Silent_p.L39L|NFE2L1_uc002inc.1_Silent_p.L39L	p.L39L	NM_003204	NP_003195	WXS	Illumina HiSeq	Unspecified	Q14494	NF2L1_HUMAN			2	768	+			39					D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	ENST00000362042.3	37	c.117C>T	CCDS11524.1																																																																																				0.522	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204		38	109	0	0	0	0.00623	0	38	109				
SPAG9	9043	broad.mit.edu	37	17	49079164	49079164	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:49079164C>G	ENST00000262013.7	-	13	1727	c.1519G>C	c.(1519-1521)Gaa>Caa	p.E507Q	SPAG9_ENST00000510283.1_Missense_Mutation_p.E350Q|SPAG9_ENST00000505279.1_Missense_Mutation_p.E493Q|SPAG9_ENST00000357122.4_Missense_Mutation_p.E493Q	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	507					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.E493Q(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CGGGCCATTTCTACTCTAGTA	0.413																																							uc002itc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|breast(1)	5						c.(1519-1521)GAA>CAA		sperm associated antigen 9 isoform 1							142.0	129.0	133.0					17																	49079164		2203	4300	6503	SO:0001583	missense	9043				positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm		g.chr17:49079164C>G	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1519G>C	17.37:g.49079164C>G	ENSP00000262013:p.Glu507Gln		Somatic				SPAG9_uc002itb.2_Missense_Mutation_p.E493Q|SPAG9_uc002itd.2_Missense_Mutation_p.E493Q|SPAG9_uc002itf.2_Missense_Mutation_p.E328Q|SPAG9_uc002ita.2_Missense_Mutation_p.E350Q|SPAG9_uc002ite.2_Missense_Mutation_p.E337Q	p.E507Q	NM_001130528	NP_001124000	WXS	Illumina HiSeq	Unspecified	O60271	JIP4_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.24e-07)		13	1728	-			507			Potential.		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	c.1519G>C	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553296	0.96501	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;0.999;1.0	D	0.86718	0.1940	10	0.87932	D	0	-24.2784	20.1467	0.98079	0.0:1.0:0.0:0.0	.	493;507;493;507;493;350	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	Q	507;263;249;350;493;493;105	ENSP00000262013:E507Q;ENSP00000423165:E350Q;ENSP00000426900:E493Q;ENSP00000349636:E493Q	ENSP00000262013:E507Q	E	-	1	0	SPAG9	46434163	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.838000	0.97847	0.655000	0.94253	GAA		0.413	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971		12	89	0	0	0	0.001855	0	12	89				
INTS2	57508	broad.mit.edu	37	17	59967149	59967149	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:59967149A>G	ENST00000444766.3	-	15	2081	c.2006T>C	c.(2005-2007)tTa>tCa	p.L669S	INTS2_ENST00000251334.6_Missense_Mutation_p.L661S	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	669					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)		p.L669S(1)		NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CAACTTACCTAAAGTCTTCGT	0.368																																							uc002izn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(2005-2007)TTA>TCA		integrator complex subunit 2							83.0	79.0	80.0					17																	59967149		1881	4113	5994	SO:0001583	missense	57508				snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding	g.chr17:59967149A>G	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2006T>C	17.37:g.59967149A>G	ENSP00000414237:p.Leu669Ser		Somatic				INTS2_uc002izm.2_Missense_Mutation_p.L661S	p.L669S	NM_020748	NP_065799	WXS	Illumina HiSeq	Unspecified	Q9H0H0	INT2_HUMAN			15	2082	-			669					Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	c.2006T>C	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	A	19.85	3.903785	0.72754	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.46819	0.86	5.42	5.42	0.78866	.	0.127432	0.52532	D	0.000061	T	0.65502	0.2697	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.65183	-0.6230	9	.	.	.	-6.53	14.9199	0.70829	1.0:0.0:0.0:0.0	.	669	Q9H0H0	INT2_HUMAN	S	669;668	ENSP00000414237:L669S	.	L	-	2	0	INTS2	57321931	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	8.184000	0.89702	2.183000	0.69458	0.397000	0.26171	TTA		0.368	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		7	11	0	0	0	0.001984	0	7	11				
RHBDF2	79651	broad.mit.edu	37	17	74473792	74473792	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:74473792C>A	ENST00000313080.4	-	7	1108	c.835G>T	c.(835-837)Gag>Tag	p.E279*	RHBDF2_ENST00000591885.1_Nonsense_Mutation_p.E250*|RHBDF2_ENST00000389760.4_Nonsense_Mutation_p.E250*|RHBDF2_ENST00000592378.1_5'Flank	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	279					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.E279*(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						ACATCCTCCTCCAGGAAGCTC	0.637																																							uc002jrq.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(835-837)GAG>TAG		rhomboid, veinlet-like 6 isoform 1							134.0	101.0	113.0					17																	74473792		2203	4300	6503	SO:0001587	stop_gained	79651				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity	g.chr17:74473792C>A	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.835G>T	17.37:g.74473792C>A	ENSP00000322775:p.Glu279*		Somatic				RHBDF2_uc002jrp.1_Nonsense_Mutation_p.E250*|RHBDF2_uc002jrr.1_Nonsense_Mutation_p.E131*|RHBDF2_uc010wtf.1_Nonsense_Mutation_p.E250*|RHBDF2_uc002jrs.1_Nonsense_Mutation_p.E274*	p.E279*	NM_024599	NP_078875	WXS	Illumina HiSeq	Unspecified	Q6PJF5	RHDF2_HUMAN			7	1128	-			279			Cytoplasmic (Potential).		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Nonsense_Mutation	SNP	ENST00000313080.4	37	c.835G>T	CCDS32743.1	.	.	.	.	.	.	.	.	.	.	C	40	8.401213	0.98796	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	.	.	.	5.43	5.43	0.79202	.	0.329251	0.33253	N	0.005104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-24.0744	19.233	0.93847	0.0:1.0:0.0:0.0	.	.	.	.	X	279;250;225	.	ENSP00000322775:E279X	E	-	1	0	RHBDF2	71985387	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.487000	0.81328	2.538000	0.85594	0.491000	0.48974	GAG		0.637	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599		49	76	1	0	9.45407e-15	0.00361	1.60147e-14	49	76				
ENPP7	339221	broad.mit.edu	37	17	77709206	77709206	+	Missense_Mutation	SNP	G	G	A	rs372623650		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:77709206G>A	ENST00000328313.5	+	3	985	c.764G>A	c.(763-765)cGg>cAg	p.R255Q		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.R255Q(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTGGACAAACGGGCTGGCGAC	0.597																																							uc002jxa.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(763-765)CGG>CAG		ectonucleotide pyrophosphatase/phosphodiesterase		G	GLN/ARG	0,4406		0,0,2203	125.0	98.0	107.0		764	-10.8	0.0	17		107	1,8599	1.2+/-3.3	0,1,4299	no	missense	ENPP7	NM_178543.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	255/459	77709206	1,13005	2203	4300	6503	SO:0001583	missense	339221				negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity	g.chr17:77709206G>A	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.764G>A	17.37:g.77709206G>A	ENSP00000332656:p.Arg255Gln		Somatic					p.R255Q	NM_178543	NP_848638	WXS	Illumina HiSeq	Unspecified	Q6UWV6	ENPP7_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		3	784	+			255						Missense_Mutation	SNP	ENST00000328313.5	37	c.764G>A	CCDS11763.1	.	.	.	.	.	.	.	.	.	.	G	2.267	-0.367982	0.05069	0.0	1.16E-4	ENSG00000182156	ENST00000328313	T	0.73469	-0.75	5.39	-10.8	0.00216	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	1.684540	0.03255	N	0.182384	T	0.54046	0.1834	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.22753	0.041	T	0.50197	-0.8856	10	0.20519	T	0.43	-0.2839	12.7312	0.57199	0.21:0.6078:0.1822:0.0	.	255	Q6UWV6	ENPP7_HUMAN	Q	255	ENSP00000332656:R255Q	ENSP00000332656:R255Q	R	+	2	0	ENPP7	75323801	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.007000	0.01457	-3.492000	0.00153	-1.004000	0.02495	CGG		0.597	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		24	57	0	0	0	0.001512	0	24	57				
AATK	9625	broad.mit.edu	37	17	79094822	79094822	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:79094822C>G	ENST00000326724.4	-	11	2938	c.2914G>C	c.(2914-2916)Ggc>Cgc	p.G972R	AATK_ENST00000417379.1_Missense_Mutation_p.G869R	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	972					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.G972R(2)		endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GGCCCGGGGCCCTCACCCTCT	0.622																																							uc010dia.2		NA																	2	Substitution - Missense(2)		lung(2)	stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9						c.(2914-2916)GGC>CGC		apoptosis-associated tyrosine kinase							18.0	22.0	21.0					17																	79094822		1924	4113	6037	SO:0001583	missense	9625					integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:79094822C>G	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.2914G>C	17.37:g.79094822C>G	ENSP00000324196:p.Gly972Arg		Somatic				AATK_uc010dhz.2_Intron	p.G972R	NM_001080395	NP_001073864	WXS	Illumina HiSeq	Unspecified	Q6ZMQ8	LMTK1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)		11	2994	-	all_neural(118;0.101)		972					O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	c.2914G>C	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.401|0.401	-0.918218|-0.918218	0.02396|0.02396	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000326724|ENST00000417379	T|.	0.12984|.	2.63|.	4.98|4.98	2.76|2.76	0.32466|0.32466	.|.	1.249090|.	0.05187|.	N|.	0.502431|.	T|T	0.22437|0.22437	0.0541|0.0541	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|.	0.14805|.	0.011|.	B|.	0.11329|.	0.006|.	T|T	0.19582|0.19582	-1.0301|-1.0301	10|5	0.52906|.	T|.	0.07|.	.|.	3.7285|3.7285	0.08484|0.08484	0.157:0.258:0.0:0.5851|0.157:0.258:0.0:0.5851	.|.	972|.	Q6ZMQ8|.	LMTK1_HUMAN|.	R|S	972|924	ENSP00000324196:G972R|.	ENSP00000324196:G972R|.	G|R	-|-	1|3	0|2	AATK|AATK	76709417|76709417	0.000000|0.000000	0.05858|0.05858	0.119000|0.119000	0.21687|0.21687	0.020000|0.020000	0.10135|0.10135	0.703000|0.703000	0.25646|0.25646	0.744000|0.744000	0.32741|0.32741	-0.379000|-0.379000	0.06801|0.06801	GGC|AGG		0.622	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920		5	16	0	0	0	0.001168	0	5	16				
NARF	26502	broad.mit.edu	37	17	80436742	80436742	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr17:80436742C>T	ENST00000309794.11	+	6	785	c.587C>T	c.(586-588)tCc>tTc	p.S196F	RP13-991F5.2_ENST00000582249.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.S196F|NARF_ENST00000345415.7_Missense_Mutation_p.S148F|NARF_ENST00000390006.4_Missense_Mutation_p.S137F|NARF_ENST00000581743.1_3'UTR|NARF_ENST00000412079.2_Missense_Mutation_p.S68F	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	196						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.S196F(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			ACCGCCAAGTCCCCCCAGCAG	0.627																																							uc002kfg.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(586-588)TCC>TTC		nuclear prelamin A recognition factor isoform a							44.0	42.0	43.0					17																	80436742		2203	4300	6503	SO:0001583	missense	26502					lamin filament	lamin binding	g.chr17:80436742C>T	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.587C>T	17.37:g.80436742C>T	ENSP00000309899:p.Ser196Phe		Somatic				NARF_uc002kff.3_Missense_Mutation_p.S137F|NARF_uc010wvo.1_Missense_Mutation_p.S151F|NARF_uc010wvp.1_Missense_Mutation_p.S68F|NARF_uc010dit.2_Missense_Mutation_p.S196F|NARF_uc002kfj.3_Missense_Mutation_p.S148F|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Missense_Mutation_p.S196F|NARF_uc002kfk.2_RNA	p.S196F	NM_012336	NP_036468	WXS	Illumina HiSeq	Unspecified	Q9UHQ1	NARF_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)		6	727	+	Breast(20;0.00106)|all_neural(118;0.0804)		196					A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	c.587C>T	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640610	0.47153	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52	5.57	4.59	0.56863	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.89518	0.6738	H	0.97806	4.08	0.80722	D	1	D;B;P;B;P;P	0.76494	0.999;0.179;0.769;0.296;0.806;0.593	D;B;P;B;P;B	0.71656	0.974;0.33;0.447;0.222;0.582;0.443	D	0.93202	0.6592	10	0.87932	D	0	-21.8397	14.7635	0.69621	0.1457:0.8543:0.0:0.0	.	68;151;196;148;196;196	B4DZZ6;B4DND8;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;.;NARF_HUMAN	F	137;196;196;148;68;151	ENSP00000374656:S137F;ENSP00000363739:S196F;ENSP00000309899:S196F;ENSP00000283996:S148F;ENSP00000409710:S68F	ENSP00000309899:S196F	S	+	2	0	NARF	78030031	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.541000	0.67212	1.328000	0.45358	0.561000	0.74099	TCC		0.627	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968		14	33	0	0	0	0.001855	0	14	33				
AFG3L2	10939	broad.mit.edu	37	18	12356752	12356752	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:12356752A>G	ENST00000269143.3	-	9	1336	c.1105T>C	c.(1105-1107)Ttc>Ctc	p.F369L		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	369					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.F369L(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	ACGGTGATGAAGGGGACATTG	0.512																																							uc002kqz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1105-1107)TTC>CTC		AFG3 ATPase family gene 3-like 2	Adenosine triphosphate(DB00171)						166.0	124.0	138.0					18																	12356752		2203	4300	6503	SO:0001583	missense	10939				cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	g.chr18:12356752A>G	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1105T>C	18.37:g.12356752A>G	ENSP00000269143:p.Phe369Leu		Somatic					p.F369L	NM_006796	NP_006787	WXS	Illumina HiSeq	Unspecified	Q9Y4W6	AFG32_HUMAN			9	1218	-			369					Q6P1L0	Missense_Mutation	SNP	ENST00000269143.3	37	c.1105T>C	CCDS11859.1	.	.	.	.	.	.	.	.	.	.	A	34	5.360873	0.95877	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	D	0.93307	-3.2	5.28	5.28	0.74379	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.95207	0.8446	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95800	0.8832	10	0.87932	D	0	.	15.5097	0.75769	1.0:0.0:0.0:0.0	.	369	Q9Y4W6	AFG32_HUMAN	L	369;384	ENSP00000269143:F369L	ENSP00000269143:F369L	F	-	1	0	AFG3L2	12346752	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.287000	0.95975	2.126000	0.65437	0.460000	0.39030	TTC		0.512	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796		3	67	0	0	0	0.004672	0	3	67				
CEP192	55125	broad.mit.edu	37	18	13087217	13087217	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:13087217G>C	ENST00000325971.8	+	29	5623	c.4030G>C	c.(4030-4032)Gat>Cat	p.D1344H	CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000506447.1_Missense_Mutation_p.D1940H|CEP192_ENST00000430049.2_Missense_Mutation_p.D1465H			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1344					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.D1940H(1)|p.D1344H(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AGTTTTGCTGGATCCTAAAGT	0.343																																							uc010xac.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(5818-5820)GAT>CAT		centrosomal protein 192kDa							45.0	50.0	48.0					18																	13087217		2203	4295	6498	SO:0001583	missense	55125							g.chr18:13087217G>C	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4030G>C	18.37:g.13087217G>C	ENSP00000317156:p.Asp1344His		Somatic				CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.D1465H|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.D362H|CEP192_uc002krw.2_Missense_Mutation_p.D89H|CEP192_uc002krx.2_5'UTR|CEP192_uc002kry.2_5'Flank	p.D1940H	NM_032142	NP_115518	WXS	Illumina HiSeq	Unspecified	E9PF99	E9PF99_HUMAN			31	5898	+			1940					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.5818G>C		.	.	.	.	.	.	.	.	.	.	G	20.3	3.969224	0.74246	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.43294	0.95;0.95;0.95	5.5	4.62	0.57501	.	0.058380	0.64402	D	0.000002	T	0.62792	0.2457	M	0.70275	2.135	0.80722	D	1	D;P;D	0.76494	0.999;0.941;0.999	D;P;D	0.71870	0.975;0.547;0.918	T	0.67658	-0.5614	10	0.87932	D	0	-21.1339	14.6635	0.68891	0.0704:0.0:0.9296:0.0	.	1465;1940;542	C9JT09;E9PF99;Q9HCK3	.;.;.	H	1940;1344;1344;1465	ENSP00000427550:D1940H;ENSP00000317156:D1344H;ENSP00000389190:D1465H	ENSP00000317156:D1344H	D	+	1	0	CEP192	13077217	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	4.315000	0.59172	1.313000	0.45069	0.650000	0.86243	GAT		0.343	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		3	72	0	0	0	0.004672	0	3	72				
MIB1	57534	broad.mit.edu	37	18	19345792	19345792	+	Nonsense_Mutation	SNP	C	C	T	rs151095403		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:19345792C>T	ENST00000261537.6	+	2	553	c.289C>T	c.(289-291)Cga>Tga	p.R97*	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	97					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R97*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			CATTGGCATTCGATGGAAGTG	0.393																																							uc002ktq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)	4						c.(289-291)CGA>TGA		mindbomb homolog 1		C	stop/ARG	0,4406		0,0,2203	144.0	128.0	134.0		289	4.9	1.0	18	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	MIB1	NM_020774.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		97/1007	19345792	1,13005	2203	4300	6503	SO:0001587	stop_gained	57534				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr18:19345792C>T	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.289C>T	18.37:g.19345792C>T	ENSP00000261537:p.Arg97*		Somatic				MIB1_uc002ktp.2_5'UTR	p.R97*	NM_020774	NP_065825	WXS	Illumina HiSeq	Unspecified	Q86YT6	MIB1_HUMAN	STAD - Stomach adenocarcinoma(5;0.212)		2	289	+			97			ZZ-type.		B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Nonsense_Mutation	SNP	ENST00000261537.6	37	c.289C>T	CCDS11871.1	.	.	.	.	.	.	.	.	.	.	C	39	7.720263	0.98453	0.0	1.16E-4	ENSG00000101752	ENST00000261537	.	.	.	5.79	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1526	16.0383	0.80645	0.1355:0.8645:0.0:0.0	.	.	.	.	X	97	.	ENSP00000261537:R97X	R	+	1	2	MIB1	17599790	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.764000	0.55264	1.415000	0.47037	0.591000	0.81541	CGA		0.393	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774		12	61	0	0	0	0.001368	0	12	61				
CTAGE1	64693	broad.mit.edu	37	18	19997690	19997690	+	5'Flank	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:19997690A>G	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Silent_p.L29L			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)		p.L29L(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					CTTCTCCACAAGAAGAGAACA	0.408																																							uc002ktv.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(85-87)TTG>CTG		cutaneous T-cell lymphoma-associated antigen 1							84.0	78.0	80.0					18																	19997690		2203	4300	6503	SO:0001631	upstream_gene_variant	64693					integral to membrane		g.chr18:19997690A>G	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997690A>G	Exception_encountered		Somatic					p.L29L	NM_172241	NP_758441	WXS	Illumina HiSeq	Unspecified	Q96RT6	CTGE2_HUMAN			1	189	-	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)		29			Helical; (Potential).		B0YIZ3	Silent	SNP	ENST00000525417.1	37	c.85T>C																																																																																					0.408	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		13	38	0	0	0	0.001368	0	13	38				
ASXL3	80816	broad.mit.edu	37	18	31324042	31324042	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:31324042C>A	ENST00000269197.5	+	12	4230	c.4230C>A	c.(4228-4230)caC>caA	p.H1410Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H1410Q(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGGTTGCACACCCGACCGTCG	0.498											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010dmg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4228-4230)CAC>CAA		additional sex combs like 3							132.0	134.0	134.0					18																	31324042		1984	4161	6145	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31324042C>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4230C>A	18.37:g.31324042C>A	ENSP00000269197:p.His1410Gln		Somatic	OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	823	ASXL3_uc002kxq.2_Missense_Mutation_p.H1117Q	p.H1410Q	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	4285	+			1410					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.4230C>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	4.011	-0.000599	0.07819	.	.	ENSG00000141431	ENST00000269197	T	0.13196	2.61	6.17	1.39	0.22231	.	.	.	.	.	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B	0.23735	0.09	B	0.14023	0.01	T	0.38178	-0.9673	9	0.37606	T	0.19	.	3.6675	0.08261	0.1016:0.5026:0.2624:0.1334	.	1410	Q9C0F0	ASXL3_HUMAN	Q	1410	ENSP00000269197:H1410Q	ENSP00000269197:H1410Q	H	+	3	2	ASXL3	29578040	0.825000	0.29262	0.213000	0.23690	0.214000	0.24535	-0.016000	0.12613	-0.029000	0.13827	0.655000	0.94253	CAC		0.498	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			48	158	1	0	5.7616e-29	0.00361	1.12398e-28	48	158				
CELF4	56853	broad.mit.edu	37	18	34850743	34850743	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr18:34850743G>T	ENST00000591282.1	-	8	1086	c.1087C>A	c.(1087-1089)Cac>Aac	p.H363N	CELF4_ENST00000334919.5_Missense_Mutation_p.H353N|CELF4_ENST00000603232.1_Missense_Mutation_p.H362N|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000420428.2_Missense_Mutation_p.H363N|CELF4_ENST00000601019.1_Missense_Mutation_p.H361N|CELF4_ENST00000412753.1_Missense_Mutation_p.H362N|CELF4_ENST00000588597.1_Missense_Mutation_p.H352N|CELF4_ENST00000361795.5_Missense_Mutation_p.H361N|CELF4_ENST00000591287.1_Missense_Mutation_p.H362N			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	363					alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.H363N(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						GGGTAGGGGTGGATGCCATTG	0.557																																							uc002lae.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1087-1089)CAC>AAC		bruno-like 4, RNA binding protein isoform 1							105.0	88.0	94.0					18																	34850743		2203	4300	6503	SO:0001583	missense	56853				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding	g.chr18:34850743G>T	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.1087C>A	18.37:g.34850743G>T	ENSP00000464794:p.His363Asn		Somatic				CELF4_uc010dnd.1_Missense_Mutation_p.H361N|CELF4_uc002lag.2_Missense_Mutation_p.H353N|CELF4_uc002laf.2_Missense_Mutation_p.H358N|CELF4_uc002lai.2_Missense_Mutation_p.H348N|CELF4_uc002lah.1_Missense_Mutation_p.H88N	p.H363N	NM_020180	NP_064565	WXS	Illumina HiSeq	Unspecified	Q9BZC1	CELF4_HUMAN			8	1483	-			363					Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	ENST00000591282.1	37	c.1087C>A	CCDS32818.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438612	0.62955	.	.	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919	T;T	0.73897	-0.72;-0.79	4.66	4.66	0.58398	.	0.115661	0.64402	D	0.000012	D	0.83298	0.5224	M	0.67953	2.075	0.80722	D	1	P;P;P;D;P;P	0.54601	0.523;0.67;0.908;0.967;0.871;0.786	B;B;D;P;P;P	0.64144	0.358;0.244;0.922;0.84;0.609;0.449	T	0.81145	-0.1066	10	0.27785	T	0.31	-13.9865	17.7309	0.88377	0.0:0.0:1.0:0.0	.	361;352;88;353;362;363	Q9BZC1-3;B4DHA8;A0PK06;Q9BZC1-5;Q9BZC1-2;Q9BZC1	.;.;.;.;.;CELF4_HUMAN	N	363;362;361;353	ENSP00000406823:H362N;ENSP00000335631:H353N	ENSP00000335631:H353N	H	-	1	0	CELF4	33104741	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.263000	0.95617	2.409000	0.81822	0.557000	0.71058	CAC		0.557	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180		22	72	1	0	1.9806e-07	0.002299	2.83113e-07	22	72				
GPR108	56927	broad.mit.edu	37	19	6731116	6731116	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:6731116C>T	ENST00000264080.7	-	17	1467	c.1441G>A	c.(1441-1443)Gtg>Atg	p.V481M	GPR108_ENST00000598626.1_Intron|GPR108_ENST00000430424.4_Missense_Mutation_p.V239M	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	481						integral component of membrane (GO:0016021)		p.V481M(1)		breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						GAGCCCTCCACCAAGAGCTGG	0.701																																							uc002mfp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1441-1443)GTG>ATG		G protein-coupled receptor 108 isoform 1							40.0	45.0	44.0					19																	6731116		1964	4146	6110	SO:0001583	missense	56927					integral to membrane		g.chr19:6731116C>T		CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.1441G>A	19.37:g.6731116C>T	ENSP00000264080:p.Val481Met		Somatic				GPR108_uc010duv.2_Missense_Mutation_p.V32M|GPR108_uc002mfn.2_Missense_Mutation_p.V136M|GPR108_uc002mfo.3_Missense_Mutation_p.V239M|GPR108_uc010duw.2_RNA	p.V481M	NM_001080452	NP_001073921	WXS	Illumina HiSeq	Unspecified	Q9NPR9	GP108_HUMAN			17	1487	-			481			Helical; Name=7; (Potential).		B9EJD7	Missense_Mutation	SNP	ENST00000264080.7	37	c.1441G>A	CCDS42479.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307362	0.40795	.	.	ENSG00000125734	ENST00000548402;ENST00000264080;ENST00000550472;ENST00000430424	T	0.23950	1.88	3.91	2.85	0.33270	.	0.093490	0.42420	U	0.000706	T	0.38026	0.1025	L	0.47016	1.485	0.39939	D	0.974389	P;B	0.51933	0.949;0.281	P;P	0.61874	0.895;0.489	T	0.12142	-1.0559	10	0.48119	T	0.1	-8.1186	11.0914	0.48119	0.0:0.8101:0.1899:0.0	.	481;239	Q9NPR9;B9EK73	GP108_HUMAN;.	M	73;481;115;239	ENSP00000264080:V481M	ENSP00000264080:V481M	V	-	1	0	GPR108	6682116	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	3.317000	0.51968	0.618000	0.30179	0.305000	0.20034	GTG		0.701	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2			6	39	0	0	0	0.001984	0	6	39				
FCER2	2208	broad.mit.edu	37	19	7754258	7754258	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:7754258G>A	ENST00000346664.5	-	11	999	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	FCER2_ENST00000597921.1_Missense_Mutation_p.R263W|FCER2_ENST00000360067.4_Missense_Mutation_p.R262W	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	263	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)	p.R263W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						CCGGAGCCCCGCATCATCACG	0.687																																							uc002mhn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(787-789)CGG>TGG		Fc fragment of IgE, low affinity II, receptor							12.0	13.0	13.0					19																	7754258		2197	4289	6486	SO:0001583	missense	2208				positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding	g.chr19:7754258G>A	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.787C>T	19.37:g.7754258G>A	ENSP00000264072:p.Arg263Trp		Somatic				FCER2_uc010xjs.1_Missense_Mutation_p.R185W|FCER2_uc010xjt.1_Missense_Mutation_p.R185W|FCER2_uc002mhm.2_Missense_Mutation_p.R263W	p.R263W	NM_002002	NP_001993	WXS	Illumina HiSeq	Unspecified	P06734	FCER2_HUMAN			11	971	-			263			C-type lectin.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000346664.5	37	c.787C>T	CCDS12184.1	.	.	.	.	.	.	.	.	.	.	g	6.660	0.490377	0.12702	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.17370	2.28;2.28	3.81	1.57	0.23409	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.22322	0.0538	L	0.28740	0.885	0.25377	N	0.988646	D	0.76494	0.999	D	0.63793	0.918	T	0.10428	-1.0630	9	0.66056	D	0.02	.	4.759	0.13099	0.1177:0.0:0.6715:0.2108	.	263	P06734	FCER2_HUMAN	W	263;262	ENSP00000264072:R263W;ENSP00000353178:R262W	ENSP00000264072:R263W	R	-	1	2	FCER2	7660258	0.342000	0.24809	0.267000	0.24556	0.021000	0.10359	0.440000	0.21592	0.123000	0.18342	-1.576000	0.00868	CGG		0.687	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002		5	14	0	0	0	0.000602	0	5	14				
HNRNPM	4670	broad.mit.edu	37	19	8550609	8550609	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:8550609G>A	ENST00000325495.4	+	14	1338	c.1297G>A	c.(1297-1299)Gag>Aag	p.E433K	HNRNPM_ENST00000348943.3_Missense_Mutation_p.E394K	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	433	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)	p.E433K(1)|p.E433Q(1)		endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CGTGGGCTCCGAGATCGAGCG	0.706																																							uc010dwe.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1297-1299)GAG>AAG		heterogeneous nuclear ribonucleoprotein M							71.0	77.0	75.0					19																	8550609		2203	4298	6501	SO:0001583	missense	4670				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding	g.chr19:8550609G>A	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1297G>A	19.37:g.8550609G>A	ENSP00000325376:p.Glu433Lys		Somatic				HNRNPM_uc010xke.1_Missense_Mutation_p.E379K|HNRNPM_uc010dwd.2_Missense_Mutation_p.E394K|HNRNPM_uc002mka.2_Missense_Mutation_p.E298K|HNRNPM_uc002mkb.1_5'Flank	p.E433K	NM_005968	NP_005959	WXS	Illumina HiSeq	Unspecified	P52272	HNRPM_HUMAN			14	1377	+			433			5.|27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	c.1297G>A	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.876390	0.33162	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159	T;T	0.14266	2.52;2.84	5.76	4.72	0.59763	.	0.146836	0.64402	D	0.000008	T	0.11452	0.0279	L	0.51422	1.61	0.43608	D	0.995975	B;P;B;B	0.42556	0.449;0.783;0.196;0.032	B;B;B;B	0.24974	0.029;0.057;0.021;0.005	T	0.08452	-1.0721	10	0.33940	T	0.23	.	15.5711	0.76337	0.0:0.1385:0.8615:0.0	.	273;433;394;318	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	K	433;394;318	ENSP00000325376:E433K;ENSP00000325732:E394K	ENSP00000325376:E433K	E	+	1	0	HNRNPM	8456609	1.000000	0.71417	0.359000	0.25824	0.968000	0.65278	4.866000	0.63005	1.430000	0.47334	0.491000	0.48974	GAG		0.706	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1			12	131	0	0	0	0.000978	0	12	131				
MUC16	94025	broad.mit.edu	37	19	9048993	9048993	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:9048993G>C	ENST00000397910.4	-	5	32841	c.32638C>G	c.(32638-32640)Cct>Gct	p.P10880A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10882	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P6513A(1)|p.P10880A(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGACCAAAGGGGTCACTACT	0.493																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(32638-32640)CCT>GCT		mucin 16							101.0	91.0	95.0					19																	9048993		1929	4125	6054	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9048993G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32638C>G	19.37:g.9048993G>C	ENSP00000381008:p.Pro10880Ala		Somatic					p.P10880A	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	32842	-			10882			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.32638C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.547	-0.092387	0.07053	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	3.28	-0.257	0.12979	.	.	.	.	.	T	0.03178	0.0093	L	0.29908	0.895	.	.	.	B	0.20780	0.048	B	0.16722	0.016	T	0.25779	-1.0122	8	0.87932	D	0	.	6.7686	0.23581	0.747:0.0:0.253:0.0	.	10880	B5ME49	.	A	10880	ENSP00000381008:P10880A	ENSP00000381008:P10880A	P	-	1	0	MUC16	8909993	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.472000	0.06623	-0.135000	0.11495	-1.843000	0.00578	CCT		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		27	114	0	0	0	0.004656	0	27	114				
OR7G2	390882	broad.mit.edu	37	19	9213076	9213076	+	Missense_Mutation	SNP	G	G	T	rs571301614		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:9213076G>T	ENST00000305456.2	-	1	906	c.907C>A	c.(907-909)Cct>Act	p.P303T		NM_001005193.1	NP_001005193.1	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G, member 2	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P303T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|skin(3)	16						ACCATTTGAGGGAACACAGAA	0.458																																					Esophageal Squamous(67;143 1448 28637 40648)	Esophageal Squamous(67;143 1448 28637 40648)	uc010xkk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(907-909)CCT>ACT		olfactory receptor, family 7, subfamily G,							124.0	109.0	114.0					19																	9213076		2203	4300	6503	SO:0001583	missense	390882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9213076G>T		CCDS32897.1	19p13.2	2013-09-24			ENSG00000170923	ENSG00000170923		"""GPCR / Class A : Olfactory receptors"""	8466	protein-coding gene	gene with protein product							Standard	NM_001005193		Approved	OST260	uc010xkk.2	Q8NG99	OTTHUMG00000179931	ENST00000305456.2:c.907C>A	19.37:g.9213076G>T	ENSP00000303822:p.Pro303Thr		Somatic					p.P303T	NM_001005193	NP_001005193	WXS	Illumina HiSeq	Unspecified	Q8NG99	OR7G2_HUMAN			1	907	-			282			Helical; Name=7; (Potential).		Q6IFJ4|Q96RA0	Missense_Mutation	SNP	ENST00000305456.2	37	c.907C>A	CCDS32897.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.118503	0.00349	.	.	ENSG00000170923	ENST00000305456	T	0.36520	1.25	3.14	-6.28	0.02020	GPCR, rhodopsin-like superfamily (1);	0.469935	0.15318	N	0.268685	T	0.08179	0.0204	N	0.00742	-1.23	0.09310	N	1	B	0.22604	0.072	B	0.29267	0.1	T	0.25082	-1.0142	10	0.02654	T	1	.	10.5461	0.45060	0.0793:0.0:0.2024:0.7183	.	282	Q8NG99	OR7G2_HUMAN	T	303	ENSP00000303822:P303T	ENSP00000303822:P303T	P	-	1	0	OR7G2	9074076	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.404000	0.07205	-1.432000	0.01979	-0.600000	0.04104	CCT		0.458	OR7G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448994.1			24	58	1	0	7.88262e-20	0.00333	1.42126e-19	24	58				
KANK2	25959	broad.mit.edu	37	19	11303645	11303645	+	Missense_Mutation	SNP	C	C	A	rs201031064	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:11303645C>A	ENST00000586659.1	-	4	1425	c.1111G>T	c.(1111-1113)Ggt>Tgt	p.G371C	KANK2_ENST00000432929.2_Missense_Mutation_p.G371C|KANK2_ENST00000589894.1_Missense_Mutation_p.G371C|KANK2_ENST00000589359.1_Missense_Mutation_p.G371C|KANK2_ENST00000355150.5_Missense_Mutation_p.G371C			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	371					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)		p.G371C(1)		endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TCAGGCCTACCAGGCATTGCC	0.667																																							uc010dxv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1111-1113)GGT>TGT		ankyrin repeat domain 25 isoform 1							56.0	59.0	58.0					19																	11303645		2203	4300	6503	SO:0001583	missense	25959							g.chr19:11303645C>A	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1111G>T	19.37:g.11303645C>A	ENSP00000465650:p.Gly371Cys		Somatic				KANK2_uc002mqm.2_Missense_Mutation_p.G371C|KANK2_uc002mqo.3_Missense_Mutation_p.G371C|KANK2_uc002mqp.1_Missense_Mutation_p.G180C|KANK2_uc002mqq.2_Missense_Mutation_p.G371C	p.G371C	NM_015493	NP_056308	WXS	Illumina HiSeq	Unspecified	Q63ZY3	KANK2_HUMAN			6	1669	-			371					B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	ENST00000586659.1	37	c.1111G>T	CCDS12255.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390376	0.42410	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.42131	0.98;0.98	4.11	-0.738	0.11125	.	1.017670	0.07864	N	0.966850	T	0.44222	0.1283	L	0.43152	1.355	0.09310	N	1	P;P;P	0.52842	0.844;0.947;0.956	P;B;P	0.52267	0.518;0.417;0.694	T	0.43163	-0.9408	10	0.56958	D	0.05	-27.878	8.5232	0.33289	0.0:0.6445:0.0:0.3555	.	371;371;371	Q63ZY3-3;Q63ZY3;Q63ZY3-2	.;KANK2_HUMAN;.	C	371	ENSP00000395650:G371C;ENSP00000347276:G371C	ENSP00000347276:G371C	G	-	1	0	KANK2	11164645	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.037000	0.03557	-0.051000	0.13334	0.462000	0.41574	GGT		0.667	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493		17	42	1	0	5.3912e-06	0.006122	7.26973e-06	17	42				
ZNF442	79973	broad.mit.edu	37	19	12461717	12461717	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:12461717C>A	ENST00000242804.4	-	6	1264	c.682G>T	c.(682-684)Gaa>Taa	p.E228*	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Nonsense_Mutation_p.E159*	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E228*(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TGAGTTCTTTCATGCATACGA	0.393																																							uc002mtr.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(2)|breast(1)|kidney(1)	4						c.(682-684)GAA>TAA		zinc finger protein 442							138.0	136.0	137.0					19																	12461717		2203	4300	6503	SO:0001587	stop_gained	79973				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12461717C>A	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.682G>T	19.37:g.12461717C>A	ENSP00000242804:p.Glu228*		Somatic				ZNF442_uc010xmk.1_Nonsense_Mutation_p.E159*	p.E228*	NM_030824	NP_110451	WXS	Illumina HiSeq	Unspecified	Q9H7R0	ZN442_HUMAN			6	1293	-			228			C2H2-type 2.		B4DJ48	Nonsense_Mutation	SNP	ENST00000242804.4	37	c.682G>T	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765272	0.49574	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	.	.	.	0.832	-0.284	0.12870	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	2.3919	0.04380	0.0:0.4142:0.3292:0.2566	.	.	.	.	X	228;159	.	ENSP00000242804:E228X	E	-	1	0	ZNF442	12322717	0.000000	0.05858	0.003000	0.11579	0.637000	0.38172	-1.158000	0.03153	-0.071000	0.12886	0.313000	0.20887	GAA		0.393	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824		37	117	1	0	2.20474e-14	0.003755	3.69526e-14	37	117				
DNASE2	1777	broad.mit.edu	37	19	12986926	12986926	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:12986926G>A	ENST00000222219.3	-	6	1053	c.961C>T	c.(961-963)Cgg>Tgg	p.R321W	DNASE2_ENST00000538460.1_Missense_Mutation_p.R266W	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	321					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)	p.R321W(1)		breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CCCCCACCCCGTTGCTCCTCT	0.607																																							uc002mvn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(961-963)CGG>TGG	Direct_reversal_of_damage	deoxyribonuclease II, lysosomal precursor							60.0	56.0	57.0					19																	12986926		2203	4300	6503	SO:0001583	missense	1777				apoptosis	lysosome	deoxyribonuclease II activity|DNA binding|protein binding	g.chr19:12986926G>A	AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.961C>T	19.37:g.12986926G>A	ENSP00000222219:p.Arg321Trp		Somatic				DNASE2_uc010xmr.1_Missense_Mutation_p.R266W	p.R321W	NM_001375	NP_001366	WXS	Illumina HiSeq	Unspecified	O00115	DNS2A_HUMAN			6	1107	-			321					B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	ENST00000222219.3	37	c.961C>T	CCDS12284.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019634	0.75275	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.19105	2.17;2.17	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70278	-0.4916	10	0.87932	D	0	-44.3971	15.772	0.78176	0.0:0.0:1.0:0.0	.	266;321	B7Z4K6;O00115	.;DNS2A_HUMAN	W	321;266	ENSP00000222219:R321W;ENSP00000445988:R266W	ENSP00000222219:R321W	R	-	1	2	DNASE2	12847926	1.000000	0.71417	0.784000	0.31847	0.909000	0.53808	3.878000	0.56130	2.327000	0.79052	0.462000	0.41574	CGG		0.607	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1			13	71	0	0	0	0.001368	0	13	71				
ATP13A1	57130	broad.mit.edu	37	19	19760641	19760641	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:19760641C>A	ENST00000357324.6	-	18	2470	c.2444G>T	c.(2443-2445)gGc>gTc	p.G815V	ATP13A1_ENST00000291503.5_Missense_Mutation_p.G697V	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	815						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.G815V(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GTGGGCCAAGCCGTCGCCTGT	0.677																																					Esophageal Squamous(142;920 1789 9047 14684 24777)	Esophageal Squamous(142;920 1789 9047 14684 24777)	uc002nnh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|central_nervous_system(1)	6						c.(2443-2445)GGC>GTC		ATPase type 13A1							33.0	39.0	37.0					19																	19760641		2202	4298	6500	SO:0001583	missense	57130				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr19:19760641C>A	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2444G>T	19.37:g.19760641C>A	ENSP00000349877:p.Gly815Val		Somatic				ATP13A1_uc002nne.2_5'UTR|ATP13A1_uc002nnf.3_Missense_Mutation_p.G183V|ATP13A1_uc002nng.2_Missense_Mutation_p.G697V	p.G815V	NM_020410	NP_065143	WXS	Illumina HiSeq	Unspecified	Q9HD20	AT131_HUMAN			18	2472	-			815			Cytoplasmic (Potential).		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	37	c.2444G>T	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999380	0.74818	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.56103	0.48;0.48	5.11	5.11	0.69529	HAD-like domain (2);	0.043292	0.85682	D	0.000000	T	0.41373	0.1156	L	0.28115	0.83	0.80722	D	1	B;B	0.15719	0.014;0.001	B;B	0.23150	0.044;0.005	T	0.20009	-1.0288	10	0.19147	T	0.46	-34.4176	16.3924	0.83544	0.0:1.0:0.0:0.0	.	815;697	Q9HD20;Q9HD20-2	AT131_HUMAN;.	V	697;815	ENSP00000291503:G697V;ENSP00000349877:G815V	ENSP00000291503:G697V	G	-	2	0	ATP13A1	19621641	1.000000	0.71417	0.972000	0.41901	0.334000	0.28698	7.312000	0.78968	2.557000	0.86248	0.561000	0.74099	GGC		0.677	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410		5	41	1	0	0.00116845	0.001168	0.00145979	5	41				
URI1	8725	broad.mit.edu	37	19	30498451	30498451	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:30498451G>C	ENST00000542441.2	+	7	889	c.592G>C	c.(592-594)Gat>Cat	p.D198H	URI1_ENST00000360605.4_Missense_Mutation_p.D180H|URI1_ENST00000392271.1_Missense_Mutation_p.D122H|URI1_ENST00000312051.6_Missense_Mutation_p.D158H|URI1_ENST00000574176.1_3'UTR			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	198					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.D198H(1)									TATTGCAAATGATGTGAAATC	0.383																																						Melanoma(75;661 1306 1472 28422 37948)	uc002nsr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(592-594)GAT>CAT		RPB5-mediating protein isoform a							91.0	89.0	90.0					19																	30498451		2203	4299	6502	SO:0001583	missense	8725				protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding	g.chr19:30498451G>C	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.592G>C	19.37:g.30498451G>C	ENSP00000442436:p.Asp198His		Somatic				C19orf2_uc002nsq.2_Missense_Mutation_p.D180H|C19orf2_uc002nss.2_Missense_Mutation_p.D158H|C19orf2_uc002nst.2_Missense_Mutation_p.D122H	p.D198H	NM_003796	NP_003787	WXS	Illumina HiSeq	Unspecified	O94763	RMP_HUMAN	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)	7	622	+	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	198					A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	37	c.592G>C	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242850	0.39598	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T;T;T	0.10477	2.87;2.87;2.87	5.6	3.5	0.40072	.	0.815272	0.12025	N	0.506522	T	0.10723	0.0262	L	0.29908	0.895	0.27332	N	0.956755	P;P;P	0.49961	0.773;0.877;0.93	P;B;B	0.45610	0.487;0.293;0.38	T	0.13255	-1.0516	10	0.48119	T	0.1	-6.1713	9.0909	0.36610	0.1664:0.0:0.8336:0.0	.	158;198;196	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	H	196;122;198;158	ENSP00000376097:D122H;ENSP00000442436:D198H;ENSP00000312530:D158H	ENSP00000312530:D158H	D	+	1	0	C19orf2	35190291	0.997000	0.39634	0.665000	0.29768	0.125000	0.20455	3.038000	0.49783	1.377000	0.46286	0.655000	0.94253	GAT		0.383	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447		6	36	0	0	0	0.001168	0	6	36				
HKR1	284459	broad.mit.edu	37	19	37854368	37854368	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:37854368G>T	ENST00000324411.4	+	6	1940	c.1671G>T	c.(1669-1671)gaG>gaT	p.E557D	HKR1_ENST00000541583.2_Missense_Mutation_p.E496D|HKR1_ENST00000589392.1_Missense_Mutation_p.E539D|HKR1_ENST00000544914.1_Missense_Mutation_p.E284D|HKR1_ENST00000591471.1_Missense_Mutation_p.E284D|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000392153.3_Missense_Mutation_p.E538D	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	557					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E557D(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTGCAGGGAGTGTGGCAGAA	0.502																																							uc002ogb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1669-1671)GAG>GAT		GLI-Kruppel family member HKR1							53.0	48.0	49.0					19																	37854368		2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854368G>T	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1671G>T	19.37:g.37854368G>T	ENSP00000315505:p.Glu557Asp		Somatic				HKR1_uc002ofx.2_Missense_Mutation_p.E273D|HKR1_uc002ofy.2_Missense_Mutation_p.E273D|HKR1_uc002oga.2_Missense_Mutation_p.E539D|HKR1_uc010xto.1_Missense_Mutation_p.E539D|HKR1_uc002ogc.2_Missense_Mutation_p.E538D|HKR1_uc010xtp.1_Missense_Mutation_p.E496D|HKR1_uc002ogd.2_Missense_Mutation_p.E496D	p.E557D	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1940	+			557			C2H2-type 10.		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.1671G>T	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187009	0.38609	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	2.77	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18087	0.0434	M	0.65320	2	0.80722	D	1	B;B;B;B	0.23806	0.035;0.027;0.091;0.058	B;B;B;B	0.28849	0.054;0.051;0.095;0.032	T	0.04495	-1.0947	9	0.36615	T	0.2	.	7.6042	0.28093	0.1283:0.0:0.8717:0.0	.	496;538;557;539	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	D	284;336;538;593;557;496	ENSP00000437774:E284D;ENSP00000375994:E538D;ENSP00000315505:E557D;ENSP00000438261:E496D	ENSP00000315505:E557D	E	+	3	2	HKR1	42546208	0.000000	0.05858	1.000000	0.80357	0.959000	0.62525	-2.475000	0.00987	1.862000	0.54008	0.650000	0.86243	GAG		0.502	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		21	34	1	0	1.50039e-11	0.001882	2.37271e-11	21	34				
FCGBP	8857	broad.mit.edu	37	19	40368642	40368642	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:40368642C>A	ENST00000221347.6	-	28	12713	c.12706G>T	c.(12706-12708)Gct>Tct	p.A4236S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4236	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.A4236S(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ATGGAGGGAGCCAGTGTGCCA	0.642																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(12706-12708)GCT>TCT		Fc fragment of IgG binding protein precursor							19.0	22.0	21.0					19																	40368642		2199	4273	6472	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40368642C>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12706G>T	19.37:g.40368642C>A	ENSP00000221347:p.Ala4236Ser		Somatic					p.A4236S	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		28	12714	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		4236			VWFD 10.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.12706G>T	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789912	0.50102	.	.	ENSG00000090920	ENST00000221347	T	0.18657	2.2	3.92	3.92	0.45320	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.42630	0.1211	M	0.78223	2.4	0.27617	N	0.948463	D	0.61697	0.99	P	0.57204	0.815	T	0.30736	-0.9968	9	0.52906	T	0.07	.	15.2045	0.73169	0.0:1.0:0.0:0.0	.	4236	Q9Y6R7	FCGBP_HUMAN	S	4236	ENSP00000221347:A4236S	ENSP00000221347:A4236S	A	-	1	0	FCGBP	45060482	0.002000	0.14202	0.958000	0.39756	0.215000	0.24574	1.153000	0.31676	2.201000	0.70794	0.305000	0.20034	GCT		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		15	203	1	0	1.50039e-11	0.001882	2.37271e-11	15	203				
HNRNPUL1	11100	broad.mit.edu	37	19	41782090	41782090	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:41782090G>T	ENST00000392006.3	+	5	846	c.673G>T	c.(673-675)Gcc>Tcc	p.A225S	HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.A225S|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.A125S|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.A125S|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.A182S|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.A125S|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.A136S|HNRNPUL1_ENST00000594207.1_3'UTR	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	225	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A225S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						CTTCAAGGTGGCCCGAGATCG	0.502																																							uc002oqb.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(673-675)GCC>TCC		heterogeneous nuclear ribonucleoprotein U-like 1							113.0	113.0	113.0					19																	41782090		2203	4300	6503	SO:0001583	missense	11100				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding	g.chr19:41782090G>T	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.673G>T	19.37:g.41782090G>T	ENSP00000375863:p.Ala225Ser		Somatic				CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Missense_Mutation_p.A125S|HNRNPUL1_uc002oqa.3_Missense_Mutation_p.A125S|HNRNPUL1_uc010ehm.2_Missense_Mutation_p.A225S|HNRNPUL1_uc002oqc.3_Missense_Mutation_p.A182S|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Missense_Mutation_p.A125S|HNRNPUL1_uc010ehn.2_Missense_Mutation_p.A125S|HNRNPUL1_uc010eho.2_Missense_Mutation_p.A125S|HNRNPUL1_uc010xvy.1_Missense_Mutation_p.A125S|HNRNPUL1_uc010ehp.2_Missense_Mutation_p.A81S|HNRNPUL1_uc010ehl.1_Missense_Mutation_p.A125S	p.A225S	NM_007040	NP_008971	WXS	Illumina HiSeq	Unspecified	Q9BUJ2	HNRL1_HUMAN			5	962	+			225			B30.2/SPRY.|Necessary for interaction with TP53.		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	c.673G>T	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	7.748	0.702806	0.15172	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.099139	0.64402	D	0.000001	T	0.33177	0.0854	N	0.00521	-1.4	0.35581	D	0.806266	B;B;B;B;B;B	0.29136	0.01;0.01;0.067;0.234;0.02;0.017	B;B;B;B;B;B	0.28465	0.008;0.007;0.051;0.09;0.014;0.01	T	0.52079	-0.8623	10	0.02654	T	1	-19.6497	18.7482	0.91802	0.0:0.0:1.0:0.0	.	136;125;225;182;225;125	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	S	125;225;182;136	ENSP00000340857:A125S;ENSP00000375863:A225S;ENSP00000367460:A182S;ENSP00000263367:A136S	ENSP00000263367:A136S	A	+	1	0	HNRNPUL1	46473930	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.078000	0.50096	2.729000	0.93468	0.655000	0.94253	GCC		0.502	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040		38	95	1	0	2.87052e-16	0.005524	4.93273e-16	38	95				
MEGF8	1954	broad.mit.edu	37	19	42867243	42867243	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:42867243G>T	ENST00000251268.6	+	35	6102	c.6102G>T	c.(6100-6102)tgG>tgT	p.W2034C	MEGF8_ENST00000334370.4_Missense_Mutation_p.W1967C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2034					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.W2034C(1)|p.W1575C(1)|p.W1967C(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCTATGACTGGACGTGCTTCA	0.637																																							uc002otl.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(5899-5901)TGG>TGT		multiple EGF-like-domains 8							109.0	95.0	100.0					19																	42867243		2203	4300	6503	SO:0001583	missense	1954					integral to membrane	calcium ion binding|structural molecule activity	g.chr19:42867243G>T	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6102G>T	19.37:g.42867243G>T	ENSP00000251268:p.Trp2034Cys		Somatic				MEGF8_uc002otm.3_Missense_Mutation_p.W1575C	p.W1967C	NM_001410	NP_001401	WXS	Illumina HiSeq	Unspecified	Q7Z7M0	MEGF8_HUMAN			34	6536	+		Prostate(69;0.00682)	2034			Extracellular (Potential).		A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37	c.5901G>T		.	.	.	.	.	.	.	.	.	.	G	19.19	3.780482	0.70222	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.23147	1.92;1.92	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000003	T	0.47229	0.1434	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.46247	-0.9205	10	0.72032	D	0.01	-16.7198	16.6976	0.85340	0.0:0.0:1.0:0.0	.	2034;1967	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	C	1967;2034	ENSP00000334219:W1967C;ENSP00000251268:W2034C	ENSP00000251268:W2034C	W	+	3	0	MEGF8	47559083	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	5.512000	0.67030	2.556000	0.86216	0.508000	0.49915	TGG		0.637	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410		8	16	1	0	5.4927e-09	0.004482	8.30008e-09	8	16				
PSG4	5672	broad.mit.edu	37	19	43698709	43698709	+	Silent	SNP	G	G	C	rs146368793		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:43698709G>C	ENST00000405312.3	-	5	1263	c.1026C>G	c.(1024-1026)acC>acG	p.T342T	PSG4_ENST00000244295.9_Silent_p.T249T|PSG4_ENST00000433626.2_Silent_p.T249T	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	342	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)		p.T249T(1)|p.T342T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				AACGGTAATAGGTGAATGAAG	0.488																																							uc002ovy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1024-1026)ACC>ACG		pregnancy specific beta-1-glycoprotein 4 isoform		G	,	0,4404		0,0,2202	145.0	152.0	150.0		1026,747	0.3	0.0	19	dbSNP_134	150	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous	PSG4	NM_002780.3,NM_213633.1	,	0,1,6494	CC,CG,GG		0.0116,0.0,0.0077	,	342/420,249/327	43698709	1,12989	2202	4293	6495	SO:0001819	synonymous_variant	5672				defense response|female pregnancy	extracellular region		g.chr19:43698709G>C		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.1026C>G	19.37:g.43698709G>C			Somatic				PSG6_uc010xwk.1_Intron|PSG4_uc002owa.2_Intron|PSG4_uc002owb.2_Silent_p.T249T|PSG4_uc002ovz.2_Silent_p.T249T	p.T342T	NM_002780	NP_002771	WXS	Illumina HiSeq	Unspecified	Q00888	PSG4_HUMAN			5	1128	-		Prostate(69;0.00682)	342			Ig-like C2-type 3.		E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	ENST00000405312.3	37	c.1026C>G	CCDS46093.1																																																																																				0.488	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633		79	209	0	0	0	0.00361	0	79	209				
ZNF235	9310	broad.mit.edu	37	19	44792687	44792687	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:44792687T>C	ENST00000291182.4	-	5	1003	c.901A>G	c.(901-903)Agt>Ggt	p.S301G	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S301G(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				GAGCTATAACTGGTGTCCTTC	0.418																																							uc002oza.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(901-903)AGT>GGT		zinc finger protein 93 homolog							128.0	117.0	120.0					19																	44792687		2203	4300	6503	SO:0001583	missense	9310				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44792687T>C	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.901A>G	19.37:g.44792687T>C	ENSP00000291182:p.Ser301Gly		Somatic				ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.S297G|ZNF235_uc010xwx.1_Missense_Mutation_p.S215G	p.S301G	NM_004234	NP_004225	WXS	Illumina HiSeq	Unspecified	Q14590	ZN235_HUMAN			5	1004	-		Prostate(69;0.0352)|all_neural(266;0.116)	301					B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	c.901A>G	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	t	8.268	0.812772	0.16537	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	T	0.01015	5.44	4.5	-9.01	0.00744	.	0.772331	0.11437	N	0.564195	T	0.00637	0.0021	L	0.33710	1.025	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.41998	-0.9477	10	0.33940	T	0.23	.	3.4744	0.07579	0.1001:0.354:0.3061:0.2398	.	297;301	Q14590-2;Q14590	.;ZN235_HUMAN	G	301;301;223	ENSP00000291182:S301G	ENSP00000291182:S301G	S	-	1	0	ZNF235	49484527	0.568000	0.26635	0.000000	0.03702	0.002000	0.02628	1.553000	0.36255	-2.316000	0.00645	-0.484000	0.04775	AGT		0.418	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			6	78	0	0	0	0.001984	0	6	78				
SYMPK	8189	broad.mit.edu	37	19	46326729	46326729	+	Splice_Site	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:46326729G>C	ENST00000245934.7	-	20	2845	c.2601C>G	c.(2599-2601)gtC>gtG	p.V867V	SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	867					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.V867V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GGGAGGGTGGGACTGCATGGA	0.637																																							uc002pdn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2599-2601)GTC>GTG		symplekin							41.0	39.0	40.0					19																	46326729		2203	4300	6503	SO:0001630	splice_region_variant	8189				cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding	g.chr19:46326729G>C	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.2600-1C>G	19.37:g.46326729G>C			Somatic				SYMPK_uc002pdo.1_Silent_p.V867V|SYMPK_uc002pdp.1_Silent_p.V867V	p.V867V	NM_004819	NP_004810	WXS	Illumina HiSeq	Unspecified	Q92797	SYMPK_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)	20	2846	-		all_neural(266;0.0299)|Ovarian(192;0.0308)	867					O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	c.2601C>G	CCDS12676.2																																																																																				0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	Silent	3	31	0	0	0	0.004672	0	3	31				
FAM71E1	112703	broad.mit.edu	37	19	50979147	50979147	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:50979147C>T	ENST00000600100.1	-	2	667	c.303G>A	c.(301-303)caG>caA	p.Q101Q	EMC10_ENST00000376918.3_5'Flank|FAM71E1_ENST00000595790.1_Silent_p.Q101Q|EMC10_ENST00000598585.1_5'Flank|EMC10_ENST00000334976.6_5'Flank			Q6IPT2	F71E1_HUMAN	family with sequence similarity 71, member E1	101								p.Q101Q(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		ATTCGCCGCTCTGGAGGTAGC	0.627																																							uc002psh.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(301-303)CAG>CAA		hypothetical protein LOC112703							45.0	44.0	45.0					19																	50979147		2203	4300	6503	SO:0001819	synonymous_variant	112703							g.chr19:50979147C>T		CCDS33081.1	19q13.33	2007-11-20				ENSG00000142530			25107	protein-coding gene	gene with protein product							Standard	XM_005258472		Approved		uc002psg.3	Q6IPT2		ENST00000600100.1:c.303G>A	19.37:g.50979147C>T			Somatic				FAM71E1_uc002psg.2_Silent_p.Q101Q|FAM71E1_uc002psi.2_RNA|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	p.Q101Q	NM_138411	NP_612420	WXS	Illumina HiSeq	Unspecified	Q6IPT2	F71E1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)	2	661	-		all_neural(266;0.131)	101					Q96EJ5|Q9BSM9	Silent	SNP	ENST00000600100.1	37	c.303G>A																																																																																					0.627	FAM71E1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464754.2			11	9	0	0	0	0.001855	0	11	9				
KLK2	3817	broad.mit.edu	37	19	51379887	51379887	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:51379887G>T	ENST00000325321.3	+	3	591	c.366G>T	c.(364-366)atG>atT	p.M122I	AC037199.1_ENST00000594218.1_5'Flank|KLK2_ENST00000358049.4_Missense_Mutation_p.M122I|KLK2_ENST00000391810.2_Missense_Mutation_p.M20I			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	122	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.M122I(2)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		ATGACCTCATGCTGCTCCGCC	0.587			T	ETV4	prostate																																		uc002ptv.2		NA		Dom	yes		19	19q13.41	3817	T	kallikrein-related peptidase 2			E	ETV4		prostate		2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(364-366)ATG>ATT		kallikrein 2, prostatic isoform 1							64.0	58.0	60.0					19																	51379887		2203	4300	6503	SO:0001583	missense	3817				proteolysis		serine-type endopeptidase activity	g.chr19:51379887G>T	M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.366G>T	19.37:g.51379887G>T	ENSP00000313581:p.Met122Ile		Somatic				KLK2_uc010eog.2_Missense_Mutation_p.M20I|KLK2_uc010yck.1_Missense_Mutation_p.M122I|KLK2_uc002ptu.2_Missense_Mutation_p.M122I|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_Missense_Mutation_p.M105I|KLK2_uc010ycm.1_Missense_Mutation_p.M20I|KLK2_uc010eoh.2_Missense_Mutation_p.M20I	p.M122I	NM_005551	NP_005542	WXS	Illumina HiSeq	Unspecified	P20151	KLK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)	3	407	+		all_neural(266;0.026)	122			Peptidase S1.		B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	c.366G>T	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561664	0.65538	.	.	ENSG00000167751	ENST00000325321;ENST00000358049;ENST00000391810	T;T;T	0.07114	3.22;3.22;3.22	2.61	2.61	0.31194	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.46442	D	0.000287	T	0.25457	0.0619	M	0.74881	2.28	0.25217	N	0.989933	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79784	0.993;0.983;0.99	T	0.01345	-1.1379	10	0.87932	D	0	.	11.3633	0.49657	0.0:0.0:1.0:0.0	.	105;122;122	B4DU77;P20151-2;P20151	.;.;KLK2_HUMAN	I	122;122;20	ENSP00000313581:M122I;ENSP00000350748:M122I;ENSP00000375686:M20I	ENSP00000313581:M122I	M	+	3	0	KLK2	56071699	1.000000	0.71417	0.470000	0.27216	0.167000	0.22549	5.078000	0.64425	1.415000	0.47037	0.305000	0.20034	ATG		0.587	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3		24	34	1	0	1.64293e-13	0.00333	2.69668e-13	24	34				
SIGLECL1	284369	broad.mit.edu	37	19	51768813	51768813	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:51768813C>A	ENST00000316401.7	+	3	595	c.214C>A	c.(214-216)Cta>Ata	p.L72I	SIGLECL1_ENST00000597824.1_Intron|CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_Intron	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	430	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.L72I(1)									CACCATCAGCCTAACTGAAGA	0.557																																							uc002pwb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(214-216)CTA>ATA		hypothetical protein LOC284369							73.0	69.0	71.0					19																	51768813		2203	4300	6503	SO:0001583	missense	284369					integral to membrane		g.chr19:51768813C>A	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.214C>A	19.37:g.51768813C>A	ENSP00000321249:p.Leu72Ile		Somatic				C19orf75_uc010eov.1_Intron|C19orf75_uc010ycw.1_Intron	p.L72I	NM_173635	NP_775906	WXS	Illumina HiSeq	Unspecified	Q8N7X8	CS075_HUMAN			3	595	+			72					Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	c.214C>A	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330319	0.24167	.	.	ENSG00000179213	ENST00000316401	D	0.86230	-2.09	3.83	2.78	0.32641	Immunoglobulin-like fold (1);	0.000000	0.30840	N	0.008779	D	0.90177	0.6930	M	0.68593	2.085	0.09310	N	1	D	0.69078	0.997	D	0.68765	0.96	T	0.80979	-0.1140	10	0.49607	T	0.09	-5.964	7.5424	0.27746	0.0:0.8793:0.0:0.1207	.	72	Q8N7X8	CS075_HUMAN	I	72	ENSP00000321249:L72I	ENSP00000321249:L72I	L	+	1	2	C19orf75	56460625	0.001000	0.12720	0.025000	0.17156	0.007000	0.05969	-0.118000	0.10692	0.936000	0.37367	0.557000	0.71058	CTA		0.557	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635		13	70	1	0	5.50884e-06	0.001368	7.36575e-06	13	70				
NLRP2	55655	broad.mit.edu	37	19	55494060	55494060	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:55494060C>A	ENST00000543010.1	+	6	1137	c.994C>A	c.(994-996)Ctg>Atg	p.L332M	NLRP2_ENST00000537859.1_Missense_Mutation_p.L310M|NLRP2_ENST00000263437.6_Missense_Mutation_p.L329M|NLRP2_ENST00000391721.4_Missense_Mutation_p.L308M|NLRP2_ENST00000339757.7_Missense_Mutation_p.L310M|NLRP2_ENST00000427260.2_Missense_Mutation_p.L309M|NLRP2_ENST00000448584.2_Missense_Mutation_p.L332M|NLRP2_ENST00000538819.1_Missense_Mutation_p.L308M	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	332	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.L332M(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CAAGGCCGCCCTGCTGGTCAC	0.652																																							uc002qij.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(994-996)CTG>ATG		NLR family, pyrin domain containing 2							36.0	32.0	33.0					19																	55494060		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55494060C>A	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.994C>A	19.37:g.55494060C>A	ENSP00000445135:p.Leu332Met		Somatic				NLRP2_uc010yfp.1_Missense_Mutation_p.L309M|NLRP2_uc010esn.2_Missense_Mutation_p.L308M|NLRP2_uc010eso.2_Missense_Mutation_p.L329M|NLRP2_uc010esp.2_Missense_Mutation_p.L310M	p.L332M	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	6	1080	+			332			NACHT.		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.994C>A	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326295	0.41197	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	D;D;D;D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6	1.55	0.492	0.16872	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.91126	0.7206	M	0.92169	3.28	0.25061	N	0.99106	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.998;0.994;0.996;0.992;0.996	T	0.80132	-0.1510	9	0.87932	D	0	.	6.0323	0.19686	0.0:0.8177:0.0:0.1823	.	309;310;329;308;332	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	M	332;308;310;332;310;309;308;329	ENSP00000445135:L332M;ENSP00000375601:L308M;ENSP00000344074:L310M;ENSP00000409370:L332M;ENSP00000440601:L310M;ENSP00000402474:L309M;ENSP00000441133:L308M;ENSP00000263437:L329M	ENSP00000263437:L329M	L	+	1	2	NLRP2	60185872	0.000000	0.05858	0.006000	0.13384	0.227000	0.25037	-1.746000	0.01829	0.249000	0.21456	0.485000	0.47835	CTG		0.652	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		6	27	1	0	0.00116845	0.001168	0.00145979	6	27				
ZNF530	348327	broad.mit.edu	37	19	58117956	58117956	+	Missense_Mutation	SNP	G	G	A	rs35182752		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:58117956G>A	ENST00000332854.6	+	3	1283	c.1063G>A	c.(1063-1065)Gaa>Aaa	p.E355K	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E355K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGAGTGCAGTGAATGTGGAAA	0.463																																							uc002qpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1063-1065)GAA>AAA		zinc finger protein 530							109.0	103.0	105.0					19																	58117956		2203	4300	6503	SO:0001583	missense	348327				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58117956G>A	AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.1063G>A	19.37:g.58117956G>A	ENSP00000332861:p.Glu355Lys		Somatic				ZNF547_uc002qpm.3_Intron|ZNF530_uc002qpl.2_RNA	p.E355K	NM_020880	NP_065931	WXS	Illumina HiSeq	Unspecified	Q6P9A1	ZN530_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	3	1283	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)	355			C2H2-type 5.		O43340|Q9P220	Missense_Mutation	SNP	ENST00000332854.6	37	c.1063G>A	CCDS12955.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501550	0.44455	.	.	ENSG00000183647	ENST00000332854	T	0.16597	2.33	2.27	-1.07	0.09968	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17365	0.0417	N	0.26092	0.79	0.09310	N	1	P	0.43701	0.815	P	0.49085	0.6	T	0.31024	-0.9958	9	0.72032	D	0.01	.	10.4988	0.44794	0.0:0.4464:0.5536:0.0	.	355	Q6P9A1	ZN530_HUMAN	K	355	ENSP00000332861:E355K	ENSP00000332861:E355K	E	+	1	0	ZNF530	62809768	0.000000	0.05858	0.007000	0.13788	0.141000	0.21300	-0.786000	0.04623	0.197000	0.20387	0.609000	0.83330	GAA		0.463	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1	NM_020880		6	116	0	0	0	0.001984	0	6	116				
ZNF776	284309	broad.mit.edu	37	19	58262174	58262174	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:58262174G>A	ENST00000317178.5	+	2	318	c.55G>A	c.(55-57)Gtg>Atg	p.V19M	ZNF776_ENST00000431353.1_Missense_Mutation_p.V19M|AC003006.7_ENST00000594684.1_Missense_Mutation_p.V19M	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V19M(1)		cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CTTTGAAGATGTGGCTGTGAA	0.488																																						Pancreas(59;641 1233 1885 20055 50741)	uc002qqb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(-457--453)ATGTG>ATATG		zinc finger protein 587							251.0	191.0	209.0					19																	58262174		692	1591	2283	SO:0001583	missense	84914				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58262174G>A	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.55G>A	19.37:g.58262174G>A	ENSP00000321812:p.Val19Met		Somatic				ZNF776_uc002qpx.2_Missense_Mutation_p.V19M|ZNF776_uc002qqa.2_Missense_Mutation_p.V19M		NM_032828	NP_116217	WXS	Illumina HiSeq	Unspecified	Q96SQ5	ZN587_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)	2	318	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)						Q6ZS36|Q8N968	Translation_Start_Site	SNP	ENST00000317178.5	37	c.-455G>A	CCDS12962.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.35|13.35	2.212427|2.212427	0.39102|0.39102	.|.	.|.	ENSG00000152443|ENSG00000152443	ENST00000451849|ENST00000317178;ENST00000431353	.|T;T	.|0.10382	.|2.88;2.88	1.5|1.5	1.5|1.5	0.22942|0.22942	.|Krueppel-associated box (4);	.|.	.|.	.|.	.|.	T|T	0.38692|0.38692	0.1050|0.1050	H|H	0.94385|0.94385	3.53|3.53	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.995;1.0	T|T	0.08868|0.08868	-1.0701|-1.0701	5|9	.|0.87932	.|D	.|0	.|.	6.4096|6.4096	0.21684|0.21684	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|19;19	.|Q68DI1;B4DSC6	.|ZN776_HUMAN;.	I|M	1|19	.|ENSP00000321812:V19M;ENSP00000405772:V19M	.|ENSP00000321812:V19M	M|V	+|+	3|1	0|0	ZNF776|ZNF776	62953986|62953986	0.010000|0.010000	0.17322|0.17322	0.181000|0.181000	0.23098|0.23098	0.950000|0.950000	0.60333|0.60333	0.812000|0.812000	0.27211|0.27211	1.151000|1.151000	0.42436|0.42436	0.313000|0.313000	0.20887|0.20887	ATG|GTG		0.488	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632		10	139	0	0	0	0.001368	0	10	139				
ZNF586	54807	broad.mit.edu	37	19	58287980	58287980	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:58287980C>A	ENST00000396154.2	+	2	279	c.106C>A	c.(106-108)Cag>Aag	p.Q36K	ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000396150.4_Intron|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000391702.3_5'UTR|ZNF586_ENST00000599802.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	36	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q36K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAATGAGGCTCAGAGATGCCT	0.468																																							uc002qqd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(106-108)CAG>AAG		zinc finger protein 586							263.0	260.0	261.0					19																	58287980		2203	4300	6503	SO:0001583	missense	54807				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58287980C>A	AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.106C>A	19.37:g.58287980C>A	ENSP00000379458:p.Gln36Lys		Somatic				ZNF587_uc002qqb.2_Intron|ZNF586_uc002qqe.2_Intron|ZNF586_uc010euh.2_5'UTR|ZNF586_uc002qqf.1_Intron	p.Q36K	NM_017652	NP_060122	WXS	Illumina HiSeq	Unspecified	Q9NXT0	ZN586_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	2	292	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	36			KRAB.		A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	c.106C>A	CCDS42640.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536903	0.45176	.	.	ENSG00000083828	ENST00000449441;ENST00000396154	T	0.08896	3.04	2.06	2.06	0.26882	Krueppel-associated box (4);	.	.	.	.	T	0.19967	0.0480	H	0.97491	4.015	0.38616	D	0.951034	B	0.26258	0.145	B	0.20955	0.032	T	0.10706	-1.0618	9	0.62326	D	0.03	.	7.5304	0.27679	0.0:1.0:0.0:0.0	.	36	Q9NXT0	ZN586_HUMAN	K	36	ENSP00000379458:Q36K	ENSP00000379458:Q36K	Q	+	1	0	ZNF586	62979792	0.858000	0.29795	0.256000	0.24389	0.825000	0.46686	1.693000	0.37742	1.135000	0.42183	0.655000	0.94253	CAG		0.468	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652		47	220	1	0	4.64027e-19	0.00361	8.30363e-19	47	220				
ZNF418	147686	broad.mit.edu	37	19	58439157	58439157	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr19:58439157T>A	ENST00000396147.1	-	4	683	c.392A>T	c.(391-393)tAc>tTc	p.Y131F	ZNF418_ENST00000425570.3_Missense_Mutation_p.Y152F|ZNF418_ENST00000595830.1_Missense_Mutation_p.Y131F|ZNF418_ENST00000599852.1_Missense_Mutation_p.Y46F|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y131F(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		CTCTCCAAGGTACTGATTCTG	0.453																																							uc002qqs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(391-393)TAC>TTC		zinc finger protein 418							168.0	177.0	174.0					19																	58439157		2202	4299	6501	SO:0001583	missense	147686				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58439157T>A	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.392A>T	19.37:g.58439157T>A	ENSP00000379451:p.Tyr131Phe		Somatic				ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.Y46F	p.Y131F	NM_133460	NP_597717	WXS	Illumina HiSeq	Unspecified	Q8TF45	ZN418_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)	4	684	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	131					Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	37	c.392A>T	CCDS42642.1	.	.	.	.	.	.	.	.	.	.	.	16.21	3.059768	0.55325	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.07800	3.16;3.18	2.05	-0.429	0.12303	.	.	.	.	.	T	0.05090	0.0136	N	0.25485	0.75	0.09310	N	1	P	0.47762	0.9	B	0.38985	0.287	T	0.33854	-0.9852	9	0.66056	D	0.02	.	4.0466	0.09776	0.0:0.1436:0.2067:0.6497	.	131	Q8TF45	ZN418_HUMAN	F	131;152;97	ENSP00000379451:Y131F;ENSP00000407039:Y152F	ENSP00000379451:Y131F	Y	-	2	0	ZNF418	63130969	0.000000	0.05858	0.000000	0.03702	0.202000	0.24057	0.803000	0.27083	-0.160000	0.11002	0.254000	0.18369	TAC		0.453	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460		17	163	0	0	0	0.00499	0	17	163				
MYT1L	23040	broad.mit.edu	37	2	1893159	1893159	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:1893159G>T	ENST00000399161.2	-	16	3121	c.2374C>A	c.(2374-2376)Cct>Act	p.P792T	MYT1L_ENST00000428368.2_Missense_Mutation_p.P790T	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	792					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P792T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGCTCCAGAGGGGTCAGGATG	0.622																																							uc002qxe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)	6						c.(2374-2376)CCT>ACT		myelin transcription factor 1-like							57.0	62.0	60.0					2																	1893159		2041	4168	6209	SO:0001583	missense	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1893159G>T	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2374C>A	2.37:g.1893159G>T	ENSP00000382114:p.Pro792Thr		Somatic				MYT1L_uc002qxd.2_Missense_Mutation_p.P790T|MYT1L_uc010ewl.1_RNA	p.P792T	NM_015025	NP_055840	WXS	Illumina HiSeq	Unspecified	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	16	3201	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	792					A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37	c.2374C>A		.	.	.	.	.	.	.	.	.	.	G	26.2	4.717133	0.89205	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.48836	0.8;0.8	4.78	4.78	0.61160	Myelin transcription factor 1 (1);	0.049886	0.85682	D	0.000000	T	0.69160	0.3080	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.979;0.951	T	0.69316	-0.5177	10	0.35671	T	0.21	-23.3664	18.1738	0.89754	0.0:0.0:1.0:0.0	.	792;790	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	T	792;738;790	ENSP00000382114:P792T;ENSP00000396103:P790T	ENSP00000295067:P738T	P	-	1	0	MYT1L	1872166	1.000000	0.71417	0.963000	0.40424	0.976000	0.68499	9.731000	0.98807	2.368000	0.80403	0.591000	0.81541	CCT		0.622	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		25	74	1	0	1.64293e-13	0.00333	2.69668e-13	25	74				
NBAS	51594	broad.mit.edu	37	2	15496520	15496520	+	Silent	SNP	G	G	T	rs368280415		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:15496520G>T	ENST00000281513.5	-	33	3863	c.3838C>A	c.(3838-3840)Cgg>Agg	p.R1280R	NBAS_ENST00000441750.1_Silent_p.R1160R	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1280					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R1280R(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ACCTGTCCCCGCCTTTCTTCT	0.453																																							uc002rcc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(3838-3840)CGG>AGG		neuroblastoma-amplified protein							124.0	123.0	123.0					2																	15496520		2203	4300	6503	SO:0001819	synonymous_variant	51594							g.chr2:15496520G>T	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3838C>A	2.37:g.15496520G>T			Somatic				NBAS_uc010exl.1_Silent_p.R352R|NBAS_uc002rcd.1_RNA	p.R1280R	NM_015909	NP_056993	WXS	Illumina HiSeq	Unspecified	A2RRP1	NBAS_HUMAN			33	3864	-			1280					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	c.3838C>A	CCDS1685.1																																																																																				0.453	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		18	81	1	0	2.94398e-08	0.007413	4.36553e-08	18	81				
MSH6	2956	broad.mit.edu	37	2	48033436	48033436	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:48033436C>G	ENST00000234420.5	+	8	3892	c.3740C>G	c.(3739-3741)aCt>aGt	p.T1247S	MSH6_ENST00000538136.1_Missense_Mutation_p.T945S|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.T1117S	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1247					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.T1247S(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTATTTTCAACTCACTACCAT	0.353			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rwd.3		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	Mis|N|F|S	mutS homolog 6 (E. coli)			E		colorectal|endometrial|ovarian	colorectal		3	Whole gene deletion(2)|Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(2)|lung(1)	large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168						c.(3739-3741)ACT>AGT	MMR	mutS homolog 6							104.0	100.0	102.0					2																	48033436		2203	4300	6503	SO:0001583	missense	2956	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding	g.chr2:48033436C>G	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3740C>G	2.37:g.48033436C>G	ENSP00000234420:p.Thr1247Ser		Somatic				MSH6_uc010fbj.2_Missense_Mutation_p.T945S|MSH6_uc010yoi.1_Missense_Mutation_p.T1117S|MSH6_uc010yoj.1_Missense_Mutation_p.T945S	p.T1247S	NM_000179	NP_000170	WXS	Illumina HiSeq	Unspecified	P52701	MSH6_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		8	3892	+		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	1247					B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	c.3740C>G	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772095	0.90108	.	.	ENSG00000116062	ENST00000234420;ENST00000543270;ENST00000540021;ENST00000538136	D;D;D	0.91464	-2.85;-2.85;-2.85	5.5	5.5	0.81552	DNA mismatch repair protein MutS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96920	0.8994	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97414	1.0004	10	0.87932	D	0	-16.0729	19.5916	0.95514	0.0:1.0:0.0:0.0	.	1117;1247	B4DF41;P52701	.;MSH6_HUMAN	S	1247;213;1117;945	ENSP00000234420:T1247S;ENSP00000446475:T1117S;ENSP00000438580:T945S	ENSP00000234420:T1247S	T	+	2	0	MSH6	47886940	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.436000	0.80404	2.861000	0.98227	0.655000	0.94253	ACT		0.353	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179		6	84	0	0	0	0.00308	0	6	84				
WDR54	84058	broad.mit.edu	37	2	74650614	74650614	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:74650614T>G	ENST00000348227.4	+	5	450	c.362T>G	c.(361-363)gTg>gGg	p.V121G	WDR54_ENST00000409791.1_Missense_Mutation_p.V69G|WDR54_ENST00000461531.1_3'UTR	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54	121								p.V121G(1)		breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						GTACAGGCTGTGTTTGCCCGG	0.587																																							uc002slb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)GTG>GGG		WD repeat domain 54							101.0	99.0	100.0					2																	74650614		2203	4300	6503	SO:0001583	missense	84058							g.chr2:74650614T>G	AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951	ENST00000348227.4:c.362T>G	2.37:g.74650614T>G	ENSP00000006526:p.Val121Gly		Somatic					p.V121G	NM_032118	NP_115494	WXS	Illumina HiSeq	Unspecified	Q9H977	WDR54_HUMAN			5	422	+			121			WD 1.		D6W5I3|Q53H85|Q86V45	Missense_Mutation	SNP	ENST00000348227.4	37	c.362T>G	CCDS1940.1	.	.	.	.	.	.	.	.	.	.	T	12.37	1.917739	0.33815	.	.	ENSG00000005448	ENST00000409791;ENST00000348227	T;T	0.52526	0.66;0.66	5.19	2.84	0.33178	WD40 repeat-like-containing domain (1);	0.280979	0.33772	N	0.004578	T	0.34658	0.0905	L	0.40543	1.245	0.58432	D	0.999994	B	0.15141	0.012	B	0.14023	0.01	T	0.19192	-1.0313	10	0.59425	D	0.04	-5.8441	5.8814	0.18858	0.0:0.2749:0.0:0.7251	.	121	Q9H977	WDR54_HUMAN	G	69;121	ENSP00000387236:V69G;ENSP00000006526:V121G	ENSP00000006526:V121G	V	+	2	0	WDR54	74504122	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.349000	0.33998	0.815000	0.34398	0.477000	0.44152	GTG		0.587	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252213.1	NM_032118		23	62	0	0	0	0.005443	0	23	62				
LRRTM1	347730	broad.mit.edu	37	2	80529975	80529975	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:80529975C>A	ENST00000295057.3	-	2	1626	c.970G>T	c.(970-972)Gcc>Tcc	p.A324S	CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.A324S|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	324	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.A324S(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GAGGCTAGGGCACACACGTTG	0.642										HNSCC(69;0.2)																													uc002sok.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(970-972)GCC>TCC		leucine rich repeat transmembrane neuronal 1							40.0	37.0	38.0					2																	80529975		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80529975C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.970G>T	2.37:g.80529975C>A	ENSP00000295057:p.Ala324Ser	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.A324S	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	1240	-			324			LRRCT.|Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.970G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880950	0.33255	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.38722	1.12;1.12	5.26	5.26	0.73747	.	0.000000	0.85682	U	0.000000	T	0.29914	0.0748	L	0.27975	0.815	0.80722	D	1	P	0.39391	0.671	B	0.31686	0.134	T	0.06356	-1.0831	9	.	.	.	.	18.8459	0.92205	0.0:1.0:0.0:0.0	.	324	Q86UE6	LRRT1_HUMAN	S	324	ENSP00000295057:A324S;ENSP00000386646:A324S	.	A	-	1	0	LRRTM1	80383486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.086000	0.71352	2.416000	0.81992	0.655000	0.94253	GCC		0.642	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		4	24	1	0	1.024e-07	0.000602	1.49517e-07	4	24				
ACTR1B	10120	broad.mit.edu	37	2	98277062	98277062	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:98277062C>A	ENST00000289228.5	-	3	377	c.161G>T	c.(160-162)gGg>gTg	p.G54V		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	54					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.G54V(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						GAAGAGGTCCCCCTCCAGGGC	0.607																																							uc002syb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(160-162)GGG>GTG		ARP1 actin-related protein 1 homolog B,							137.0	130.0	132.0					2																	98277062		2203	4300	6503	SO:0001583	missense	10120					centrosome|dynactin complex	ATP binding|protein binding	g.chr2:98277062C>A	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.161G>T	2.37:g.98277062C>A	ENSP00000289228:p.Gly54Val		Somatic					p.G54V	NM_005735	NP_005726	WXS	Illumina HiSeq	Unspecified	P42025	ACTY_HUMAN			3	369	-			54					D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	ENST00000289228.5	37	c.161G>T	CCDS2033.1	.	.	.	.	.	.	.	.	.	.	.	29.2	4.987555	0.93106	.	.	ENSG00000115073	ENST00000289228	D	0.97089	-4.24	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000001	D	0.98388	0.9464	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99395	1.0926	10	0.87932	D	0	.	16.8234	0.85924	0.0:1.0:0.0:0.0	.	54	P42025	ACTY_HUMAN	V	54	ENSP00000289228:G54V	ENSP00000289228:G54V	G	-	2	0	ACTR1B	97643494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.068000	0.71201	2.591000	0.87537	0.561000	0.74099	GGG		0.607	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735		24	85	1	0	3.17567e-06	0.001512	4.31891e-06	24	85				
ST6GAL2	84620	broad.mit.edu	37	2	107460276	107460276	+	Missense_Mutation	SNP	G	G	A	rs372148383		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:107460276G>A	ENST00000409382.3	-	2	768	c.158C>T	c.(157-159)cCg>cTg	p.P53L	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.P53L|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.P53L	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	53					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.P53L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CCCCTGCACCGGCAGGAGCCT	0.682																																							uc002tdq.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(4)|skin(1)	11						c.(157-159)CCG>CTG		ST6 beta-galactosamide		G	LEU/PRO,LEU/PRO,LEU/PRO	0,4388		0,0,2194	15.0	19.0	18.0		158,158,158	5.7	1.0	2		18	1,8579		0,1,4289	no	missense,missense,missense	ST6GAL2	NM_001142351.1,NM_001142352.1,NM_032528.2	98,98,98	0,1,6483	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	53/530,53/467,53/530	107460276	1,12967	2194	4290	6484	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107460276G>A	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.158C>T	2.37:g.107460276G>A	ENSP00000386942:p.Pro53Leu		Somatic				ST6GAL2_uc002tdr.2_Missense_Mutation_p.P53L|ST6GAL2_uc002tds.3_Missense_Mutation_p.P53L	p.P53L	NM_001142351	NP_001135823	WXS	Illumina HiSeq	Unspecified	Q96JF0	SIAT2_HUMAN			2	277	-			53			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.158C>T	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	32	5.161446	0.94727	0.0	1.17E-4	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.36878	2.28;2.28;1.23	5.74	5.74	0.90152	.	0.049989	0.85682	D	0.000000	T	0.58047	0.2095	L	0.55990	1.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.978	T	0.58092	-0.7697	10	0.87932	D	0	-34.5678	18.8932	0.92413	0.0:0.0:1.0:0.0	.	53;53	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	L	53	ENSP00000355273:P53L;ENSP00000386942:P53L;ENSP00000387332:P53L	ENSP00000355273:P53L	P	-	2	0	ST6GAL2	106826708	1.000000	0.71417	0.963000	0.40424	0.797000	0.45037	8.900000	0.92551	2.701000	0.92244	0.655000	0.94253	CCG		0.682	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		8	41	0	0	0	0.00308	0	8	41				
SAP130	79595	broad.mit.edu	37	2	128712558	128712558	+	Splice_Site	SNP	A	A	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:128712558A>C	ENST00000259235.3	-	15	2525		c.e15+1		SAP130_ENST00000259234.6_Splice_Site|SAP130_ENST00000357702.5_Splice_Site	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.?(2)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		GGACGGACTTACCAGAAACTG	0.488																																							uc002tpp.2		NA																	2	Unknown(2)		lung(2)	ovary(2)|skin(2)	4						c.e15+1		Sin3A-associated protein, 130kDa isoform b							148.0	130.0	136.0					2																	128712558		2203	4300	6503	SO:0001630	splice_region_variant	79595				histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity	g.chr2:128712558A>C	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.2395+1T>G	2.37:g.128712558A>C			Somatic				SAP130_uc002tpn.2_Splice_Site_p.A559_splice|SAP130_uc002tpo.2_Splice_Site_p.A579_splice|SAP130_uc010fmd.2_Splice_Site_p.A834_splice	p.A799_splice	NM_024545	NP_078821	WXS	Illumina HiSeq	Unspecified	Q9H0E3	SP130_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0771)	15	2527	-	Colorectal(110;0.1)							B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Splice_Site	SNP	ENST00000259235.3	37	c.2395_splice	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	-	17.43	3.386593	0.61956	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9292	0.63983	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SAP130	128429028	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	5.399000	0.66314	2.022000	0.59522	0.514000	0.50259	.		0.488	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	Intron	12	72	0	0	0	0.00245	0	12	72				
LRP1B	53353	broad.mit.edu	37	2	142238044	142238044	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:142238044G>T	ENST00000389484.3	-	3	1235	c.264C>A	c.(262-264)aaC>aaA	p.N88K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	88	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.N88K(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAACACATTTGTTGGTACCAA	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(262-264)AAC>AAA		low density lipoprotein-related protein 1B							129.0	112.0	118.0					2																	142238044		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:142238044G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.264C>A	2.37:g.142238044G>T	ENSP00000374135:p.Asn88Lys	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.N88K	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	3	1236	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	88			Extracellular (Potential).|LDL-receptor class A 2.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.264C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	9.390	1.075368	0.20227	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95035	-3.59	5.51	2.65	0.31530	.	0.549864	0.19665	N	0.108889	D	0.85013	0.5600	N	0.11255	0.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73914	-0.3832	10	0.39692	T	0.17	.	5.3352	0.15953	0.0679:0.1223:0.5304:0.2793	.	88	Q9NZR2	LRP1B_HUMAN	K	88;24	ENSP00000374135:N88K	ENSP00000374135:N88K	N	-	3	2	LRP1B	141954514	0.878000	0.30173	0.002000	0.10522	0.613000	0.37349	0.318000	0.19504	0.332000	0.23536	-0.284000	0.09977	AAC		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		5	56	1	0	1.23904e-05	0.000602	1.63375e-05	5	56				
DLX2	1746	broad.mit.edu	37	2	172966194	172966194	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:172966194G>T	ENST00000234198.4	-	2	942	c.581C>A	c.(580-582)aCt>aAt	p.T194N	DLX2_ENST00000466293.2_Missense_Mutation_p.T194N|AC104801.1_ENST00000448117.1_lincRNA	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	194					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)	p.T194N(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCCCACCTGAGTCTGGGTGAG	0.602																																					GBM(188;775 2993 11256 23072)	GBM(188;775 2993 11256 23072)	uc002uhn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(580-582)ACT>AAT		distal-less homeobox 2							8.0	9.0	9.0					2																	172966194		2175	4242	6417	SO:0001583	missense	1746					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:172966194G>T	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.581C>A	2.37:g.172966194G>T	ENSP00000234198:p.Thr194Asn		Somatic				DLX2_uc010zdx.1_Missense_Mutation_p.T194N	p.T194N	NM_004405	NP_004396	WXS	Illumina HiSeq	Unspecified	Q07687	DLX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		2	793	-			194			Homeobox.		B4DMK4|B7ZA14	Missense_Mutation	SNP	ENST00000234198.4	37	c.581C>A	CCDS2248.1	.	.	.	.	.	.	.	.	.	.	G	33	5.231304	0.95207	.	.	ENSG00000115844	ENST00000234198;ENST00000466293	D;D	0.96232	-3.95;-3.95	4.68	4.68	0.58851	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97408	0.9152	L	0.53729	1.69	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.994;0.998	D	0.98481	1.0605	10	0.87932	D	0	-14.3017	17.2011	0.86907	0.0:0.0:1.0:0.0	.	194;194	B7ZA14;Q07687	.;DLX2_HUMAN	N	194	ENSP00000234198:T194N;ENSP00000446904:T194N	ENSP00000234198:T194N	T	-	2	0	DLX2	172674440	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.780000	0.99024	2.128000	0.65567	0.555000	0.69702	ACT		0.602	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255368.3			3	10	1	0	6.4e-05	0.004672	8.36923e-05	3	10				
TTC30A	92104	broad.mit.edu	37	2	178483345	178483345	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:178483345C>T	ENST00000355689.5	-	1	349	c.85G>A	c.(85-87)Gag>Aag	p.E29K	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	29					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.E29K(1)		autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			TGCACCGCCTCGGCGTAGCGG	0.677																																							uc002ulo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(85-87)GAG>AAG		tetratricopeptide repeat domain 30A							9.0	11.0	10.0					2																	178483345		2119	4201	6320	SO:0001583	missense	92104				cell projection organization	cilium	binding	g.chr2:178483345C>T	AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.85G>A	2.37:g.178483345C>T	ENSP00000347915:p.Glu29Lys		Somatic					p.E29K	NM_152275	NP_689488	WXS	Illumina HiSeq	Unspecified	Q86WT1	TT30A_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)		1	350	-			29			TPR 1.		A8K8N0|Q8IVP2	Missense_Mutation	SNP	ENST00000355689.5	37	c.85G>A	CCDS2276.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919904	0.92249	.	.	ENSG00000197557	ENST00000355689	D	0.81821	-1.54	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.193661	0.53938	D	0.000054	D	0.86285	0.5896	L	0.54323	1.7	0.58432	D	0.999999	D	0.76494	0.999	P	0.58520	0.84	D	0.86541	0.1828	10	0.72032	D	0.01	.	18.7402	0.91770	0.0:1.0:0.0:0.0	.	29	Q86WT1	TT30A_HUMAN	K	29	ENSP00000347915:E29K	ENSP00000347915:E29K	E	-	1	0	TTC30A	178191591	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.339000	0.52135	2.868000	0.98415	0.555000	0.69702	GAG		0.677	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255728.2	NM_152275		5	21	0	0	0	0.000602	0	5	21				
DFNB59	494513	broad.mit.edu	37	2	179320856	179320856	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:179320856G>T	ENST00000409117.3	+	4	883	c.527G>T	c.(526-528)gGa>gTa	p.G176V	DFNB59_ENST00000375129.4_Missense_Mutation_p.G176V|DFNB59_ENST00000605419.1_3'UTR	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	176					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)		p.G176V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTGCATGCTGGAATTCGAGGG	0.453																																							uc002umi.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)GGA>GTA		deafness, autosomal recessive 59							55.0	55.0	55.0					2																	179320856		1999	4168	6167	SO:0001583	missense	494513				sensory perception of sound			g.chr2:179320856G>T	BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.527G>T	2.37:g.179320856G>T	ENSP00000386647:p.Gly176Val		Somatic				DFNB59_uc002umj.3_Missense_Mutation_p.G176V	p.G176V	NM_001042702	NP_001036167	WXS	Illumina HiSeq	Unspecified	Q0ZLH3	PJVK_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)		4	883	+			176					A0PK14|B9EJE2	Missense_Mutation	SNP	ENST00000409117.3	37	c.527G>T	CCDS42787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.508725|4.508725	0.85282|0.85282	.|.	.|.	ENSG00000204311|ENSG00000204311	ENST00000409117;ENST00000375129|ENST00000442710	T;T|.	0.21734|.	1.99;1.99|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.000000|.	0.33834|.	U|.	0.004508|.	T|T	0.75708|0.75708	0.3886|0.3886	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.68353|.	0.957|.	T|T	0.72337|0.72337	-0.4324|-0.4324	10|5	0.59425|.	D|.	0.04|.	-5.5315|-5.5315	20.1041|20.1041	0.97884|0.97884	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	176|.	Q0ZLH3|.	PJVK_HUMAN|.	V|C	176|123	ENSP00000386647:G176V;ENSP00000364271:G176V|.	ENSP00000364271:G176V|.	G|W	+|+	2|3	0|0	DFNB59|DFNB59	179029102|179029102	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.780000|7.780000	0.85658|0.85658	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.453	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335160.1			12	26	1	0	1.08611e-07	0.000978	1.5619e-07	12	26				
TTN	7273	broad.mit.edu	37	2	179592313	179592313	+	Splice_Site	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:179592313T>A	ENST00000591111.1	-	66	19265	c.19041A>T	c.(19039-19041)acA>acT	p.T6347T	TTN_ENST00000342992.6_Splice_Site_p.T5420T|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Splice_Site_p.T6664T|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13119	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T5420T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGCACACCTGTCACAAGCA	0.378																																							uc010zfg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16258-16260)ACA>ACT		titin isoform N2-A							161.0	160.0	160.0					2																	179592313		2055	4211	6266	SO:0001630	splice_region_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179592313T>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19042+1A>T	2.37:g.179592313T>A			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.T2081T	p.T5420T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		65	16484	-			6347					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.16260A>T																																																																																					0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Silent	17	227	0	0	0	0.007413	0	17	227				
PMS1	5378	broad.mit.edu	37	2	190738322	190738322	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:190738322A>T	ENST00000441310.2	+	12	2807	c.2574A>T	c.(2572-2574)ttA>ttT	p.L858F	PMS1_ENST00000418224.3_Missense_Mutation_p.L682F|PMS1_ENST00000447232.2_Missense_Mutation_p.L696F|PMS1_ENST00000432292.3_Missense_Mutation_p.L682F|PMS1_ENST00000409823.3_Missense_Mutation_p.L819F	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	858					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.L858F(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			ATGCTATATTAAACAGAAATG	0.303			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															uc002urh.3		NA	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	Mis|N	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)			E		colorectal|endometrial|ovarian			1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(2572-2574)TTA>TTT	Direct_reversal_of_damage|MMR	postmeiotic segregation 1 isoform a							44.0	50.0	48.0					2																	190738322		2202	4300	6502	SO:0001583	missense	5378				mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding	g.chr2:190738322A>T		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2574A>T	2.37:g.190738322A>T	ENSP00000406490:p.Leu858Phe		Somatic				PMS1_uc002urk.3_Missense_Mutation_p.L819F|PMS1_uc002uri.3_Missense_Mutation_p.L696F|PMS1_uc010zgc.1_Missense_Mutation_p.L682F|PMS1_uc010zgd.1_Missense_Mutation_p.L682F|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_3'UTR|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.L481F|PMS1_uc002urm.2_RNA	p.L858F	NM_000534	NP_000525	WXS	Illumina HiSeq	Unspecified	P54277	PMS1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)		12	3103	+			858					D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	37	c.2574A>T	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.321743	0.60634	.	.	ENSG00000064933	ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000409593;ENST00000452382	D;D;D;D;D;D;T	0.96967	-2.48;-2.2;-2.64;-2.99;-2.2;-4.19;1.74	5.97	3.6	0.41247	.	0.484740	0.21579	N	0.072275	D	0.93377	0.7888	L	0.43152	1.355	0.28363	N	0.92037	D;P;P;P	0.60575	0.988;0.907;0.933;0.846	P;P;P;P	0.51615	0.675;0.472;0.542;0.472	D	0.86353	0.1712	10	0.09590	T	0.72	-0.1704	4.2386	0.10637	0.6765:0.1227:0.0691:0.1317	.	481;819;696;858	Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;PMS1_HUMAN	F	858;682;819;696;682;481;246	ENSP00000406490:L858F;ENSP00000404492:L682F;ENSP00000387125:L819F;ENSP00000401064:L696F;ENSP00000398378:L682F;ENSP00000387169:L481F;ENSP00000396232:L246F	ENSP00000387169:L481F	L	+	3	2	PMS1	190446567	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.419000	0.44671	1.049000	0.40321	0.528000	0.53228	TTA		0.303	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2			38	77	0	0	0	0.005524	0	38	77				
PLCL1	5334	broad.mit.edu	37	2	198949108	198949108	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:198949108G>T	ENST00000428675.1	+	2	1265	c.867G>T	c.(865-867)aaG>aaT	p.K289N	PLCL1_ENST00000437704.2_Missense_Mutation_p.K191N	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	289					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.K289N(1)|p.K191N(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	AAATCCAGAAGAGCAAGGAAA	0.403																																							uc010fsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(865-867)AAG>AAT		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						105.0	108.0	107.0					2																	198949108		2203	4300	6503	SO:0001583	missense	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198949108G>T	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.867G>T	2.37:g.198949108G>T	ENSP00000402861:p.Lys289Asn		Somatic				PLCL1_uc002uuv.3_Missense_Mutation_p.K210N	p.K289N	NM_001114661	NP_001108133	WXS	Illumina HiSeq	Unspecified	Q15111	PLCL1_HUMAN			2	1158	+			289					Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	c.867G>T	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780227	0.49891	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.47528	0.84;0.84	6.04	4.26	0.50523	EF-hand-like domain (1);	0.072347	0.64402	D	0.000017	T	0.50531	0.1621	L	0.39898	1.24	0.48762	D	0.999701	D;D	0.58970	0.984;0.984	P;P	0.54590	0.756;0.67	T	0.42396	-0.9454	9	.	.	.	.	12.5814	0.56393	0.1328:0.0:0.8672:0.0	.	289;215	Q15111;B4DYZ4	PLCL1_HUMAN;.	N	289;191	ENSP00000402861:K289N;ENSP00000414138:K191N	.	K	+	3	2	PLCL1	198657353	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.074000	0.30703	0.904000	0.36572	0.561000	0.74099	AAG		0.403	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		8	129	1	0	5.4927e-09	0.004482	8.30008e-09	8	129				
PLCL1	5334	broad.mit.edu	37	2	198950297	198950297	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:198950297C>G	ENST00000428675.1	+	2	2454	c.2056C>G	c.(2056-2058)Ctt>Gtt	p.L686V	PLCL1_ENST00000437704.2_Missense_Mutation_p.L588V	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	686	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.L588V(1)|p.L686V(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GGGCTGGTTTCTTCAAAACGG	0.453																																							uc010fsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(2056-2058)CTT>GTT		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						75.0	76.0	76.0					2																	198950297		2203	4299	6502	SO:0001583	missense	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198950297C>G	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2056C>G	2.37:g.198950297C>G	ENSP00000402861:p.Leu686Val		Somatic				PLCL1_uc002uuv.3_Missense_Mutation_p.L607V	p.L686V	NM_001114661	NP_001108133	WXS	Illumina HiSeq	Unspecified	Q15111	PLCL1_HUMAN			2	2347	+			686			PI-PLC Y-box.		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	c.2056C>G	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	C	3.835	-0.034914	0.07543	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.67171	-0.25;-0.25	5.36	5.36	0.76844	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.105629	0.42682	D	0.000665	T	0.59569	0.2203	L	0.51422	1.61	0.37795	D	0.927498	B;B	0.29805	0.257;0.257	B;B	0.36030	0.216;0.216	T	0.59521	-0.7439	9	.	.	.	.	7.0718	0.25183	0.1561:0.7223:0.0:0.1216	.	686;612	Q15111;B4DYZ4	PLCL1_HUMAN;.	V	686;588	ENSP00000402861:L686V;ENSP00000414138:L588V	.	L	+	1	0	PLCL1	198658542	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.779000	0.38624	2.793000	0.96121	0.561000	0.74099	CTT		0.453	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		5	140	0	0	0	0.000602	0	5	140				
MDH1B	130752	broad.mit.edu	37	2	207621721	207621721	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:207621721A>C	ENST00000374412.3	-	4	589	c.314T>G	c.(313-315)aTg>aGg	p.M105R	MDH1B_ENST00000392214.2_Missense_Mutation_p.M105R|MDH1B_ENST00000449792.1_Missense_Mutation_p.M7R|MDH1B_ENST00000454776.2_Missense_Mutation_p.M105R	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	105					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.M105R(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		AGCAATTACCATCATCAGTTC	0.418																																					Pancreas(76;29 1355 28675 37177 51207)	Pancreas(76;29 1355 28675 37177 51207)	uc002vbs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(313-315)ATG>AGG		malate dehydrogenase 1B, NAD (soluble)							107.0	99.0	102.0					2																	207621721		2203	4300	6503	SO:0001583	missense	130752				carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity	g.chr2:207621721A>C		CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.314T>G	2.37:g.207621721A>C	ENSP00000363533:p.Met105Arg		Somatic				MDH1B_uc010ziw.1_RNA|MDH1B_uc010fui.2_Missense_Mutation_p.M105R|MDH1B_uc010fuj.2_Missense_Mutation_p.M7R|MDH1B_uc002vbt.2_RNA	p.M105R	NM_001039845	NP_001034934	WXS	Illumina HiSeq	Unspecified	Q5I0G3	MDH1B_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)	4	369	-			105					A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	ENST00000374412.3	37	c.314T>G	CCDS33365.1	.	.	.	.	.	.	.	.	.	.	A	3.952	-0.011990	0.07727	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776;ENST00000392214	T;T;T;T	0.58210	0.35;1.52;0.35;0.35	6.08	-1.02	0.10135	.	0.376108	0.30311	N	0.009915	T	0.35799	0.0944	L	0.36672	1.1	0.09310	N	1	B;B	0.18863	0.031;0.018	B;B	0.17098	0.017;0.008	T	0.19844	-1.0293	10	0.30078	T	0.28	-11.8896	8.6761	0.34181	0.2756:0.0:0.0674:0.6569	.	105;105	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	R	105;7;105;105	ENSP00000363533:M105R;ENSP00000416577:M7R;ENSP00000389916:M105R;ENSP00000376049:M105R	ENSP00000363533:M105R	M	-	2	0	MDH1B	207329966	0.418000	0.25440	0.185000	0.23176	0.136000	0.21042	1.089000	0.30890	-0.074000	0.12820	-0.301000	0.09380	ATG		0.418	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845		14	53	0	0	0	0.004007	0	14	53				
IDH1	3417	broad.mit.edu	37	2	209103826	209103826	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:209103826C>A	ENST00000415913.1	-	9	1504	c.1123G>T	c.(1123-1125)Gac>Tac	p.D375Y	IDH1_ENST00000345146.2_Missense_Mutation_p.D375Y|IDH1_ENST00000446179.1_Missense_Mutation_p.D375Y	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	375					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.D375Y(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		GCAGCCAAGTCCTTGGTCATG	0.423			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	Pancreas(158;264 1958 3300 35450 36047)	uc002vcs.2		NA		Dom	yes		2	2q33.3	3417	Mis	"""isocitrate dehydrogenase 1 (NADP+), soluble"""			O			gliobastoma 		1	Substitution - Missense(1)		lung(1)	central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868						c.(1123-1125)GAC>TAC		isocitrate dehydrogenase 1 (NADP+), soluble							95.0	89.0	91.0					2																	209103826		2203	4300	6503	SO:0001583	missense	3417				2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	g.chr2:209103826C>A		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.1123G>T	2.37:g.209103826C>A	ENSP00000390265:p.Asp375Tyr		Somatic				IDH1_uc002vct.2_Missense_Mutation_p.D375Y|IDH1_uc002vcu.2_Missense_Mutation_p.D375Y	p.D375Y	NM_005896	NP_005887	WXS	Illumina HiSeq	Unspecified	O75874	IDHC_HUMAN		Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)	9	1369	-			375					Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	c.1123G>T	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361382	0.82353	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	D;D;D	0.92199	-2.99;-2.99;-2.99	5.53	4.66	0.58398	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.97857	0.9296	H	0.99299	4.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99143	1.0856	10	0.87932	D	0	-14.1247	14.6379	0.68702	0.0:0.93:0.0:0.07	.	375	O75874	IDHC_HUMAN	Y	375	ENSP00000260985:D375Y;ENSP00000410513:D375Y;ENSP00000390265:D375Y	ENSP00000260985:D375Y	D	-	1	0	IDH1	208812071	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	1.492000	0.48499	0.585000	0.79938	GAC		0.423	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			19	79	1	0	1.78486e-19	0.007413	3.20602e-19	19	79				
IDH1	3417	broad.mit.edu	37	2	209104696	209104696	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:209104696C>A	ENST00000415913.1	-	8	1263	c.882G>T	c.(880-882)gtG>gtT	p.V294V	IDH1_ENST00000345146.2_Silent_p.V294V|IDH1_ENST00000446179.1_Silent_p.V294V	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	294					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.V294V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		GACAAACCAGCACGCTGGTCA	0.542			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	Pancreas(158;264 1958 3300 35450 36047)	uc002vcs.2		NA		Dom	yes		2	2q33.3	3417	Mis	"""isocitrate dehydrogenase 1 (NADP+), soluble"""			O			gliobastoma 		1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868						c.(880-882)GTG>GTT		isocitrate dehydrogenase 1 (NADP+), soluble							133.0	103.0	113.0					2																	209104696		2203	4300	6503	SO:0001819	synonymous_variant	3417				2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	g.chr2:209104696C>A		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.882G>T	2.37:g.209104696C>A			Somatic				IDH1_uc002vct.2_Silent_p.V294V|IDH1_uc002vcu.2_Silent_p.V294V	p.V294V	NM_005896	NP_005887	WXS	Illumina HiSeq	Unspecified	O75874	IDHC_HUMAN		Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)	8	1128	-			294					Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Silent	SNP	ENST00000415913.1	37	c.882G>T	CCDS2381.1																																																																																				0.542	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			25	61	1	0	5.61819e-17	0.005443	9.79581e-17	25	61				
CCDC108	255101	broad.mit.edu	37	2	219890792	219890792	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:219890792G>A	ENST00000341552.5	-	14	2384	c.2301C>T	c.(2299-2301)ttC>ttT	p.F767F	CCDC108_ENST00000441968.1_Silent_p.F767F|CCDC108_ENST00000453220.1_Silent_p.F767F	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	767						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.F767F(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAAGCCAGCGAAATAGCTGT	0.597																																							uc002vjl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(2299-2301)TTC>TTT		coiled-coil domain containing 108 isoform 1							85.0	76.0	79.0					2																	219890792		2203	4300	6503	SO:0001819	synonymous_variant	255101					integral to membrane	structural molecule activity	g.chr2:219890792G>A	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2301C>T	2.37:g.219890792G>A			Somatic					p.F767F	NM_194302	NP_919278	WXS	Illumina HiSeq	Unspecified	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	14	2385	-		Renal(207;0.0915)	767					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	c.2301C>T	CCDS2430.2																																																																																				0.597	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		5	59	0	0	0	0.000602	0	5	59				
ALPP	250	broad.mit.edu	37	2	233246046	233246046	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:233246046C>T	ENST00000392027.2	+	10	1547	c.1278C>T	c.(1276-1278)ggC>ggT	p.G426G	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	426					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)	p.G426G(2)		NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCAAGGACGGCGCCCGGCCGG	0.697																																							uc002vsq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1276-1278)GGC>GGT		placental alkaline phosphatase preproprotein							55.0	65.0	62.0					2																	233246046		2203	4300	6503	SO:0001819	synonymous_variant	250					anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	g.chr2:233246046C>T	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1278C>T	2.37:g.233246046C>T			Somatic				ALPP_uc002vsr.2_RNA	p.G426G	NM_001632	NP_001623	WXS	Illumina HiSeq	Unspecified	P05187	PPB1_HUMAN		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	10	1443	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	426					P05188|P06861|Q53S78|Q96DB7	Silent	SNP	ENST00000392027.2	37	c.1278C>T	CCDS2490.1																																																																																				0.697	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632		6	74	0	0	0	0.001984	0	6	74				
UGT1A7	54577	broad.mit.edu	37	2	234590853	234590853	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:234590853C>T	ENST00000373426.3	+	1	270	c.270C>T	c.(268-270)ttC>ttT	p.F90F	UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	90					cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)	p.F90F(1)		NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	ACCGGGAGTTCATGGTTTTTG	0.433																																							uc002vut.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(268-270)TTC>TTT		UDP glycosyltransferase 1 family, polypeptide A7							123.0	118.0	120.0					2																	234590853		2203	4300	6503	SO:0001819	synonymous_variant	54577				drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding	g.chr2:234590853C>T	U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	ENST00000373426.3:c.270C>T	2.37:g.234590853C>T			Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Silent_p.F90F	p.F90F	NM_019077	NP_061950	WXS	Illumina HiSeq	Unspecified	Q9HAW7	UD17_HUMAN		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	1	270	+		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)	90					B8K293|O00473	Silent	SNP	ENST00000373426.3	37	c.270C>T	CCDS2506.1																																																																																				0.433	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130614.1	NM_019077		55	139	0	0	0	0.00361	0	55	139				
HDAC4	9759	broad.mit.edu	37	2	239988418	239988418	+	Splice_Site	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:239988418C>A	ENST00000345617.3	-	24	3779	c.2988G>T	c.(2986-2988)gaG>gaT	p.E996D	AC017028.6_ENST00000577291.1_RNA|AC017028.10_ENST00000579161.1_RNA|MIR4440_ENST00000583986.1_RNA|AC017028.2_ENST00000578555.1_RNA|AC017028.9_ENST00000581111.1_RNA|HDAC4_ENST00000543185.1_Splice_Site_p.E580D|AC017028.3_ENST00000584260.1_RNA|AC017028.4_ENST00000577359.1_RNA	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	996	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E996D(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GTCTTCCTACCTCGTTTCCCA	0.637																																							uc002vyk.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|skin(2)|ovary(1)	6						c.(2986-2988)GAG>GAT		histone deacetylase 4							103.0	104.0	104.0					2																	239988418		2203	4300	6503	SO:0001630	splice_region_variant	9759				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding	g.chr2:239988418C>A	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2988+1G>T	2.37:g.239988418C>A			Somatic				HDAC4_uc010fyy.2_Missense_Mutation_p.E953D	p.E996D	NM_006037	NP_006028	WXS	Illumina HiSeq	Unspecified	P56524	HDAC4_HUMAN		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)	24	3780	-		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)	996			Histone deacetylase.		Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	c.2988G>T	CCDS2529.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.44|16.44	3.123014|3.123014	0.56613|0.56613	.|.	.|.	ENSG00000068024|ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185|ENST00000430200	T;T|.	0.65916|.	0.2;-0.18|.	4.21|4.21	3.29|3.29	0.37713|0.37713	Histone deacetylase domain (1);|.	0.052189|.	0.85682|.	D|.	0.000000|.	T|T	0.66665|0.66665	0.2812|0.2812	L|L	0.53617|0.53617	1.68|1.68	0.52099|0.52099	D|D	0.999947|0.999947	B;B|.	0.10296|.	0.0;0.003|.	B;B|.	0.14023|.	0.002;0.01|.	T|T	0.64997|0.64997	-0.6275|-0.6275	9|5	.|.	.|.	.|.	.|.	14.2332|14.2332	0.65908|0.65908	0.0:0.8487:0.1513:0.0|0.0:0.8487:0.1513:0.0	.|.	964;996|.	Q53SM2;P56524|.	.;HDAC4_HUMAN|.	D|I	996;884;580|87	ENSP00000264606:E996D;ENSP00000440481:E580D|.	.|.	E|S	-|-	3|2	2|0	HDAC4|HDAC4	239653355|239653355	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.851000|0.851000	0.48451|0.48451	7.342000|7.342000	0.79310|0.79310	1.007000|1.007000	0.39238|0.39238	0.591000|0.591000	0.81541|0.81541	GAG|AGC		0.637	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	Missense_Mutation	53	126	1	0	3.21867e-24	0.00361	6.12835e-24	53	126				
GPR35	2859	broad.mit.edu	37	2	241569993	241569993	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:241569993G>A	ENST00000319838.5	+	6	1566	c.624G>A	c.(622-624)caG>caA	p.Q208Q	GPR35_ENST00000438013.2_Silent_p.Q239Q|GPR35_ENST00000407714.1_Silent_p.Q208Q|GPR35_ENST00000430267.1_Silent_p.Q208Q|GPR35_ENST00000403859.1_Silent_p.Q208Q	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	208					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.Q208Q(1)		NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		ACGTGGGGCAGGCAGAGGCCA	0.687																																							uc002vzs.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|pancreas(1)	3						c.(622-624)CAG>CAA		G protein-coupled receptor 35							40.0	37.0	38.0					2																	241569993		2203	4298	6501	SO:0001819	synonymous_variant	2859					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:241569993G>A		CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.624G>A	2.37:g.241569993G>A			Somatic				GPR35_uc010fzh.1_Silent_p.Q239Q|GPR35_uc010fzi.1_Silent_p.Q239Q	p.Q208Q	NM_005301	NP_005292	WXS	Illumina HiSeq	Unspecified	Q9HC97	GPR35_HUMAN		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)	1	1199	+		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)	208			Cytoplasmic (Potential).		J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Silent	SNP	ENST00000319838.5	37	c.624G>A	CCDS2541.1																																																																																				0.687	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382		21	28	0	0	0	0.001523	0	21	28				
AQP12B	653437	broad.mit.edu	37	2	241622061	241622061	+	Missense_Mutation	SNP	C	C	A	rs200240739		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:241622061C>A	ENST00000407834.3	-	1	256	c.194G>T	c.(193-195)gGg>gTg	p.G65V		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	53						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.G65V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CCCAAAGTCCCCAGCCCAGGG	0.701																																							uc010fzj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)GGG>GTG		aquaporin 12B							44.0	46.0	46.0					2																	241622061		2203	4297	6500	SO:0001583	missense	653437					integral to membrane	transporter activity	g.chr2:241622061C>A	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.194G>T	2.37:g.241622061C>A	ENSP00000384894:p.Gly65Val		Somatic				AQP12B_uc002vzt.2_Intron	p.G65V	NM_001102467	NP_001095937	WXS	Illumina HiSeq	Unspecified	A6NM10	AQ12B_HUMAN		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)	1	257	-		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	53					A4QPB9	Missense_Mutation	SNP	ENST00000407834.3	37	c.194G>T	CCDS46560.1	.	.	.	.	.	.	.	.	.	.	.	11.18	1.561615	0.27915	.	.	ENSG00000185176	ENST00000407834	T	0.18502	2.21	2.53	0.475	0.16774	.	0.179734	0.49305	D	0.000157	T	0.33498	0.0865	M	0.76328	2.33	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.04041	-1.0982	9	.	.	.	-0.8614	9.7574	0.40510	0.0:0.5938:0.4062:0.0	.	65	A6NM10-2	.	V	65	ENSP00000384894:G65V	.	G	-	2	0	AQP12B	241270734	0.999000	0.42202	0.091000	0.20842	0.070000	0.16714	3.003000	0.49505	0.105000	0.17753	0.479000	0.44913	GGG		0.701	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1			20	32	1	0	1.33834e-09	0.007413	2.06165e-09	20	32				
MYH7B	57644	broad.mit.edu	37	20	33578063	33578063	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:33578063G>C	ENST00000262873.7	+	20	2145	c.2053G>C	c.(2053-2055)Gag>Cag	p.E685Q	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	643	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E685Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGGGGTGAAAGAGAAGCGTAA	0.597																																							uc002xbi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(2053-2055)GAG>CAG		myosin, heavy polypeptide 7B, cardiac muscle,							83.0	91.0	88.0					20																	33578063		2203	4300	6503	SO:0001583	missense	57644					membrane|myosin filament	actin binding|ATP binding|motor activity	g.chr20:33578063G>C	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.2053G>C	20.37:g.33578063G>C	ENSP00000262873:p.Glu685Gln		Somatic				MIR499_hsa-mir-499|MI0003183_5'Flank	p.E685Q	NM_020884	NP_065935	WXS	Illumina HiSeq	Unspecified	A7E2Y1	MYH7B_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00691)		20	2145	+			643			Myosin head-like.		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	c.2053G>C	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041116	0.55003	.	.	ENSG00000078814	ENST00000262873	D	0.87571	-2.27	4.39	4.39	0.52855	Myosin head, motor domain (2);	0.000000	0.38381	N	0.001715	D	0.82678	0.5089	L	0.28608	0.87	0.46874	D	0.999232	B	0.21071	0.051	B	0.27608	0.081	T	0.80569	-0.1324	10	0.59425	D	0.04	.	17.5203	0.87784	0.0:0.0:1.0:0.0	.	643	A7E2Y1	MYH7B_HUMAN	Q	685	ENSP00000262873:E685Q	ENSP00000262873:E685Q	E	+	1	0	MYH7B	33041724	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.218000	0.65257	2.445000	0.82738	0.511000	0.50034	GAG		0.597	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884		5	252	0	0	0	0.001984	0	5	252				
DLGAP4	22839	broad.mit.edu	37	20	35060507	35060507	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:35060507C>T	ENST00000373907.2	+	2	586	c.387C>T	c.(385-387)gcC>gcT	p.A129A	DLGAP4_ENST00000373913.3_Silent_p.A129A|DLGAP4_ENST00000339266.5_Silent_p.A129A|DLGAP4_ENST00000401952.2_Silent_p.A129A			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	129					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.A129A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GTGGCGAGGCCAAGGCCCGTG	0.642																																							uc002xff.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(385-387)GCC>GCT		disks large-associated protein 4 isoform a							61.0	64.0	63.0					20																	35060507		2203	4300	6503	SO:0001819	synonymous_variant	22839				cell-cell signaling	membrane	protein binding	g.chr20:35060507C>T	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.387C>T	20.37:g.35060507C>T			Somatic				DLGAP4_uc010zvp.1_Silent_p.A129A	p.A129A	NM_014902	NP_055717	WXS	Illumina HiSeq	Unspecified	Q9Y2H0	DLGP4_HUMAN			3	822	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	129					E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	ENST00000373907.2	37	c.387C>T																																																																																					0.642	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902		25	232	0	0	0	0.00333	0	25	232				
PPP1R16B	26051	broad.mit.edu	37	20	37547132	37547132	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:37547132G>T	ENST00000299824.1	+	11	1716	c.1527G>T	c.(1525-1527)acG>acT	p.T509T	PPP1R16B_ENST00000373331.2_Silent_p.T467T	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	509					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.T509T(1)		biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				TGGCCAGGACGGGCGAGAGTA	0.622																																							uc002xje.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3						c.(1525-1527)ACG>ACT		protein phosphatase 1 regulatory inhibitor							66.0	55.0	59.0					20																	37547132		2203	4300	6503	SO:0001819	synonymous_variant	26051				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding	g.chr20:37547132G>T	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1527G>T	20.37:g.37547132G>T			Somatic				PPP1R16B_uc010ggc.2_Silent_p.T467T	p.T509T	NM_015568	NP_056383	WXS	Illumina HiSeq	Unspecified	Q96T49	PP16B_HUMAN			11	1716	+		Myeloproliferative disorder(115;0.00878)	509					A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Silent	SNP	ENST00000299824.1	37	c.1527G>T	CCDS13309.1	.	.	.	.	.	.	.	.	.	.	G	6.602	0.479415	0.12581	.	.	ENSG00000101445	ENST00000438192	.	.	.	5.35	-1.55	0.08558	.	.	.	.	.	T	0.17916	0.0430	.	.	.	0.20489	N	0.999895	.	.	.	.	.	.	T	0.22487	-1.0215	4	.	.	.	.	0.319	0.00300	0.331:0.2102:0.2444:0.2144	.	.	.	.	L	410	.	.	R	+	2	0	PPP1R16B	36980546	0.009000	0.17119	0.168000	0.22838	0.996000	0.88848	-0.138000	0.10374	-0.564000	0.06070	-0.137000	0.14449	CGG		0.622	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568		22	21	1	0	5.26018e-13	0.001882	8.57481e-13	22	21				
CASS4	57091	broad.mit.edu	37	20	55027049	55027050	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:55027049_55027050CC>AA	ENST00000360314.3	+	6	1042_1043	c.817_818CC>AA	c.(817-819)CCc>AAc	p.P273N	CASS4_ENST00000371336.3_Missense_Mutation_p.P273N|CASS4_ENST00000434344.1_Intron	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	273					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.P273N(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CCACGCTCTCCCCAGTTCCAGC	0.515																																							uc002xxp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(817-819)CCC>AAC		HEF-like protein isoform a																																				SO:0001583	missense	57091				cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity	g.chr20:55027049_55027050CC>AA	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	Exception_encountered	20.37:g.55027049_55027050delinsAA	ENSP00000353462:p.Pro273Asn		Somatic				CASS4_uc002xxq.3_Missense_Mutation_p.P273N|CASS4_uc002xxr.2_Missense_Mutation_p.P273N|CASS4_uc010zze.1_Missense_Mutation_p.P219N|CASS4_uc010gio.2_Intron	p.P273N	NM_001164116	NP_001157588	WXS	Illumina HiSeq	Unspecified	Q9NQ75	CASS4_HUMAN			6	1042_1043	+			273					E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	DNP	ENST00000360314.3	37	c.817_818CC>AA	CCDS33492.1																																																																																				0.515	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		37	176	0	0	0	0.004672	0	37	176				
EDN3	1908	broad.mit.edu	37	20	57876513	57876513	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:57876513C>T	ENST00000337938.2	+	2	487	c.101C>T	c.(100-102)tCc>tTc	p.S34F	EDN3_ENST00000395654.3_Missense_Mutation_p.S34F|EDN3_ENST00000311585.7_Missense_Mutation_p.S34F|EDN3_ENST00000371028.2_Missense_Mutation_p.S34F|EDN3_ENST00000371025.3_Missense_Mutation_p.S34F	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	34					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.S34F(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CGCGGCGTGTCCCAGGCCCCC	0.657																																							uc002yap.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(100-102)TCC>TTC		endothelin 3 isoform 1 preproprotein							27.0	30.0	29.0					20																	57876513		2203	4299	6502	SO:0001583	missense	1908				cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity	g.chr20:57876513C>T	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.101C>T	20.37:g.57876513C>T	ENSP00000337128:p.Ser34Phe		Somatic				EDN3_uc002yao.1_Missense_Mutation_p.S34F|EDN3_uc002yaq.2_Missense_Mutation_p.S34F|EDN3_uc002yar.2_Missense_Mutation_p.S34F|EDN3_uc002yas.2_Missense_Mutation_p.S34F	p.S34F	NM_000114	NP_000105	WXS	Illumina HiSeq	Unspecified	P14138	EDN3_HUMAN			2	470	+	all_lung(29;0.0115)		34					E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	37	c.101C>T	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	C	7.260	0.604929	0.14002	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	4.64	2.63	0.31362	.	1.414890	0.04516	N	0.383705	D	0.84293	0.5440	L	0.36672	1.1	0.09310	N	1	P;P;P;P	0.50443	0.935;0.893;0.893;0.744	P;B;B;B	0.46543	0.52;0.44;0.321;0.31	T	0.71210	-0.4660	10	0.59425	D	0.04	-7.5792	5.7437	0.18108	0.3483:0.5591:0.0:0.0926	.	34;34;34;34	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	F	34	ENSP00000337128:S34F;ENSP00000311854:S34F;ENSP00000360067:S34F;ENSP00000360064:S34F;ENSP00000379015:S34F	ENSP00000311854:S34F	S	+	2	0	EDN3	57309908	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.473000	0.22132	0.441000	0.26529	0.491000	0.48974	TCC		0.657	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114		78	31	0	0	0	0.00361	0	78	31				
MRGBP	55257	broad.mit.edu	37	20	61430850	61430850	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr20:61430850C>G	ENST00000370487.3	+	5	541	c.470C>G	c.(469-471)tCc>tGc	p.S157C	OGFR-AS1_ENST00000431361.1_RNA	NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	157					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S157C(1)									TCAGAAAAATCCAGCAAAGAC	0.453																																							uc002ydi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(469-471)TCC>TGC		MRG-binding protein							85.0	96.0	92.0					20																	61430850		2203	4300	6503	SO:0001583	missense	55257				chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex		g.chr20:61430850C>G	AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.470C>G	20.37:g.61430850C>G	ENSP00000359518:p.Ser157Cys		Somatic					p.S157C	NM_018270	NP_060740	WXS	Illumina HiSeq	Unspecified	Q9NV56	MRGBP_HUMAN			5	541	+	Breast(26;3.65e-08)		157					A8C4L5	Missense_Mutation	SNP	ENST00000370487.3	37	c.470C>G	CCDS13503.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578372	0.45902	.	.	ENSG00000101189	ENST00000370487	.	.	.	5.47	4.51	0.55191	.	0.609184	0.18259	N	0.146696	T	0.53206	0.1782	L	0.29908	0.895	0.46981	D	0.999278	B	0.09022	0.002	B	0.08055	0.003	T	0.50783	-0.8787	9	0.72032	D	0.01	-4.5047	16.2242	0.82283	0.0:0.8667:0.1333:0.0	.	157	Q9NV56	MRGBP_HUMAN	C	157	.	ENSP00000359518:S157C	S	+	2	0	C20orf20	60901295	1.000000	0.71417	0.885000	0.34714	0.990000	0.78478	3.495000	0.53280	1.264000	0.44198	0.655000	0.94253	TCC		0.453	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080080.1	NM_018270		9	170	0	0	0	0.004482	0	9	170				
TPTE	7179	broad.mit.edu	37	21	10908861	10908861	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr21:10908861T>C	ENST00000361285.4	-	23	1813	c.1484A>G	c.(1483-1485)tAc>tGc	p.Y495C	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.Y477C|TPTE_ENST00000342420.5_Missense_Mutation_p.Y457C	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	495	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Y477C(1)|p.Y495C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CAACCAGAAGTAAAATGAGCA	0.279																																							uc002yip.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1483-1485)TAC>TGC		transmembrane phosphatase with tensin homology							128.0	120.0	122.0					21																	10908861		2202	4297	6499	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10908861T>C	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1484A>G	21.37:g.10908861T>C	ENSP00000355208:p.Tyr495Cys		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.Y477C|TPTE_uc002yir.1_Missense_Mutation_p.Y457C|TPTE_uc010gkv.1_Missense_Mutation_p.Y357C	p.Y495C	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	23	1852	-			495			C2 tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.1484A>G	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	6.144	0.394709	0.11638	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.85484	-1.99;-1.99;-1.99	2.18	2.18	0.27775	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.068647	0.64402	U	0.000011	D	0.84683	0.5526	L	0.36672	1.1	0.29168	N	0.877302	D;D;D	0.67145	0.996;0.996;0.972	D;D;P	0.65987	0.94;0.94;0.84	T	0.77330	-0.2628	10	0.72032	D	0.01	-14.3846	5.0981	0.14745	0.5081:0.0:0.0:0.4919	.	457;477;495	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	C	477;495;457	ENSP00000298232:Y477C;ENSP00000355208:Y495C;ENSP00000344441:Y457C	ENSP00000298232:Y477C	Y	-	2	0	TPTE	9930732	0.998000	0.40836	0.931000	0.37212	0.013000	0.08279	0.366000	0.20365	0.275000	0.22094	-1.489000	0.00976	TAC		0.279	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			4	97	0	0	0	0.000602	0	4	97				
NRIP1	8204	broad.mit.edu	37	21	16339433	16339433	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr21:16339433C>A	ENST00000400202.1	-	3	1793	c.1081G>T	c.(1081-1083)Ggt>Tgt	p.G361C	NRIP1_ENST00000318948.4_Missense_Mutation_p.G361C|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.G361C			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	361	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G361C(1)		cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTCTTATAACCTGCATTTTTA	0.363																																							uc002yjx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1081-1083)GGT>TGT		nuclear receptor interacting protein 1							115.0	111.0	112.0					21																	16339433		2203	4299	6502	SO:0001583	missense	8204				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity	g.chr21:16339433C>A	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.1081G>T	21.37:g.16339433C>A	ENSP00000383063:p.Gly361Cys		Somatic					p.G361C	NM_003489	NP_003480	WXS	Illumina HiSeq	Unspecified	P48552	NRIP1_HUMAN		Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)	4	1679	-			361					Q8IWE8	Missense_Mutation	SNP	ENST00000400202.1	37	c.1081G>T	CCDS13568.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918316	0.33908	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.09817	2.94;2.94;2.94	6.02	2.23	0.28157	.	0.543518	0.18706	N	0.133456	T	0.14399	0.0348	L	0.43152	1.355	0.20563	N	0.999883	P	0.48503	0.911	P	0.49752	0.621	T	0.06373	-1.0830	10	0.54805	T	0.06	0.0848	9.7612	0.40532	0.0:0.6674:0.0:0.3326	.	361	P48552	NRIP1_HUMAN	C	361	ENSP00000383060:G361C;ENSP00000383063:G361C;ENSP00000327213:G361C	ENSP00000327213:G361C	G	-	1	0	NRIP1	15261304	0.645000	0.27286	0.866000	0.34008	0.973000	0.67179	0.454000	0.21827	0.147000	0.19030	0.644000	0.83932	GGT		0.363	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489		51	100	1	0	3.07002e-29	0.00361	6.01369e-29	51	100				
TMPRSS15	5651	broad.mit.edu	37	21	19687463	19687463	+	Splice_Site	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr21:19687463C>A	ENST00000284885.3	-	17	2065	c.2032G>T	c.(2032-2034)Gtg>Ttg	p.V678L		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	678	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.|SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.V678L(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TAAGACATACCACAATCTGCT	0.398																																							uc002ykw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(2032-2034)GTG>TTG		enterokinase precursor							128.0	108.0	115.0					21																	19687463		2203	4300	6503	SO:0001630	splice_region_variant	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19687463C>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2032+1G>T	21.37:g.19687463C>A			Somatic					p.V678L	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			17	2063	-			678			Extracellular (Potential).|LDL-receptor class A 2.|SRCR.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.2032G>T	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869399	0.51588	.	.	ENSG00000154646	ENST00000284885	T	0.33216	1.42	5.27	5.27	0.74061	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.071759	0.56097	D	0.000040	T	0.24431	0.0592	L	0.41079	1.255	0.37441	D	0.9144	P	0.41910	0.764	B	0.33620	0.167	T	0.12734	-1.0536	9	.	.	.	.	16.4399	0.83896	0.0:1.0:0.0:0.0	.	678	P98073	ENTK_HUMAN	L	678	ENSP00000284885:V678L	.	V	-	1	0	TMPRSS15	18609334	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	2.995000	0.49441	2.752000	0.94435	0.650000	0.86243	GTG		0.398	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	Missense_Mutation	10	83	1	0	7.48243e-07	0.006214	1.03536e-06	10	83				
TIAM1	7074	broad.mit.edu	37	21	32559330	32559330	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr21:32559330T>A	ENST00000286827.3	-	15	3120	c.2649A>T	c.(2647-2649)ttA>ttT	p.L883F	TIAM1_ENST00000541036.1_Missense_Mutation_p.L823F	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	883	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L883F(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TCTTGGAAGCTAAACCGGTTT	0.438																																							uc002yow.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(2647-2649)TTA>TTT		T-cell lymphoma invasion and metastasis 1							188.0	193.0	192.0					21																	32559330		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32559330T>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2649A>T	21.37:g.32559330T>A	ENSP00000286827:p.Leu883Phe		Somatic				TIAM1_uc011adk.1_Missense_Mutation_p.L883F|TIAM1_uc011adl.1_Missense_Mutation_p.L823F	p.L883F	NM_003253	NP_003244	WXS	Illumina HiSeq	Unspecified	Q13009	TIAM1_HUMAN			15	3121	-			883			PDZ.		B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.2649A>T	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200599	0.79015	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.27402	1.67;1.67	6.03	4.9	0.64082	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000002	T	0.49440	0.1557	M	0.69823	2.125	0.54753	D	0.999981	D;D;D	0.62365	0.989;0.991;0.991	P;D;D	0.65323	0.892;0.934;0.934	T	0.52223	-0.8604	10	0.87932	D	0	.	9.3579	0.38177	0.0:0.0807:0.0:0.9193	.	823;823;883	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	F	883;724;823	ENSP00000286827:L883F;ENSP00000441570:L823F	ENSP00000286827:L883F	L	-	3	2	TIAM1	31481201	0.994000	0.37717	0.996000	0.52242	0.959000	0.62525	0.266000	0.18534	2.302000	0.77476	0.533000	0.62120	TTA		0.438	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		109	176	0	0	0	0.00361	0	109	176				
PRMT2	3275	broad.mit.edu	37	21	48064292	48064292	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr21:48064292G>T	ENST00000397637.1	+	4	1173	c.219G>T	c.(217-219)gcG>gcT	p.A73A	PRMT2_ENST00000440086.1_Silent_p.A73A|PRMT2_ENST00000458387.2_Silent_p.A73A|PRMT2_ENST00000397638.2_Silent_p.A73A|PRMT2_ENST00000397628.1_Silent_p.A73A|PRMT2_ENST00000355680.3_Silent_p.A73A|PRMT2_ENST00000334494.4_Silent_p.A73A|PRMT2_ENST00000451211.2_Silent_p.A73A|PRMT2_ENST00000291705.6_Silent_p.A73A			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	73	Interaction with ESR1.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.A73A(2)		NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GTGAGCGTGCGGGCTGCTGTG	0.488																																							uc002zjx.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(217-219)GCG>GCT		HMT1 hnRNP methyltransferase-like 1							110.0	105.0	107.0					21																	48064292		2203	4300	6503	SO:0001819	synonymous_variant	3275				developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity	g.chr21:48064292G>T	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.219G>T	21.37:g.48064292G>T			Somatic				PRMT2_uc002zjw.2_Silent_p.A73A|PRMT2_uc002zjy.2_Silent_p.A73A|PRMT2_uc010gqm.2_Silent_p.A73A|PRMT2_uc011aga.1_Silent_p.A73A|PRMT2_uc011agb.1_Silent_p.A73A|PRMT2_uc011agc.1_Silent_p.A73A|PRMT2_uc002zjz.1_5'UTR	p.A73A	NM_206962	NP_996845	WXS	Illumina HiSeq	Unspecified	P55345	ANM2_HUMAN		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)	5	533	+	Breast(49;0.247)	Lung NSC(3;0.245)	73			SH3.		B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Silent	SNP	ENST00000397637.1	37	c.219G>T	CCDS13737.1	.	.	.	.	.	.	.	.	.	.	G	0.931	-0.712712	0.03206	.	.	ENSG00000160310	ENST00000455177	.	.	.	5.4	-10.8	0.00216	.	.	.	.	.	T	0.41581	0.1165	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53885	-0.8375	4	.	.	.	-16.443	5.5163	0.16908	0.2004:0.4247:0.3055:0.0694	.	.	.	.	L	13	.	.	R	+	2	0	PRMT2	46888720	0.000000	0.05858	0.021000	0.16686	0.048000	0.14542	-2.133000	0.01308	-3.532000	0.00145	-0.282000	0.10007	CGG		0.488	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535		54	67	1	0	9.22156e-22	0.00361	1.70134e-21	54	67				
MICAL3	57553	broad.mit.edu	37	22	18301725	18301725	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:18301725C>A	ENST00000441493.2	-	26	4054	c.3702G>T	c.(3700-3702)agG>agT	p.R1234S		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1234	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.R1234S(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		AGACAGGAGTCCTAGCTTCTG	0.652																																							uc002zng.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3700-3702)AGG>AGT		microtubule associated monoxygenase, calponin							14.0	18.0	17.0					22																	18301725		1982	4136	6118	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18301725C>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3702G>T	22.37:g.18301725C>A	ENSP00000416015:p.Arg1234Ser		Somatic				MICAL3_uc011agl.1_Missense_Mutation_p.R1150S	p.R1234S	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	26	4055	-		all_epithelial(15;0.198)	1234			Pro-rich.		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.3702G>T	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.049|7.049	0.564067|0.564067	0.13498|0.13498	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.61158	.|0.13	4.73|4.73	2.46|2.46	0.29980|0.29980	.|.	.|.	.|.	.|.	.|.	T|T	0.45458|0.45458	0.1343|0.1343	L|L	0.60455|0.60455	1.87|1.87	0.58432|0.58432	D|D	0.999999|0.999999	.|B	.|0.10296	.|0.003	.|B	.|0.06405	.|0.002	T|T	0.40608|0.40608	-0.9554|-0.9554	5|9	.|0.32370	.|T	.|0.25	.|.	2.2071|2.2071	0.03938|0.03938	0.3001:0.4182:0.1798:0.1019|0.3001:0.4182:0.1798:0.1019	.|.	.|1234	.|Q7RTP6	.|MICA3_HUMAN	V|S	216|1234	.|ENSP00000416015:R1234S	.|ENSP00000416015:R1234S	G|R	-|-	2|3	0|2	XXbac-B461K10.4|XXbac-B461K10.4	16681725|16681725	0.092000|0.092000	0.21681|0.21681	0.986000|0.986000	0.45419|0.45419	0.254000|0.254000	0.26022|0.26022	0.345000|0.345000	0.19979|0.19979	0.955000|0.955000	0.37878|0.37878	0.563000|0.563000	0.77884|0.77884	GGA|AGG		0.652	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			9	21	1	0	0.00448238	0.004482	0.005499	9	21				
NEFH	4744	broad.mit.edu	37	22	29881765	29881765	+	Silent	SNP	C	C	A	rs372676194		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:29881765C>A	ENST00000310624.6	+	3	1170	c.1137C>A	c.(1135-1137)gcC>gcA	p.A379A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	379	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A379A(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GGGAGATGGCCGCCCAGCTGC	0.572																																							uc003afo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1135-1137)GCC>GCA		neurofilament, heavy polypeptide 200kDa							79.0	68.0	72.0					22																	29881765		2203	4300	6503	SO:0001819	synonymous_variant	4744				cell death|nervous system development	neurofilament		g.chr22:29881765C>A		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1137C>A	22.37:g.29881765C>A			Somatic					p.A379A	NM_021076	NP_066554	WXS	Illumina HiSeq	Unspecified	P12036	NFH_HUMAN			3	1208	+			379			Coil 2B.|Rod.		B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	c.1137C>A	CCDS13858.1																																																																																				0.572	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076		12	43	1	0	4.3838e-07	0.001855	6.10143e-07	12	43				
TBC1D10A	83874	broad.mit.edu	37	22	30688782	30688782	+	Missense_Mutation	SNP	C	C	A	rs536246153		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:30688782C>A	ENST00000215790.7	-	9	1273	c.1109G>T	c.(1108-1110)cGg>cTg	p.R370L	TBC1D10A_ENST00000403477.3_Missense_Mutation_p.R377L|RP1-130H16.18_ENST00000447976.1_Intron|TBC1D10A_ENST00000403362.1_Missense_Mutation_p.R282L	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	370					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)	p.R370L(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						CTGCCAGCGCCGCAGCTGAAT	0.647																																							uc011akt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1108-1110)CGG>CTG		TBC1 domain family, member 10A							29.0	30.0	30.0					22																	30688782		2203	4300	6503	SO:0001583	missense	83874					intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity	g.chr22:30688782C>A	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.1109G>T	22.37:g.30688782C>A	ENSP00000215790:p.Arg370Leu		Somatic				GATSL3_uc003ahf.2_RNA|GATSL3_uc003ahg.2_Intron|GATSL3_uc003ahh.2_Intron|GATSL3_uc010gvq.2_Intron|GATSL3_uc003ahi.2_Missense_Mutation_p.R228L|TBC1D10A_uc003ahj.3_Missense_Mutation_p.R282L|TBC1D10A_uc010gvu.2_Missense_Mutation_p.R377L|TBC1D10A_uc003ahk.3_Missense_Mutation_p.R370L	p.R370L	NM_031937	NP_114143	WXS	Illumina HiSeq	Unspecified	Q9BXI6	TB10A_HUMAN			11	1133	-			370					B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	37	c.1109G>T	CCDS13874.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896646	0.52121	.	.	ENSG00000248751;ENSG00000099992;ENSG00000099992;ENSG00000099992	ENST00000434291;ENST00000215790;ENST00000403477;ENST00000403362	T;T;T;T	0.08896	3.04;3.35;3.35;3.38	4.98	4.98	0.66077	.	0.267116	0.31268	N	0.007946	T	0.07728	0.0194	L	0.47716	1.5	0.42070	D	0.991208	B;B;B;B	0.25007	0.116;0.071;0.116;0.031	B;B;B;B	0.17433	0.018;0.018;0.018;0.018	T	0.16928	-1.0386	10	0.33141	T	0.24	.	7.6898	0.28561	0.0:0.8301:0.0:0.1699	.	370;377;370;370	Q20WK7;B3KXT8;Q9BXI6;A7E244	.;.;TB10A_HUMAN;.	L	244;370;377;282	ENSP00000401535:R244L;ENSP00000215790:R370L;ENSP00000384996:R377L;ENSP00000385050:R282L	ENSP00000331267:R231L	R	-	2	0	TBC1D10A;RP1-130H16.18	29018782	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.933000	0.40153	2.768000	0.95171	0.561000	0.74099	CGG		0.647	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937		3	22	1	0	0.004672	0.004672	0.00570224	3	22				
CSF2RB	1439	broad.mit.edu	37	22	37333578	37333578	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:37333578C>A	ENST00000403662.3	+	14	1950	c.1728C>A	c.(1726-1728)gcC>gcA	p.A576A	CSF2RB_ENST00000262825.5_Silent_p.A582A|CSF2RB_ENST00000536485.1_Silent_p.A523A|CSF2RB_ENST00000406230.1_Silent_p.A582A			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	576					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A576A(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CGCCTGCCGCCTCCCACACAC	0.657																																							uc003aqa.3		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|pancreas(1)	3						c.(1726-1728)GCC>GCA		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)						20.0	23.0	22.0					22																	37333578		2202	4298	6500	SO:0001819	synonymous_variant	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37333578C>A	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1728C>A	22.37:g.37333578C>A			Somatic				CSF2RB_uc003aqc.3_Silent_p.A582A	p.A576A	NM_000395	NP_000386	WXS	Illumina HiSeq	Unspecified	P32927	IL3RB_HUMAN			14	1945	+			576			Cytoplasmic (Potential).		Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	37	c.1728C>A	CCDS13936.1																																																																																				0.657	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		5	22	1	0	0.00448238	0.004482	0.005499	5	22				
TMEM184B	25829	broad.mit.edu	37	22	38620938	38620938	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:38620938T>A	ENST00000361906.3	-	8	1044	c.836A>T	c.(835-837)cAc>cTc	p.H279L	TMEM184B_ENST00000504337.1_5'Flank|TMEM184B_ENST00000361684.4_Missense_Mutation_p.H279L	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	279						integral component of membrane (GO:0016021)		p.H279L(1)		endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					GCGGGCCGAGTGGATTTTGGG	0.632																																							uc003avf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(835-837)CAC>CTC		transmembrane protein 184B							32.0	26.0	28.0					22																	38620938		2201	4300	6501	SO:0001583	missense	25829					integral to membrane		g.chr22:38620938T>A	AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.836A>T	22.37:g.38620938T>A	ENSP00000355210:p.His279Leu		Somatic				TMEM184B_uc003avg.1_Missense_Mutation_p.H279L|TMEM184B_uc003avh.1_Missense_Mutation_p.H213L	p.H279L	NM_012264	NP_036396	WXS	Illumina HiSeq	Unspecified	Q9Y519	T184B_HUMAN			8	1060	-	Melanoma(58;0.045)		279					A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Missense_Mutation	SNP	ENST00000361906.3	37	c.836A>T	CCDS13969.2	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587925	0.46110	.	.	ENSG00000198792	ENST00000361906;ENST00000361684	T;T	0.40476	1.03;1.03	5.82	5.82	0.92795	.	0.188964	0.56097	D	0.000026	T	0.22322	0.0538	N	0.04387	-0.21	0.46437	D	0.999046	B	0.02656	0.0	B	0.12837	0.008	T	0.13764	-1.0497	10	0.09590	T	0.72	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	279	Q9Y519	T184B_HUMAN	L	279	ENSP00000355210:H279L;ENSP00000354441:H279L	ENSP00000354441:H279L	H	-	2	0	TMEM184B	36950884	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.874000	0.63064	2.225000	0.72522	0.459000	0.35465	CAC		0.632	TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075445.4	NM_012264		5	14	0	0	0	0.000602	0	5	14				
APOBEC3A	200315	broad.mit.edu	37	22	39358206	39358206	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:39358206G>T	ENST00000402255.1	+	5	777	c.573G>T	c.(571-573)cgG>cgT	p.R191R	APOBEC3A_ENST00000249116.2_Silent_p.R191R			P31941	ABC3A_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A	191					cellular response to xenobiotic stimulus (GO:0071466)|clearance of foreign intracellular DNA by conversion of DNA cytidine to uridine (GO:0044356)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|zinc ion binding (GO:0008270)	p.R191R(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5	Melanoma(58;0.04)					GGAGGCTGCGGGCCATTCTCC	0.652																																							uc003awn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(571-573)CGG>CGT		phorbolin 1							79.0	77.0	78.0					22																	39358206		2203	4300	6503	SO:0001819	synonymous_variant	200315				cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding	g.chr22:39358206G>T	U03891	CCDS13981.1	22q13.1-q13.2	2014-01-28			ENSG00000128383	ENSG00000128383		"""Apolipoprotein B mRNA editing enzymes"""	17343	protein-coding gene	gene with protein product	"""phorbolin I"""	607109				11863358, 10469298	Standard	NM_145699		Approved	ARP3, PHRBN		P31941	OTTHUMG00000151004	ENST00000402255.1:c.573G>T	22.37:g.39358206G>T			Somatic				APOBEC3A_uc011aob.1_Silent_p.R173R|APOBEC3A_uc011aoc.1_Silent_p.R191R	p.R191R	NM_145699	NP_663745	WXS	Illumina HiSeq	Unspecified	P31941	ABC3A_HUMAN			4	743	+	Melanoma(58;0.04)		191					A0AVM1|Q12807|Q5JZ93|Q9UH18	Silent	SNP	ENST00000402255.1	37	c.573G>T	CCDS13981.1																																																																																				0.652	APOBEC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320915.2	NM_145699		14	52	1	0	0.000151284	0.001855	0.000194625	14	52				
TNRC6B	23112	broad.mit.edu	37	22	40661419	40661419	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr22:40661419C>T	ENST00000454349.2	+	5	1396	c.1185C>T	c.(1183-1185)ccC>ccT	p.P395P	TNRC6B_ENST00000335727.9_Silent_p.P395P|TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	395	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AGGGAATGCCCTTTGGAATGG	0.478																																							uc011aor.1		NA																	0					0						c.(1183-1185)CCC>CCT		trinucleotide repeat containing 6B isoform 1							62.0	62.0	62.0					22																	40661419		1926	4134	6060	SO:0001819	synonymous_variant	23112				gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding	g.chr22:40661419C>T	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1185C>T	22.37:g.40661419C>T			Somatic				TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Silent_p.P395P|TNRC6B_uc003ayo.2_Silent_p.P199P	p.P395P	NM_001162501	NP_001155973	WXS	Illumina HiSeq	Unspecified	Q9UPQ9	TNR6B_HUMAN			5	1396	+			395					B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000454349.2	37	c.1185C>T	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	C	1.614	-0.523382	0.04141	.	.	ENSG00000100354	ENST00000446273	T	0.59638	0.25	5.07	5.07	0.68467	.	0.356004	0.30723	N	0.009006	T	0.67249	0.2873	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70407	-0.4880	7	0.72032	D	0.01	-4.0016	11.0146	0.47681	0.0:0.915:0.0:0.085	.	.	.	.	L	138	ENSP00000409429:P138L	ENSP00000409429:P138L	P	+	2	0	TNRC6B	38991365	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.405000	0.52630	2.369000	0.80426	0.650000	0.86243	CCT		0.478	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				12	38	0	0	0	0.000978	0	12	38				
SCN11A	11280	broad.mit.edu	37	3	38991610	38991610	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:38991610C>A	ENST00000302328.3	-	1	442	c.244G>T	c.(244-246)Gac>Tac	p.D82Y	SCN11A_ENST00000456224.3_Missense_Mutation_p.D82Y|SCN11A_ENST00000450244.1_Missense_Mutation_p.D82Y|SCN11A_ENST00000444237.2_Missense_Mutation_p.D82Y	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	82					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D82Y(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAGAATGGGTCCAAGTCTTCC	0.552																																							uc011ays.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(244-246)GAC>TAC		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						66.0	65.0	65.0					3																	38991610		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38991610C>A	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.244G>T	3.37:g.38991610C>A	ENSP00000307599:p.Asp82Tyr		Somatic					p.D82Y	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	1	443	-			82					A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.244G>T	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583024	0.86748	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98649	-5.05;-5.05;-4.96;-4.89	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.99384	0.9783	H	0.94306	3.52	0.53688	D	0.999972	D	0.89917	1.0	D	0.91635	0.999	D	0.98688	1.0695	10	0.87932	D	0	.	16.6892	0.85317	0.0:1.0:0.0:0.0	.	82	Q9UI33	SCNBA_HUMAN	Y	82	ENSP00000307599:D82Y;ENSP00000400945:D82Y;ENSP00000416757:D82Y;ENSP00000408028:D82Y	ENSP00000307599:D82Y	D	-	1	0	SCN11A	38966614	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.445000	0.80570	2.536000	0.85505	0.655000	0.94253	GAC		0.552	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		29	79	1	0	5.61819e-17	0.005443	9.79581e-17	29	79				
CX3CR1	1524	broad.mit.edu	37	3	39307362	39307362	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:39307362T>G	ENST00000541347.1	-	2	878	c.639A>C	c.(637-639)agA>agC	p.R213S	CX3CR1_ENST00000542107.1_Missense_Mutation_p.R213S|CX3CR1_ENST00000399220.2_Missense_Mutation_p.R213S|CX3CR1_ENST00000358309.3_Missense_Mutation_p.R245S	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	213					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)	p.R245S(1)|p.R213S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TCTGGATGATTCTGAAGTAGC	0.478																																							uc003cjl.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)	3						c.(637-639)AGA>AGC		chemokine (C-X3-C motif) receptor 1							99.0	104.0	103.0					3																	39307362		1939	4137	6076	SO:0001583	missense	1524				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity	g.chr3:39307362T>G	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.639A>C	3.37:g.39307362T>G	ENSP00000439140:p.Arg213Ser		Somatic					p.R213S	NM_001337	NP_001328	WXS	Illumina HiSeq	Unspecified	P49238	CX3C1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)	2	731	-			213			Helical; Name=5; (Potential).		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	ENST00000541347.1	37	c.639A>C	CCDS43069.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627772	0.46944	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.62	0.09	0.14461	GPCR, rhodopsin-like superfamily (1);	0.159674	0.51477	D	0.000086	T	0.29126	0.0724	L	0.41492	1.28	0.24058	N	0.996028	P	0.38677	0.642	B	0.38106	0.265	T	0.14587	-1.0467	10	0.59425	D	0.04	.	5.7181	0.17972	0.0:0.3412:0.3461:0.3127	.	213	P49238	CX3C1_HUMAN	S	213;221;245;213;213	ENSP00000382166:R213S;ENSP00000351059:R245S;ENSP00000439140:R213S;ENSP00000444928:R213S	ENSP00000351059:R245S	R	-	3	2	CX3CR1	39282366	0.000000	0.05858	0.951000	0.38953	0.979000	0.70002	-0.199000	0.09491	-0.221000	0.09973	0.533000	0.62120	AGA		0.478	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337		43	101	0	0	0	0.002222	0	43	101				
FYCO1	79443	broad.mit.edu	37	3	46014653	46014653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:46014653C>A	ENST00000296137.2	-	6	671	c.466G>T	c.(466-468)Gag>Tag	p.E156*	FYCO1_ENST00000535325.1_Nonsense_Mutation_p.E156*	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	156	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.E156*(1)		NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TCAGTCAGCTCATAGAGTTGG	0.478																																							uc003cpb.3		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(466-468)GAG>TAG		FYVE and coiled-coil domain containing 1							108.0	103.0	105.0					3																	46014653		2203	4300	6503	SO:0001587	stop_gained	79443				transport	integral to membrane	metal ion binding|protein binding	g.chr3:46014653C>A	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.466G>T	3.37:g.46014653C>A	ENSP00000296137:p.Glu156*		Somatic				FYCO1_uc011bal.1_Nonsense_Mutation_p.E156*	p.E156*	NM_024513	NP_078789	WXS	Illumina HiSeq	Unspecified	Q9BQS8	FYCO1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)	6	672	-			156			RUN.		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	ENST00000296137.2	37	c.466G>T	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	39	7.692316	0.98438	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	6.08	6.08	0.98989	.	0.050655	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-37.6841	18.844	0.92196	0.0:1.0:0.0:0.0	.	.	.	.	X	156	.	ENSP00000296137:E156X	E	-	1	0	FYCO1	45989657	1.000000	0.71417	0.978000	0.43139	0.873000	0.50193	7.506000	0.81665	2.894000	0.99253	0.655000	0.94253	GAG		0.478	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513		45	56	1	0	3.7052e-28	0.003214	7.19868e-28	45	56				
DNASE1L3	1776	broad.mit.edu	37	3	58183597	58183597	+	Missense_Mutation	SNP	C	C	A	rs576576004		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:58183597C>A	ENST00000394549.2	-	6	971	c.655G>T	c.(655-657)Gac>Tac	p.D219Y	DNASE1L3_ENST00000483681.1_Missense_Mutation_p.D219Y|DNASE1L3_ENST00000486455.1_Missense_Mutation_p.D189Y|DNASE1L3_ENST00000318316.3_Missense_Mutation_p.D219Y	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	219					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)	p.D219Y(1)		breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		TCCTCTTGGTCCCCGATCAGC	0.572																																					Esophageal Squamous(96;1069 1424 4841 43466 52325)	Esophageal Squamous(96;1069 1424 4841 43466 52325)	uc003djo.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|large_intestine(1)	3						c.(655-657)GAC>TAC		deoxyribonuclease I-like 3 precursor							151.0	130.0	137.0					3																	58183597		2203	4300	6503	SO:0001583	missense	1776				apoptosis|DNA catabolic process	nucleus	calcium ion binding|DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters	g.chr3:58183597C>A	AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.655G>T	3.37:g.58183597C>A	ENSP00000378053:p.Asp219Tyr		Somatic				DNASE1L3_uc011bfd.1_Missense_Mutation_p.D189Y|DNASE1L3_uc003djp.1_Missense_Mutation_p.D219Y|DNASE1L3_uc003djq.1_Missense_Mutation_p.D219Y	p.D219Y	NM_004944	NP_004935	WXS	Illumina HiSeq	Unspecified	Q13609	DNSL3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)	6	752	-			219					B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	ENST00000394549.2	37	c.655G>T	CCDS2886.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.779737	0.70107	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000477209;ENST00000394549	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.25	5.25	0.73442	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82627	-0.0364	10	0.87932	D	0	.	19.0335	0.92967	0.0:1.0:0.0:0.0	.	189;219;219	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	Y	189;219;219;219;93;219	ENSP00000419052:D189Y;ENSP00000316193:D219Y;ENSP00000417047:D219Y;ENSP00000417976:D93Y;ENSP00000378053:D219Y	ENSP00000316193:D219Y	D	-	1	0	DNASE1L3	58158637	1.000000	0.71417	0.996000	0.52242	0.256000	0.26092	7.651000	0.83577	2.738000	0.93877	0.591000	0.81541	GAC		0.572	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353533.1	NM_004944		23	51	1	0	6.44725e-10	0.002299	1.00291e-09	23	51				
OR5K3	403277	broad.mit.edu	37	3	98109910	98109910	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:98109910C>A	ENST00000383695.1	+	1	401	c.401C>A	c.(400-402)aCc>aAc	p.T134N	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T134N(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						CAGTACCACACCATGATGTCC	0.468																																							uc011bgw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(400-402)ACC>AAC		olfactory receptor, family 5, subfamily K,							166.0	154.0	158.0					3																	98109910		2203	4300	6503	SO:0001583	missense	403277				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98109910C>A		CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.401C>A	3.37:g.98109910C>A	ENSP00000373194:p.Thr134Asn		Somatic					p.T134N	NM_001005516	NP_001005516	WXS	Illumina HiSeq	Unspecified	A6NET4	OR5K3_HUMAN			1	401	+			134			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000383695.1	37	c.401C>A	CCDS33803.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151982	0.38021	.	.	ENSG00000206536	ENST00000383695	T	0.00557	6.62	5.15	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	0.472642	0.17858	N	0.159635	T	0.00754	0.0025	M	0.75777	2.31	0.09310	N	1	P	0.43885	0.82	B	0.42062	0.374	T	0.47355	-0.9124	10	0.66056	D	0.02	-22.3592	7.046	0.25046	0.0:0.5605:0.3218:0.1177	.	134	A6NET4	OR5K3_HUMAN	N	134	ENSP00000373194:T134N	ENSP00000373194:T134N	T	+	2	0	OR5K3	99592600	0.000000	0.05858	0.568000	0.28447	0.817000	0.46193	-0.780000	0.04654	0.599000	0.29845	0.603000	0.83216	ACC		0.468	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1			54	138	1	0	5.57489e-27	0.00361	1.07435e-26	54	138				
ABI3BP	25890	broad.mit.edu	37	3	100604424	100604424	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:100604424C>A	ENST00000284322.5	-	6	782	c.673G>T	c.(673-675)Gta>Tta	p.V225L	ABI3BP_ENST00000495063.1_Missense_Mutation_p.V225L|ABI3BP_ENST00000471714.1_Missense_Mutation_p.V225L	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	225					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.V225L(2)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TTCCCATTTACTTTTTTACCT	0.303																																							uc003dun.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						c.(673-675)GTA>TTA		ABI gene family, member 3 (NESH) binding protein							108.0	99.0	102.0					3																	100604424		1822	4061	5883	SO:0001583	missense	25890					extracellular space		g.chr3:100604424C>A	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.673G>T	3.37:g.100604424C>A	ENSP00000284322:p.Val225Leu		Somatic				ABI3BP_uc003duo.2_Missense_Mutation_p.V218L|ABI3BP_uc003dup.3_Missense_Mutation_p.V218L	p.V225L	NM_015429	NP_056244	WXS	Illumina HiSeq	Unspecified	Q7Z7G0	TARSH_HUMAN			6	758	-			225					B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	37	c.673G>T	CCDS46880.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.110725	0.37242	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000495063;ENST00000527258	T;T	0.23754	2.19;1.89	5.24	5.24	0.73138	.	0.619757	0.16791	N	0.199374	T	0.33933	0.0880	L	0.47716	1.5	0.80722	D	1	P;P;P	0.52692	0.847;0.955;0.924	B;P;P	0.50405	0.257;0.64;0.452	T	0.01702	-1.1292	10	0.30078	T	0.28	-12.0596	15.976	0.80063	0.0:1.0:0.0:0.0	.	218;225;225	Q9H717;Q5JPC9;Q7Z7G0	.;.;TARSH_HUMAN	L	225;225;225;144	ENSP00000420524:V225L;ENSP00000284322:V225L	ENSP00000284322:V225L	V	-	1	0	ABI3BP	102087114	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.225000	0.58600	2.434000	0.82447	0.655000	0.94253	GTA		0.303	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1			6	8	1	0	0.00198382	0.001984	0.00247198	6	8				
SENP7	57337	broad.mit.edu	37	3	101090930	101090930	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:101090930T>G	ENST00000394095.2	-	7	771	c.718A>C	c.(718-720)Aag>Cag	p.K240Q	SENP7_ENST00000358203.3_Missense_Mutation_p.K76Q|SENP7_ENST00000394091.1_Missense_Mutation_p.K76Q|SENP7_ENST00000348610.3_Missense_Mutation_p.K207Q|SENP7_ENST00000314261.7_Missense_Mutation_p.K174Q|SENP7_ENST00000394094.2_Missense_Mutation_p.K175Q	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	240						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.K240Q(1)|p.K174Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GCAGTCTGCTTTGCAGAATTG	0.373																																							uc003dut.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)	5						c.(718-720)AAG>CAG		sentrin/SUMO-specific protease 7 isoform 1							132.0	124.0	127.0					3																	101090930		2203	4300	6503	SO:0001583	missense	57337				proteolysis	nucleus	cysteine-type peptidase activity	g.chr3:101090930T>G		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.718A>C	3.37:g.101090930T>G	ENSP00000377655:p.Lys240Gln		Somatic				SENP7_uc003duu.2_Missense_Mutation_p.K175Q|SENP7_uc003duv.2_Missense_Mutation_p.K207Q|SENP7_uc003duw.2_Missense_Mutation_p.K174Q|SENP7_uc003dux.2_Missense_Mutation_p.K76Q	p.K240Q	NM_020654	NP_065705	WXS	Illumina HiSeq	Unspecified	Q9BQF6	SENP7_HUMAN			7	829	-			240					A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	37	c.718A>C	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	T	6.909	0.537368	0.13188	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.22539	2.05;2.07;2.09;1.95;1.95;2.06	5.1	1.19	0.21007	.	0.491817	0.18685	N	0.134043	T	0.19485	0.0468	M	0.61703	1.905	0.09310	N	0.999996	B;B;B;B	0.27351	0.176;0.17;0.128;0.078	B;B;B;B	0.28553	0.037;0.067;0.091;0.015	T	0.20207	-1.0282	10	0.66056	D	0.02	-3.0968	5.2349	0.15441	0.0:0.0941:0.3563:0.5497	.	76;174;207;240	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	Q	240;175;174;76;76;207	ENSP00000377655:K240Q;ENSP00000377654:K175Q;ENSP00000313624:K174Q;ENSP00000377651:K76Q;ENSP00000350936:K76Q;ENSP00000342159:K207Q	ENSP00000313624:K174Q	K	-	1	0	SENP7	102573620	0.971000	0.33674	0.140000	0.22221	0.007000	0.05969	0.464000	0.21988	0.304000	0.22809	0.477000	0.44152	AAG		0.373	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654		5	127	0	0	0	0.001168	0	5	127				
BOC	91653	broad.mit.edu	37	3	113002297	113002297	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:113002297C>A	ENST00000495514.1	+	16	3175	c.2471C>A	c.(2470-2472)cCa>cAa	p.P824Q	BOC_ENST00000273395.4_Missense_Mutation_p.P825Q|BOC_ENST00000355385.3_Missense_Mutation_p.P824Q			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	824					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.P824Q(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CTGCCACCCCCAACTCTGGCC	0.557																																							uc003dzx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(2470-2472)CCA>CAA		brother of CDO precursor							92.0	107.0	102.0					3																	113002297		2203	4300	6503	SO:0001583	missense	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:113002297C>A	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2471C>A	3.37:g.113002297C>A	ENSP00000418663:p.Pro824Gln		Somatic				BOC_uc003dzy.2_Missense_Mutation_p.P824Q|BOC_uc003dzz.2_Missense_Mutation_p.P825Q|BOC_uc003eab.2_Missense_Mutation_p.P525Q|BOC_uc003eac.2_Missense_Mutation_p.P139Q	p.P824Q	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		16	3092	+			824			Extracellular (Potential).		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	c.2471C>A	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098690	0.56183	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.61392	0.11;0.12;0.11	5.85	4.96	0.65561	.	0.258295	0.37809	N	0.001934	T	0.67590	0.2909	M	0.71036	2.16	0.42940	D	0.994346	P;P;P	0.52577	0.943;0.954;0.923	P;P;P	0.57720	0.67;0.826;0.675	T	0.66118	-0.6003	10	0.10636	T	0.68	.	14.0591	0.64788	0.0:0.9269:0.0:0.0731	.	641;825;824	Q9BWV1-2;Q9BWV1-3;Q9BWV1	.;.;BOC_HUMAN	Q	824;825;824	ENSP00000418663:P824Q;ENSP00000273395:P825Q;ENSP00000347546:P824Q	ENSP00000273395:P825Q	P	+	2	0	BOC	114484987	0.007000	0.16637	0.983000	0.44433	0.025000	0.11179	1.006000	0.29847	1.449000	0.47699	0.655000	0.94253	CCA		0.557	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		66	164	1	0	1.37693e-34	0.00361	2.76549e-34	66	164				
CFAP44	55779	broad.mit.edu	37	3	113119471	113119471	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:113119471G>T	ENST00000295868.2	-	12	1557	c.1395C>A	c.(1393-1395)ctC>ctA	p.L465L	WDR52_ENST00000393845.2_Silent_p.L465L	NM_018338.3	NP_060808.2												p.L465L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						GGAAGGAGAAGAGGCATTCTG	0.408																																							uc003eae.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1393-1395)CTC>CTA		WD repeat domain 52 isoform 2							53.0	58.0	56.0					3																	113119471		2203	4300	6503	SO:0001819	synonymous_variant	55779							g.chr3:113119471G>T																												ENST00000295868.2:c.1395C>A	3.37:g.113119471G>T			Somatic					p.L465L	NM_018338	NP_060808	WXS	Illumina HiSeq	Unspecified	Q96MT7	WDR52_HUMAN			12	1441	-			465						Silent	SNP	ENST00000295868.2	37	c.1395C>A	CCDS2972.1																																																																																				0.408	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3			7	77	1	0	0.00307968	0.00308	0.00379774	7	77				
MYLK	4638	broad.mit.edu	37	3	123458825	123458825	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:123458825G>A	ENST00000475616.1	-	3	396	c.397C>T	c.(397-399)Cag>Tag	p.Q133*	MYLK_ENST00000346322.5_Nonsense_Mutation_p.Q133*|MYLK_ENST00000360304.3_Nonsense_Mutation_p.Q133*|MYLK_ENST00000359169.1_Nonsense_Mutation_p.Q133*|MYLK_ENST00000360772.3_Nonsense_Mutation_p.Q133*			Q15746	MYLK_HUMAN	myosin light chain kinase	133			Q -> H (in dbSNP:rs140148380). {ECO:0000269|PubMed:21055718}.		actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.Q133*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACAACAGGCTGACCAAGCTGC	0.463																																							uc003ego.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|skin(2)|stomach(1)	9						c.(397-399)CAG>TAG		myosin light chain kinase isoform 1							148.0	146.0	147.0					3																	123458825		2203	4300	6503	SO:0001587	stop_gained	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123458825G>A	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.397C>T	3.37:g.123458825G>A	ENSP00000418335:p.Gln133*		Somatic				MYLK_uc011bjw.1_Nonsense_Mutation_p.Q133*|MYLK_uc003egp.2_Nonsense_Mutation_p.Q133*|MYLK_uc003egq.2_Nonsense_Mutation_p.Q133*|MYLK_uc003egr.2_Nonsense_Mutation_p.Q133*|MYLK_uc003egs.2_5'UTR|MYLK_uc010hrs.1_Nonsense_Mutation_p.Q133*	p.Q133*	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	6	679	-		Lung NSC(201;0.0496)	133		Q -> H.			B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Nonsense_Mutation	SNP	ENST00000475616.1	37	c.397C>T	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	G	30	5.055507	0.93793	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	.	.	.	4.97	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.34789	D	0.735513	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4124	0.44301	0.0:0.2145:0.7855:0.0	.	.	.	.	X	133	.	ENSP00000320622:Q133X	Q	-	1	0	MYLK	124941515	0.574000	0.26684	0.964000	0.40570	0.637000	0.38172	3.113000	0.50376	2.601000	0.87937	0.655000	0.94253	CAG		0.463	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		6	241	0	0	0	0.001168	0	6	241				
UMPS	7372	broad.mit.edu	37	3	124462773	124462773	+	Missense_Mutation	SNP	G	G	A	rs121917891		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:124462773G>A	ENST00000232607.2	+	6	1391	c.1285G>A	c.(1285-1287)Ggc>Agc	p.G429S	UMPS_ENST00000536109.1_Missense_Mutation_p.G337S|UMPS_ENST00000413078.2_Missense_Mutation_p.G154S|UMPS_ENST00000538242.1_Missense_Mutation_p.G251S	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	429	OMPdecase.		G -> R (in ORAC1). {ECO:0000269|PubMed:9042911}.		'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)	p.G429S(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	AGATAATCTTGGCCAACAGTA	0.398																																							uc003ehl.3		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1	GRCh37	CM971562	UMPS	M	rs121917891	c.(1285-1287)GGC>AGC		uridine monophosphate synthase							120.0	112.0	114.0					3																	124462773		2203	4300	6503	SO:0001583	missense	7372				'de novo' pyrimidine base biosynthetic process|'de novo' UMP biosynthetic process|pyrimidine nucleoside biosynthetic process	cytosol|nucleus	orotate phosphoribosyltransferase activity|orotidine-5'-phosphate decarboxylase activity	g.chr3:124462773G>A		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1285G>A	3.37:g.124462773G>A	ENSP00000232607:p.Gly429Ser		Somatic				UMPS_uc003ehm.3_RNA|UMPS_uc011bka.1_Missense_Mutation_p.G251S|UMPS_uc011bkb.1_Missense_Mutation_p.G337S|UMPS_uc011bkc.1_Missense_Mutation_p.G251S|UMPS_uc003ehn.3_Missense_Mutation_p.G251S|UMPS_uc011bkd.1_Missense_Mutation_p.G154S	p.G429S	NM_000373	NP_000364	WXS	Illumina HiSeq	Unspecified	P11172	UMPS_HUMAN		GBM - Glioblastoma multiforme(114;0.146)	6	1391	+			429		G -> R (in ORAC1).	OMPdecase.		B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Missense_Mutation	SNP	ENST00000232607.2	37	c.1285G>A	CCDS3029.1	.	.	.	.	.	.	.	.	.	.	G	32	5.110102	0.94292	.	.	ENSG00000114491	ENST00000232607;ENST00000536109;ENST00000538242;ENST00000413078	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.67	5.67	0.87782	Orotidine 5&apos (2);Aldolase-type TIM barrel (1);-phosphate decarboxylase domain (2);Ribulose-phosphate binding barrel (1);	0.000000	0.85682	D	0.000000	D	0.92805	0.7712	M	0.93808	3.46	0.46701	D	0.999167	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.993	D	0.93856	0.7149	10	0.66056	D	0.02	-12.5887	19.7626	0.96329	0.0:0.0:1.0:0.0	.	154;251;429	B5LY72;B5LY70;P11172	.;.;UMPS_HUMAN	S	429;337;251;154	ENSP00000232607:G429S;ENSP00000443577:G337S;ENSP00000444988:G251S;ENSP00000397965:G154S	ENSP00000232607:G429S	G	+	1	0	UMPS	125945463	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	9.429000	0.97481	2.676000	0.91093	0.561000	0.74099	GGC		0.398	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373		28	59	0	0	0	0.001786	0	28	59				
MSL2	55167	broad.mit.edu	37	3	135870109	135870109	+	Missense_Mutation	SNP	G	G	T	rs138536154		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:135870109G>T	ENST00000309993.2	-	2	2346	c.1614C>A	c.(1612-1614)aaC>aaA	p.N538K	MSL2_ENST00000434835.2_Missense_Mutation_p.N464K	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	538					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N538K(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						TGGTACTAGCGTTACGCACAG	0.483																																							uc003eqx.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1612-1614)AAC>AAA		ring finger protein 184 isoform 1							112.0	105.0	108.0					3																	135870109		2203	4300	6503	SO:0001583	missense	55167				histone H4-K16 acetylation	MSL complex	zinc ion binding	g.chr3:135870109G>T	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.1614C>A	3.37:g.135870109G>T	ENSP00000311827:p.Asn538Lys		Somatic				MSL2_uc011bmb.1_Missense_Mutation_p.N464K	p.N538K	NM_018133	NP_060603	WXS	Illumina HiSeq	Unspecified	Q9HCI7	MSL2_HUMAN			2	2347	-			538					B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	37	c.1614C>A	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182276	0.38511	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	5.92	0.143	0.14820	.	0.145657	0.64402	D	0.000013	T	0.55593	0.1930	L	0.57536	1.79	0.47308	D	0.999382	P	0.45715	0.865	P	0.46510	0.519	T	0.56655	-0.7943	9	0.56958	D	0.05	-9.0321	10.7822	0.46384	0.7875:0.0:0.2125:0.0	.	538	Q9HCI7	MSL2_HUMAN	K	538;464	.	ENSP00000311827:N538K	N	-	3	2	MSL2	137352799	0.993000	0.37304	0.934000	0.37439	0.946000	0.59487	0.492000	0.22435	0.002000	0.14630	-0.444000	0.05651	AAC		0.483	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133		7	79	1	0	8.12818e-05	0.001984	0.000105711	7	79				
CRYGS	1427	broad.mit.edu	37	3	186257351	186257351	+	Silent	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:186257351A>T	ENST00000392499.2	-	3	396	c.57T>A	c.(55-57)cgT>cgA	p.R19R	CRYGS_ENST00000307944.5_Silent_p.R19R	NM_017541.2	NP_060011.1	P22914	CRBS_HUMAN	crystallin, gamma S	19	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|morphogenesis of an epithelium (GO:0002009)		structural constituent of eye lens (GO:0005212)	p.R19R(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	11	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		AGTCATAGCGACGGCCTTGAA	0.443																																							uc003fqe.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(55-57)CGT>CGA		crystallin, gamma S							73.0	72.0	73.0					3																	186257351		2203	4300	6503	SO:0001819	synonymous_variant	1427						structural constituent of eye lens	g.chr3:186257351A>T		CCDS3275.1	3q27.3	2013-02-14			ENSG00000213139	ENSG00000213139			2417	protein-coding gene	gene with protein product	"""crystallin, gamma 8"""	123730		CRYG8			Standard	NM_017541		Approved		uc003fqe.3	P22914	OTTHUMG00000156615	ENST00000392499.2:c.57T>A	3.37:g.186257351A>T			Somatic				CRYGS_uc003fqf.2_Silent_p.R19R	p.R19R	NM_017541	NP_060011	WXS	Illumina HiSeq	Unspecified	P22914	CRBS_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)	2	109	-	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		19			Beta/gamma crystallin 'Greek key' 1.		B2RAF8	Silent	SNP	ENST00000392499.2	37	c.57T>A	CCDS3275.1																																																																																				0.443	CRYGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344784.1	NM_017541		24	40	0	0	0	0.003954	0	24	40				
BCL6	604	broad.mit.edu	37	3	187447128	187447128	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr3:187447128G>T	ENST00000406870.2	-	5	1431	c.1065C>A	c.(1063-1065)atC>atA	p.I355I	BCL6_ENST00000450123.2_Silent_p.I355I|RP11-211G3.3_ENST00000449623.1_Intron|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Silent_p.I355I	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	355					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I355I(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		AAGCCTGGAGGATGCAGGCAT	0.572			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																		uc003frp.3		NA		Dom	yes		3	3q27	604	T|Mis	B-cell CLL/lymphoma 6			L	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3		NHL|CLL		1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(2)|central_nervous_system(1)	5						c.(1063-1065)ATC>ATA		B-cell lymphoma 6 protein isoform 1							130.0	149.0	143.0					3																	187447128		2203	4300	6503	SO:0001819	synonymous_variant	604				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:187447128G>T		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1065C>A	3.37:g.187447128G>T			Somatic				BCL6_uc011bsf.1_Silent_p.I355I|BCL6_uc010hza.2_Silent_p.I253I|BCL6_uc003frq.1_Silent_p.I355I	p.I355I	NM_001130845	NP_001124317	WXS	Illumina HiSeq	Unspecified	P41182	BCL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)	5	1522	-	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		355					A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	37	c.1065C>A	CCDS3289.1																																																																																				0.572	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931		27	208	1	0	7.41945e-09	0.005443	1.11409e-08	27	208				
SORCS2	57537	broad.mit.edu	37	4	7728606	7728606	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:7728606G>C	ENST00000507866.2	+	21	2954	c.2845G>C	c.(2845-2847)Gac>Cac	p.D949H	SORCS2_ENST00000329016.9_Missense_Mutation_p.D777H	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	949					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.D799H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GGTGCTGCAGGACTCCAGGGT	0.632																																							uc003gkb.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2845-2847)GAC>CAC		VPS10 domain receptor protein SORCS 2 precursor							67.0	83.0	78.0					4																	7728606		2123	4209	6332	SO:0001583	missense	57537					integral to membrane	neuropeptide receptor activity	g.chr4:7728606G>C	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2845G>C	4.37:g.7728606G>C	ENSP00000422185:p.Asp949His		Somatic				SORCS2_uc011bwi.1_Missense_Mutation_p.D777H	p.D949H	NM_020777	NP_065828	WXS	Illumina HiSeq	Unspecified	Q96PQ0	SORC2_HUMAN			21	2845	+			949			Lumenal (Potential).		Q9P2L7	Missense_Mutation	SNP	ENST00000507866.2	37	c.2845G>C	CCDS47008.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502306	0.44455	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.27104	1.69;1.81	4.25	4.25	0.50352	.	0.270901	0.33753	N	0.004597	T	0.48978	0.1530	M	0.72353	2.195	0.46901	D	0.999243	D;D	0.76494	0.998;0.999	D;D	0.63703	0.917;0.91	T	0.56721	-0.7932	10	0.87932	D	0	.	17.0841	0.86606	0.0:0.0:1.0:0.0	.	777;949	B5MED8;Q96PQ0	.;SORC2_HUMAN	H	949;777	ENSP00000422185:D949H;ENSP00000329124:D777H	ENSP00000329124:D777H	D	+	1	0	SORCS2	7779506	1.000000	0.71417	1.000000	0.80357	0.130000	0.20726	6.001000	0.70685	2.090000	0.63153	0.454000	0.30748	GAC		0.632	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777		21	34	0	0	0	0.001216	0	21	34				
N4BP2	55728	broad.mit.edu	37	4	40104287	40104287	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:40104287C>T	ENST00000261435.6	+	4	1238	c.822C>T	c.(820-822)tgC>tgT	p.C274C		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	274					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.C274C(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AATCTGAGTGCGTTGAGGCTC	0.433																																							uc003guy.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(820-822)TGC>TGT		Nedd4 binding protein 2							73.0	77.0	76.0					4																	40104287		2203	4300	6503	SO:0001819	synonymous_variant	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40104287C>T	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.822C>T	4.37:g.40104287C>T			Somatic				N4BP2_uc010ifq.2_Silent_p.C194C|N4BP2_uc010ifr.2_Silent_p.C194C	p.C274C	NM_018177	NP_060647	WXS	Illumina HiSeq	Unspecified	Q86UW6	N4BP2_HUMAN			4	1160	+			274					A0AVR3|Q9NVK2|Q9P2D4	Silent	SNP	ENST00000261435.6	37	c.822C>T	CCDS3457.1																																																																																				0.433	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		19	92	0	0	0	0.007413	0	19	92				
REST	5978	broad.mit.edu	37	4	57777171	57777171	+	Missense_Mutation	SNP	C	C	G	rs149829250		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:57777171C>G	ENST00000309042.7	+	2	681	c.367C>G	c.(367-369)Cct>Gct	p.P123A		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	123					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P123A(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					AGAACCTCAGCCTGTATTTGA	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		20294	0.0		0.001	False		,,,				2504	0.0						uc003hch.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9						c.(367-369)CCT>GCT		RE1-silencing transcription factor		C	ALA/PRO,ALA/PRO	2,4404	4.2+/-10.8	0,2,2201	67.0	66.0	66.0		367,367	3.2	1.0	4	dbSNP_134	66	25,8575	16.6+/-54.9	0,25,4275	yes	missense,missense	REST	NM_001193508.1,NM_005612.4	27,27	0,27,6476	GG,GC,CC		0.2907,0.0454,0.2076	probably-damaging,probably-damaging	123/1098,123/1098	57777171	27,12979	2203	4300	6503	SO:0001583	missense	5978				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	g.chr4:57777171C>G	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.367C>G	4.37:g.57777171C>G	ENSP00000311816:p.Pro123Ala		Somatic				REST_uc003hci.2_Missense_Mutation_p.P123A|REST_uc003hcj.1_Missense_Mutation_p.P123A|REST_uc010ihf.2_5'UTR	p.P123A	NM_005612	NP_005603	WXS	Illumina HiSeq	Unspecified	Q13127	REST_HUMAN			2	714	+	Glioma(25;0.08)|all_neural(26;0.181)		123					A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	37	c.367C>G	CCDS3509.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.73	3.203654	0.58234	4.54E-4	0.002907	ENSG00000084093	ENST00000456010;ENST00000309042;ENST00000358605	T	0.07688	3.17	6.02	3.16	0.36331	.	0.404030	0.23842	N	0.044031	T	0.07143	0.0181	N	0.22421	0.69	0.43550	D	0.995856	B;P	0.50369	0.048;0.934	B;P	0.47673	0.023;0.554	T	0.45366	-0.9266	10	0.20519	T	0.43	-8.5918	8.6138	0.33820	0.121:0.7019:0.1078:0.0693	.	123;123	Q13127-2;Q13127	.;REST_HUMAN	A	123	ENSP00000311816:P123A	ENSP00000311816:P123A	P	+	1	0	REST	57471928	0.844000	0.29557	1.000000	0.80357	0.949000	0.60115	0.133000	0.15912	1.551000	0.49450	0.655000	0.94253	CCT		0.463	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612		18	60	0	0	0	0.001216	0	18	60				
LPHN3	23284	broad.mit.edu	37	4	62778453	62778453	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:62778453G>A	ENST00000514591.1	+	12	2215	c.1886G>A	c.(1885-1887)cGc>cAc	p.R629H	LPHN3_ENST00000507625.1_Missense_Mutation_p.R697H|LPHN3_ENST00000511324.1_Missense_Mutation_p.R697H|LPHN3_ENST00000506746.1_Missense_Mutation_p.R697H|LPHN3_ENST00000512091.2_Missense_Mutation_p.R629H|LPHN3_ENST00000506720.1_Missense_Mutation_p.R697H|LPHN3_ENST00000506700.1_Missense_Mutation_p.R629H|LPHN3_ENST00000509896.1_Missense_Mutation_p.R697H|LPHN3_ENST00000514996.1_Missense_Mutation_p.R629H|LPHN3_ENST00000507164.1_Missense_Mutation_p.R697H|LPHN3_ENST00000514157.1_Missense_Mutation_p.R629H|LPHN3_ENST00000508946.1_Missense_Mutation_p.R629H|LPHN3_ENST00000545650.1_Missense_Mutation_p.R629H|LPHN3_ENST00000504896.1_Missense_Mutation_p.R629H|LPHN3_ENST00000508693.1_Missense_Mutation_p.R697H			Q9HAR2	LPHN3_HUMAN	latrophilin 3	623					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.R629H(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AAAAGAGAGCGCTCTTGCAGA	0.363																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(1885-1887)CGC>CAC		latrophilin 3 precursor							177.0	159.0	164.0					4																	62778453		1836	4094	5930	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62778453G>A	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1886G>A	4.37:g.62778453G>A	ENSP00000422533:p.Arg629His		Somatic				LPHN3_uc003hcq.3_Missense_Mutation_p.R629H|LPHN3_uc003hct.2_Intron|LPHN3_uc003hcs.1_Intron	p.R629H	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			10	2059	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.1886G>A	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203155	0.79127	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70986	-0.5;-0.49;-0.52;-0.52;-0.5;-0.49;-0.52;-0.52;-0.5;-0.5;-0.5;-0.52;-0.53;-0.53;-0.51	5.63	5.63	0.86233	.	.	.	.	.	T	0.82176	0.4980	L	0.58101	1.795	0.53688	D	0.999974	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.933	T	0.82932	-0.0212	9	0.66056	D	0.02	.	18.655	0.91450	0.0:0.0:1.0:0.0	.	629;629	E9PE04;Q9HAR2-2	.;.	H	629;629;697;697;629;629;629;697;697;697;629;629;629;697;697;629	ENSP00000423388:R629H;ENSP00000422533:R629H;ENSP00000423787:R697H;ENSP00000425033:R697H;ENSP00000424120:R629H;ENSP00000439831:R629H;ENSP00000421476:R697H;ENSP00000424030:R697H;ENSP00000421372:R697H;ENSP00000425201:R629H;ENSP00000423434:R629H;ENSP00000421627:R629H;ENSP00000420931:R697H;ENSP00000425884:R697H;ENSP00000424258:R629H	ENSP00000280009:R629H	R	+	2	0	LPHN3	62461048	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.914000	0.92735	2.645000	0.89757	0.561000	0.74099	CGC		0.363	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			23	92	0	0	0	0.002299	0	23	92				
TECRL	253017	broad.mit.edu	37	4	65147240	65147240	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:65147240G>T	ENST00000381210.3	-	10	980	c.870C>A	c.(868-870)ccC>ccA	p.P290P	TECRL_ENST00000507440.1_Silent_p.P290P	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	290					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.P290P(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TCCATGTGAAGGGGTTATAAT	0.328																																							uc003hcv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(868-870)CCC>CCA		steroid 5 alpha-reductase 2-like 2							105.0	102.0	103.0					4																	65147240		2203	4300	6503	SO:0001819	synonymous_variant	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65147240G>T	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.870C>A	4.37:g.65147240G>T			Somatic				TECRL_uc010ihi.2_RNA	p.P290P	NM_001010874	NP_001010874	WXS	Illumina HiSeq	Unspecified	Q5HYJ1	TECRL_HUMAN			10	979	-			290						Silent	SNP	ENST00000381210.3	37	c.870C>A	CCDS33990.1																																																																																				0.328	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		18	46	1	0	1.15919e-05	0.001216	1.54126e-05	18	46				
MUC7	4589	broad.mit.edu	37	4	71347156	71347156	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:71347156C>A	ENST00000304887.5	+	3	885	c.695C>A	c.(694-696)cCa>cAa	p.P232Q	MUC7_ENST00000456088.1_Missense_Mutation_p.P232Q|MUC7_ENST00000413702.1_Missense_Mutation_p.P232Q	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	232	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.P232Q(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			TCAGCTCCACCAGAGACCACA	0.587																																							uc011cat.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(694-696)CCA>CAA		mucin 7, secreted precursor							381.0	317.0	339.0					4																	71347156		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71347156C>A	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.695C>A	4.37:g.71347156C>A	ENSP00000302021:p.Pro232Gln		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.P232Q|MUC7_uc003hfj.2_Missense_Mutation_p.P232Q|uc011cav.1_Intron	p.P232Q	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	983	+			232			3.|Thr-rich.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.695C>A	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	6.122	0.390757	0.11581	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.50548	0.74;0.74;0.74	1.29	-0.745	0.11098	.	.	.	.	.	T	0.27098	0.0664	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20706	-1.0267	8	.	.	.	.	6.8805	0.24170	0.4789:0.521:0.0:0.0	.	232	Q8TAX7	MUC7_HUMAN	Q	232	ENSP00000407422:P232Q;ENSP00000400585:P232Q;ENSP00000302021:P232Q	.	P	+	2	0	MUC7	71381745	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.368000	0.07543	-0.310000	0.08766	-0.127000	0.14921	CCA		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		66	114	1	0	1.63498e-16	0.00361	2.81975e-16	66	114				
PDHA2	5161	broad.mit.edu	37	4	96762444	96762444	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:96762444G>T	ENST00000295266.4	+	1	1206	c.1143G>T	c.(1141-1143)tgG>tgT	p.W381C		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	381					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.W381C(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		CAAATCCATGGATCAAGTTTA	0.413																																							uc003htr.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1141-1143)TGG>TGT		pyruvate dehydrogenase E1 alpha 2 precursor	NADH(DB00157)						100.0	92.0	95.0					4																	96762444		2203	4300	6503	SO:0001583	missense	5161				glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity	g.chr4:96762444G>T		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.1143G>T	4.37:g.96762444G>T	ENSP00000295266:p.Trp381Cys		Somatic					p.W381C	NM_005390	NP_005381	WXS	Illumina HiSeq	Unspecified	P29803	ODPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	1	1206	+		Hepatocellular(203;0.114)	381					B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	c.1143G>T	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237237	0.39498	.	.	ENSG00000163114	ENST00000295266	D	0.85339	-1.97	4.85	4.01	0.46588	.	0.000000	0.85682	D	0.000000	D	0.92344	0.7571	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93276	0.6656	10	0.72032	D	0.01	-21.765	13.247	0.60028	0.0:0.1608:0.8392:0.0	.	381	P29803	ODPAT_HUMAN	C	381	ENSP00000295266:W381C	ENSP00000295266:W381C	W	+	3	0	PDHA2	96981467	1.000000	0.71417	0.989000	0.46669	0.291000	0.27294	7.161000	0.77505	1.404000	0.46819	0.563000	0.77884	TGG		0.413	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			13	90	1	0	4.3838e-07	0.001855	6.10143e-07	13	90				
FAT4	79633	broad.mit.edu	37	4	126372404	126372404	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:126372404G>T	ENST00000394329.3	+	9	10246	c.10233G>T	c.(10231-10233)gtG>gtT	p.V3411V	FAT4_ENST00000335110.5_Silent_p.V1709V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3411	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3411V(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCTACAGTGTGCAGATCAGTG	0.463																																							uc003ifj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(10231-10233)GTG>GTT		FAT tumor suppressor homolog 4 precursor							166.0	160.0	162.0					4																	126372404		2203	4300	6503	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126372404G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10233G>T	4.37:g.126372404G>T			Somatic				FAT4_uc011cgp.1_Silent_p.V1709V|FAT4_uc003ifi.1_Silent_p.V889V	p.V3411V	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			9	10233	+			3411			Cadherin 33.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.10233G>T	CCDS3732.3																																																																																				0.463	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		14	192	1	0	4.36969e-10	0.001855	6.81958e-10	14	192				
PCDH10	57575	broad.mit.edu	37	4	134071514	134071514	+	Silent	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:134071514G>T	ENST00000264360.5	+	1	1045	c.219G>T	c.(217-219)ctG>ctT	p.L73L	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L73L(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CAGGGGTGCTGTACGTGAACG	0.542																																							uc003iha.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(217-219)CTG>CTT		protocadherin 10 isoform 1 precursor							82.0	87.0	85.0					4																	134071514		2203	4300	6503	SO:0001819	synonymous_variant	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134071514G>T	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.219G>T	4.37:g.134071514G>T			Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.L73L	p.L73L	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	1045	+			73			Cadherin 1.|Extracellular (Potential).		Q4W5F6|Q96SF0	Silent	SNP	ENST00000264360.5	37	c.219G>T	CCDS34063.1																																																																																				0.542	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		7	112	1	0	0.00307968	0.00308	0.00379774	7	112				
TIGD4	201798	broad.mit.edu	37	4	153691222	153691222	+	Missense_Mutation	SNP	G	G	A	rs149761550		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:153691222G>A	ENST00000304337.2	-	2	1755	c.935C>T	c.(934-936)tCt>tTt	p.S312F		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	312	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S312F(1)|p.S312Y(1)		breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					ACATTTGGAAGATAAACATGA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		22282	0.0		0.001	False		,,,				2504	0.0						uc003imy.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(1)	1						c.(934-936)TCT>TTT		tigger transposable element derived 4		G	PHE/SER	2,4404	2.1+/-5.4	0,2,2201	102.0	106.0	105.0		935	6.0	1.0	4	dbSNP_134	105	8,8592	6.4+/-24.3	0,8,4292	yes	missense	TIGD4	NM_145720.3	155	0,10,6493	AA,AG,GG		0.093,0.0454,0.0769	probably-damaging	312/513	153691222	10,12996	2203	4300	6503	SO:0001583	missense	201798				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding	g.chr4:153691222G>A	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.935C>T	4.37:g.153691222G>A	ENSP00000355162:p.Ser312Phe		Somatic					p.S312F	NM_145720	NP_663772	WXS	Illumina HiSeq	Unspecified	Q8IY51	TIGD4_HUMAN			2	1717	-	all_hematologic(180;0.093)		312			DDE.		Q96LP5	Missense_Mutation	SNP	ENST00000304337.2	37	c.935C>T	CCDS34079.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.28	2.189705	0.38707	4.54E-4	9.3E-4	ENSG00000169989	ENST00000304337	T	0.50001	0.76	6.03	6.03	0.97812	.	0.273612	0.26496	N	0.024044	T	0.59211	0.2177	L	0.43923	1.385	0.36323	D	0.858403	D	0.71674	0.998	D	0.66196	0.942	T	0.65977	-0.6037	10	0.72032	D	0.01	-11.3566	13.3889	0.60811	0.0721:0.0:0.9279:0.0	.	312	Q8IY51	TIGD4_HUMAN	F	312	ENSP00000355162:S312F	ENSP00000355162:S312F	S	-	2	0	TIGD4	153910672	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.038000	0.64177	2.861000	0.98227	0.655000	0.94253	TCT		0.348	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720		49	81	0	0	0	0.00361	0	49	81				
ADAMTS16	170690	broad.mit.edu	37	5	5200305	5200305	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:5200305G>A	ENST00000274181.7	+	9	1512	c.1374G>A	c.(1372-1374)atG>atA	p.M458I	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.M458I	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	458	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M458I(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GCAACATCATGTCCCCTACAT	0.473																																							uc003jdl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(1372-1374)ATG>ATA		ADAM metallopeptidase with thrombospondin type 1							82.0	86.0	85.0					5																	5200305		1976	4176	6152	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5200305G>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1374G>A	5.37:g.5200305G>A	ENSP00000274181:p.Met458Ile		Somatic				ADAMTS16_uc003jdk.1_Missense_Mutation_p.M458I|ADAMTS16_uc003jdj.1_Missense_Mutation_p.M458I	p.M458I	NM_139056	NP_620687	WXS	Illumina HiSeq	Unspecified	Q8TE57	ATS16_HUMAN			9	1512	+			458			Peptidase M12B.		C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.1374G>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404879	0.83230	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.96265	-3.96;-3.96	4.96	4.96	0.65561	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.98776	0.9588	H	0.96333	3.805	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.91635	0.992;0.999;0.999	D	0.99716	1.1008	10	0.87932	D	0	.	17.3667	0.87366	0.0:0.0:1.0:0.0	.	458;458;458	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	I	458	ENSP00000274181:M458I;ENSP00000421631:M458I	ENSP00000274181:M458I	M	+	3	0	ADAMTS16	5253305	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.122000	0.94380	2.454000	0.82982	0.655000	0.94253	ATG		0.473	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		9	50	0	0	0	0.004482	0	9	50				
CDH12	1010	broad.mit.edu	37	5	21975358	21975358	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:21975358G>A	ENST00000382254.1	-	6	1454	c.368C>T	c.(367-369)cCt>cTt	p.P123L	CDH12_ENST00000522262.1_Missense_Mutation_p.P123L|CDH12_ENST00000504376.2_Missense_Mutation_p.P123L	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	123	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P123L(2)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AGTGTAGAAAGGTTTCTCTTC	0.443										HNSCC(59;0.17)																													uc010iuc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(367-369)CCT>CTT		cadherin 12, type 2 preproprotein							77.0	73.0	74.0					5																	21975358		2060	3872	5932	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21975358G>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.368C>T	5.37:g.21975358G>A	ENSP00000371689:p.Pro123Leu	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Missense_Mutation_p.P123L|CDH12_uc003jgk.2_Missense_Mutation_p.P123L	p.P123L	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			3	826	-			123			Cadherin 1.|Extracellular (Potential).		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.368C>T	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839990	0.91117	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.61980	0.06;0.06;0.06	5.16	5.16	0.70880	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.80138	0.4568	M	0.84219	2.685	0.80722	D	1	P;D	0.76494	0.898;0.999	P;D	0.62955	0.643;0.909	D	0.83678	0.0170	10	0.87932	D	0	.	18.6264	0.91340	0.0:0.0:1.0:0.0	.	123;123	B7Z2U6;P55289	.;CAD12_HUMAN	L	123	ENSP00000423577:P123L;ENSP00000371689:P123L;ENSP00000428786:P123L	ENSP00000371689:P123L	P	-	2	0	CDH12	22011115	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.357000	0.97099	2.414000	0.81942	0.484000	0.47621	CCT		0.443	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		4	175	0	0	0	0.000248	0	4	175				
CDH10	1008	broad.mit.edu	37	5	24537674	24537674	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:24537674G>T	ENST00000264463.4	-	3	848	c.341C>A	c.(340-342)aCa>aAa	p.T114K		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	114	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T114K(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AATTCGCCTTGTGGCATGAAT	0.408										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(340-342)ACA>AAA		cadherin 10, type 2 preproprotein							136.0	127.0	130.0					5																	24537674		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24537674G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.341C>A	5.37:g.24537674G>T	ENSP00000264463:p.Thr114Lys	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.T114K	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	3	673	-			114			Cadherin 1.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.341C>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027026	0.93518	.	.	ENSG00000040731	ENST00000264463	T	0.53640	0.61	5.73	5.73	0.89815	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	L	0.46614	1.455	0.58432	D	0.999995	D	0.65815	0.995	P	0.60473	0.875	T	0.61773	-0.6994	10	0.66056	D	0.02	.	18.8832	0.92365	0.0:0.0:1.0:0.0	.	114	Q9Y6N8	CAD10_HUMAN	K	114	ENSP00000264463:T114K	ENSP00000264463:T114K	T	-	2	0	CDH10	24573431	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.423000	0.73361	2.715000	0.92844	0.563000	0.77884	ACA		0.408	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		26	118	1	0	4.22769e-11	0.00632	6.66352e-11	26	118				
DNAJC21	134218	broad.mit.edu	37	5	34937468	34937468	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:34937468G>T	ENST00000342382.4	+	5	703	c.476G>T	c.(475-477)tGc>tTc	p.C159F	DNAJC21_ENST00000303525.7_Missense_Mutation_p.C159F|DNAJC21_ENST00000382021.2_Missense_Mutation_p.C159F			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	159					protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C159F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			CAGAGTTTCTGCACTCAAAAG	0.373																																							uc003jjc.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(475-477)TGC>TTC		DnaJ homology subfamily A member 5 isoform 2							63.0	64.0	64.0					5																	34937468		2203	4300	6503	SO:0001583	missense	134218				protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding	g.chr5:34937468G>T		CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.476G>T	5.37:g.34937468G>T	ENSP00000343728:p.Cys159Phe		Somatic				DNAJC21_uc003jjb.2_Missense_Mutation_p.C159F|DNAJC21_uc010iuu.1_Missense_Mutation_p.C43F	p.C159F	NM_001012339	NP_001012339	WXS	Illumina HiSeq	Unspecified	Q5F1R6	DJC21_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		5	703	+	all_lung(31;7.08e-05)		159					Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Missense_Mutation	SNP	ENST00000342382.4	37	c.476G>T	CCDS34144.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686689	0.88639	.	.	ENSG00000168724	ENST00000342382;ENST00000382021;ENST00000303525	T;T;T	0.43294	0.95;0.95;0.95	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.66117	0.2757	M	0.70595	2.14	0.80722	D	1	P;P;D	0.89917	0.858;0.613;1.0	B;B;D	0.91635	0.363;0.179;0.999	T	0.66838	-0.5822	10	0.56958	D	0.05	-4.1441	19.51	0.95137	0.0:0.0:1.0:0.0	.	159;159;159	Q5F1R6-3;Q5F1R6;Q5F1R6-2	.;DJC21_HUMAN;.	F	159	ENSP00000343728:C159F;ENSP00000371451:C159F;ENSP00000306289:C159F	ENSP00000306289:C159F	C	+	2	0	DNAJC21	34973225	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.378000	0.97191	2.672000	0.90937	0.650000	0.86243	TGC		0.373	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283		28	33	1	0	2.2171e-23	0.001786	4.15488e-23	28	33				
NUP155	9631	broad.mit.edu	37	5	37299057	37299057	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:37299057T>C	ENST00000231498.3	-	32	3909	c.3706A>G	c.(3706-3708)Agc>Ggc	p.S1236G	NUP155_ENST00000381843.2_Missense_Mutation_p.S1177G|NUP155_ENST00000513532.1_Missense_Mutation_p.S1172G|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1236					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.S1236G(1)		endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCCGAGGAGCTCAATGTCACA	0.368																																							uc003jku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3706-3708)AGC>GGC		nucleoporin 155kDa isoform 1							134.0	119.0	124.0					5																	37299057		2203	4300	6503	SO:0001583	missense	9631				carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity	g.chr5:37299057T>C	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.3706A>G	5.37:g.37299057T>C	ENSP00000231498:p.Ser1236Gly		Somatic				NUP155_uc003jkt.1_Missense_Mutation_p.S1177G|NUP155_uc010iuz.1_Missense_Mutation_p.S1172G	p.S1236G	NM_153485	NP_705618	WXS	Illumina HiSeq	Unspecified	O75694	NU155_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		32	3824	-	all_lung(31;0.000137)		1236					Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	c.3706A>G	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247958	0.59103	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.77750	-1.12;-1.11;-1.1	5.75	5.75	0.90469	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84570	0.5501	M	0.69823	2.125	0.52099	D	0.999941	D;P	0.67145	0.996;0.793	D;P	0.66847	0.947;0.74	T	0.81754	-0.0788	10	0.15066	T	0.55	.	13.1199	0.59321	0.0:0.0:0.1331:0.8669	.	1172;1236	E9PF10;O75694	.;NU155_HUMAN	G	1236;1177;1198;1172	ENSP00000231498:S1236G;ENSP00000371265:S1177G;ENSP00000422019:S1172G	ENSP00000231498:S1236G	S	-	1	0	NUP155	37334814	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	7.361000	0.79497	2.178000	0.69098	0.533000	0.62120	AGC		0.368	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298		3	46	0	0	0	0.000602	0	3	46				
EGFLAM	133584	broad.mit.edu	37	5	38458490	38458490	+	Missense_Mutation	SNP	C	C	A	rs139285515	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:38458490C>A	ENST00000354891.3	+	21	3135	c.2789C>A	c.(2788-2790)gCc>gAc	p.A930D	EGFLAM_ENST00000514476.1_Missense_Mutation_p.A65D|EGFLAM_ENST00000506135.1_Missense_Mutation_p.A65D|EGFLAM_ENST00000397210.3_Missense_Mutation_p.A65D|CTD-2263F21.1_ENST00000510469.1_RNA|EGFLAM_ENST00000322350.5_Missense_Mutation_p.A922D|EGFLAM_ENST00000397202.2_Missense_Mutation_p.A288D|EGFLAM_ENST00000336740.6_Missense_Mutation_p.A688D	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	930	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.A930D(1)|p.A922D(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CGAGTTAAGGCCGTTAGGTGA	0.562																																					Colon(62;485 1295 3347 17454)	Colon(62;485 1295 3347 17454)	uc003jlc.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(3)|skin(3)|ovary(1)	7						c.(2788-2790)GCC>GAC		EGF-like, fibronectin type III and laminin G							128.0	113.0	118.0					5																	38458490		2203	4300	6503	SO:0001583	missense	133584					cell junction|proteinaceous extracellular matrix|synapse		g.chr5:38458490C>A	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2789C>A	5.37:g.38458490C>A	ENSP00000346964:p.Ala930Asp		Somatic				EGFLAM_uc003jlb.1_Missense_Mutation_p.A922D|EGFLAM_uc003jle.1_Missense_Mutation_p.A688D|EGFLAM_uc003jlf.1_Missense_Mutation_p.A288D|EGFLAM_uc003jlg.1_Missense_Mutation_p.A65D	p.A930D	NM_152403	NP_689616	WXS	Illumina HiSeq	Unspecified	Q63HQ2	EGFLA_HUMAN			21	3113	+	all_lung(31;0.000385)		930			Laminin G-like 3.		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	c.2789C>A	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447329	0.84101	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580;ENST00000397210;ENST00000506135;ENST00000508131;ENST00000514476	T;T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.18;-1.18;-1.4;-1.18	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.92018	0.7471	M	0.89658	3.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.996;0.999;0.988	D	0.93062	0.6475	10	0.87932	D	0	.	19.6604	0.95864	0.0:1.0:0.0:0.0	.	688;930;922	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	D	930;922;688;288;688;65;65;65;65	ENSP00000346964:A930D;ENSP00000313084:A922D;ENSP00000337607:A688D;ENSP00000380385:A288D;ENSP00000380393:A65D;ENSP00000425579:A65D;ENSP00000427228:A65D;ENSP00000423228:A65D	ENSP00000313084:A922D	A	+	2	0	EGFLAM	38494247	1.000000	0.71417	0.998000	0.56505	0.556000	0.35491	7.087000	0.76893	2.721000	0.93114	0.655000	0.94253	GCC		0.562	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403		18	66	1	0	1.15919e-05	0.001216	1.54126e-05	18	66				
OSMR	9180	broad.mit.edu	37	5	38883971	38883971	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:38883971A>T	ENST00000274276.3	+	5	863	c.461A>T	c.(460-462)aAa>aTa	p.K154I	OSMR_ENST00000502536.1_Missense_Mutation_p.K154I	NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	154					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.K154I(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					GTTTTCCCTAAAGATAAGCTG	0.348																																							uc003jln.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(460-462)AAA>ATA		oncostatin M receptor precursor							95.0	90.0	92.0					5																	38883971		2203	4300	6503	SO:0001583	missense	9180				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity	g.chr5:38883971A>T	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.461A>T	5.37:g.38883971A>T	ENSP00000274276:p.Lys154Ile		Somatic				OSMR_uc003jlm.1_Missense_Mutation_p.K154I	p.K154I	NM_003999	NP_003990	WXS	Illumina HiSeq	Unspecified	Q99650	OSMR_HUMAN			5	828	+	all_lung(31;0.000365)		154			Extracellular (Potential).		Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	c.461A>T	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081390	0.36758	.	.	ENSG00000145623	ENST00000502536;ENST00000274276	T;T	0.56444	0.46;1.0	5.25	-0.198	0.13224	.	1.717170	0.02585	N	0.099260	T	0.45054	0.1323	L	0.54323	1.7	0.09310	N	1	B;B	0.33583	0.294;0.418	B;B	0.27076	0.051;0.076	T	0.35076	-0.9803	10	0.46703	T	0.11	.	5.2387	0.15460	0.3848:0.1576:0.0:0.4576	.	154;154	Q99650;Q99650-2	OSMR_HUMAN;.	I	154	ENSP00000422023:K154I;ENSP00000274276:K154I	ENSP00000274276:K154I	K	+	2	0	OSMR	38919728	0.000000	0.05858	0.033000	0.17914	0.975000	0.68041	0.128000	0.15810	0.365000	0.24400	0.533000	0.62120	AAA		0.348	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		33	120	0	0	0	0.004289	0	33	120				
DAB2	1601	broad.mit.edu	37	5	39383196	39383196	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:39383196T>A	ENST00000320816.6	-	10	1332	c.865A>T	c.(865-867)Acc>Tcc	p.T289S	DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000509337.1_Missense_Mutation_p.T268S|DAB2_ENST00000545653.1_Missense_Mutation_p.T268S	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	289	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.T289S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GGATTAGGGGTGGGAAAGAAG	0.473																																							uc003jlx.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|skin(1)	3						c.(865-867)ACC>TCC		disabled homolog 2							142.0	149.0	146.0					5																	39383196		2203	4300	6503	SO:0001583	missense	1601				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding	g.chr5:39383196T>A	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.865A>T	5.37:g.39383196T>A	ENSP00000313391:p.Thr289Ser		Somatic				DAB2_uc003jlw.2_Missense_Mutation_p.T268S	p.T289S	NM_001343	NP_001334	WXS	Illumina HiSeq	Unspecified	P98082	DAB2_HUMAN	Epithelial(62;0.137)		10	1396	-	all_lung(31;0.000197)		289					A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	c.865A>T	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.671929	0.67928	.	.	ENSG00000153071	ENST00000320816;ENST00000545653;ENST00000509337	T;T;T	0.40476	1.03;1.1;1.1	5.73	4.57	0.56435	.	0.106561	0.64402	D	0.000006	T	0.59115	0.2170	M	0.66939	2.045	0.38890	D	0.957093	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.58945	-0.7546	10	0.27082	T	0.32	-7.397	11.6764	0.51432	0.0:0.0689:0.0:0.9311	.	289;268	P98082;P98082-3	DAB2_HUMAN;.	S	289;268;268	ENSP00000313391:T289S;ENSP00000439919:T268S;ENSP00000426245:T268S	ENSP00000313391:T289S	T	-	1	0	DAB2	39418953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.916000	0.48813	1.113000	0.41760	0.533000	0.62120	ACC		0.473	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343		47	160	0	0	0	0.00361	0	47	160				
ANKRD34B	340120	broad.mit.edu	37	5	79855060	79855060	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:79855060C>A	ENST00000338682.3	-	5	1451	c.779G>T	c.(778-780)aGa>aTa	p.R260I		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	260						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R260I(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		TGAAGCCACTCTGTTCTGGTG	0.532																																							uc010jam.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(778-780)AGA>ATA		ankyrin repeat domain 34B							54.0	60.0	58.0					5																	79855060		2203	4300	6503	SO:0001583	missense	340120					cytoplasm|nucleus		g.chr5:79855060C>A		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.779G>T	5.37:g.79855060C>A	ENSP00000339802:p.Arg260Ile		Somatic				ANKRD34B_uc003kgw.2_Missense_Mutation_p.R260I|ANKRD34B_uc010jan.2_Missense_Mutation_p.R260I	p.R260I	NM_001004441	NP_001004441	WXS	Illumina HiSeq	Unspecified	A5PLL1	AN34B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)	4	1129	-		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)	260					B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	37	c.779G>T	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933662	0.73442	.	.	ENSG00000189127	ENST00000338682	T	0.20463	2.07	5.96	4.99	0.66335	.	0.341003	0.25117	N	0.033010	T	0.20455	0.0492	L	0.51422	1.61	0.50813	D	0.999893	P	0.49961	0.93	P	0.45037	0.467	T	0.01294	-1.1393	10	0.62326	D	0.03	-22.2349	4.8407	0.13489	0.0:0.7423:0.0:0.2577	.	260	A5PLL1	AN34B_HUMAN	I	260	ENSP00000339802:R260I	ENSP00000339802:R260I	R	-	2	0	ANKRD34B	79890816	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	2.152000	0.42272	2.832000	0.97577	0.655000	0.94253	AGA		0.532	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441		31	90	1	0	4.4194e-11	0.002836	6.94269e-11	31	90				
PCSK1	5122	broad.mit.edu	37	5	95764992	95764992	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:95764992G>C	ENST00000311106.3	-	2	447	c.210C>G	c.(208-210)ttC>ttG	p.F70L	PCSK1_ENST00000508626.1_Missense_Mutation_p.F23L|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	70					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.F70L(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTTATGTTTGAATAAGTAGT	0.328																																							uc003kls.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(208-210)TTC>TTG		proprotein convertase subtilisin/kexin type 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						108.0	105.0	106.0					5																	95764992		2203	4298	6501	SO:0001583	missense	5122				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity	g.chr5:95764992G>C		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.210C>G	5.37:g.95764992G>C	ENSP00000308024:p.Phe70Leu		Somatic					p.F70L	NM_000439	NP_000430	WXS	Illumina HiSeq	Unspecified	P29120	NEC1_HUMAN		all cancers(79;3.44e-16)	2	416	-		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)	70					B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	37	c.210C>G	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941105	0.34283	.	.	ENSG00000175426	ENST00000311106;ENST00000508626;ENST00000509190	T;T;T	0.49432	0.78;0.78;0.78	5.52	2.8	0.32819	Proteinase inhibitor, propeptide (1);	0.144794	0.64402	N	0.000006	T	0.42017	0.1184	L	0.58354	1.805	0.44024	D	0.996741	B	0.02656	0.0	B	0.06405	0.002	T	0.22173	-1.0224	10	0.38643	T	0.18	-9.2856	10.6558	0.45673	0.2031:0.0:0.7969:0.0	.	70	P29120	NEC1_HUMAN	L	70;23;70	ENSP00000308024:F70L;ENSP00000421600:F23L;ENSP00000427294:F70L	ENSP00000308024:F70L	F	-	3	2	PCSK1	95790748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.738000	0.38207	0.301000	0.22738	0.650000	0.86243	TTC		0.328	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439		5	103	0	0	0	0.000602	0	5	103				
CSNK1G3	1456	broad.mit.edu	37	5	122909090	122909090	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:122909090G>T	ENST00000361991.2	+	4	323	c.293G>T	c.(292-294)gGt>gTt	p.G98V	CSNK1G3_ENST00000395411.1_Missense_Mutation_p.G98V|CSNK1G3_ENST00000511130.2_5'UTR|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.G98V|CSNK1G3_ENST00000512718.3_Missense_Mutation_p.G23V|CSNK1G3_ENST00000521364.1_Missense_Mutation_p.G98V|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.G98V|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.G98V|CSNK1G3_ENST00000360683.2_Missense_Mutation_p.G98V			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	98	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G98V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		CCCCCAGATGGTATACCTCAA	0.338																																					Pancreas(187;2868 2964 4353 6297)	Pancreas(187;2868 2964 4353 6297)	uc003ktm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)GGT>GTT		casein kinase 1, gamma 3 isoform 1							155.0	148.0	151.0					5																	122909090		2203	4300	6503	SO:0001583	missense	1456				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr5:122909090G>T	AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.293G>T	5.37:g.122909090G>T	ENSP00000354942:p.Gly98Val		Somatic				CSNK1G3_uc003ktl.2_Missense_Mutation_p.G98V|CSNK1G3_uc003ktn.2_Missense_Mutation_p.G98V|CSNK1G3_uc003kto.2_Missense_Mutation_p.G98V|CSNK1G3_uc011cwr.1_Missense_Mutation_p.G23V|CSNK1G3_uc011cws.1_5'UTR|CSNK1G3_uc010jda.2_Missense_Mutation_p.G98V	p.G98V	NM_004384	NP_004375	WXS	Illumina HiSeq	Unspecified	Q9Y6M4	KC1G3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)	5	1012	+		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	98			Protein kinase.		A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	ENST00000361991.2	37	c.293G>T	CCDS4135.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580192	0.86645	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	4.9	4.9	0.64082	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.67363	0.2885	H	0.99182	4.46	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;1.0	T	0.82914	-0.0221	10	0.87932	D	0	.	18.5808	0.91170	0.0:0.0:1.0:0.0	.	23;98;98;98;98	B4DSH2;A8K040;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.;.;.;KC1G3_HUMAN;.	V	98;98;98;23;98;98;98;98	ENSP00000378807:G98V;ENSP00000378806:G98V;ENSP00000334735:G98V;ENSP00000421998:G23V;ENSP00000429412:G98V;ENSP00000423838:G98V;ENSP00000354942:G98V;ENSP00000353904:G98V	ENSP00000334735:G98V	G	+	2	0	CSNK1G3	122936989	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.766000	0.98957	2.634000	0.89283	0.655000	0.94253	GGT		0.338	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1	NM_004384		8	159	1	0	0.000274275	0.004482	0.000348147	8	159				
FBN2	2201	broad.mit.edu	37	5	127713551	127713551	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:127713551C>G	ENST00000508053.1	-	19	2717	c.1743G>C	c.(1741-1743)caG>caC	p.Q581H	FBN2_ENST00000508989.1_Missense_Mutation_p.Q548H|FBN2_ENST00000511489.1_5'Flank|FBN2_ENST00000262464.4_Missense_Mutation_p.Q581H			P35556	FBN2_HUMAN	fibrillin 2	581	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Q581H(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GAACCCCATTCTGGATGCACT	0.358																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(1741-1743)CAG>CAC		fibrillin 2 precursor							127.0	135.0	132.0					5																	127713551		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127713551C>G	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1743G>C	5.37:g.127713551C>G	ENSP00000424571:p.Gln581His		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.Q548H	p.Q581H	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	13	2182	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	581			EGF-like 8; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.1743G>C	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051889	0.55218	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87650	-2.28;-2.28;-2.28	4.21	4.21	0.49690	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000006	D	0.84401	0.5464	L	0.35542	1.07	0.47037	D	0.999291	B;P	0.50710	0.059;0.938	B;P	0.48952	0.028;0.596	T	0.80939	-0.1158	10	0.15952	T	0.53	.	17.8845	0.88850	0.0:1.0:0.0:0.0	.	548;581	D6RJI3;P35556	.;FBN2_HUMAN	H	581;581;548	ENSP00000262464:Q581H;ENSP00000424571:Q581H;ENSP00000425596:Q548H	ENSP00000262464:Q581H	Q	-	3	2	FBN2	127741450	0.988000	0.35896	1.000000	0.80357	0.978000	0.69477	0.240000	0.18042	2.648000	0.89879	0.655000	0.94253	CAG		0.358	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		15	203	0	0	0	0.003163	0	15	203				
FBN2	2201	broad.mit.edu	37	5	127713567	127713567	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:127713567A>T	ENST00000508053.1	-	19	2701	c.1727T>A	c.(1726-1728)aTt>aAt	p.I576N	FBN2_ENST00000508989.1_Missense_Mutation_p.I543N|FBN2_ENST00000511489.1_5'Flank|FBN2_ENST00000262464.4_Missense_Mutation_p.I576N			P35556	FBN2_HUMAN	fibrillin 2	576	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.I576N(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCACTCATCAATATCTAGGAA	0.348																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(1726-1728)ATT>AAT		fibrillin 2 precursor							112.0	120.0	117.0					5																	127713567		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127713567A>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1727T>A	5.37:g.127713567A>T	ENSP00000424571:p.Ile576Asn		Somatic				FBN2_uc003kuv.2_Missense_Mutation_p.I543N	p.I576N	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	13	2166	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	576			EGF-like 8; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.1727T>A	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.824940	0.71143	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.93659	-3.26;-3.26;-3.26	4.21	4.21	0.49690	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000003	D	0.97216	0.9090	M	0.92738	3.34	0.58432	D	0.999994	D;D	0.69078	0.997;0.991	D;D	0.78314	0.966;0.991	D	0.98109	1.0419	10	0.87932	D	0	.	14.3546	0.66727	1.0:0.0:0.0:0.0	.	543;576	D6RJI3;P35556	.;FBN2_HUMAN	N	576;576;543	ENSP00000262464:I576N;ENSP00000424571:I576N;ENSP00000425596:I543N	ENSP00000262464:I576N	I	-	2	0	FBN2	127741466	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	7.196000	0.77805	2.140000	0.66376	0.533000	0.62120	ATT		0.348	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		11	180	0	0	0	0.001855	0	11	180				
ACSL6	23305	broad.mit.edu	37	5	131324551	131324551	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:131324551A>G	ENST00000379240.1	-	6	677	c.524T>C	c.(523-525)gTc>gCc	p.V175A	ACSL6_ENST00000379264.2_Missense_Mutation_p.V200A|ACSL6_ENST00000431707.1_Missense_Mutation_p.V140A|ACSL6_ENST00000379246.1_Missense_Mutation_p.V186A|ACSL6_ENST00000379249.3_Missense_Mutation_p.V175A|ACSL6_ENST00000296869.4_Missense_Mutation_p.V200A|ACSL6_ENST00000379244.1_Missense_Mutation_p.V175A|ACSL6_ENST00000379272.2_Missense_Mutation_p.V175A|ACSL6_ENST00000543479.1_Missense_Mutation_p.V175A|ACSL6_ENST00000357096.1_Missense_Mutation_p.V140A|ACSL6_ENST00000379255.1_Missense_Mutation_p.V140A|ACSL6_ENST00000544770.1_Missense_Mutation_p.V84A			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	175					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)	p.V200A(2)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATAGAGCGGGACCACCACCAT	0.597																																							uc010jdo.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(523-525)GTC>GCC		acyl-CoA synthetase long-chain family member 6							127.0	121.0	123.0					5																	131324551		2203	4300	6503	SO:0001583	missense	23305				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr5:131324551A>G	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.524T>C	5.37:g.131324551A>G	ENSP00000368542:p.Val175Ala		Somatic				ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Missense_Mutation_p.V200A|ACSL6_uc003kvy.1_Missense_Mutation_p.V200A|ACSL6_uc003kwb.2_Missense_Mutation_p.V165A|ACSL6_uc003kvz.1_Missense_Mutation_p.V140A|ACSL6_uc003kwa.1_Missense_Mutation_p.V186A|ACSL6_uc010jdn.1_Missense_Mutation_p.V175A|ACSL6_uc010jdp.1_5'Flank	p.V175A	NM_015256	NP_056071	WXS	Illumina HiSeq	Unspecified	Q9UKU0	ACSL6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		6	607	-		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	175			Cytoplasmic (Potential).		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37	c.524T>C		.	.	.	.	.	.	.	.	.	.	A	28.8	4.951897	0.92660	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479;ENST00000434099;ENST00000430403	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.79	5.79	0.91817	AMP-dependent synthetase/ligase (1);	0.053424	0.85682	D	0.000000	T	0.79811	0.4510	M	0.93854	3.465	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.997;0.998;0.999;0.997;0.997;0.997	D;P;D;D;P;P;P	0.79108	0.986;0.902;0.941;0.992;0.902;0.902;0.902	D	0.85259	0.1049	10	0.72032	D	0.01	.	16.1224	0.81369	1.0:0.0:0.0:0.0	.	175;175;165;175;140;200;200	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	A	175;200;175;140;140;200;186;175;84;175;140;175;140;175	ENSP00000368551:V175A;ENSP00000368566:V200A;ENSP00000368574:V175A;ENSP00000349608:V140A;ENSP00000368557:V140A;ENSP00000296869:V200A;ENSP00000368548:V186A;ENSP00000368546:V175A;ENSP00000445154:V84A;ENSP00000368542:V175A;ENSP00000413329:V140A;ENSP00000442124:V175A;ENSP00000397507:V140A;ENSP00000398423:V175A	ENSP00000296869:V200A	V	-	2	0	ACSL6	131352450	1.000000	0.71417	0.998000	0.56505	0.847000	0.48162	9.237000	0.95368	2.208000	0.71279	0.533000	0.62120	GTC		0.597	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256		4	151	0	0	0	0.001168	0	4	151				
PCDHB4	56131	broad.mit.edu	37	5	140502877	140502877	+	Missense_Mutation	SNP	C	C	A	rs559824378		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140502877C>A	ENST00000194152.1	+	1	1297	c.1297C>A	c.(1297-1299)Cag>Aag	p.Q433K	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	433	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q433K(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGAAAACCCAGCAGAACAT	0.582													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17399	0.0		0.0	False		,,,				2504	0.0						uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1297-1299)CAG>AAG		protocadherin beta 4 precursor							111.0	100.0	104.0					5																	140502877		2203	4300	6503	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140502877C>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1297C>A	5.37:g.140502877C>A	ENSP00000194152:p.Gln433Lys		Somatic					p.Q433K	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1297	+			433			Cadherin 4.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1297C>A	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	C	2.083	-0.410295	0.04799	.	.	ENSG00000081818	ENST00000194152	T	0.01685	4.69	3.97	-1.69	0.08186	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02929	0.0087	L	0.55834	1.745	0.09310	N	1	B	0.13145	0.007	B	0.23419	0.046	T	0.34428	-0.9829	9	0.59425	D	0.04	.	13.8881	0.63721	0.0:0.2821:0.6408:0.0771	.	433	Q9Y5E5	PCDB4_HUMAN	K	433	ENSP00000194152:Q433K	ENSP00000194152:Q433K	Q	+	1	0	PCDHB4	140483061	0.000000	0.05858	0.155000	0.22561	0.021000	0.10359	-2.395000	0.01053	-0.493000	0.06678	0.558000	0.71614	CAG		0.582	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		33	123	1	0	1.02151e-06	0.002836	1.40531e-06	33	123				
PCDHB7	56129	broad.mit.edu	37	5	140554464	140554464	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140554464C>A	ENST00000231137.3	+	1	2222	c.2048C>A	c.(2047-2049)tCg>tAg	p.S683*	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	683					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S683*(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGCCAACTCGCTCACCGTC	0.706																																							uc003lit.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2047-2049)TCG>TAG		protocadherin beta 7 precursor							60.0	94.0	82.0					5																	140554464		2200	4295	6495	SO:0001587	stop_gained	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140554464C>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2048C>A	5.37:g.140554464C>A	ENSP00000231137:p.Ser683*		Somatic				PCDHB8_uc011dai.1_5'Flank	p.S683*	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2222	+			683			Extracellular (Potential).		A1L3Y8	Nonsense_Mutation	SNP	ENST00000231137.3	37	c.2048C>A	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	C	39	7.316110	0.98207	.	.	ENSG00000113212	ENST00000231137	.	.	.	3.77	0.745	0.18359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.3288	0.04230	0.1548:0.5221:0.1502:0.1729	.	.	.	.	X	683	.	ENSP00000231137:S683X	S	+	2	0	PCDHB7	140534648	0.000000	0.05858	0.144000	0.22314	0.775000	0.43874	0.225000	0.17757	-0.106000	0.12110	-0.384000	0.06662	TCG		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		39	80	1	0	2.05212e-20	0.005524	3.7141e-20	39	80				
PCDHGB1	56104	broad.mit.edu	37	5	140732045	140732045	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140732045A>T	ENST00000523390.1	+	1	2218	c.2218A>T	c.(2218-2220)Agc>Tgc	p.S740C	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	740					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S740C(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCAACCACAGCGAGGGGAC	0.562																																							uc003ljo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2218-2220)AGC>TGC		protocadherin gamma subfamily B, 1 isoform 1							96.0	100.0	99.0					5																	140732045		1976	4149	6125	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140732045A>T	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.2218A>T	5.37:g.140732045A>T	ENSP00000429273:p.Ser740Cys		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc011daq.1_Missense_Mutation_p.S740C|PCDHGA4_uc003ljp.1_5'Flank	p.S740C	NM_018922	NP_061745	WXS	Illumina HiSeq	Unspecified	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2218	+			740			Cytoplasmic (Potential).		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.2218A>T	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	14.22	2.469323	0.43839	.	.	ENSG00000254221	ENST00000523390	T	0.52057	0.68	5.14	5.14	0.70334	.	.	.	.	.	T	0.67031	0.2850	M	0.88377	2.95	0.09310	N	1	D;D	0.63046	0.992;0.992	D;P	0.63877	0.919;0.832	T	0.61888	-0.6970	9	0.38643	T	0.18	.	6.1445	0.20278	0.7751:0.0:0.0798:0.1451	.	740;740	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	C	740	ENSP00000429273:S740C	ENSP00000429273:S740C	S	+	1	0	PCDHGB1	140712229	0.000000	0.05858	0.154000	0.22540	0.038000	0.13279	0.196000	0.17176	2.054000	0.61138	0.533000	0.62120	AGC		0.562	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		27	131	0	0	0	0.00632	0	27	131				
PCDHGA4	56111	broad.mit.edu	37	5	140735712	140735712	+	Nonsense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140735712T>A	ENST00000571252.1	+	1	945	c.945T>A	c.(943-945)taT>taA	p.Y315*	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGATTCTATGACATAGATG	0.438																																							uc003ljq.1		NA																	0					0						c.(943-945)TAT>TAA		protocadherin gamma subfamily A, 4 isoform 1							50.0	49.0	50.0					5																	140735712		1853	4101	5954	SO:0001587	stop_gained	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140735712T>A	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.945T>A	5.37:g.140735712T>A	ENSP00000458570:p.Tyr315*		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Nonsense_Mutation_p.Y315*	p.Y315*	NM_018917	NP_061740	WXS	Illumina HiSeq	Unspecified	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	945	+			315			Cadherin 3.|Extracellular (Potential).		Q9Y5D3	Nonsense_Mutation	SNP	ENST00000571252.1	37	c.945T>A	CCDS58979.1																																																																																				0.438	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		7	19	0	0	0	0.001984	0	7	19				
PCDHGB3	56102	broad.mit.edu	37	5	140779378	140779378	+	Intron	SNP	G	G	A	rs371245499		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140779378G>A	ENST00000576222.1	+	1	2546				PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGTACCCCGCGCTGGGTCC	0.692																																							uc003lkf.1		NA																	0					0						c.(1684-1686)GCG>ACG		protocadherin gamma subfamily B, 5 isoform 1							27.0	35.0	32.0					5																	140779378		2083	4229	6312	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140779378G>A	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+27002G>A	5.37:g.140779378G>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.A562T	p.A562T	NM_018925	NP_061748	WXS	Illumina HiSeq	Unspecified	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1684	+			562			Extracellular (Potential).		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.1684G>A	CCDS58980.1																																																																																				0.692	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		5	34	0	0	0	0.001168	0	5	34				
GNPDA1	10007	broad.mit.edu	37	5	141387389	141387389	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:141387389C>A	ENST00000508177.1	-	2	959	c.201G>T	c.(199-201)aaG>aaT	p.K67N	GNPDA1_ENST00000542860.1_Missense_Mutation_p.K67N|GNPDA1_ENST00000311337.6_Missense_Mutation_p.K67N|GNPDA1_ENST00000500692.2_Missense_Mutation_p.K67N|GNPDA1_ENST00000458112.2_Intron|GNPDA1_ENST00000513454.1_Missense_Mutation_p.K67N|GNPDA1_ENST00000503794.1_Missense_Mutation_p.K67N			P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1	67					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucosamine catabolic process (GO:0006043)|N-acetylglucosamine metabolic process (GO:0006044)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)	p.K67N(1)		central_nervous_system(1)|lung(1)|skin(3)|stomach(1)	6		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTGAAGGTCTTCACATATT	0.478																																							uc003lmf.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(199-201)AAG>AAT		glucosamine-6-phosphate deaminase 1							193.0	192.0	193.0					5																	141387389		2203	4300	6503	SO:0001583	missense	10007				generation of precursor metabolites and energy|glucosamine catabolic process|N-acetylglucosamine metabolic process|single fertilization	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity	g.chr5:141387389C>A	AF048826	CCDS4272.1	5q21	2008-02-05	2003-10-17	2003-10-22	ENSG00000113552	ENSG00000113552	3.5.99.6		4417	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate deaminase"", ""oscillin"""	601798	"""glucosamine-6-phosphate isomerase"""	GNPI		9714720, 9438414	Standard	NM_005471		Approved	GNPDA, HLN, GPI, KIAA0060	uc010jgh.3	P46926	OTTHUMG00000129657	ENST00000508177.1:c.201G>T	5.37:g.141387389C>A	ENSP00000423674:p.Lys67Asn		Somatic				GNPDA1_uc003lmg.3_Missense_Mutation_p.K67N|GNPDA1_uc010jgh.2_Missense_Mutation_p.K67N|GNPDA1_uc003lmh.3_Intron	p.K67N	NM_005471	NP_005462	WXS	Illumina HiSeq	Unspecified	P46926	GNPI1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	960	-		all_hematologic(541;0.118)	67					B7Z3X4|D3DQE7	Missense_Mutation	SNP	ENST00000508177.1	37	c.201G>T	CCDS4272.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688765	0.68271	.	.	ENSG00000113552	ENST00000513454;ENST00000311337;ENST00000500692;ENST00000508177;ENST00000503794;ENST00000542860;ENST00000504139;ENST00000505689;ENST00000510194;ENST00000503229	T;T;T;T;T;T;T;T;T;T	0.49139	0.97;0.97;0.97;0.97;0.97;0.79;0.97;0.97;0.97;0.97	5.44	4.58	0.56647	Glucosamine/galactosamine-6-phosphate isomerase (1);	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	M	0.74389	2.26	0.24917	N	0.992002	P	0.40931	0.733	P	0.46049	0.502	T	0.55055	-0.8200	10	0.87932	D	0	-27.63	6.2307	0.20734	0.0:0.7015:0.0:0.2985	.	67	P46926	GNPI1_HUMAN	N	67;67;67;67;67;67;67;88;67;67	ENSP00000423494:K67N;ENSP00000311876:K67N;ENSP00000424275:K67N;ENSP00000423674:K67N;ENSP00000423485:K67N;ENSP00000445143:K67N;ENSP00000424625:K67N;ENSP00000421524:K88N;ENSP00000424537:K67N;ENSP00000422173:K67N	ENSP00000311876:K67N	K	-	3	2	GNPDA1	141367573	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.412000	0.21131	1.519000	0.48950	0.655000	0.94253	AAG		0.478	GNPDA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370631.1	NM_005471		64	202	1	0	2.03652e-46	0.00361	4.16045e-46	64	202				
PDE6A	5145	broad.mit.edu	37	5	149240474	149240474	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:149240474G>T	ENST00000255266.5	-	22	2686	c.2567C>A	c.(2566-2568)tCc>tAc	p.S856Y		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	856					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.S856Y(1)|p.S856C(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GATGCAGCAGGACTTGGATGT	0.562																																							uc003lrg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(2566-2568)TCC>TAC		phosphodiesterase 6A							79.0	73.0	75.0					5																	149240474		2203	4300	6503	SO:0001583	missense	5145				cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr5:149240474G>T		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2567C>A	5.37:g.149240474G>T	ENSP00000255266:p.Ser856Tyr		Somatic					p.S856Y	NM_000440	NP_000431	WXS	Illumina HiSeq	Unspecified	P16499	PDE6A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		22	2687	-			856					Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	c.2567C>A	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474466	0.63737	.	.	ENSG00000132915	ENST00000255266	T	0.63417	-0.04	4.9	4.02	0.46733	.	0.357054	0.27060	N	0.021121	T	0.54615	0.1869	L	0.54323	1.7	0.42139	D	0.9915	B	0.26935	0.164	B	0.22753	0.041	T	0.57394	-0.7819	10	0.87932	D	0	.	9.4176	0.38530	0.0994:0.0:0.9006:0.0	.	856	P16499	PDE6A_HUMAN	Y	856	ENSP00000255266:S856Y	ENSP00000255266:S856Y	S	-	2	0	PDE6A	149220667	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.275000	0.58927	1.171000	0.42768	0.561000	0.74099	TCC		0.562	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2			9	24	1	0	1.08611e-07	0.000978	1.5619e-07	9	24				
GABRA1	2554	broad.mit.edu	37	5	161317997	161317997	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:161317997T>A	ENST00000428797.2	+	9	1152	c.797T>A	c.(796-798)aTt>aAt	p.I266N	GABRA1_ENST00000023897.6_Missense_Mutation_p.I266N|GABRA1_ENST00000393943.4_Missense_Mutation_p.I266N|GABRA1_ENST00000437025.2_Missense_Mutation_p.I266N|GABRA1_ENST00000444819.1_Missense_Mutation_p.I266N|GABRA1_ENST00000420560.1_Missense_Mutation_p.I266N	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	266					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.I266N(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	ATGACAGTGATTCTCTCACAA	0.413																																							uc010jiw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(796-798)ATT>AAT		gamma-aminobutyric acid (GABA) A receptor, alpha	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)						140.0	133.0	136.0					5																	161317997		2203	4300	6503	SO:0001583	missense	2554				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:161317997T>A		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.797T>A	5.37:g.161317997T>A	ENSP00000393097:p.Ile266Asn		Somatic				GABRA1_uc010jix.2_Missense_Mutation_p.I266N|GABRA1_uc010jiy.2_Missense_Mutation_p.I266N|GABRA1_uc003lyx.3_Missense_Mutation_p.I266N|GABRA1_uc010jiz.2_Missense_Mutation_p.I266N|GABRA1_uc010jja.2_Missense_Mutation_p.I266N|GABRA1_uc010jjb.2_Missense_Mutation_p.I266N	p.I266N	NM_000806	NP_000797	WXS	Illumina HiSeq	Unspecified	P14867	GBRA1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	9	1265	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	266			Helical; (Probable).		D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	c.797T>A	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689004	0.88735	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25;-2.25	5.52	5.52	0.82312	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94175	0.8131	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95105	0.8233	10	0.87932	D	0	.	15.6517	0.77099	0.0:0.0:0.0:1.0	.	266	P14867	GBRA1_HUMAN	N	266	ENSP00000023897:I266N;ENSP00000393097:I266N;ENSP00000377517:I266N;ENSP00000415441:I266N;ENSP00000408041:I266N;ENSP00000414232:I266N	ENSP00000023897:I266N	I	+	2	0	GABRA1	161250575	1.000000	0.71417	0.994000	0.49952	0.817000	0.46193	7.903000	0.87398	2.105000	0.64084	0.528000	0.53228	ATT		0.413	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5		5	113	0	0	0	0.000602	0	5	113				
HMMR	3161	broad.mit.edu	37	5	162896811	162896811	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:162896811G>T	ENST00000358715.3	+	5	471	c.435G>T	c.(433-435)agG>agT	p.R145S	HMMR_ENST00000432118.2_Missense_Mutation_p.R59S|HMMR_ENST00000353866.3_Missense_Mutation_p.R130S|HMMR_ENST00000393915.4_Missense_Mutation_p.R146S			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	145					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)	p.R145S(1)		cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	AATTGACCAGGACTAATGAAC	0.373																																							uc003lzf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(433-435)AGG>AGT		hyaluronan-mediated motility receptor isoform b							85.0	80.0	81.0					5																	162896811		2203	4300	6503	SO:0001583	missense	3161					cell surface|cytoplasm	hyaluronic acid binding	g.chr5:162896811G>T	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.435G>T	5.37:g.162896811G>T	ENSP00000351554:p.Arg145Ser		Somatic				HMMR_uc003lzh.2_Missense_Mutation_p.R146S|HMMR_uc003lzg.2_Missense_Mutation_p.R130S|HMMR_uc011dem.1_Missense_Mutation_p.R59S	p.R145S	NM_012484	NP_036616	WXS	Illumina HiSeq	Unspecified	O75330	HMMR_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	5	617	+	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	145					A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	c.435G>T	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.467245	0.63625	.	.	ENSG00000072571	ENST00000416990;ENST00000520345;ENST00000522094;ENST00000353866;ENST00000434157;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.78481	2.49;-1.18;-1.18;2.65;-1.18	5.95	1.18	0.20946	.	0.140243	0.64402	D	0.000003	T	0.80523	0.4639	M	0.67953	2.075	0.09310	N	1	P;P;D;D	0.53151	0.953;0.743;0.958;0.958	P;P;P;P	0.56474	0.736;0.53;0.799;0.799	T	0.71045	-0.4706	10	0.72032	D	0.01	-6.0866	7.5462	0.27768	0.6759:0.0:0.3241:0.0	.	59;146;130;145	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	S	31;31;31;130;130;146;122;59;145	ENSP00000400527:R31S;ENSP00000185942:R130S;ENSP00000377492:R146S;ENSP00000402673:R59S;ENSP00000351554:R145S	ENSP00000185942:R130S	R	+	3	2	HMMR	162829389	0.967000	0.33354	0.001000	0.08648	0.913000	0.54294	2.327000	0.43858	0.288000	0.22398	0.655000	0.94253	AGG		0.373	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484		19	22	1	0	3.85864e-22	0.00278	7.14674e-22	19	22				
UIMC1	51720	broad.mit.edu	37	5	176332314	176332314	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:176332314T>A	ENST00000377227.4	-	15	2261	c.2129A>T	c.(2128-2130)aAa>aTa	p.K710I	UIMC1_ENST00000506128.1_Missense_Mutation_p.K544I|UIMC1_ENST00000511320.1_Missense_Mutation_p.K710I|UIMC1_ENST00000377219.2_Missense_Mutation_p.K711I			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	710					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.K710I(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTGCCAGCTTTGGTCCGTGT	0.448																																							uc011dfp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2128-2130)AAA>ATA		ubiquitin interaction motif containing 1							81.0	83.0	82.0					5																	176332314		2203	4300	6503	SO:0001583	missense	51720				double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding	g.chr5:176332314T>A	AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.2129A>T	5.37:g.176332314T>A	ENSP00000366434:p.Lys710Ile		Somatic				UIMC1_uc003mfc.1_Missense_Mutation_p.K587I|UIMC1_uc003mfd.1_Missense_Mutation_p.K340I	p.K710I	NM_016290	NP_057374	WXS	Illumina HiSeq	Unspecified	Q96RL1	UIMC1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		15	2296	-	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	710					A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	c.2129A>T	CCDS4408.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945736	0.53079	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000506128;ENST00000377220;ENST00000323774	T;T;T;T	0.20738	2.07;2.07;2.07;2.05	5.7	2.14	0.27477	.	0.193623	0.41396	D	0.000881	T	0.36552	0.0971	L	0.56769	1.78	0.32943	D	0.518679	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.76575	0.943;0.988;0.943	T	0.47328	-0.9126	10	0.87932	D	0	.	7.6094	0.28120	0.0:0.3218:0.0:0.6782	.	710;340;632	Q96RL1;Q96RL1-4;Q96RL1-3	UIMC1_HUMAN;.;.	I	710;711;710;544;633;341	ENSP00000366434:K710I;ENSP00000366425:K711I;ENSP00000421926:K710I;ENSP00000427480:K544I	ENSP00000314909:K341I	K	-	2	0	UIMC1	176264920	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.939000	0.40213	0.460000	0.27045	0.533000	0.62120	AAA		0.448	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290		9	95	0	0	0	0.001368	0	9	95				
PRPF4B	8899	broad.mit.edu	37	6	4032758	4032758	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:4032758G>T	ENST00000337659.6	+	2	1107	c.1007G>T	c.(1006-1008)gGg>gTg	p.G336V	PRPF4B_ENST00000538861.1_Missense_Mutation_p.G322V	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	336	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G336V(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GCTTCATCTGGGAAAGAAAAT	0.408																																							uc003mvv.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)	5						c.(1006-1008)GGG>GTG		serine/threonine-protein kinase PRP4K							67.0	74.0	72.0					6																	4032758		2203	4300	6503	SO:0001583	missense	8899					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:4032758G>T	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1007G>T	6.37:g.4032758G>T	ENSP00000337194:p.Gly336Val		Somatic				PRPF4B_uc011dhv.1_RNA	p.G336V	NM_003913	NP_003904	WXS	Illumina HiSeq	Unspecified	Q13523	PRP4B_HUMAN			2	1098	+	Ovarian(93;0.0925)	all_hematologic(90;0.0895)	336			Arg/Lys-rich (basic).		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	c.1007G>T	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154256	0.78114	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.68624	-0.31;-0.34	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000001	T	0.76248	0.3961	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76252	-0.3027	10	0.66056	D	0.02	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	336	Q13523	PRP4B_HUMAN	V	336;322	ENSP00000337194:G336V;ENSP00000439331:G322V	ENSP00000337194:G336V	G	+	2	0	PRPF4B	3977757	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.168000	0.94781	2.788000	0.95919	0.650000	0.86243	GGG		0.408	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2			69	59	1	0	1.43987e-31	0.00361	2.85574e-31	69	59				
F13A1	2162	broad.mit.edu	37	6	6196057	6196057	+	Silent	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:6196057T>C	ENST00000264870.3	-	10	1543	c.1278A>G	c.(1276-1278)caA>caG	p.Q426Q		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	426					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.Q426Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTGCATCAAATTGGAAGCAGA	0.493																																							uc003mwv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(1276-1278)CAA>CAG		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						99.0	80.0	86.0					6																	6196057		2203	4300	6503	SO:0001819	synonymous_variant	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6196057T>C	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1278A>G	6.37:g.6196057T>C			Somatic				F13A1_uc011dib.1_Silent_p.Q363Q	p.Q426Q	NM_000129	NP_000120	WXS	Illumina HiSeq	Unspecified	P00488	F13A_HUMAN			10	1401	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	426					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Silent	SNP	ENST00000264870.3	37	c.1278A>G	CCDS4496.1																																																																																				0.493	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		4	76	0	0	0	0.000602	0	4	76				
CDKAL1	54901	broad.mit.edu	37	6	21065370	21065370	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:21065370G>C	ENST00000378610.1	+	10	1157	c.1147G>C	c.(1147-1149)Gag>Cag	p.E383Q	CDKAL1_ENST00000274695.4_Missense_Mutation_p.E383Q|CDKAL1_ENST00000378624.4_Missense_Mutation_p.E313Q			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	383					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)	p.E383Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ACTTGTTGAAGAGTACAAATT	0.373																																							uc003ndc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1147-1149)GAG>CAG		CDK5 regulatory subunit associated protein							106.0	104.0	105.0					6																	21065370		2203	4300	6503	SO:0001583	missense	54901				RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity	g.chr6:21065370G>C	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1147G>C	6.37:g.21065370G>C	ENSP00000367873:p.Glu383Gln		Somatic				CDKAL1_uc003ndd.1_Missense_Mutation_p.E383Q|CDKAL1_uc003nde.1_Missense_Mutation_p.E313Q|CDKAL1_uc003ndf.1_5'UTR	p.E383Q	NM_017774	NP_060244	WXS	Illumina HiSeq	Unspecified	Q5VV42	CDKAL_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)		12	1321	+	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		383					A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	c.1147G>C	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508234	0.44660	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.26373	1.74;1.74;1.74	5.87	5.87	0.94306	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);	0.385166	0.33364	N	0.004988	T	0.10380	0.0254	N	0.24115	0.695	0.34222	D	0.675524	B;B	0.14012	0.009;0.001	B;B	0.12837	0.008;0.001	T	0.05649	-1.0872	10	0.35671	T	0.21	.	17.0083	0.86399	0.0:0.1351:0.8649:0.0	.	313;383	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	Q	383;313;383	ENSP00000274695:E383Q;ENSP00000367889:E313Q;ENSP00000367873:E383Q	ENSP00000274695:E383Q	E	+	1	0	CDKAL1	21173349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.609000	0.54117	2.941000	0.99782	0.655000	0.94253	GAG		0.373	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774		26	71	0	0	0	0.005443	0	26	71				
TRIM10	10107	broad.mit.edu	37	6	30121946	30121946	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:30121946C>A	ENST00000449742.2	-	7	1321	c.1246G>T	c.(1246-1248)Ggc>Tgc	p.G416C	TRIM10_ENST00000376704.3_Intron	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	416	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.G12C(1)|p.G416C(1)		ovary(1)	1						GGGAAGGAGCCCAGAGCCGAG	0.662																																							uc003npo.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1246-1248)GGC>TGC		tripartite motif-containing 10 isoform 1							46.0	37.0	40.0					6																	30121946		1511	2709	4220	SO:0001583	missense	10107					cytoplasm	zinc ion binding	g.chr6:30121946C>A	Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.1246G>T	6.37:g.30121946C>A	ENSP00000397073:p.Gly416Cys		Somatic				TRIM10_uc003npn.2_Intron	p.G416C	NM_006778	NP_006769	WXS	Illumina HiSeq	Unspecified	Q9UDY6	TRI10_HUMAN			7	1322	-			416			B30.2/SPRY.		A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	ENST00000449742.2	37	c.1246G>T	CCDS34375.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.501176	0.44455	.	.	ENSG00000204613	ENST00000449742;ENST00000376706;ENST00000542439	T	0.60920	0.15	5.49	2.8	0.32819	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.056900	0.07320	N	0.877515	T	0.45377	0.1339	L	0.33624	1.015	0.80722	D	1	D	0.55172	0.97	P	0.53988	0.739	T	0.32481	-0.9905	10	0.56958	D	0.05	.	9.4804	0.38898	0.0:0.7873:0.0:0.2127	.	416	Q9UDY6	TRI10_HUMAN	C	416;416;12	ENSP00000397073:G416C	ENSP00000365896:G416C	G	-	1	0	TRIM10	30229925	0.001000	0.12720	0.916000	0.36221	0.425000	0.31504	0.758000	0.26447	0.450000	0.26774	0.643000	0.83706	GGC		0.662	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1			22	19	1	0	1.33986e-20	0.004656	2.44358e-20	22	19				
PGK2	5232	broad.mit.edu	37	6	49753968	49753968	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:49753968C>A	ENST00000304801.3	-	1	1085	c.933G>T	c.(931-933)tgG>tgT	p.W311C		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	311					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.W311C(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CCAAACCCATCCAGCCAGGAG	0.453																																							uc003ozu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(931-933)TGG>TGT		phosphoglycerate kinase 2							137.0	137.0	137.0					6																	49753968		2203	4300	6503	SO:0001583	missense	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49753968C>A	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.933G>T	6.37:g.49753968C>A	ENSP00000305995:p.Trp311Cys		Somatic					p.W311C	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	1040	-	Lung NSC(77;0.0402)		311					B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	c.933G>T	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818672	0.32145	.	.	ENSG00000170950	ENST00000304801	D	0.92249	-3.0	4.19	4.19	0.49359	Phosphoglycerate kinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92789	0.7707	M	0.93763	3.455	0.80722	D	1	B	0.26672	0.156	B	0.32211	0.142	D	0.93656	0.6977	10	0.72032	D	0.01	-5.6779	14.804	0.69938	0.0:1.0:0.0:0.0	.	311	P07205	PGK2_HUMAN	C	311	ENSP00000305995:W311C	ENSP00000305995:W311C	W	-	3	0	PGK2	49861927	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	4.253000	0.58791	2.619000	0.88677	0.585000	0.79938	TGG		0.453	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			111	122	1	0	8.62921e-31	0.00361	1.69732e-30	111	122				
BEND6	221336	broad.mit.edu	37	6	56857338	56857338	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:56857338T>A	ENST00000370746.3	+	3	552	c.283T>A	c.(283-285)Ttg>Atg	p.L95M	BEND6_ENST00000370748.3_Missense_Mutation_p.L95M|BEND6_ENST00000370745.1_Missense_Mutation_p.L95M|BEND6_ENST00000370750.2_Missense_Mutation_p.L95M	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	95					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)	p.L95M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						TCGACAGTCTTTGGTCATGCT	0.353																																							uc010kab.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)TTG>ATG		BEN domain containing 6							144.0	147.0	147.0					6																	56857338		1813	4078	5891	SO:0001583	missense	221336							g.chr6:56857338T>A	AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.283T>A	6.37:g.56857338T>A	ENSP00000359782:p.Leu95Met		Somatic				BEND6_uc003pdg.2_RNA	p.L95M	NM_152731	NP_689944	WXS	Illumina HiSeq	Unspecified	Q5SZJ8	BEND6_HUMAN			3	869	+			95			Potential.		Q4G0W8|Q8N662|Q96NS6	Missense_Mutation	SNP	ENST00000370746.3	37	c.283T>A	CCDS43476.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.267885	0.59540	.	.	ENSG00000151917	ENST00000322055;ENST00000370750;ENST00000370748;ENST00000370746;ENST00000370745	.	.	.	5.13	2.71	0.32032	.	0.000000	0.49305	D	0.000157	T	0.42630	0.1211	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.49021	-0.8982	9	0.87932	D	0	-9.0676	6.3696	0.21473	0.0:0.2705:0.0:0.7295	.	95	Q5SZJ8	BEND6_HUMAN	M	95	.	ENSP00000322773:L95M	L	+	1	2	BEND6	56965297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.399000	0.20916	0.913000	0.36797	0.459000	0.35465	TTG		0.353	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041032.4	NM_152731		20	243	0	0	0	0.002299	0	20	243				
BAI3	577	broad.mit.edu	37	6	69728293	69728293	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:69728293G>A	ENST00000370598.1	+	13	2830	c.2009G>A	c.(2008-2010)gGg>gAg	p.G670E		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	670					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G670E(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ATTTATCCAGGGTCAATAGAG	0.303																																							uc003pev.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(2008-2010)GGG>GAG		brain-specific angiogenesis inhibitor 3							113.0	120.0	118.0					6																	69728293		2203	4296	6499	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69728293G>A	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2009G>A	6.37:g.69728293G>A	ENSP00000359630:p.Gly670Glu		Somatic				BAI3_uc010kak.2_Missense_Mutation_p.G670E	p.G670E	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			13	2457	+		all_lung(197;0.212)	670			Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.2009G>A	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006035	0.93287	.	.	ENSG00000135298	ENST00000370598	T	0.11604	2.76	6.08	6.08	0.98989	Domain of unknown function DUF3497 (1);	0.115766	0.64402	D	0.000020	T	0.25121	0.0610	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00361	-1.1789	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	670	O60242	BAI3_HUMAN	E	670	ENSP00000359630:G670E	ENSP00000359630:G670E	G	+	2	0	BAI3	69785014	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.226000	0.72277	2.894000	0.99253	0.591000	0.81541	GGG		0.303	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			7	108	0	0	0	0.00308	0	7	108				
LMBRD1	55788	broad.mit.edu	37	6	70490434	70490434	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:70490434C>G	ENST00000370577.3	-	3	488	c.259G>C	c.(259-261)Gct>Cct	p.A87P	LMBRD1_ENST00000370570.1_Missense_Mutation_p.A14P	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	87					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.A87S(1)|p.A87P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						CTGACATTAGCATTAGCCCAG	0.338																																							uc003pfa.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(259-261)GCT>CCT		liver regeneration p-53 related protein							117.0	112.0	114.0					6																	70490434		2203	4300	6503	SO:0001583	missense	55788				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding	g.chr6:70490434C>G	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.259G>C	6.37:g.70490434C>G	ENSP00000359609:p.Ala87Pro		Somatic				LMBRD1_uc003pez.2_Missense_Mutation_p.A14P|LMBRD1_uc010kal.2_Missense_Mutation_p.A14P|LMBRD1_uc003pfb.2_RNA	p.A87P	NM_018368	NP_060838	WXS	Illumina HiSeq	Unspecified	Q9NUN5	LMBD1_HUMAN			3	374	-			87			Extracellular (Potential).		A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	c.259G>C	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191277	0.38707	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.18810	2.19;2.19	5.67	4.69	0.59074	LMBR1-like membrane protein (1);	0.333487	0.34853	N	0.003622	T	0.03305	0.0096	N	0.02751	-0.505	0.37058	D	0.897901	B	0.24576	0.106	B	0.26094	0.066	T	0.32295	-0.9912	10	0.26408	T	0.33	-5.075	8.3391	0.32232	0.0:0.8006:0.0:0.1994	.	87	Q9NUN5	LMBD1_HUMAN	P	87;14	ENSP00000359609:A87P;ENSP00000359602:A14P	ENSP00000359602:A14P	A	-	1	0	LMBRD1	70547155	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.957000	0.40392	2.661000	0.90470	0.462000	0.41574	GCT		0.338	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368		38	32	0	0	0	0.001951	0	38	32				
PTPRK	5796	broad.mit.edu	37	6	128294253	128294253	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:128294253C>T	ENST00000368215.3	-	29	4179	c.4180G>A	c.(4180-4182)Gaa>Aaa	p.E1394K	PTPRK_ENST00000368213.5_Missense_Mutation_p.E1401K|PTPRK_ENST00000532331.1_Missense_Mutation_p.E1417K|PTPRK_ENST00000368207.3_Missense_Mutation_p.E1427K|PTPRK_ENST00000368226.4_Missense_Mutation_p.E1395K|PTPRK_ENST00000368227.3_Missense_Mutation_p.E1412K|PTPRK_ENST00000368210.3_Missense_Mutation_p.E1413K			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1394	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1395K(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTCACCATTTCAACAACGATG	0.468																																							uc003qbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(4180-4182)GAA>AAA		protein tyrosine phosphatase, receptor type, K							191.0	169.0	177.0					6																	128294253		2203	4300	6503	SO:0001583	missense	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128294253C>T	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.4180G>A	6.37:g.128294253C>T	ENSP00000357198:p.Glu1394Lys		Somatic				PTPRK_uc003qbj.2_Missense_Mutation_p.E1395K|PTPRK_uc010kfc.2_Missense_Mutation_p.E1401K|PTPRK_uc011ebu.1_Missense_Mutation_p.E1417K	p.E1394K	NM_002844	NP_002835	WXS	Illumina HiSeq	Unspecified	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	29	4547	-			1394			Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37	c.4180G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.521531	0.96416	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	D;D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	5.3	5.3	0.74995	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.89438	0.6715	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.65815	0.995;0.994;0.992;0.99	D;P;P;P	0.64877	0.93;0.885;0.867;0.79	D	0.90150	0.4220	10	0.87932	D	0	.	19.296	0.94122	0.0:1.0:0.0:0.0	.	1417;1401;1394;1395	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	K	1395;1412;1417;1401;1413;1394;1427	ENSP00000357209:E1395K;ENSP00000357210:E1412K;ENSP00000432973:E1417K;ENSP00000357196:E1401K;ENSP00000357193:E1413K;ENSP00000357198:E1394K;ENSP00000357190:E1427K	ENSP00000357190:E1427K	E	-	1	0	PTPRK	128335946	1.000000	0.71417	0.987000	0.45799	0.919000	0.55068	7.776000	0.85560	2.633000	0.89246	0.655000	0.94253	GAA		0.468	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			30	167	0	0	0	0.00632	0	30	167				
ALDH8A1	64577	broad.mit.edu	37	6	135263563	135263563	+	Silent	SNP	C	C	A	rs541243826		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:135263563C>A	ENST00000265605.2	-	3	494	c.426G>T	c.(424-426)cgG>cgT	p.R142R	ALDH8A1_ENST00000367845.2_Silent_p.R142R|ALDH8A1_ENST00000367847.2_Silent_p.R142R|RP11-349J5.2_ENST00000416448.2_RNA	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	142					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.R142R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CCACCGGGGCCCGCACCGTGT	0.582																																							uc003qew.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(424-426)CGG>CGT		aldehyde dehydrogenase 8A1 isoform 1							78.0	73.0	75.0					6																	135263563		2203	4300	6503	SO:0001819	synonymous_variant	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135263563C>A	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.426G>T	6.37:g.135263563C>A			Somatic				ALDH8A1_uc003qex.2_Silent_p.R142R|ALDH8A1_uc010kgh.2_5'UTR|ALDH8A1_uc011ecx.1_Silent_p.R142R	p.R142R	NM_022568	NP_072090	WXS	Illumina HiSeq	Unspecified	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	3	479	-	Colorectal(23;0.221)		142					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Silent	SNP	ENST00000265605.2	37	c.426G>T	CCDS5171.1																																																																																				0.582	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			27	40	1	0	1.50538e-07	0.00632	2.15832e-07	27	40				
GRM1	2911	broad.mit.edu	37	6	146720434	146720434	+	Silent	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:146720434G>C	ENST00000282753.1	+	7	2494	c.2259G>C	c.(2257-2259)gtG>gtC	p.V753V	GRM1_ENST00000392299.2_Silent_p.V753V|GRM1_ENST00000355289.4_Silent_p.V753V|GRM1_ENST00000361719.2_Silent_p.V753V|GRM1_ENST00000507907.1_Silent_p.V753V|GRM1_ENST00000492807.2_Silent_p.V753V			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	753					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.V753V(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		ACCTGGGTGTGGTGGCCCCTT	0.512																																							uc010khw.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(2257-2259)GTG>GTC		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						130.0	128.0	129.0					6																	146720434		2203	4300	6503	SO:0001819	synonymous_variant	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146720434G>C	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2259G>C	6.37:g.146720434G>C			Somatic				GRM1_uc010khv.1_Silent_p.V753V|GRM1_uc003qll.2_Silent_p.V753V|GRM1_uc011edz.1_Silent_p.V753V|GRM1_uc011eea.1_Silent_p.V753V	p.V753V	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	8	2729	+		Ovarian(120;0.0387)	753			Helical; Name=5; (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	c.2259G>C	CCDS5209.1																																																																																				0.512	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		52	84	0	0	0	0.00361	0	52	84				
CLDN20	49861	broad.mit.edu	37	6	155597138	155597138	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:155597138C>G	ENST00000367165.3	+	2	665	c.285C>G	c.(283-285)atC>atG	p.I95M	TFB1M_ENST00000367166.4_Intron	NM_001001346.3	NP_001001346.1	P56880	CLD20_HUMAN	claudin 20	95					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.I95M(1)		endometrium(1)|lung(2)	3				OV - Ovarian serous cystadenocarcinoma(155;7.82e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0114)		CTTTGGGGATCTGCACTTCCA	0.542																																							uc003qql.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)ATC>ATG		claudin 20							140.0	118.0	126.0					6																	155597138		2203	4300	6503	SO:0001583	missense	49861				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr6:155597138C>G	BC020838	CCDS5249.1	6q25	2008-08-01			ENSG00000171217	ENSG00000171217		"""Claudins"""	2042	protein-coding gene	gene with protein product						16836752	Standard	NM_001001346		Approved		uc003qql.2	P56880	OTTHUMG00000015882	ENST00000367165.3:c.285C>G	6.37:g.155597138C>G	ENSP00000356133:p.Ile95Met		Somatic				TFB1M_uc003qqj.3_Intron|TFB1M_uc003qqk.2_Intron	p.I95M	NM_001001346	NP_001001346	WXS	Illumina HiSeq	Unspecified	P56880	CLD20_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;7.82e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0114)	2	665	+			95			Helical; (Potential).			Missense_Mutation	SNP	ENST00000367165.3	37	c.285C>G	CCDS5249.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277102	0.59758	.	.	ENSG00000171217	ENST00000367165	D	0.89050	-2.46	5.38	2.16	0.27623	.	0.122032	0.56097	D	0.000028	T	0.72471	0.3464	L	0.47716	1.5	0.38142	D	0.938472	B	0.31125	0.309	B	0.28232	0.087	T	0.66968	-0.5789	10	0.33141	T	0.24	.	7.7307	0.28786	0.0:0.6658:0.1374:0.1967	.	95	P56880	CLD20_HUMAN	M	95	ENSP00000356133:I95M	ENSP00000356133:I95M	I	+	3	3	CLDN20	155638830	0.999000	0.42202	0.981000	0.43875	0.980000	0.70556	0.777000	0.26718	0.628000	0.30357	0.563000	0.77884	ATC		0.542	CLDN20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042818.1	NM_001001346		3	75	0	0	0	0.004672	0	3	75				
T	6862	broad.mit.edu	37	6	166571970	166571970	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:166571970C>T	ENST00000296946.2	-	9	1609	c.1141G>A	c.(1141-1143)Gcg>Acg	p.A381T	T_ENST00000366871.3_Missense_Mutation_p.A323T	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	381					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A381T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GTGTAGTGCGCGGGGGAGCCC	0.711									Chordoma, Familial Clustering of																														uc003quu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1141-1143)GCG>ACG		transcription factor T							29.0	37.0	35.0					6																	166571970		2202	4298	6500	SO:0001583	missense	6862	Chordoma_Familial_Clustering_of	Familial Cancer Database		anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity	g.chr6:166571970C>T	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1141G>A	6.37:g.166571970C>T	ENSP00000296946:p.Ala381Thr		Somatic				T_uc003qut.1_Missense_Mutation_p.A382T|T_uc003quv.1_Missense_Mutation_p.A323T	p.A381T	NM_003181	NP_003172	WXS	Illumina HiSeq	Unspecified	O15178	BRAC_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)	9	1634	-		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)	381					E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	c.1141G>A	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	C	8.243	0.807183	0.16467	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83506	-1.69;-1.73	4.79	2.0	0.26442	.	0.838244	0.10388	N	0.680694	T	0.52191	0.1719	L	0.41027	1.25	0.09310	N	1	B;B;B	0.12630	0.001;0.003;0.006	B;B;B	0.08055	0.001;0.003;0.002	T	0.34576	-0.9823	10	0.17369	T	0.5	.	4.9617	0.14070	0.0:0.5898:0.1547:0.2555	.	323;381;323	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	T	381;381;323	ENSP00000296946:A381T;ENSP00000355836:A323T	ENSP00000296946:A381T	A	-	1	0	T	166491960	0.006000	0.16342	0.000000	0.03702	0.097000	0.18754	0.768000	0.26590	0.538000	0.28769	0.561000	0.74099	GCG		0.711	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181		4	53	0	0	0	0.000248	0	4	53				
RPS6KA2	6196	broad.mit.edu	37	6	166872949	166872949	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:166872949G>A	ENST00000265678.4	-	12	1286	c.1063C>T	c.(1063-1065)Cgg>Tgg	p.R355W	RPS6KA2-IT1_ENST00000416770.1_RNA|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.R380W|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.R266W|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.R363W|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.R266W	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	355	AGC-kinase C-terminal.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.R363W(1)|p.R355W(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GTGGGCGTCCGCGCTGTGAAC	0.552																																							uc003qvb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						c.(1063-1065)CGG>TGG		ribosomal protein S6 kinase, 90kDa, polypeptide							140.0	109.0	120.0					6																	166872949		2203	4300	6503	SO:0001583	missense	6196				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr6:166872949G>A	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1063C>T	6.37:g.166872949G>A	ENSP00000265678:p.Arg355Trp		Somatic				RPS6KA2_uc011ego.1_Missense_Mutation_p.R266W|RPS6KA2_uc010kkl.1_Missense_Mutation_p.R266W|RPS6KA2_uc003qvc.1_Missense_Mutation_p.R363W|RPS6KA2_uc003qvd.1_Missense_Mutation_p.R380W	p.R355W	NM_021135	NP_066958	WXS	Illumina HiSeq	Unspecified	Q15349	KS6A2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)	12	1282	-		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)	355			AGC-kinase C-terminal.		B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	c.1063C>T	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679704	0.47886	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.0	-2.24	0.06909	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.61664	0.2365	M	0.83692	2.655	0.33994	D	0.64945	D;D;D	0.76494	0.999;0.998;0.999	D;P;D	0.67548	0.952;0.877;0.941	T	0.73335	-0.4015	10	0.72032	D	0.01	.	15.9929	0.80220	0.0:0.0:0.4833:0.5167	.	380;363;355	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	W	355;380;363;266;266	ENSP00000265678:R355W;ENSP00000422435:R380W;ENSP00000427015:R363W;ENSP00000422484:R266W;ENSP00000386050:R266W	ENSP00000265678:R355W	R	-	1	2	RPS6KA2	166792939	0.146000	0.22672	0.001000	0.08648	0.581000	0.36288	0.988000	0.29616	-0.260000	0.09418	0.563000	0.77884	CGG		0.552	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135		4	20	0	0	0	0.000248	0	4	20				
COX19	90639	broad.mit.edu	37	7	1012907	1012907	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:1012907T>C	ENST00000344111.3	-	2	193	c.104A>G	c.(103-105)gAg>gGg	p.E35G		NM_001031617.2	NP_001026788.1	Q49B96	COX19_HUMAN	cytochrome c oxidase assembly homolog 19 (S. cerevisiae)	35	CHCH.					cytoplasm (GO:0005737)		p.E35G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		CATGAATTTCTCTTTAAAGCT	0.363																																							uc003sjp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)GAG>GGG		COX19 cytochrome c oxidase assembly homolog							83.0	81.0	82.0					7																	1012907		2202	4299	6501	SO:0001583	missense	90639					cytosol		g.chr7:1012907T>C	AY957566	CCDS34582.1	7p22.3	2012-10-15	2012-10-15		ENSG00000240230	ENSG00000240230		"""Mitochondrial respiratory chain complex assembly factors"""	28074	protein-coding gene	gene with protein product		610429	"""COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)"""			15596615, 16212937	Standard	NM_001031617		Approved	MGC104475	uc003sjp.1	Q49B96	OTTHUMG00000151476	ENST00000344111.3:c.104A>G	7.37:g.1012907T>C	ENSP00000342015:p.Glu35Gly		Somatic				ADAP1_uc010ksc.2_5'UTR	p.E35G	NM_001031617	NP_001026788	WXS	Illumina HiSeq	Unspecified	Q49B96	COX19_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)	2	194	-		Ovarian(82;0.0112)	35			CHCH.		A4FTX0	Missense_Mutation	SNP	ENST00000344111.3	37	c.104A>G	CCDS34582.1	.	.	.	.	.	.	.	.	.	.	T	12.79	2.043769	0.36085	.	.	ENSG00000240230	ENST00000344111	T	0.76709	-1.04	4.77	4.77	0.60923	CHCH (1);	0.073712	0.53938	D	0.000060	T	0.69296	0.3095	.	.	.	0.45261	D	0.998263	B	0.31459	0.324	B	0.34536	0.185	T	0.66015	-0.6028	9	0.23891	T	0.37	-18.9845	13.5717	0.61851	0.0:0.0:0.0:1.0	.	35	Q49B96	COX19_HUMAN	G	35	ENSP00000342015:E35G	ENSP00000342015:E35G	E	-	2	0	COX19	979433	1.000000	0.71417	0.988000	0.46212	0.615000	0.37417	5.539000	0.67199	1.903000	0.55091	0.383000	0.25322	GAG		0.363	COX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322812.1	NM_001031617		8	64	0	0	0	0.00308	0	8	64				
COL28A1	340267	broad.mit.edu	37	7	7480482	7480482	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:7480482C>A	ENST00000399429.3	-	21	1801	c.1661G>T	c.(1660-1662)gGc>gTc	p.G554V		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	554	Collagen-like 5.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G554V(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CCCTTTCTTGCCTTCGTCACC	0.443																																							uc003src.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1660-1662)GGC>GTC		collagen, type XXVIII precursor							150.0	141.0	144.0					7																	7480482		1845	4094	5939	SO:0001583	missense	340267				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity	g.chr7:7480482C>A	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1661G>T	7.37:g.7480482C>A	ENSP00000382356:p.Gly554Val		Somatic				COL28A1_uc011jxe.1_Missense_Mutation_p.G237V|COL28A1_uc003srd.2_Missense_Mutation_p.G109V	p.G554V	NM_001037763	NP_001032852	WXS	Illumina HiSeq	Unspecified	Q2UY09	COSA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)	21	1778	-		Ovarian(82;0.0789)	554			Collagen-like 5.		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	c.1661G>T	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205215	0.58234	.	.	ENSG00000215018	ENST00000399429;ENST00000399419	D	0.99353	-5.77	4.09	4.09	0.47781	.	0.082559	0.47852	U	0.000215	D	0.99588	0.9851	H	0.97440	4.005	0.58432	D	0.999999	D;D;D	0.89917	0.998;1.0;0.997	D;D;D	0.91635	0.948;0.999;0.944	D	0.97667	1.0164	10	0.87932	D	0	-7.1004	12.1176	0.53873	0.0:1.0:0.0:0.0	.	554;554;554	Q2UY09-2;B5MDS6;Q2UY09	.;.;COSA1_HUMAN	V	554	ENSP00000382356:G554V	ENSP00000382347:G554V	G	-	2	0	COL28A1	7447007	1.000000	0.71417	0.998000	0.56505	0.796000	0.44982	1.978000	0.40598	2.573000	0.86826	0.557000	0.71058	GGC		0.443	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763		15	50	1	0	4.7546e-09	0.004007	7.25382e-09	15	50				
GLCCI1	113263	broad.mit.edu	37	7	8110750	8110750	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:8110750A>T	ENST00000223145.5	+	6	1723	c.1166A>T	c.(1165-1167)gAt>gTt	p.D389V		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	389						cytoplasm (GO:0005737)		p.D389V(1)		endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		TTGCTCTATGATCGTGATAAA	0.443																																							uc003srk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1165-1167)GAT>GTT		glucocorticoid induced transcript 1							102.0	98.0	99.0					7																	8110750		2203	4300	6503	SO:0001583	missense	113263							g.chr7:8110750A>T	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1166A>T	7.37:g.8110750A>T	ENSP00000223145:p.Asp389Val		Somatic					p.D389V	NM_138426	NP_612435	WXS	Illumina HiSeq	Unspecified	Q86VQ1	GLCI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	6	1725	+		Ovarian(82;0.0608)	389					A4D103|Q96FD0	Missense_Mutation	SNP	ENST00000223145.5	37	c.1166A>T	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.415766	0.83449	.	.	ENSG00000106415	ENST00000223145	.	.	.	4.9	4.9	0.64082	.	0.049200	0.85682	D	0.000000	T	0.68604	0.3019	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71836	-0.4472	9	0.72032	D	0.01	-33.6164	14.9978	0.71446	1.0:0.0:0.0:0.0	.	389	Q86VQ1	GLCI1_HUMAN	V	389	.	ENSP00000223145:D389V	D	+	2	0	GLCCI1	8077275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.115000	0.89572	2.184000	0.69523	0.528000	0.53228	GAT		0.443	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426		19	88	0	0	0	0.001216	0	19	88				
TWIST1	7291	broad.mit.edu	37	7	19156565	19156565	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:19156565G>A	ENST00000242261.5	-	1	730	c.380C>T	c.(379-381)gCg>gTg	p.A127V	AC003986.7_ENST00000417460.1_RNA|AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	127	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)	p.A127V(1)		lung(2)|upper_aerodigestive_tract(1)	3						CGCGGCGAACGCCTCGTTCAG	0.657																																							uc003sum.2		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CM000118|CM060097	TWIST1	M		c.(379-381)GCG>GTG		twist							82.0	64.0	70.0					7																	19156565		2203	4300	6503	SO:0001583	missense	7291	Saethre-Chotzen_syndrome			aortic valve morphogenesis|cellular response to hypoxia|embryonic camera-type eye formation|embryonic cranial skeleton morphogenesis|eyelid development in camera-type eye|muscle organ development|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of histone phosphorylation|negative regulation of osteoblast differentiation|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of cell motility|positive regulation of epithelial to mesenchymal transition|positive regulation of fatty acid beta-oxidation|positive regulation of monocyte chemotactic protein-1 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of tumor necrosis factor production|regulation of bone mineralization	nucleus	bHLH transcription factor binding|E-box binding|sequence-specific DNA binding RNA polymerase II transcription factor activity	g.chr7:19156565G>A	U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.380C>T	7.37:g.19156565G>A	ENSP00000242261:p.Ala127Val		Somatic					p.A127V	NM_000474	NP_000465	WXS	Illumina HiSeq	Unspecified	Q15672	TWST1_HUMAN			1	731	-			127			Helix-loop-helix motif.		A4D128|Q92487|Q99804	Missense_Mutation	SNP	ENST00000242261.5	37	c.380C>T	CCDS5367.1	.	.	.	.	.	.	.	.	.	.	g	26.0	4.692092	0.88735	.	.	ENSG00000122691	ENST00000242261	D	0.98329	-4.87	4.65	4.65	0.58169	Helix-loop-helix DNA-binding (5);	0.000000	0.48286	D	0.000200	D	0.99396	0.9787	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98274	1.0505	9	.	.	.	-9.9928	17.119	0.86697	0.0:0.0:1.0:0.0	.	127	Q15672	TWST1_HUMAN	V	127	ENSP00000242261:A127V	.	A	-	2	0	TWIST1	19123090	1.000000	0.71417	0.945000	0.38365	0.971000	0.66376	9.699000	0.98703	2.129000	0.65627	0.305000	0.20034	GCG		0.657	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207625.1	NM_000474		4	25	0	0	0	0.000602	0	4	25				
PDE1C	5137	broad.mit.edu	37	7	31917643	31917643	+	Silent	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:31917643A>G	ENST00000396191.1	-	5	887	c.432T>C	c.(430-432)taT>taC	p.Y144Y	PDE1C_ENST00000396184.3_Silent_p.Y144Y|PDE1C_ENST00000396193.1_Silent_p.Y204Y|PDE1C_ENST00000321453.7_Silent_p.Y144Y|PDE1C_ENST00000396182.2_Silent_p.Y144Y	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	144					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.Y144Y(2)|p.Y204Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ATGTCCGTCTATACATTCTGA	0.348																																							uc003tcm.1		NA																	3	Substitution - coding silent(3)		lung(3)	skin(3)|central_nervous_system(1)	4						c.(430-432)TAT>TAC		phosphodiesterase 1C							108.0	99.0	102.0					7																	31917643		2203	4300	6503	SO:0001819	synonymous_variant	5137				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr7:31917643A>G	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.432T>C	7.37:g.31917643A>G			Somatic				PDE1C_uc003tcn.1_Silent_p.Y144Y|PDE1C_uc003tco.1_Silent_p.Y204Y|PDE1C_uc003tcr.2_Silent_p.Y144Y|PDE1C_uc003tcs.2_Silent_p.Y144Y	p.Y144Y	NM_005020	NP_005011	WXS	Illumina HiSeq	Unspecified	Q14123	PDE1C_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		5	901	-			144					B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	37	c.432T>C	CCDS55099.1																																																																																				0.348	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1			26	28	0	0	0	0.00632	0	26	28				
VPS41	27072	broad.mit.edu	37	7	38783118	38783118	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:38783118G>A	ENST00000310301.4	-	24	2060	c.2006C>T	c.(2005-2007)gCc>gTc	p.A669V	VPS41_ENST00000395969.2_Missense_Mutation_p.A644V	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	669					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.A669V(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CATCTTCAGGGCACTTCGGCT	0.368																																							uc003tgy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(2005-2007)GCC>GTC		vacuolar protein sorting 41 isoform 1							128.0	118.0	121.0					7																	38783118		2203	4299	6502	SO:0001583	missense	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38783118G>A	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2006C>T	7.37:g.38783118G>A	ENSP00000309457:p.Ala669Val		Somatic				VPS41_uc003tgz.2_Missense_Mutation_p.A644V|VPS41_uc010kxn.2_Missense_Mutation_p.A580V|VPS41_uc003tgx.2_RNA	p.A669V	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			24	2032	-			669			Clathrin.		E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	c.2006C>T	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	G	36	5.661118	0.96734	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000439468	T;T;T	0.30448	1.53;1.53;1.53	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);	0.138558	0.64402	D	0.000004	T	0.64057	0.2564	M	0.91872	3.25	0.80722	D	1	D;D;D	0.56968	0.978;0.978;0.978	P;P;P	0.60473	0.875;0.875;0.875	T	0.71097	-0.4691	10	0.87932	D	0	-15.2198	20.3116	0.98642	0.0:0.0:1.0:0.0	.	669;644;669	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	V	669;644;10	ENSP00000309457:A669V;ENSP00000379297:A644V;ENSP00000395410:A10V	ENSP00000309457:A669V	A	-	2	0	VPS41	38749643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.890000	0.99128	0.650000	0.86243	GCC		0.368	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			4	103	0	0	0	0.000602	0	4	103				
ABCA13	154664	broad.mit.edu	37	7	48314884	48314884	+	Nonsense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:48314884C>G	ENST00000435803.1	+	17	5645	c.5621C>G	c.(5620-5622)tCa>tGa	p.S1874*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1874					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S1819*(1)|p.S1874*(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCACCATGTTCAAATGAAAGC	0.423																																							uc003toq.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(5620-5622)TCA>TGA		ATP binding cassette, sub-family A (ABC1),							59.0	59.0	59.0					7																	48314884		1833	4077	5910	SO:0001587	stop_gained	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48314884C>G	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5621C>G	7.37:g.48314884C>G	ENSP00000411096:p.Ser1874*		Somatic				ABCA13_uc010kyr.2_Nonsense_Mutation_p.S1377*	p.S1874*	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			17	5646	+			1874					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	c.5621C>G	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	42	9.620780	0.99221	.	.	ENSG00000179869	ENST00000435803	.	.	.	6.16	3.23	0.37069	.	0.692763	0.12574	N	0.457035	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3863	0.21561	0.0:0.682:0.1458:0.1722	.	.	.	.	X	1874	.	.	S	+	2	0	ABCA13	48285430	0.002000	0.14202	0.000000	0.03702	0.026000	0.11368	0.741000	0.26202	0.387000	0.25024	0.650000	0.86243	TCA		0.423	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		9	69	0	0	0	0.006214	0	9	69				
GBAS	2631	broad.mit.edu	37	7	56049250	56049250	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:56049250G>T	ENST00000322090.3	+	4	392	c.363G>T	c.(361-363)caG>caT	p.Q121H	GBAS_ENST00000446778.1_Missense_Mutation_p.R106M	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	121					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)		p.Q121H(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ATGGCGAGCAGGACCAAGCTG	0.398																																							uc003tre.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(361-363)CAG>CAT		nipsnap homolog 2							158.0	145.0	149.0					7																	56049250		2203	4300	6503	SO:0001583	missense	2631					integral to plasma membrane|membrane fraction|mitochondrion	protein binding	g.chr7:56049250G>T	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.363G>T	7.37:g.56049250G>T	ENSP00000313050:p.Gln121His		Somatic				GBAS_uc003trf.1_Missense_Mutation_p.R106M	p.Q121H	NM_001483	NP_001474	WXS	Illumina HiSeq	Unspecified	O75323	NIPS2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	371	+	Breast(14;0.214)		121					C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	ENST00000322090.3	37	c.363G>T	CCDS5521.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.47|19.47	3.834249|3.834249	0.71373|0.71373	.|.	.|.	ENSG00000146729|ENSG00000146729	ENST00000322090|ENST00000446778	T|T	0.44083|0.61627	0.93|0.09	5.78|5.78	2.99|2.99	0.34606|0.34606	Dimeric alpha-beta barrel (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58892|0.58892	0.2154|0.2154	M|M	0.87180|0.87180	2.865|2.865	0.45995|0.45995	D|D	0.998805|0.998805	D|B	0.62365|0.28552	0.991|0.215	P|B	0.58077|0.22386	0.832|0.039	T|T	0.60515|0.60515	-0.7248|-0.7248	10|9	0.27082|0.48119	T|T	0.32|0.1	-6.1433|-6.1433	9.7897|9.7897	0.40697|0.40697	0.2921:0.0:0.7079:0.0|0.2921:0.0:0.7079:0.0	.|.	121|106	O75323|C9IYJ3	NIPS2_HUMAN|.	H|M	121|106	ENSP00000313050:Q121H|ENSP00000406855:R106M	ENSP00000313050:Q121H|ENSP00000406855:R106M	Q|R	+|+	3|2	2|0	GBAS|GBAS	56016744|56016744	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.835000|0.835000	0.47333|0.47333	3.590000|3.590000	0.53979|0.53979	0.914000|0.914000	0.36822|0.36822	0.591000|0.591000	0.81541|0.81541	CAG|AGG		0.398	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483		43	98	1	0	8.69298e-16	0.006999	1.48844e-15	43	98				
CLDN4	1364	broad.mit.edu	37	7	73245707	73245707	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:73245707C>T	ENST00000435050.1	+	2	2856	c.176C>T	c.(175-177)aCc>aTc	p.T59I	CLDN4_ENST00000431918.1_Missense_Mutation_p.T59I|CLDN4_ENST00000340958.2_Missense_Mutation_p.T59I			O14493	CLD4_HUMAN	claudin 4	59	Interaction with EPHA2.				calcium-independent cell-cell adhesion (GO:0016338)|establishment of skin barrier (GO:0061436)|female pregnancy (GO:0007565)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basal plasma membrane (GO:0009925)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)	p.T59I(1)		kidney(2)|lung(4)|urinary_tract(1)	7		Lung NSC(55;0.159)				GTGCAGAGCACCGGCCAGATG	0.642																																							uc003tzi.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(175-177)ACC>ATC		claudin 4							95.0	78.0	84.0					7																	73245707		2203	4300	6503	SO:0001583	missense	1364				calcium-independent cell-cell adhesion	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity|transmembrane receptor activity	g.chr7:73245707C>T	AB000712	CCDS5560.1	7q11.23	2008-07-18			ENSG00000189143	ENSG00000189143		"""Claudins"""	2046	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 1"", ""Williams-Beuren syndrome chromosomal region 8 protein"""	602909		CPETR, CPETR1		9334247, 9892664	Standard	NM_001305		Approved	CPE-R, WBSCR8, hCPE-R	uc003tzi.4	O14493	OTTHUMG00000023425	ENST00000435050.1:c.176C>T	7.37:g.73245707C>T	ENSP00000409544:p.Thr59Ile		Somatic				RFC2_uc011kfa.1_Intron|CLDN4_uc003tzh.1_RNA	p.T59I	NM_001305	NP_001296	WXS	Illumina HiSeq	Unspecified	O14493	CLD4_HUMAN			1	515	+		Lung NSC(55;0.159)	59			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000435050.1	37	c.176C>T	CCDS5560.1	.	.	.	.	.	.	.	.	.	.	C	34	5.363013	0.95877	.	.	ENSG00000189143	ENST00000435050;ENST00000431918;ENST00000340958;ENST00000543176	D;D;D	0.89810	-2.57;-2.57;-2.57	5.37	5.37	0.77165	Claudin, conserved site (1);	0.098954	0.64402	D	0.000002	D	0.95230	0.8453	M	0.91818	3.245	0.58432	D	0.999996	D	0.59767	0.986	D	0.63597	0.916	D	0.95990	0.8985	10	0.72032	D	0.01	.	16.5932	0.84781	0.0:1.0:0.0:0.0	.	59	O14493	CLD4_HUMAN	I	59;59;59;46	ENSP00000409544:T59I;ENSP00000388639:T59I;ENSP00000342445:T59I	ENSP00000342445:T59I	T	+	2	0	CLDN4	72883643	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	6.072000	0.71238	2.529000	0.85273	0.561000	0.74099	ACC		0.642	CLDN4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348030.1	NM_001305		10	47	0	0	0	0.000978	0	10	47				
SAMD9	54809	broad.mit.edu	37	7	92730825	92730825	+	Missense_Mutation	SNP	C	C	A	rs149966534		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:92730825C>A	ENST00000379958.2	-	3	4855	c.4586G>T	c.(4585-4587)cGt>cTt	p.R1529L		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1529						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.R1529L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ACCTTGTAAACGAAGCAAAAG	0.368																																							uc003umf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(4585-4587)CGT>CTT		sterile alpha motif domain containing 9							81.0	82.0	82.0					7																	92730825		2203	4300	6503	SO:0001583	missense	54809					cytoplasm		g.chr7:92730825C>A	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.4586G>T	7.37:g.92730825C>A	ENSP00000369292:p.Arg1529Leu		Somatic				SAMD9_uc003umg.2_Missense_Mutation_p.R1529L	p.R1529L	NM_017654	NP_060124	WXS	Illumina HiSeq	Unspecified	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	4842	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		1529					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.4586G>T	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988938	0.35131	.	.	ENSG00000205413	ENST00000379958	T	0.29655	1.56	4.34	4.34	0.51931	.	0.083461	0.45606	U	0.000348	T	0.40839	0.1133	L	0.41824	1.3	0.30733	N	0.746976	D	0.69078	0.997	P	0.62435	0.902	T	0.28902	-1.0029	10	0.37606	T	0.19	.	12.6146	0.56569	0.0:0.8314:0.1686:0.0	.	1529	Q5K651	SAMD9_HUMAN	L	1529	ENSP00000369292:R1529L	ENSP00000369292:R1529L	R	-	2	0	SAMD9	92568761	0.994000	0.37717	0.998000	0.56505	0.986000	0.74619	4.568000	0.60857	2.420000	0.82092	0.609000	0.83330	CGT		0.368	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		19	60	1	0	3.32936e-07	0.006122	4.67485e-07	19	60				
DLX5	1749	broad.mit.edu	37	7	96650227	96650227	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:96650227G>T	ENST00000222598.4	-	3	1164	c.691C>A	c.(691-693)Cgc>Agc	p.R231S	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	231					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.R231S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CTGAGCGAGCGGGACGAGCCC	0.657																																							uc003uon.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(691-693)CGC>AGC		distal-less homeobox 5							69.0	61.0	63.0					7																	96650227		2203	4300	6503	SO:0001583	missense	1749				cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr7:96650227G>T		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.691C>A	7.37:g.96650227G>T	ENSP00000222598:p.Arg231Ser		Somatic					p.R231S	NM_005221	NP_005212	WXS	Illumina HiSeq	Unspecified	P56178	DLX5_HUMAN			3	899	-	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)		231					B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	37	c.691C>A	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930942	0.52866	.	.	ENSG00000105880	ENST00000222598	D	0.88354	-2.37	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.87370	0.6160	L	0.60455	1.87	0.58432	D	0.999998	D	0.57257	0.979	P	0.48654	0.585	D	0.84166	0.0431	10	0.07813	T	0.8	-12.2973	13.6223	0.62144	0.0:0.0:0.8452:0.1548	.	231	P56178	DLX5_HUMAN	S	231	ENSP00000222598:R231S	ENSP00000222598:R231S	R	-	1	0	DLX5	96488163	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.399000	0.59703	2.640000	0.89533	0.655000	0.94253	CGC		0.657	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2			15	30	1	0	6.81908e-15	0.00245	1.15924e-14	15	30				
TRRAP	8295	broad.mit.edu	37	7	98592340	98592340	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:98592340G>T	ENST00000359863.4	+	66	10345	c.10136G>T	c.(10135-10137)gGg>gTg	p.G3379V	TRRAP_ENST00000446306.3_Missense_Mutation_p.G3368V|TRRAP_ENST00000355540.3_Missense_Mutation_p.G3350V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3379					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.G3379V(1)|p.G3350V(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGCACGTTTGGGGTGGGCCTG	0.562																																							uc003upp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(10135-10137)GGG>GTG		transformation/transcription domain-associated							185.0	178.0	181.0					7																	98592340		2203	4300	6503	SO:0001583	missense	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98592340G>T	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10136G>T	7.37:g.98592340G>T	ENSP00000352925:p.Gly3379Val		Somatic				TRRAP_uc011kis.1_Missense_Mutation_p.G3350V|TRRAP_uc003upr.2_Missense_Mutation_p.G3085V	p.G3379V	NM_003496	NP_003487	WXS	Illumina HiSeq	Unspecified	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		66	10345	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		3379					A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	c.10136G>T	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.811664|4.811664	0.90707|0.90707	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|T	0.03124|0.03181	4.04;4.04|4.02	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.19248|0.19248	0.0462|0.0462	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.988;0.988|.	T|T	0.00392|0.00392	-1.1768|-1.1768	10|8	0.48119|0.87932	T|D	0.1|0	.|.	18.9356|18.9356	0.92584|0.92584	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3350;3107;3379|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	V|W	3379;3350;3367|3108	ENSP00000352925:G3379V;ENSP00000347733:G3350V|ENSP00000394645:G3108W	ENSP00000347733:G3350V|ENSP00000394645:G3108W	G|G	+|+	2|1	0|0	TRRAP|TRRAP	98430276|98430276	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.949000|0.949000	0.60115|0.60115	9.869000|9.869000	0.99810|0.99810	2.460000|2.460000	0.83146|0.83146	0.462000|0.462000	0.41574|0.41574	GGG|GGG		0.562	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		60	167	1	0	2.50483e-33	0.00361	5.00965e-33	60	167				
STAG3	10734	broad.mit.edu	37	7	99809101	99809101	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:99809101C>A	ENST00000426455.1	+	31	3861	c.3454C>A	c.(3454-3456)Cca>Aca	p.P1152T	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_Missense_Mutation_p.P1094T|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000317296.5_Missense_Mutation_p.P1152T	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1152					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.P1152T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTTCTTGGGTCCACAATATTT	0.507																																							uc003utx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(3454-3456)CCA>ACA		stromal antigen 3							169.0	151.0	157.0					7																	99809101		2203	4300	6503	SO:0001583	missense	10734				chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding	g.chr7:99809101C>A	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.3454C>A	7.37:g.99809101C>A	ENSP00000400359:p.Pro1152Thr		Somatic				STAG3_uc011kjk.1_Missense_Mutation_p.P1094T|GATS_uc003uty.3_RNA|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Missense_Mutation_p.P377T|GATS_uc011kjl.1_RNA|GATS_uc010lgu.2_RNA	p.P1152T	NM_012447	NP_036579	WXS	Illumina HiSeq	Unspecified	Q9UJ98	STAG3_HUMAN			31	3609	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		1152					A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	c.3454C>A	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	c	14.38	2.518954	0.44866	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000379577;ENST00000317296;ENST00000412190	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.02	1.01	0.19927	.	1.208910	0.06253	N	0.692477	T	0.21062	0.0507	L	0.60455	1.87	0.20563	N	0.999889	B;B;B	0.32573	0.075;0.376;0.376	B;B;B	0.30401	0.027;0.115;0.115	T	0.26258	-1.0108	10	0.07482	T	0.82	-0.0157	5.6831	0.17786	0.0:0.4112:0.3917:0.1971	.	1094;1153;1152	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	T	1152;1094;815;173;1152;111	ENSP00000400359:P1152T;ENSP00000377586:P1094T;ENSP00000319318:P1152T;ENSP00000395039:P111T	ENSP00000319318:P1152T	P	+	1	0	STAG3	99647037	0.000000	0.05858	0.002000	0.10522	0.359000	0.29487	-0.256000	0.08757	-0.024000	0.13941	0.561000	0.74099	CCA		0.507	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		33	121	1	0	9.80977e-26	0.004289	1.88284e-25	33	121				
MUC17	140453	broad.mit.edu	37	7	100683794	100683794	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:100683794G>T	ENST00000306151.4	+	3	9161	c.9097G>T	c.(9097-9099)Ggt>Tgt	p.G3033C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3033	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G3033C(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTGCTGAAGGTACCGGCAT	0.522																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(9097-9099)GGT>TGT		mucin 17 precursor							266.0	279.0	274.0					7																	100683794		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683794G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9097G>T	7.37:g.100683794G>T	ENSP00000302716:p.Gly3033Cys		Somatic				MUC17_uc010lho.1_RNA	p.G3033C	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	9150	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3033			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|49.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.9097G>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	5.613	0.297748	0.10622	.	.	ENSG00000169876	ENST00000306151	T	0.01838	4.61	0.811	-1.62	0.08372	.	.	.	.	.	T	0.02888	0.0086	N	0.24115	0.695	0.09310	N	1	D	0.67145	0.996	P	0.55112	0.769	T	0.41179	-0.9523	9	0.54805	T	0.06	.	3.8042	0.08770	0.1985:0.2467:0.5549:0.0	.	3033	Q685J3	MUC17_HUMAN	C	3033	ENSP00000302716:G3033C	ENSP00000302716:G3033C	G	+	1	0	MUC17	100470514	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.860000	0.04272	-0.789000	0.04498	0.121000	0.15741	GGT		0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		13	573	1	0	1.05317e-09	0.00245	1.62763e-09	13	573				
MUC17	140453	broad.mit.edu	37	7	100684511	100684511	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:100684511C>T	ENST00000306151.4	+	3	9878	c.9814C>T	c.(9814-9816)Cca>Tca	p.P3272S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3272	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.502																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(9814-9816)CCA>TCA		mucin 17 precursor							336.0	334.0	334.0					7																	100684511		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100684511C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9814C>T	7.37:g.100684511C>T	ENSP00000302716:p.Pro3272Ser		Somatic				MUC17_uc010lho.1_RNA	p.P3272S	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	9867	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3272			Extracellular (Potential).|Ser-rich.|53.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.9814C>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	6.591	0.477466	0.12521	.	.	ENSG00000169876	ENST00000306151	T	0.02216	4.39	1.25	-2.31	0.06765	.	.	.	.	.	T	0.02533	0.0077	N	0.14661	0.345	0.09310	N	1	D	0.57571	0.98	D	0.70227	0.968	T	0.29852	-0.9998	9	0.08599	T	0.76	.	2.0673	0.03605	0.2482:0.2806:0.0:0.4712	.	3272	Q685J3	MUC17_HUMAN	S	3272	ENSP00000302716:P3272S	ENSP00000302716:P3272S	P	+	1	0	MUC17	100471231	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-4.045000	0.00306	-0.659000	0.05359	0.196000	0.17591	CCA		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		6	648	0	0	0	0.001168	0	6	648				
SLC26A5	375611	broad.mit.edu	37	7	103018234	103018234	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:103018234C>T	ENST00000306312.3	-	18	2059	c.1798G>A	c.(1798-1800)Gat>Aat	p.D600N	SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000432958.2_Missense_Mutation_p.D568N|SLC26A5_ENST00000339444.6_Missense_Mutation_p.D600N|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000393730.1_Missense_Mutation_p.D568N|SLC26A5_ENST00000393727.1_Missense_Mutation_p.D602N|SLC26A5_ENST00000354356.4_Missense_Mutation_p.D33N|SLC26A5_ENST00000393729.1_Missense_Mutation_p.D563N|SLC26A5_ENST00000393723.1_Missense_Mutation_p.D570N	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	600	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)	p.D600N(2)		endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TCCTCTCCATCTACTTCTGCA	0.363																																							uc003vbz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1798-1800)GAT>AAT		prestin isoform a																																				SO:0001583	missense	375611				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity	g.chr7:103018234C>T	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1798G>A	7.37:g.103018234C>T	ENSP00000304783:p.Asp600Asn		Somatic				SLC26A5_uc003vbt.1_Missense_Mutation_p.D600N|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.D568N|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	p.D600N	NM_198999	NP_945350	WXS	Illumina HiSeq	Unspecified	P58743	S26A5_HUMAN			18	2034	-			600			Cytoplasmic (Potential).|STAS.		Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	37	c.1798G>A	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829925	0.32329	.	.	ENSG00000170615	ENST00000339444;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000354356;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D	0.95918	-3.14;-3.18;-3.17;-3.17;-3.85;-3.1;-3.18;-3.21	5.42	4.54	0.55810	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.787632	0.12552	N	0.458978	D	0.92776	0.7703	N	0.14661	0.345	0.09310	N	1	B;D;D	0.56968	0.034;0.978;0.973	B;P;P	0.58077	0.026;0.832;0.742	D	0.84431	0.0577	10	0.15499	T	0.54	.	9.2485	0.37541	0.0:0.7921:0.0:0.2079	.	600;568;600	P58743;Q496J2;P58743-2	S26A5_HUMAN;.;.	N	600;600;568;568;33;563;602;570	ENSP00000342396:D600N;ENSP00000304783:D600N;ENSP00000377331:D568N;ENSP00000389733:D568N;ENSP00000346325:D33N;ENSP00000377330:D563N;ENSP00000377328:D602N;ENSP00000377324:D570N	ENSP00000304783:D600N	D	-	1	0	SLC26A5	102805470	0.744000	0.28250	0.401000	0.26359	0.997000	0.91878	2.421000	0.44688	1.427000	0.47276	0.650000	0.86243	GAT		0.363	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999		21	72	0	0	0	0.002299	0	21	72				
RELN	5649	broad.mit.edu	37	7	103206713	103206713	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:103206713A>T	ENST00000428762.1	-	33	5053	c.4894T>A	c.(4894-4896)Tgt>Agt	p.C1632S	RELN_ENST00000343529.5_Missense_Mutation_p.C1632S|RELN_ENST00000424685.2_Missense_Mutation_p.C1632S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1632					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.C1632S(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATAGAGAGACAGTCAATATCA	0.363																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(4894-4896)TGT>AGT		reelin isoform a							92.0	86.0	88.0					7																	103206713		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103206713A>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4894T>A	7.37:g.103206713A>T	ENSP00000392423:p.Cys1632Ser		Somatic				RELN_uc010liz.2_Missense_Mutation_p.C1632S	p.C1632S	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	33	5054	-			1632					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.4894T>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874141	0.72180	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.28454	1.61;1.61;1.61	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.65975	2.015	0.80722	D	1	D;D	0.56968	0.971;0.978	P;D	0.68943	0.832;0.961	T	0.56679	-0.7939	10	0.87932	D	0	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	1632;1632	P78509-2;P78509	.;RELN_HUMAN	S	1632	ENSP00000392423:C1632S;ENSP00000345694:C1632S;ENSP00000388446:C1632S	ENSP00000345694:C1632S	C	-	1	0	RELN	102993949	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.711000	0.91396	2.333000	0.79357	0.533000	0.62120	TGT		0.363	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		15	58	0	0	0	0.006122	0	15	58				
PUS7	54517	broad.mit.edu	37	7	105108805	105108805	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:105108805C>T	ENST00000356362.2	-	12	1718	c.1504G>A	c.(1504-1506)Ggg>Agg	p.G502R	PUS7_ENST00000469408.1_Missense_Mutation_p.G502R	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	502	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.G502R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						ACGAGGTCCCCTGGAACAGGT	0.408																																					Colon(138;2387 3051 17860)	Colon(138;2387 3051 17860)	uc003vcx.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1504-1506)GGG>AGG		pseudouridylate synthase 7 homolog							189.0	181.0	183.0					7																	105108805		2203	4300	6503	SO:0001583	missense	54517				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr7:105108805C>T	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1504G>A	7.37:g.105108805C>T	ENSP00000348722:p.Gly502Arg		Somatic				PUS7_uc010lji.2_Missense_Mutation_p.G508R|PUS7_uc003vcy.2_Missense_Mutation_p.G502R|PUS7_uc003vcz.1_Missense_Mutation_p.G502R	p.G502R	NM_019042	NP_061915	WXS	Illumina HiSeq	Unspecified	Q96PZ0	PUS7_HUMAN			12	1723	-			502			TRUD.		Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	c.1504G>A	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565730	0.65651	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.58358	0.34;0.34	5.73	5.73	0.89815	Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase, TruD, insertion domain (1);	0.000000	0.85682	D	0.000000	T	0.81842	0.4908	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86638	0.1890	10	0.72032	D	0.01	-1.1401	18.9043	0.92454	0.0:1.0:0.0:0.0	.	502;502	B3KY42;Q96PZ0	.;PUS7_HUMAN	R	502	ENSP00000348722:G502R;ENSP00000417402:G502R	ENSP00000348722:G502R	G	-	1	0	PUS7	104896041	1.000000	0.71417	0.974000	0.42286	0.044000	0.14063	7.429000	0.80309	2.710000	0.92621	0.650000	0.86243	GGG		0.408	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042		52	183	0	0	0	0.00361	0	52	183				
EIF3IP1	442720	broad.mit.edu	37	7	109599684	109599684	+	IGR	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:109599684G>T								AC073071.1 (362461 upstream) : AC003088.1 (472611 downstream)																							TAATCTGCTAGGAGTGCTCCT	0.478																																							uc003vfp.1		NA																	0					0						c.(412-414)TCC>TCA		Homo sapiens eukaryotic translation initiation factor 3, subunit I pseudogene 1 (EIF3IP1), non-coding RNA.																																				SO:0001628	intergenic_variant	442720							g.chr7:109599684G>T																													7.37:g.109599684G>T			Somatic					p.S138S	NR_003024		WXS	Illumina HiSeq	Unspecified					1	587	-									Silent	SNP		37	c.414C>A																																																																																				0	0.478									11	43	1	0	2.27111e-07	0.001368	3.20786e-07	11	43				
ARF5	381	broad.mit.edu	37	7	127231284	127231284	+	Silent	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:127231284C>T	ENST00000000233.5	+	6	628	c.474C>T	c.(472-474)acC>acT	p.T158T	FSCN3_ENST00000420086.2_5'Flank|GCC1_ENST00000497650.1_Intron|FSCN3_ENST00000265825.5_5'Flank	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	158					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T158T(1)		cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TCCAGGCCACCTGTGCCACCC	0.572																																							uc003vmb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(472-474)ACC>ACT		ADP-ribosylation factor 5							51.0	47.0	49.0					7																	127231284		2203	4300	6503	SO:0001819	synonymous_variant	381				protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding	g.chr7:127231284C>T		CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.474C>T	7.37:g.127231284C>T			Somatic				FSCN3_uc003vmc.1_5'Flank|FSCN3_uc011kog.1_5'Flank|FSCN3_uc011koh.1_5'Flank|FSCN3_uc003vmd.1_5'Flank|FSCN3_uc010llc.1_5'Flank	p.T158T	NM_001662	NP_001653	WXS	Illumina HiSeq	Unspecified	P84085	ARF5_HUMAN			6	510	+			158					P26437	Silent	SNP	ENST00000000233.5	37	c.474C>T	CCDS34745.1																																																																																				0.572	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059567.2	NM_001662		13	25	0	0	0	0.00245	0	13	25				
KLHDC10	23008	broad.mit.edu	37	7	129765721	129765721	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:129765721T>A	ENST00000335420.5	+	7	1015	c.881T>A	c.(880-882)cTt>cAt	p.L294H		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	294						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L294H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						GCATACAACCTTGAAACGAAT	0.274																																							uc003vpj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(880-882)CTT>CAT		kelch domain containing 10							57.0	58.0	57.0					7																	129765721		2203	4300	6503	SO:0001583	missense	23008							g.chr7:129765721T>A		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.881T>A	7.37:g.129765721T>A	ENSP00000334140:p.Leu294His		Somatic				KLHDC10_uc003vpk.1_Missense_Mutation_p.L265H|KLHDC10_uc010lmb.1_Missense_Mutation_p.L191H	p.L294H	NM_014997	NP_055812	WXS	Illumina HiSeq	Unspecified	Q6PID8	KLD10_HUMAN			7	1016	+			294			Kelch 4.		Q86Y99|Q92554	Missense_Mutation	SNP	ENST00000335420.5	37	c.881T>A	CCDS5815.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163041	0.78226	.	.	ENSG00000128607	ENST00000335420	T	0.79247	-1.25	5.33	4.16	0.48862	Galactose oxidase, beta-propeller (1);	0.061158	0.64402	D	0.000002	D	0.82486	0.5047	L	0.49126	1.545	0.80722	D	1	D;D;D	0.76494	0.994;0.985;0.999	P;P;D	0.65323	0.819;0.789;0.934	T	0.83005	-0.0175	10	0.87932	D	0	-7.6159	11.0642	0.47966	0.1392:0.0:0.0:0.8608	.	143;151;294	Q96G43;Q6PID8-2;Q6PID8	.;.;KLD10_HUMAN	H	294	ENSP00000334140:L294H	ENSP00000334140:L294H	L	+	2	0	KLHDC10	129552957	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.840000	0.69402	0.926000	0.37118	0.477000	0.44152	CTT		0.274	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2			12	48	0	0	0	0.00245	0	12	48				
CPA2	1358	broad.mit.edu	37	7	129916550	129916550	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:129916550C>A	ENST00000222481.4	+	7	723	c.668C>A	c.(667-669)cCt>cAt	p.P223H		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	223					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P221H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					GTCACAAACCCTGATGGATAC	0.423																																							uc003vpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(667-669)CCT>CAT		carboxypeptidase A2 (pancreatic) precursor							205.0	185.0	192.0					7																	129916550		2203	4300	6503	SO:0001583	missense	1358				proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129916550C>A	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.668C>A	7.37:g.129916550C>A	ENSP00000222481:p.Pro223His		Somatic				CPA2_uc011kpc.1_Missense_Mutation_p.P223H	p.P223H	NM_001869	NP_001860	WXS	Illumina HiSeq	Unspecified	P48052	CBPA2_HUMAN			7	687	+	Melanoma(18;0.0435)		223					A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	ENST00000222481.4	37	c.668C>A	CCDS5817.2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666366	0.88251	.	.	ENSG00000158516	ENST00000222481	T	0.24723	1.84	5.6	5.6	0.85130	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.73682	0.3618	H	0.99794	4.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86577	0.1851	10	0.72032	D	0.01	.	18.6012	0.91248	0.0:1.0:0.0:0.0	.	221;223	B4DDX9;P48052	.;CBPA2_HUMAN	H	223	ENSP00000222481:P223H	ENSP00000222481:P223H	P	+	2	0	CPA2	129703786	1.000000	0.71417	0.946000	0.38457	0.934000	0.57294	7.445000	0.80570	2.652000	0.90054	0.561000	0.74099	CCT		0.423	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869		30	93	1	0	5.60225e-13	0.001786	9.10126e-13	30	93				
MGAM	8972	broad.mit.edu	37	7	141738391	141738391	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:141738391C>A	ENST00000549489.2	+	19	2387	c.2292C>A	c.(2290-2292)ctC>ctA	p.L764L	MGAM_ENST00000475668.2_Silent_p.L764L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	764	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L764L(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGCCCGGCCTCCTCATCACTC	0.498																																							uc003vwy.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)	2						c.(2290-2292)CTC>CTA		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						53.0	56.0	55.0					7																	141738391		1946	4148	6094	SO:0001819	synonymous_variant	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141738391C>A	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2292C>A	7.37:g.141738391C>A			Somatic					p.L764L	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			19	2346	+	Melanoma(164;0.0272)		764			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	c.2292C>A	CCDS47727.1																																																																																				0.498	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			8	22	1	0	0.00307968	0.00308	0.00379774	8	22				
TRPV6	55503	broad.mit.edu	37	7	142575519	142575519	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:142575519C>A	ENST00000359396.3	-	3	479	c.234G>T	c.(232-234)atG>atT	p.M78I	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	78					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.M78I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTGTTTCCCCCATGGCTCCTG	0.572																																							uc003wbx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(232-234)ATG>ATT		transient receptor potential cation channel,							108.0	102.0	104.0					7																	142575519		2203	4300	6503	SO:0001583	missense	55503				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding	g.chr7:142575519C>A	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.234G>T	7.37:g.142575519C>A	ENSP00000352358:p.Met78Ile		Somatic				TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	p.M78I	NM_018646	NP_061116	WXS	Illumina HiSeq	Unspecified	Q9H1D0	TRPV6_HUMAN			3	450	-	Melanoma(164;0.059)		78			Cytoplasmic (Potential).|ANK 2.		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	c.234G>T	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.367475	0.42003	.	.	ENSG00000165125	ENST00000359396;ENST00000431833	T	0.51325	0.71	4.86	3.94	0.45596	Ankyrin repeat-containing domain (4);	0.239906	0.42172	D	0.000744	T	0.28764	0.0713	N	0.11789	0.175	0.34542	D	0.710414	B	0.02656	0.0	B	0.09377	0.004	T	0.29761	-1.0001	10	0.23302	T	0.38	-9.1619	13.5911	0.61961	0.1554:0.8446:0.0:0.0	.	78	Q9H1D0	TRPV6_HUMAN	I	78;5	ENSP00000352358:M78I	ENSP00000352358:M78I	M	-	3	0	TRPV6	142285641	0.731000	0.28111	1.000000	0.80357	0.962000	0.63368	0.120000	0.15647	2.240000	0.73641	0.655000	0.94253	ATG		0.572	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		32	98	1	0	1.61788e-16	0.002445	2.8004e-16	32	98				
CLCN1	1180	broad.mit.edu	37	7	143043748	143043748	+	Silent	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:143043748C>A	ENST00000343257.2	+	19	2448	c.2361C>A	c.(2359-2361)acC>acA	p.T787T		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	787					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.T787T(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AGAAAACAACCCAGGTGAGAG	0.547																																							uc003wcr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(2359-2361)ACC>ACA		chloride channel 1, skeletal muscle							84.0	82.0	83.0					7																	143043748		2203	4300	6503	SO:0001819	synonymous_variant	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143043748C>A	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2361C>A	7.37:g.143043748C>A			Somatic				CLCN1_uc011ktc.1_Silent_p.T399T	p.T787T	NM_000083	NP_000074	WXS	Illumina HiSeq	Unspecified	P35523	CLCN1_HUMAN			19	2448	+	Melanoma(164;0.205)		787			Cytoplasmic (By similarity).		A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	37	c.2361C>A	CCDS5881.1																																																																																				0.547	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		26	93	1	0	1.32003e-05	0.005443	1.73573e-05	26	93				
CNTNAP2	26047	broad.mit.edu	37	7	146997239	146997239	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:146997239G>C	ENST00000361727.3	+	9	1871	c.1355G>C	c.(1354-1356)gGg>gCg	p.G452A		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	452	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.G452A(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCAGGTTCTGGGTTGAATGAT	0.373										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1354-1356)GGG>GCG		cell recognition molecule Caspr2 precursor							134.0	124.0	127.0					7																	146997239		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146997239G>C	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1355G>C	7.37:g.146997239G>C	ENSP00000354778:p.Gly452Ala	HNSCC(39;0.1)	Somatic					p.G452A	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		9	1871	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	452			Extracellular (Potential).|Laminin G-like 2.		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1355G>C	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005367	0.54254	.	.	ENSG00000174469	ENST00000361727	T	0.77098	-1.07	5.75	3.89	0.44902	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.078366	0.50627	D	0.000115	T	0.74275	0.3695	L	0.51853	1.615	0.80722	D	1	B	0.32731	0.382	B	0.39660	0.306	T	0.66122	-0.6002	10	0.11794	T	0.64	.	15.0983	0.72253	0.0:0.2694:0.7306:0.0	.	452	Q9UHC6	CNTP2_HUMAN	A	452	ENSP00000354778:G452A	ENSP00000354778:G452A	G	+	2	0	CNTNAP2	146628172	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.353000	0.79414	0.729000	0.32403	0.563000	0.77884	GGG		0.373	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			3	73	0	0	0	0.004672	0	3	73				
GIMAP1	170575	broad.mit.edu	37	7	150417162	150417162	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:150417162C>A	ENST00000307194.5	+	3	210	c.70C>A	c.(70-72)Cag>Aag	p.Q24K		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	24					B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)	p.Q24K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCAGTCCCGGCAGGAGTCCAC	0.532																																							uc003whq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(70-72)CAG>AAG		GTPase, IMAP family member 1							134.0	156.0	149.0					7																	150417162		2172	4240	6412	SO:0001583	missense	170575					endoplasmic reticulum membrane|integral to membrane	GTP binding	g.chr7:150417162C>A	AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.70C>A	7.37:g.150417162C>A	ENSP00000302833:p.Gln24Lys		Somatic				GIMAP1_uc003whp.2_Missense_Mutation_p.Q32K	p.Q24K	NM_130759	NP_570115	WXS	Illumina HiSeq	Unspecified	Q8WWP7	GIMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	157	+			24			Cytoplasmic (Potential).		B2RCI3|Q8NAZ0	Missense_Mutation	SNP	ENST00000307194.5	37	c.70C>A	CCDS5906.1	.	.	.	.	.	.	.	.	.	.	C	9.849	1.193177	0.22037	.	.	ENSG00000213203	ENST00000307194	T	0.60171	0.21	4.67	2.83	0.33086	.	0.807665	0.10504	U	0.667017	T	0.42268	0.1195	L	0.33245	0.995	0.09310	N	1	B	0.23128	0.08	B	0.20384	0.029	T	0.27365	-1.0076	10	0.15066	T	0.55	.	7.7322	0.28793	0.1867:0.6333:0.18:0.0	.	24	Q8WWP7	GIMA1_HUMAN	K	24	ENSP00000302833:Q24K	ENSP00000302833:Q24K	Q	+	1	0	GIMAP1	150048095	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.061000	0.11693	0.579000	0.29504	-0.127000	0.14921	CAG		0.532	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	NM_130759		82	219	1	0	5.10314e-47	0.00361	1.04702e-46	82	219				
RP1L1	94137	broad.mit.edu	37	8	10465877	10465877	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:10465877C>A	ENST00000382483.3	-	4	5954	c.5731G>T	c.(5731-5733)Gca>Tca	p.A1911S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1991					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.A1911S(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCTTTTCTGCCTCCGGGGCT	0.597																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(5731-5733)GCA>TCA		retinitis pigmentosa 1-like 1							131.0	148.0	142.0					8																	10465877		2007	4165	6172	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10465877C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5731G>T	8.37:g.10465877C>A	ENSP00000371923:p.Ala1911Ser		Somatic					p.A1911S	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5960	-			1911					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.5731G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	6.135	0.393204	0.11638	.	.	ENSG00000183638	ENST00000382483	T	0.11385	2.78	1.4	0.395	0.16304	.	.	.	.	.	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.23018	0.043	T	0.46190	-0.9209	9	0.13853	T	0.58	.	4.5022	0.11869	0.0:0.5913:0.0:0.4087	.	1911	A6NKC6	.	S	1911	ENSP00000371923:A1911S	ENSP00000371923:A1911S	A	-	1	0	RP1L1	10503287	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	0.068000	0.14531	0.652000	0.30806	0.484000	0.47621	GCA		0.597	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			8	268	1	0	0.000157383	0.00308	0.000201383	8	268				
ADAM28	10863	broad.mit.edu	37	8	24184143	24184143	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:24184143G>A	ENST00000265769.4	+	10	1077	c.967G>A	c.(967-969)Gtt>Att	p.V323I	RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.V70I|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000540823.1_Missense_Mutation_p.V90I|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.V323I|ADAM28_ENST00000518516.1_3'UTR|RP11-624C23.1_ENST00000523578.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	323	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V323I(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TGTTGGCGTTGTTCAGGTCTG	0.343																																					NSCLC(193;488 2149 22258 34798 40734)	NSCLC(193;488 2149 22258 34798 40734)	uc003xdy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|lung(1)|central_nervous_system(1)	5						c.(967-969)GTT>ATT		ADAM metallopeptidase domain 28 isoform 1							311.0	269.0	284.0					8																	24184143		2203	4300	6503	SO:0001583	missense	10863				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24184143G>A	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.967G>A	8.37:g.24184143G>A	ENSP00000265769:p.Val323Ile		Somatic				ADAM28_uc003xdx.2_Missense_Mutation_p.V323I|ADAM28_uc011kzz.1_Missense_Mutation_p.V90I|ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Missense_Mutation_p.V10I	p.V323I	NM_014265	NP_055080	WXS	Illumina HiSeq	Unspecified	Q9UKQ2	ADA28_HUMAN		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)	10	1050	+		Prostate(55;0.0959)	323			Peptidase M12B.|Extracellular (Potential).		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	c.967G>A	CCDS34865.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.425652	0.01126	.	.	ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	T;T;T;T	0.09911	2.93;2.93;2.93;2.93	5.51	-3.23	0.05109	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.04998	0.0134	N	0.12746	0.255	0.19775	N	0.999956	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.12837	0.006;0.003;0.003;0.008	T	0.45220	-0.9276	9	0.06099	T	0.92	.	12.7715	0.57423	0.6984:0.0:0.3016:0.0	.	90;323;323;323	B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.;.;ADA28_HUMAN;.	I	323;70;90;323	ENSP00000265769:V323I;ENSP00000380770:V70I;ENSP00000443743:V90I;ENSP00000393699:V323I	ENSP00000265769:V323I	V	+	1	0	ADAM28	24240088	0.002000	0.14202	0.070000	0.20053	0.014000	0.08584	-0.371000	0.07513	-0.677000	0.05231	-0.302000	0.09304	GTT		0.343	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778		101	95	0	0	0	0.00361	0	101	95				
SPIDR	23514	broad.mit.edu	37	8	48309124	48309124	+	Silent	SNP	T	T	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:48309124T>A	ENST00000297423.4	+	6	1098	c.714T>A	c.(712-714)ccT>ccA	p.P238P	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Silent_p.P168P|SPIDR_ENST00000518074.1_Silent_p.P178P	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	238	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)		p.P238P(1)									TGCATACACCTCAGAAACCCA	0.373																																							uc003xqd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(712-714)CCT>CCA		hypothetical protein LOC23514							154.0	152.0	153.0					8																	48309124		1844	4099	5943	SO:0001819	synonymous_variant	23514							g.chr8:48309124T>A	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.714T>A	8.37:g.48309124T>A			Somatic				KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Silent_p.P238P|KIAA0146_uc010lxs.2_5'UTR|KIAA0146_uc011ldc.1_Silent_p.P168P|KIAA0146_uc011ldd.1_Silent_p.P178P|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Intron	p.P238P	NM_001080394	NP_001073863	WXS	Illumina HiSeq	Unspecified	Q14159	K0146_HUMAN			6	723	+		Lung NSC(58;0.175)	238					B4DFV2|B4E0Y6|Q96BI5	Silent	SNP	ENST00000297423.4	37	c.714T>A	CCDS43737.1																																																																																				0.373	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394		11	474	0	0	0	0.001855	0	11	474				
CEBPD	1052	broad.mit.edu	37	8	48650524	48650524	+	Silent	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:48650524G>A	ENST00000408965.3	-	1	1124	c.159C>T	c.(157-159)taC>taT	p.Y53Y		NM_005195.3	NP_005186.2	P49716	CEBPD_HUMAN	CCAAT/enhancer binding protein (C/EBP), delta	53					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y53Y(1)		lung(1)	1		all_cancers(86;0.0782)|Lung NSC(58;0.00363)|all_epithelial(80;0.0042)|all_lung(54;0.00914)				TCTCGTCGTCGTACATGGCGG	0.726																																					GBM(26;131 685 21356 28665)	GBM(26;131 685 21356 28665)	uc003xqh.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(157-159)TAC>TAT		CCAAT/enhancer binding protein delta							15.0	19.0	17.0					8																	48650524		1903	4100	6003	SO:0001819	synonymous_variant	1052				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr8:48650524G>A		CCDS6142.1	8p11.2-p11.1	2013-01-10				ENSG00000221869		"""basic leucine zipper proteins"""	1835	protein-coding gene	gene with protein product		116898				1840554, 1884998	Standard	NM_005195		Approved	CRP3, CELF, C/EBP-delta, NF-IL6-beta	uc003xqh.1	P49716		ENST00000408965.3:c.159C>T	8.37:g.48650524G>A			Somatic				KIAA0146_uc003xqg.1_Intron	p.Y53Y	NM_005195	NP_005186	WXS	Illumina HiSeq	Unspecified	P49716	CEBPD_HUMAN			1	203	-		all_cancers(86;0.0782)|Lung NSC(58;0.00363)|all_epithelial(80;0.0042)|all_lung(54;0.00914)	53					Q14937|Q2M2X9	Silent	SNP	ENST00000408965.3	37	c.159C>T	CCDS6142.1																																																																																				0.726	CEBPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368448.2	NM_005195		4	61	0	0	0	0.000602	0	4	61				
NSMAF	8439	broad.mit.edu	37	8	59511849	59511849	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:59511849C>G	ENST00000038176.3	-	19	1739	c.1527G>C	c.(1525-1527)tgG>tgC	p.W509C	NSMAF_ENST00000519858.1_5'Flank|NSMAF_ENST00000427130.2_Missense_Mutation_p.W540C	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	509	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)	p.W509C(1)|p.W540C(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TTAGATCAATCCACTCGTGAA	0.373																																							uc003xtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1525-1527)TGG>TGC		neutral sphingomyelinase (N-SMase) activation							168.0	162.0	164.0					8																	59511849		2203	4300	6503	SO:0001583	missense	8439				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity	g.chr8:59511849C>G	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1527G>C	8.37:g.59511849C>G	ENSP00000038176:p.Trp509Cys		Somatic				NSMAF_uc011lee.1_Missense_Mutation_p.W540C	p.W509C	NM_003580	NP_003571	WXS	Illumina HiSeq	Unspecified	Q92636	FAN_HUMAN			19	1741	-		all_lung(136;0.174)|Lung NSC(129;0.2)	509			BEACH.		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	c.1527G>C	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589457	0.86851	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	D;D	0.92249	-3.0;-3.0	6.17	6.17	0.99709	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98623	1.0668	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	540;509	Q92636-2;Q92636	.;FAN_HUMAN	C	509;540	ENSP00000038176:W509C;ENSP00000411012:W540C	.	W	-	3	0	NSMAF	59674403	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	TGG		0.373	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580		36	336	0	0	0	0.005524	0	36	336				
CSPP1	79848	broad.mit.edu	37	8	68031019	68031019	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:68031019A>G	ENST00000262210.5	+	13	1676	c.1645A>G	c.(1645-1647)Agt>Ggt	p.S549G	CSPP1_ENST00000412460.1_Missense_Mutation_p.S255G	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	584					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.S549G(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGCTTATGTTAGTGCTCCTGT	0.308																																							uc003xxi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)	5						c.(1750-1752)AGT>GGT		centrosome spindle pole associated protein 1							74.0	68.0	70.0					8																	68031019		1844	4085	5929	SO:0001583	missense	79848					centrosome|microtubule|spindle		g.chr8:68031019A>G	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1645A>G	8.37:g.68031019A>G	ENSP00000262210:p.Ser549Gly		Somatic				CSPP1_uc003xxg.1_Missense_Mutation_p.S576G|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.S549G|CSPP1_uc003xxk.2_Missense_Mutation_p.S255G	p.S584G	NM_001077204	NP_001070672	WXS	Illumina HiSeq	Unspecified	Q1MSJ5	CSPP1_HUMAN	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)		15	1781	+	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	584					A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	c.1750A>G	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.580910	0.46006	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.34472	1.36;1.36;1.36	5.07	2.59	0.31030	.	0.986238	0.08266	N	0.972220	T	0.33323	0.0859	L	0.54323	1.7	0.23249	N	0.998043	B;B;B;B	0.30914	0.167;0.102;0.3;0.3	B;B;B;B	0.33454	0.079;0.079;0.164;0.164	T	0.31447	-0.9943	10	0.34782	T	0.22	-0.7712	5.4996	0.16821	0.755:0.0:0.087:0.158	.	255;549;584;584	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5;F8W7C3	.;.;CSPP1_HUMAN;.	G	549;584;255;255	ENSP00000262210:S549G;ENSP00000415782:S255G;ENSP00000430092:S255G	ENSP00000262210:S549G	S	+	1	0	CSPP1	68193573	0.007000	0.16637	0.847000	0.33407	0.989000	0.77384	0.377000	0.20552	0.319000	0.23209	0.528000	0.53228	AGT		0.308	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		11	97	0	0	0	0.003163	0	11	97				
EYA1	2138	broad.mit.edu	37	8	72156924	72156924	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:72156924G>T	ENST00000340726.3	-	12	1693	c.1054C>A	c.(1054-1056)Cca>Aca	p.P352T	EYA1_ENST00000303824.7_Missense_Mutation_p.P346T|EYA1_ENST00000419131.1_Intron|EYA1_ENST00000388741.2_Missense_Mutation_p.P318T|EYA1_ENST00000388743.2_Missense_Mutation_p.P351T|EYA1_ENST00000388742.4_Missense_Mutation_p.P352T|EYA1_ENST00000388740.3_Missense_Mutation_p.P319T	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	352					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.P352T(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GAAGTGGGTGGATCCTAAAAT	0.373																																							uc003xys.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5						c.(1054-1056)CCA>ACA		eyes absent 1 isoform b							58.0	59.0	58.0					8																	72156924		2203	4300	6503	SO:0001583	missense	2138				double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr8:72156924G>T	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1054C>A	8.37:g.72156924G>T	ENSP00000342626:p.Pro352Thr		Somatic				EYA1_uc003xyr.3_Intron|EYA1_uc003xyt.3_Missense_Mutation_p.P319T|EYA1_uc010lzf.2_Missense_Mutation_p.P279T|EYA1_uc003xyu.2_Missense_Mutation_p.P352T|EYA1_uc011lfe.1_Missense_Mutation_p.P346T|EYA1_uc003xyv.2_Missense_Mutation_p.P230T	p.P352T	NM_172058	NP_742055	WXS	Illumina HiSeq	Unspecified	Q99502	EYA1_HUMAN	Epithelial(68;0.0837)|all cancers(69;0.247)		11	1341	-	Breast(64;0.046)		352					A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	c.1054C>A	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834789	0.50951	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743	T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	5.64	5.64	0.86602	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.051451	0.85682	D	0.000000	T	0.74809	0.3765	L	0.38953	1.18	0.80722	D	1	P;B;B;P	0.39480	0.493;0.026;0.026;0.675	B;B;B;B	0.37888	0.143;0.041;0.041;0.26	T	0.72154	-0.4376	10	0.25106	T	0.35	-17.8234	19.7123	0.96100	0.0:0.0:1.0:0.0	.	346;279;319;352	A6NCB9;Q0P517;Q99502-2;Q99502	.;.;.;EYA1_HUMAN	T	352;352;320;319;346;318;351	ENSP00000373394:P352T;ENSP00000342626:P352T;ENSP00000373392:P319T;ENSP00000303221:P346T;ENSP00000373393:P318T;ENSP00000373395:P351T	ENSP00000303221:P346T	P	-	1	0	EYA1	72319478	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.769000	0.98969	2.664000	0.90586	0.650000	0.86243	CCA		0.373	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		13	37	1	0	7.03913e-09	0.001368	1.06032e-08	13	37				
PI15	51050	broad.mit.edu	37	8	75757410	75757410	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:75757410A>C	ENST00000260113.2	+	4	619	c.440A>C	c.(439-441)aAa>aCa	p.K147T	RP11-758M4.4_ENST00000522914.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.K147T|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	147	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.K147T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			GATGAAGTGAAAGATTATGCT	0.398																																							uc003yal.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(439-441)AAA>ACA		protease inhibitor 15 preproprotein							202.0	182.0	189.0					8																	75757410		2203	4300	6503	SO:0001583	missense	51050					extracellular region	peptidase inhibitor activity	g.chr8:75757410A>C	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.440A>C	8.37:g.75757410A>C	ENSP00000260113:p.Lys147Thr		Somatic				uc003yak.1_Intron|PI15_uc003yam.2_Missense_Mutation_p.K147T	p.K147T	NM_015886	NP_056970	WXS	Illumina HiSeq	Unspecified	O43692	PI15_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)		4	619	+	Breast(64;0.137)		147					Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	c.440A>C	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921231	0.73213	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.08634	3.07;3.07	5.27	5.27	0.74061	CAP domain (3);	0.145467	0.64402	D	0.000009	T	0.17492	0.0420	M	0.74467	2.265	0.58432	D	0.999995	P	0.48407	0.91	P	0.45971	0.499	T	0.00901	-1.1521	10	0.59425	D	0.04	.	15.3517	0.74393	1.0:0.0:0.0:0.0	.	147	O43692	PI15_HUMAN	T	147	ENSP00000260113:K147T;ENSP00000428567:K147T	ENSP00000260113:K147T	K	+	2	0	PI15	75919965	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	6.954000	0.76001	2.200000	0.70718	0.455000	0.32223	AAA		0.398	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886		9	309	0	0	0	0.004482	0	9	309				
ZFHX4	79776	broad.mit.edu	37	8	77766034	77766034	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:77766034G>T	ENST00000521891.2	+	10	7325	c.6877G>T	c.(6877-6879)Gat>Tat	p.D2293Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2248Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2248Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2267Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.D2277Y(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGAAACAAAAGATAATGAAAA	0.408										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6742-6744)GAT>TAT		zinc finger homeodomain 4							82.0	80.0	81.0					8																	77766034		1905	4120	6025	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766034G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6877G>T	8.37:g.77766034G>T	ENSP00000430497:p.Asp2293Tyr	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.D2293Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.D2248Y	p.D2248Y	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7129	+			2248					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6742G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903200	0.52333	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52983	0.64;0.68;0.66;0.65	4.34	4.34	0.51931	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.45606	U	0.000346	T	0.61438	0.2347	L	0.52011	1.625	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.997	P;D;D	0.63192	0.819;0.912;0.912	T	0.65557	-0.6139	10	0.66056	D	0.02	.	17.3917	0.87434	0.0:0.0:1.0:0.0	.	2248;2248;2293	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	2293;2277;2248;2248;2267	ENSP00000430497:D2293Y;ENSP00000399605:D2248Y;ENSP00000050961:D2248Y;ENSP00000430848:D2267Y	ENSP00000050961:D2248Y	D	+	1	0	ZFHX4	77928589	1.000000	0.71417	0.734000	0.30879	0.863000	0.49368	9.522000	0.98032	2.417000	0.82017	0.650000	0.86243	GAT		0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		31	54	1	0	8.58068e-18	0.007291	1.50716e-17	31	54				
ZFHX4	79776	broad.mit.edu	37	8	77766282	77766282	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:77766282C>A	ENST00000521891.2	+	10	7573	c.7125C>A	c.(7123-7125)aaC>aaA	p.N2375K	ZFHX4_ENST00000050961.6_Missense_Mutation_p.N2330K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.N2330K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.N2349K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2330	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N2359K(1)|p.N2359N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCTAAAAACGCTGCTGCCC	0.507										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)	p.N2359N(1)	ovary(1)|lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6988-6990)AAC>AAA		zinc finger homeodomain 4							111.0	110.0	110.0					8																	77766282		2001	4168	6169	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766282C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7125C>A	8.37:g.77766282C>A	ENSP00000430497:p.Asn2375Lys	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.N2375K|ZFHX4_uc003yaw.1_Missense_Mutation_p.N2330K	p.N2330K	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7377	+			2330					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6990C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	3.636	-0.074502	0.07184	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.46451	0.87;0.92;0.88;0.88	4.8	2.04	0.26737	.	0.988254	0.08215	U	0.980034	T	0.28101	0.0693	N	0.22421	0.69	0.09310	N	1	B;B;B	0.14438	0.006;0.01;0.01	B;B;B	0.19946	0.012;0.027;0.027	T	0.30995	-0.9959	10	0.16420	T	0.52	.	8.4212	0.32700	0.0:0.704:0.0:0.296	.	2330;2330;2375	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	2375;2359;2330;2330;2349	ENSP00000430497:N2375K;ENSP00000399605:N2330K;ENSP00000050961:N2330K;ENSP00000430848:N2349K	ENSP00000050961:N2330K	N	+	3	2	ZFHX4	77928837	0.000000	0.05858	0.000000	0.03702	0.599000	0.36880	-0.004000	0.12878	0.250000	0.21479	-0.145000	0.13849	AAC		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		85	196	1	0	1.8615e-32	0.00361	3.70742e-32	85	196				
ODF1	4956	broad.mit.edu	37	8	103572936	103572936	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:103572936G>T	ENST00000285402.3	+	2	733	c.577G>T	c.(577-579)Ggc>Tgc	p.G193C	ODF1_ENST00000518835.1_Intron	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	193					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.G193C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			CTATGGGCTCGGCAGCTGTGT	0.562																																							uc003ykt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(577-579)GGC>TGC		outer dense fiber of sperm tails 1							110.0	80.0	90.0					8																	103572936		2203	4300	6503	SO:0001583	missense	4956				cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity	g.chr8:103572936G>T	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.577G>T	8.37:g.103572936G>T	ENSP00000285402:p.Gly193Cys		Somatic					p.G193C	NM_024410	NP_077721	WXS	Illumina HiSeq	Unspecified	Q14990	ODFP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)		2	685	+	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		193					Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	c.577G>T	CCDS6293.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584569	0.65992	.	.	ENSG00000155087	ENST00000285402	D	0.85955	-2.05	5.06	5.06	0.68205	Heat shock protein Hsp20 (1);	0.000000	0.56097	D	0.000030	D	0.87974	0.6313	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88937	0.3377	10	0.66056	D	0.02	-41.3366	13.9183	0.63914	0.0:0.0:1.0:0.0	.	193	Q14990	ODFP1_HUMAN	C	193	ENSP00000285402:G193C	ENSP00000285402:G193C	G	+	1	0	ODF1	103642112	0.998000	0.40836	0.998000	0.56505	0.920000	0.55202	3.339000	0.52135	2.367000	0.80283	0.555000	0.69702	GGC		0.562	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			21	84	1	0	1.2644e-06	0.001523	1.73446e-06	21	84				
RIMS2	9699	broad.mit.edu	37	8	104973292	104973292	+	Splice_Site	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:104973292G>C	ENST00000436393.2	+	13	2276		c.e13-1		RIMS2_ENST00000406091.3_Splice_Site|RIMS2_ENST00000507740.1_Splice_Site|RIMS2_ENST00000262231.10_Splice_Site			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.?(5)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTACTTTATAGGGTCAAAGAG	0.294										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Unknown(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.e13-1		regulating synaptic membrane exocytosis 2							87.0	94.0	92.0					8																	104973292		1799	4061	5860	SO:0001630	splice_region_variant	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104973292G>C	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2036-1G>C	8.37:g.104973292G>C		HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Splice_Site_p.R901_splice|RIMS2_uc003ylw.2_Splice_Site_p.R693_splice|RIMS2_uc003ylq.2_Splice_Site_p.R693_splice|RIMS2_uc003ylr.2_Splice_Site_p.R740_splice|RIMS2_uc003ylt.2_Splice_Site_p.R286_splice	p.R679_splice	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		13	2277	+								B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Splice_Site	SNP	ENST00000436393.2	37	c.2036_splice		.	.	.	.	.	.	.	.	.	.	G	16.77	3.214041	0.58452	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	6.08	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6652	0.68901	0.0:0.1454:0.8546:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIMS2	105042468	1.000000	0.71417	0.997000	0.53966	0.821000	0.46438	7.438000	0.80431	1.568000	0.49683	-0.274000	0.10170	.		0.294	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	Intron	92	262	0	0	0	0.00361	0	92	262				
PKHD1L1	93035	broad.mit.edu	37	8	110523010	110523010	+	Silent	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:110523010A>T	ENST00000378402.5	+	71	11504	c.11400A>T	c.(11398-11400)ccA>ccT	p.P3800P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3800					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P3804P(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTTAGGCCCACAGGATCATG	0.373										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(11398-11400)CCA>CCT		fibrocystin L precursor							202.0	187.0	192.0					8																	110523010		1934	4147	6081	SO:0001819	synonymous_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110523010A>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11400A>T	8.37:g.110523010A>T		HNSCC(38;0.096)	Somatic					p.P3800P	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		71	11504	+			3800			Extracellular (Potential).		Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	c.11400A>T	CCDS47911.1																																																																																				0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		38	487	0	0	0	0.002852	0	38	487				
HAS2	3037	broad.mit.edu	37	8	122641478	122641478	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:122641478G>A	ENST00000303924.4	-	2	640	c.103C>T	c.(103-105)Cag>Tag	p.Q35*		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	35					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.Q35*(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGGATAAACTGGTAGCCAACA	0.418																																							uc003yph.2		NA																HAS2/PLAG1(10)	1	Substitution - Nonsense(1)		lung(1)	soft_tissue(10)|ovary(5)	15						c.(103-105)CAG>TAG		hyaluronan synthase 2							85.0	82.0	83.0					8																	122641478		2203	4300	6503	SO:0001587	stop_gained	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122641478G>A	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.103C>T	8.37:g.122641478G>A	ENSP00000306991:p.Gln35*		Somatic					p.Q35*	NM_005328	NP_005319	WXS	Illumina HiSeq	Unspecified	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		2	641	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		35			Extracellular (Potential).		Q32MM3	Nonsense_Mutation	SNP	ENST00000303924.4	37	c.103C>T	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	G	40	8.497176	0.98836	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	.	.	.	6.17	6.17	0.99709	.	0.047958	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-13.5419	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	35	.	ENSP00000306991:Q35X	Q	-	1	0	HAS2	122710659	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.627000	0.74258	2.941000	0.99782	0.655000	0.94253	CAG		0.418	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		8	149	0	0	0	0.00308	0	8	149				
FER1L6	654463	broad.mit.edu	37	8	124992922	124992922	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:124992922G>T	ENST00000522917.1	+	11	1487	c.1281G>T	c.(1279-1281)aaG>aaT	p.K427N	FER1L6_ENST00000399018.1_Missense_Mutation_p.K427N	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	427						integral component of membrane (GO:0016021)		p.K427N(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TGCCTTCCAAGGACAAAGACT	0.458											OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(1279-1281)AAG>AAT		fer-1-like 6							72.0	74.0	73.0					8																	124992922		1864	4103	5967	SO:0001583	missense	654463					integral to membrane		g.chr8:124992922G>T	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1281G>T	8.37:g.124992922G>T	ENSP00000428280:p.Lys427Asn		Somatic	OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1538		p.K427N	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		11	1487	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		427			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.1281G>T	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744395	0.49151	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81908	-1.55;-1.55	5.21	1.95	0.26073	.	0.373382	0.20555	U	0.090040	D	0.84862	0.5566	L	0.54323	1.7	0.39235	D	0.963747	D	0.76494	0.999	D	0.75484	0.986	T	0.80158	-0.1499	10	0.18276	T	0.48	.	6.6878	0.23154	0.4475:0.0:0.5525:0.0	.	427	Q2WGJ9	FR1L6_HUMAN	N	427	ENSP00000428280:K427N;ENSP00000381982:K427N	ENSP00000381982:K427N	K	+	3	2	FER1L6	125062103	0.970000	0.33590	0.999000	0.59377	0.998000	0.95712	0.076000	0.14712	0.573000	0.29400	0.655000	0.94253	AAG		0.458	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		11	200	1	0	2.80697e-09	0.000978	4.29621e-09	11	200				
CYP11B2	1585	broad.mit.edu	37	8	143996605	143996605	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:143996605G>T	ENST00000323110.2	-	3	454	c.452C>A	c.(451-453)cCc>cAc	p.P151H		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	151					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.P151H(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CACGGCCTTGGGCGACAGCAC	0.637									Familial Hyperaldosteronism type I																														uc003yxk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(451-453)CCC>CAC		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)						61.0	51.0	54.0					8																	143996605		2203	4300	6503	SO:0001583	missense	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143996605G>T	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.452C>A	8.37:g.143996605G>T	ENSP00000325822:p.Pro151His		Somatic					p.P151H	NM_000498	NP_000489	WXS	Illumina HiSeq	Unspecified	P19099	C11B2_HUMAN			3	455	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		151					B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	c.452C>A	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	9.858	1.195386	0.22037	.	.	ENSG00000179142	ENST00000323110	T	0.69040	-0.37	3.44	0.376	0.16193	.	0.539064	0.16890	N	0.195355	T	0.66396	0.2785	M	0.78801	2.425	0.09310	N	1	B	0.32101	0.356	B	0.41510	0.359	T	0.62105	-0.6924	10	0.62326	D	0.03	.	3.5454	0.07827	0.3598:0.1937:0.4465:0.0	.	151	P19099	C11B2_HUMAN	H	151	ENSP00000325822:P151H	ENSP00000325822:P151H	P	-	2	0	CYP11B2	143993607	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	0.371000	0.20450	-0.057000	0.13199	0.561000	0.74099	CCC		0.637	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			34	41	1	0	1.36615e-20	0.002836	2.48201e-20	34	41				
SCRIB	23513	broad.mit.edu	37	8	144876106	144876106	+	Silent	SNP	C	C	T	rs555968352		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:144876106C>T	ENST00000320476.3	-	28	3879	c.3873G>A	c.(3871-3873)aaG>aaA	p.K1291K	SCRIB_ENST00000377533.3_Silent_p.K1210K|SCRIB_ENST00000546337.1_5'UTR|SCRIB_ENST00000356994.2_Silent_p.K1291K	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1291					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)		p.K1291K(2)		NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ATTCAGCCATCTTCCCTCCAG	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17735	0.0		0.0	False		,,,				2504	0.0				Pancreas(51;966 1133 10533 14576 29674)	Pancreas(51;966 1133 10533 14576 29674)	uc003yzp.1		NA																	2	Substitution - coding silent(2)		lung(2)	urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5						c.(3871-3873)AAG>AAA		scribble isoform b							99.0	80.0	86.0					8																	144876106		2203	4300	6503	SO:0001819	synonymous_variant	23513				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding	g.chr8:144876106C>T	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.3873G>A	8.37:g.144876106C>T			Somatic				SCRIB_uc003yzn.1_5'UTR|SCRIB_uc003yzo.1_Silent_p.K1291K	p.K1291K	NM_015356	NP_056171	WXS	Illumina HiSeq	Unspecified	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)		28	3880	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		1291					Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	c.3873G>A	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	C	3.804	-0.041180	0.07452	.	.	ENSG00000180900	ENST00000526832	.	.	.	3.83	0.803	0.18691	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.22730	-1.0208	4	.	.	.	.	3.7094	0.08414	0.1631:0.5708:0.1603:0.1059	.	.	.	.	N	287	.	.	D	-	1	0	SCRIB	144948094	0.000000	0.05858	0.022000	0.16811	0.074000	0.17049	0.148000	0.16224	0.808000	0.34231	0.305000	0.20034	GAT		0.662	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356		7	80	0	0	0	0.00308	0	7	80				
CYC1	1537	broad.mit.edu	37	8	145151255	145151255	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:145151255G>A	ENST00000318911.4	+	4	542	c.469G>A	c.(469-471)Ggc>Agc	p.G157S		NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	157	Cytochrome c.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G157S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTTCAAGACGGCCCCAATGA	0.587											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zaz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(469-471)GGC>AGC		cytochrome c-1							161.0	156.0	158.0					8																	145151255		2203	4300	6503	SO:0001583	missense	1537				respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding	g.chr8:145151255G>A	BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.469G>A	8.37:g.145151255G>A	ENSP00000317159:p.Gly157Ser		Somatic	OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1692	CYC1_uc003zay.2_Missense_Mutation_p.G98S	p.G157S	NM_001916	NP_001907	WXS	Illumina HiSeq	Unspecified	P08574	CY1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		4	512	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		157			Cytochrome c.		Q5U062|Q6FHS7	Missense_Mutation	SNP	ENST00000318911.4	37	c.469G>A	CCDS6415.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152252	0.78001	.	.	ENSG00000179091	ENST00000318911	T	0.51817	0.69	4.18	4.18	0.49190	Cytochrome c domain (2);	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79607	-0.1733	10	0.66056	D	0.02	-17.16	11.8801	0.52571	0.0:0.0:1.0:0.0	.	157	P08574	CY1_HUMAN	S	157	ENSP00000317159:G157S	ENSP00000317159:G157S	G	+	1	0	CYC1	145223243	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	8.495000	0.90481	2.172000	0.68678	0.462000	0.41574	GGC		0.587	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916		38	283	0	0	0	0.005524	0	38	283				
MAF1	84232	broad.mit.edu	37	8	145161786	145161786	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:145161786G>C	ENST00000322428.5	+	7	1073	c.669G>C	c.(667-669)gaG>gaC	p.E223D	KIAA1875_ENST00000323662.8_5'Flank|SHARPIN_ENST00000533948.1_5'Flank|SHARPIN_ENST00000398712.2_5'Flank|MAF1_ENST00000532522.1_Missense_Mutation_p.E223D|MAF1_ENST00000534585.1_Missense_Mutation_p.E253D	NM_032272.4	NP_115648.2	Q9H063	MAF1_HUMAN	MAF1 homolog (S. cerevisiae)	223					negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)	p.E223D(1)		central_nervous_system(1)|lung(8)|urinary_tract(1)	10	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGACATGGAGCTGGGGGAGG	0.637																																							uc003zbc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(667-669)GAG>GAC		MAF1 protein							43.0	48.0	46.0					8																	145161786		2200	4299	6499	SO:0001583	missense	84232				negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	cytoplasm|nucleus		g.chr8:145161786G>C		CCDS6416.1	8q24.3	2012-10-29			ENSG00000179632	ENSG00000179632			24966	protein-coding gene	gene with protein product		610210				11230166, 11438659	Standard	NM_032272		Approved	DKFZp586G1123	uc003zbc.1	Q9H063	OTTHUMG00000165244	ENST00000322428.5:c.669G>C	8.37:g.145161786G>C	ENSP00000318604:p.Glu223Asp		Somatic				SHARPIN_uc003zba.2_5'Flank|SHARPIN_uc003zbb.2_5'Flank|KIAA1875_uc003zbd.3_5'Flank|KIAA1875_uc011lky.1_5'Flank	p.E223D	NM_032272	NP_115648	WXS	Illumina HiSeq	Unspecified	Q9H063	MAF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		7	1170	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		223					D3DWL4	Missense_Mutation	SNP	ENST00000322428.5	37	c.669G>C	CCDS6416.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789495	0.50102	.	.	ENSG00000179632	ENST00000322428;ENST00000534585;ENST00000532522;ENST00000534811	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.18	-3.21	0.05140	.	0.397609	0.26987	N	0.021482	T	0.46308	0.1386	L	0.29908	0.895	0.38860	D	0.956469	B	0.02656	0.0	B	0.01281	0.0	T	0.11867	-1.0570	10	0.13853	T	0.58	-8.575	5.376	0.16166	0.2663:0.2946:0.4391:0.0	.	223	Q9H063	MAF1_HUMAN	D	223;253;223;41	ENSP00000318604:E223D;ENSP00000433979:E253D;ENSP00000436720:E223D;ENSP00000436639:E41D	ENSP00000318604:E223D	E	+	3	2	MAF1	145233774	1.000000	0.71417	0.096000	0.21009	0.926000	0.56050	0.569000	0.23638	-0.344000	0.08338	-0.302000	0.09304	GAG		0.637	MAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382910.1	NM_032272		4	48	0	0	0	0.000248	0	4	48				
SMARCA2	6595	broad.mit.edu	37	9	2047450	2047450	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:2047450G>T	ENST00000382203.1	+	5	1221	c.1012G>T	c.(1012-1014)Gac>Tac	p.D338Y	SMARCA2_ENST00000382194.1_Missense_Mutation_p.D338Y|SMARCA2_ENST00000349721.2_Missense_Mutation_p.D338Y|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000357248.2_Missense_Mutation_p.D338Y			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	338					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.D334Y(1)|p.D338Y(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GCAAGGCCTGGACCCCGTGGA	0.697																																							uc003zhc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(1012-1014)GAC>TAC		SWI/SNF-related matrix-associated							22.0	24.0	24.0					9																	2047450		2201	4298	6499	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2047450G>T	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1012G>T	9.37:g.2047450G>T	ENSP00000371638:p.Asp338Tyr		Somatic				SMARCA2_uc003zhd.2_Missense_Mutation_p.D338Y|SMARCA2_uc010mha.2_Missense_Mutation_p.D329Y	p.D338Y	NM_003070	NP_003061	WXS	Illumina HiSeq	Unspecified	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	5	1111	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	338					B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.1012G>T	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	g	28.6	4.930169	0.92389	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	D;D;T;D;D	0.89810	-2.57;-2.56;2.53;-2.57;-2.56	5.65	5.65	0.86999	.	0.063541	0.64402	D	0.000009	D	0.94716	0.8295	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	D	0.94760	0.7935	10	0.72032	D	0.01	-35.4517	19.4365	0.94798	0.0:0.0:1.0:0.0	.	338;338	P51531-2;P51531	.;SMCA2_HUMAN	Y	338	ENSP00000265773:D338Y;ENSP00000349788:D338Y;ENSP00000392081:D338Y;ENSP00000371638:D338Y;ENSP00000371629:D338Y	ENSP00000265773:D338Y	D	+	1	0	SMARCA2	2037450	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.809000	0.99208	2.672000	0.90937	0.546000	0.68486	GAC		0.697	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		9	18	1	0	1.76689e-08	0.006214	2.63649e-08	9	18				
FREM1	158326	broad.mit.edu	37	9	14846066	14846066	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:14846066A>T	ENST00000380880.3	-	8	2068	c.1285T>A	c.(1285-1287)Tct>Act	p.S429T	FREM1_ENST00000380881.4_Missense_Mutation_p.S430T|FREM1_ENST00000422223.2_Missense_Mutation_p.S429T			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	429					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.S430T(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		ATGGCTCGAGACTGCCCCTCA	0.488																																							uc003zlm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)	5						c.(1285-1287)TCT>ACT		FRAS1 related extracellular matrix 1 precursor							48.0	53.0	51.0					9																	14846066		2036	4198	6234	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14846066A>T	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1285T>A	9.37:g.14846066A>T	ENSP00000370262:p.Ser429Thr		Somatic				FREM1_uc010mic.2_RNA	p.S429T	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	8	1875	-			429			CSPG 2.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.1285T>A	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.356364	0.82243	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.26810	1.71;1.71;1.71	4.65	4.65	0.58169	.	0.238071	0.44902	D	0.000415	T	0.46014	0.1371	M	0.63428	1.95	0.52099	D	0.999948	D	0.89917	1.0	D	0.70227	0.968	T	0.34775	-0.9815	10	0.35671	T	0.21	-15.3091	14.371	0.66840	1.0:0.0:0.0:0.0	.	429	Q5H8C1	FREM1_HUMAN	T	430;429;429	ENSP00000370263:S430T;ENSP00000412940:S429T;ENSP00000370262:S429T	ENSP00000370257:S432T	S	-	1	0	FREM1	14836066	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.059000	0.76684	1.852000	0.53769	0.379000	0.24179	TCT		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		6	11	0	0	0	0.001168	0	6	11				
ADAMTSL1	92949	broad.mit.edu	37	9	18905849	18905849	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:18905849G>A	ENST00000380548.4	+	27	5260	c.4921G>A	c.(4921-4923)Ggc>Agc	p.G1641S	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.G342S	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1641						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G1641S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GACACGGGATGGCATCACCTT	0.527																																							uc003zne.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(4921-4923)GGC>AGC		ADAMTS-like 1 isoform 4 precursor							90.0	89.0	89.0					9																	18905849		2041	4195	6236	SO:0001583	missense	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18905849G>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4921G>A	9.37:g.18905849G>A	ENSP00000369921:p.Gly1641Ser		Somatic				ADAMTSL1_uc003znf.3_Missense_Mutation_p.G342S|ADAMTSL1_uc003zng.1_Missense_Mutation_p.G32S	p.G1641S	NM_001040272	NP_001035362	WXS	Illumina HiSeq	Unspecified	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	27	5048	+			1641					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	c.4921G>A	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	38	7.140273	0.98092	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239	T;T	0.61627	0.09;0.09	5.92	5.92	0.95590	.	0.439260	0.24879	N	0.034869	T	0.71108	0.3301	L	0.61036	1.89	0.80722	D	1	D;D;P	0.61697	0.963;0.99;0.799	P;P;B	0.59825	0.63;0.864;0.255	T	0.66818	-0.5827	10	0.34782	T	0.22	.	18.4921	0.90852	0.0:0.0:1.0:0.0	.	1142;342;1641	A2A344;Q8N6G6-6;Q8N6G6	.;.;ATL1_HUMAN	S	1641;342;345	ENSP00000369921:G1641S;ENSP00000369918:G342S	ENSP00000325584:G345S	G	+	1	0	ADAMTSL1	18895849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.472000	0.73567	2.793000	0.96121	0.650000	0.86243	GGC		0.527	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			9	16	0	0	0	0.000673	0	9	16				
ALDH1B1	219	broad.mit.edu	37	9	38396338	38396338	+	Missense_Mutation	SNP	C	C	A	rs201489278		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:38396338C>A	ENST00000377698.3	+	2	746	c.593C>A	c.(592-594)cCg>cAg	p.P198Q		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	198					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)	p.P198Q(1)		NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		AAACTTGCCCCGGCACTCGCC	0.597																																							uc004aay.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(592-594)CCG>CAG		aldehyde dehydrogenase 1B1 precursor	NADH(DB00157)						79.0	78.0	78.0					9																	38396338		2203	4300	6503	SO:0001583	missense	219				carbohydrate metabolic process	mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity	g.chr9:38396338C>A	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.593C>A	9.37:g.38396338C>A	ENSP00000366927:p.Pro198Gln		Somatic					p.P198Q	NM_000692	NP_000683	WXS	Illumina HiSeq	Unspecified	P30837	AL1B1_HUMAN		GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)	2	705	+			198					B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	c.593C>A	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130028	0.37630	.	.	ENSG00000137124	ENST00000377698	T	0.80214	-1.35	5.61	4.72	0.59763	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.093336	0.45361	D	0.000361	D	0.92374	0.7580	H	0.95850	3.73	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.93935	0.7218	10	0.87932	D	0	.	12.3416	0.55097	0.0:0.9182:0.0:0.0818	.	198	P30837	AL1B1_HUMAN	Q	198	ENSP00000366927:P198Q	ENSP00000366927:P198Q	P	+	2	0	ALDH1B1	38386338	1.000000	0.71417	0.684000	0.30055	0.009000	0.06853	4.714000	0.61902	1.385000	0.46445	0.655000	0.94253	CCG		0.597	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1			28	72	1	0	1.39806e-14	0.001512	2.35984e-14	28	72				
TMEM252	169693	broad.mit.edu	37	9	71152351	71152351	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:71152351G>T	ENST00000377311.3	-	2	389	c.337C>A	c.(337-339)Cct>Act	p.P113T		NM_153237.1	NP_694969.1	Q8N6L7	TM252_HUMAN	transmembrane protein 252	113						integral component of membrane (GO:0016021)		p.P113T(1)									CTCTCTGCAGGACAGCTCTGC	0.527																																							uc004agt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(337-339)CCT>ACT		hypothetical protein LOC169693							61.0	62.0	62.0					9																	71152351		2203	4300	6503	SO:0001583	missense	169693					integral to membrane		g.chr9:71152351G>T	BC029780	CCDS35040.1	9q21.13	2012-07-19	2012-07-19	2012-07-19	ENSG00000181778	ENSG00000181778			28537	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 71"""	C9orf71		12477932	Standard	NM_153237		Approved	MGC34760	uc004agt.3	Q8N6L7	OTTHUMG00000019967	ENST00000377311.3:c.337C>A	9.37:g.71152351G>T	ENSP00000366528:p.Pro113Thr		Somatic				uc004ags.1_RNA	p.P113T	NM_153237	NP_694969	WXS	Illumina HiSeq	Unspecified	Q8N6L7	CI071_HUMAN			2	390	-			113						Missense_Mutation	SNP	ENST00000377311.3	37	c.337C>A	CCDS35040.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672564	0.29693	.	.	ENSG00000181778	ENST00000377311	.	.	.	5.96	-4.95	0.03048	.	1.347150	0.04770	N	0.427872	T	0.37265	0.0997	M	0.62723	1.935	0.09310	N	1	B	0.33583	0.418	B	0.33960	0.173	T	0.37731	-0.9693	9	0.29301	T	0.29	1.6265	8.8085	0.34952	0.2869:0.4261:0.287:0.0	.	113	Q8N6L7	CI071_HUMAN	T	113	.	ENSP00000366528:P113T	P	-	1	0	C9orf71	70342171	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.864000	0.04254	-0.705000	0.05035	0.655000	0.94253	CCT		0.527	TMEM252-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052551.1	NM_153237		15	60	1	0	1.99824e-07	0.00499	2.84779e-07	15	60				
APBA1	320	broad.mit.edu	37	9	72130971	72130971	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:72130971T>C	ENST00000265381.4	-	2	1378	c.1156A>G	c.(1156-1158)Agc>Ggc	p.S386G		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	386	LIN-2/CASK binding.|Pro-rich.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.S386G(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CTGGTGGGGCTAATGTCCTGG	0.622																																							uc004ahh.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1156-1158)AGC>GGC		amyloid beta A4 precursor protein-binding,							135.0	113.0	120.0					9																	72130971		2203	4300	6503	SO:0001583	missense	320				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle		g.chr9:72130971T>C	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1156A>G	9.37:g.72130971T>C	ENSP00000265381:p.Ser386Gly		Somatic					p.S386G	NM_001163	NP_001154	WXS	Illumina HiSeq	Unspecified	Q02410	APBA1_HUMAN			2	1432	-			386			LIN-2/CASK binding.|Pro-rich.		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	37	c.1156A>G	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420434	0.83559	.	.	ENSG00000107282	ENST00000265381	T	0.06294	3.32	5.95	5.95	0.96441	.	0.083823	0.85682	D	0.000000	T	0.06462	0.0166	L	0.34521	1.04	0.80722	D	1	P	0.42456	0.78	B	0.34931	0.192	T	0.31530	-0.9940	10	0.48119	T	0.1	-17.7099	16.4237	0.83790	0.0:0.0:0.0:1.0	.	386	Q02410	APBA1_HUMAN	G	386	ENSP00000265381:S386G	ENSP00000265381:S386G	S	-	1	0	APBA1	71320791	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.841000	0.86834	2.279000	0.76181	0.533000	0.62120	AGC		0.622	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163		3	136	0	0	0	0.000248	0	3	136				
TRPM3	80036	broad.mit.edu	37	9	73399097	73399097	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:73399097G>C	ENST00000377111.2	-	7	1315	c.1072C>G	c.(1072-1074)Cca>Gca	p.P358A	TRPM3_ENST00000361823.5_Missense_Mutation_p.P205A|TRPM3_ENST00000360823.2_Missense_Mutation_p.P230A|TRPM3_ENST00000396285.1_Missense_Mutation_p.P205A|TRPM3_ENST00000396283.1_Missense_Mutation_p.P230A|TRPM3_ENST00000377105.1_Missense_Mutation_p.P205A|TRPM3_ENST00000408909.2_Missense_Mutation_p.P205A|TRPM3_ENST00000377101.1_Missense_Mutation_p.P205A|TRPM3_ENST00000396280.5_Missense_Mutation_p.P205A|TRPM3_ENST00000377106.1_Missense_Mutation_p.P230A|TRPM3_ENST00000358082.3_Missense_Mutation_p.P230A|TRPM3_ENST00000423814.3_Missense_Mutation_p.P385A|TRPM3_ENST00000377110.3_Missense_Mutation_p.P358A|TRPM3_ENST00000396292.4_Missense_Mutation_p.P230A|TRPM3_ENST00000357533.2_Missense_Mutation_p.P360A	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	383					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.P230A(1)|p.P358A(1)|p.P360A(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						ACAACCACTGGCACGGGAGGG	0.542																																							uc004aid.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(1072-1074)CCA>GCA		transient receptor potential cation channel,							114.0	96.0	102.0					9																	73399097		2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73399097G>C	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1072C>G	9.37:g.73399097G>C	ENSP00000366315:p.Pro358Ala		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.P188A|TRPM3_uc004ahv.2_Missense_Mutation_p.P188A|TRPM3_uc004ahw.2_Missense_Mutation_p.P230A|TRPM3_uc004ahx.2_Missense_Mutation_p.P205A|TRPM3_uc004ahy.2_Missense_Mutation_p.P230A|TRPM3_uc004ahz.2_Missense_Mutation_p.P205A|TRPM3_uc004aia.2_Missense_Mutation_p.P205A|TRPM3_uc004aib.2_Missense_Mutation_p.P205A|TRPM3_uc004aic.2_Missense_Mutation_p.P358A|TRPM3_uc010mor.2_Missense_Mutation_p.P358A|TRPM3_uc004aie.2_Missense_Mutation_p.P205A|TRPM3_uc004aif.2_Missense_Mutation_p.P230A|TRPM3_uc004aig.2_Missense_Mutation_p.P205A	p.P358A	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			7	1316	-			383			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37	c.1072C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.134991|5.134991	0.94517|0.94517	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823	.|T;T;T;T;T;T;T;T;T;T;T;T;D;T	.|0.85258	.|3.91;3.91;-1.18;-1.19;3.91;3.91;3.91;3.91;-1.18;-1.19;-1.17;3.91;-1.96;1.8	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94581|0.94581	0.8254|0.8254	M|M	0.91038|0.91038	3.17|3.17	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;P;D;D;D;D	.|0.89917	.|0.998;1.0;0.998;1.0;0.999;0.927;0.998;0.999;0.999;0.968	.|D;D;D;D;D;P;D;D;D;P	.|0.83275	.|0.945;0.996;0.993;0.986;0.996;0.742;0.927;0.996;0.984;0.783	D|D	0.94516|0.94516	0.7723|0.7723	5|10	.|0.87932	.|D	.|0	-5.7211|-5.7211	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|383;205;358;358;358;360;230;205;358;205	.|Q9HCF6;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.;.	G|A	204|358;358;230;230;205;360;205;205;230;230;385;205;230;205	.|ENSP00000366315:P358A;ENSP00000366314:P358A;ENSP00000366310:P230A;ENSP00000354066:P230A;ENSP00000366309:P205A;ENSP00000350140:P360A;ENSP00000386127:P205A;ENSP00000379581:P205A;ENSP00000379587:P230A;ENSP00000350791:P230A;ENSP00000389542:P385A;ENSP00000366305:P205A;ENSP00000379579:P230A;ENSP00000355395:P205A	.|ENSP00000350140:P360A	A|P	-|-	2|1	0|0	TRPM3|TRPM3	72588917|72588917	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.909000|0.909000	0.53808|0.53808	9.860000|9.860000	0.99555|0.99555	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CCA		0.542	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		20	74	0	0	0	0.001216	0	20	74				
TRPM6	140803	broad.mit.edu	37	9	77353458	77353458	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:77353458C>A	ENST00000360774.1	-	36	5878	c.5641G>T	c.(5641-5643)Ggg>Tgg	p.G1881W	TRPM6_ENST00000361255.3_Missense_Mutation_p.G1876W|TRPM6_ENST00000376864.4_Missense_Mutation_p.G1885W|TRPM6_ENST00000451710.3_Missense_Mutation_p.G1885W|TRPM6_ENST00000376871.3_Missense_Mutation_p.G718W|TRPM6_ENST00000376872.3_Missense_Mutation_p.G836W|TRPM6_ENST00000449912.2_Missense_Mutation_p.G1876W	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1881	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.G1881W(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CGGAACTCCCCTGTCATATAC	0.468																																							uc004ajl.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(5641-5643)GGG>TGG		transient receptor potential cation channel,							146.0	133.0	137.0					9																	77353458		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77353458C>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5641G>T	9.37:g.77353458C>A	ENSP00000354006:p.Gly1881Trp		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.G1876W|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.G832W|TRPM6_uc010mpd.1_Missense_Mutation_p.G714W|TRPM6_uc010mpe.1_Missense_Mutation_p.G428W|TRPM6_uc004ajj.1_Missense_Mutation_p.G837W	p.G1881W	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			36	5879	-			1881			Alpha-type protein kinase.|Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.5641G>T	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.988113	0.93106	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864	T;T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63;2.63	5.94	5.94	0.96194	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.50990	0.1648	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.996;1.0	T	0.60469	-0.7257	10	0.87932	D	0	.	20.3591	0.98849	0.0:1.0:0.0:0.0	.	428;714;832;1881;1876;1876	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	W	1881;1885;836;718;1876;1876;427;1885	ENSP00000354006:G1881W;ENSP00000407341:G1885W;ENSP00000366068:G836W;ENSP00000366067:G718W;ENSP00000396672:G1876W;ENSP00000354962:G1876W;ENSP00000366060:G1885W	ENSP00000354006:G1881W	G	-	1	0	TRPM6	76543278	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	7.620000	0.83070	2.816000	0.96949	0.561000	0.74099	GGG		0.468	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		11	64	1	0	2.27111e-07	0.001368	3.20786e-07	11	64				
PCSK5	5125	broad.mit.edu	37	9	78686767	78686767	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:78686767G>C	ENST00000545128.1	+	7	1385	c.847G>C	c.(847-849)Gga>Cga	p.G283R	PCSK5_ENST00000376752.4_Missense_Mutation_p.G283R|PCSK5_ENST00000376767.3_Missense_Mutation_p.G283R	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	283	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.G283R(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GACTGTGGACGGACCAGCCCC	0.527																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(847-849)GGA>CGA		proprotein convertase subtilisin/kexin type 5							131.0	137.0	135.0					9																	78686767		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78686767G>C		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.847G>C	9.37:g.78686767G>C	ENSP00000446280:p.Gly283Arg		Somatic				PCSK5_uc004ajy.2_Missense_Mutation_p.G283R|PCSK5_uc004aka.2_RNA	p.G283R	NM_006200	NP_006191	WXS	Illumina HiSeq	Unspecified	Q92824	PCSK5_HUMAN			7	1385	+			283			Catalytic.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.847G>C	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	32	5.182000	0.94885	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	D;D;D	0.89617	-2.54;-2.54;-2.54	5.57	5.57	0.84162	.	.	.	.	.	D	0.96228	0.8770	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96888	0.9651	9	0.87932	D	0	.	19.5292	0.95222	0.0:0.0:1.0:0.0	.	283;283	Q92824-2;B1AMG5	.;.	R	283	ENSP00000446280:G283R;ENSP00000365958:G283R;ENSP00000365943:G283R	ENSP00000365943:G283R	G	+	1	0	PCSK5	77876587	1.000000	0.71417	0.973000	0.42090	0.996000	0.88848	9.102000	0.94226	2.625000	0.88918	0.591000	0.81541	GGA		0.527	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				47	199	0	0	0	0.00361	0	47	199				
LPPR1	54886	broad.mit.edu	37	9	104071741	104071741	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:104071741A>G	ENST00000374874.3	+	5	1073	c.634A>G	c.(634-636)Acg>Gcg	p.T212A	LPPR1_ENST00000395056.2_Missense_Mutation_p.T212A	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		212					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.T212A(1)									CTTATATGCCACGGTGAGTGT	0.483																																							uc004bbb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(634-636)ACG>GCG		plasticity related gene 3							77.0	73.0	74.0					9																	104071741		2203	4300	6503	SO:0001583	missense	54886					integral to membrane	catalytic activity	g.chr9:104071741A>G																												ENST00000374874.3:c.634A>G	9.37:g.104071741A>G	ENSP00000364008:p.Thr212Ala		Somatic				LPPR1_uc011lvi.1_Missense_Mutation_p.T188A|LPPR1_uc004bbc.2_Missense_Mutation_p.T212A|LPPR1_uc010mtc.2_Missense_Mutation_p.T196A	p.T212A	NM_207299	NP_997182	WXS	Illumina HiSeq	Unspecified	Q8TBJ4	LPPR1_HUMAN			5	1033	+			212			Helical; (Potential).		Q5VX23|Q9NXE2	Missense_Mutation	SNP	ENST00000374874.3	37	c.634A>G	CCDS6751.1	.	.	.	.	.	.	.	.	.	.	A	7.265	0.605877	0.14002	.	.	ENSG00000148123	ENST00000374874;ENST00000374871;ENST00000395056	T;T	0.73258	-0.73;-0.73	5.18	5.18	0.71444	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	N	0.01631	-0.79	0.80722	D	1	B;P	0.50369	0.033;0.934	B;P	0.57152	0.04;0.814	T	0.58923	-0.7550	10	0.02654	T	1	-40.4506	14.4891	0.67639	1.0:0.0:0.0:0.0	.	196;212	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	A	212	ENSP00000364008:T212A;ENSP00000378496:T212A	ENSP00000364005:T212A	T	+	1	0	RP11-35N6.1	103111562	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	7.102000	0.77005	2.079000	0.62486	0.482000	0.46254	ACG		0.483	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053425.1			16	52	0	0	0	0.007413	0	16	52				
RAD23B	5887	broad.mit.edu	37	9	110068802	110068802	+	Missense_Mutation	SNP	C	C	A	rs111972101		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:110068802C>A	ENST00000358015.3	+	4	722	c.371C>A	c.(370-372)gCa>gAa	p.A124E	RAD23B_ENST00000416373.2_Missense_Mutation_p.A52E	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	124					DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)	p.A124E(1)		breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TCCACACCTGCATCCATCACT	0.567								Direct reversal of damage;Nucleotide excision repair (NER)																															uc004bde.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(370-372)GCA>GAA	Direct_reversal_of_damage|NER	UV excision repair protein RAD23 homolog B							127.0	108.0	114.0					9																	110068802		2203	4300	6503	SO:0001583	missense	5887				nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleoplasm|proteasome complex|XPC complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding	g.chr9:110068802C>A		CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.371C>A	9.37:g.110068802C>A	ENSP00000350708:p.Ala124Glu		Somatic				RAD23B_uc011lwa.1_Missense_Mutation_p.A124E|RAD23B_uc011lwb.1_Missense_Mutation_p.A103E	p.A124E	NM_002874	NP_002865	WXS	Illumina HiSeq	Unspecified	P54727	RD23B_HUMAN			4	738	+			124					B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	37	c.371C>A	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	C	0.265	-0.997038	0.02145	.	.	ENSG00000119318	ENST00000419616;ENST00000358015;ENST00000374678;ENST00000416373	T;T;T	0.48201	0.82;2.15;2.18	5.22	3.39	0.38822	.	1.013980	0.07863	N	0.966697	T	0.30324	0.0761	N	0.22421	0.69	0.21020	N	0.9998	B;B;B	0.28713	0.012;0.22;0.012	B;B;B	0.19148	0.01;0.024;0.01	T	0.24799	-1.0150	10	0.51188	T	0.08	-22.1437	3.4962	0.07655	0.1669:0.4724:0.0:0.3608	.	103;124;124	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	E	124;124;52;52	ENSP00000416868:A124E;ENSP00000350708:A124E;ENSP00000405623:A52E	ENSP00000350708:A124E	A	+	2	0	RAD23B	109108623	0.000000	0.05858	0.160000	0.22671	0.011000	0.07611	0.302000	0.19192	0.787000	0.33731	-0.140000	0.14226	GCA		0.567	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874		11	91	1	0	5.50884e-06	0.001368	7.36575e-06	11	91				
NUP188	23511	broad.mit.edu	37	9	131743636	131743636	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:131743636C>T	ENST00000372577.2	+	15	1504	c.1483C>T	c.(1483-1485)Cgg>Tgg	p.R495W		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	495					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.R495W(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AACTCTTTGGCGGAGACAAAC	0.403																																							uc004bws.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(1483-1485)CGG>TGG		nucleoporin 188kDa							160.0	161.0	161.0					9																	131743636		2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131743636C>T	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1483C>T	9.37:g.131743636C>T	ENSP00000361658:p.Arg495Trp		Somatic					p.R495W	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			15	1505	+			495					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.1483C>T	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774237	0.69992	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.32988	1.43	5.1	4.19	0.49359	.	0.049247	0.85682	D	0.000000	T	0.37732	0.1014	N	0.19112	0.55	0.58432	D	0.999995	D	0.76494	0.999	D	0.68353	0.957	T	0.30966	-0.9960	10	0.72032	D	0.01	-17.1412	12.1774	0.54194	0.3108:0.6892:0.0:0.0	.	495	Q5SRE5	NU188_HUMAN	W	384;495	ENSP00000361658:R495W	ENSP00000349125:R384W	R	+	1	2	NUP188	130783457	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.918000	0.56432	1.254000	0.44035	0.407000	0.27541	CGG		0.403	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			5	166	0	0	0	0.000602	0	5	166				
NUP214	8021	broad.mit.edu	37	9	134073549	134073549	+	Silent	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:134073549T>C	ENST00000359428.5	+	29	4812	c.4668T>C	c.(4666-4668)tcT>tcC	p.S1556S	NUP214_ENST00000451030.1_Silent_p.S1557S|NUP214_ENST00000411637.2_Silent_p.S1546S|NUP214_ENST00000483497.2_Silent_p.S382S			P35658	NU214_HUMAN	nucleoporin 214kDa	1556	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.S1556S(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CTGCAGCATCTAGTACTAGTC	0.562			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		1	Substitution - coding silent(1)		lung(1)	breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(4666-4668)TCT>TCC		nucleoporin 214kDa							64.0	65.0	65.0					9																	134073549		2203	4300	6503	SO:0001819	synonymous_variant	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134073549T>C	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4668T>C	9.37:g.134073549T>C			Somatic				NUP214_uc004cah.2_Silent_p.S1546S|NUP214_uc004cai.2_Silent_p.S986S|NUP214_uc010mzg.2_RNA|NUP214_uc011mcg.1_Silent_p.S382S|NUP214_uc011mcf.1_Silent_p.S333S|NUP214_uc010mzh.1_Silent_p.S70S|NUP214_uc010mzi.1_Silent_p.S70S	p.S1556S	NM_005085	NP_005076	WXS	Illumina HiSeq	Unspecified	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	29	4779	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	1556			Pro/Ser/Thr-rich.|11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	c.4668T>C	CCDS6940.1																																																																																				0.562	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		3	88	0	0	0	0.004672	0	3	88				
CACNA1B	774	broad.mit.edu	37	9	140809117	140809117	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:140809117G>T	ENST00000371372.1	+	5	779	c.634G>T	c.(634-636)Gtg>Ttg	p.V212L	CACNA1B_ENST00000371363.1_Missense_Mutation_p.V212L|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Missense_Mutation_p.V212L|CACNA1B_ENST00000371355.4_Missense_Mutation_p.V212L|CACNA1B_ENST00000371357.1_Missense_Mutation_p.V212L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	212					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.V212L(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTGCAGGTGGTGCTCAAGTC	0.557																																							uc004cog.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|large_intestine(2)|ovary(1)	6						c.(634-636)GTG>TTG		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						104.0	102.0	102.0					9																	140809117		2102	4211	6313	SO:0001583	missense	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140809117G>T	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.634G>T	9.37:g.140809117G>T	ENSP00000360423:p.Val212Leu		Somatic					p.V212L	NM_000718	NP_000709	WXS	Illumina HiSeq	Unspecified	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	5	779	+	all_cancers(76;0.166)		212			Cytoplasmic (Potential).|I.		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	c.634G>T	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553805	0.65425	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.97924	-4.61;-4.61;-4.61;-4.61;-4.61	4.34	4.34	0.51931	.	0.069223	0.64402	D	0.000020	D	0.97766	0.9267	L	0.60845	1.875	0.80722	D	1	D	0.55800	0.973	P	0.57204	0.815	D	0.98223	1.0479	10	0.54805	T	0.06	.	17.0399	0.86486	0.0:0.0:1.0:0.0	.	212	B1AQK6	.	L	212	ENSP00000360423:V212L;ENSP00000277551:V212L;ENSP00000360414:V212L;ENSP00000360408:V212L;ENSP00000360406:V212L	ENSP00000277551:V212L	V	+	1	0	CACNA1B	139928938	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.478000	0.97927	2.218000	0.71995	0.561000	0.74099	GTG		0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		11	23	1	0	1.08611e-07	0.000978	1.5619e-07	11	23				
DMD	1756	broad.mit.edu	37	X	32663166	32663166	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:32663166A>C	ENST00000357033.4	-	10	1270	c.1064T>G	c.(1063-1065)cTt>cGt	p.L355R	DMD_ENST00000378677.2_Missense_Mutation_p.L351R|DMD_ENST00000288447.4_Missense_Mutation_p.L347R	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	355					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L355R(1)|p.L350R(1)|p.L351R(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGCAGAAAGAAGCCACGATAA	0.408																																							uc004dda.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(1063-1065)CTT>CGT		dystrophin Dp427m isoform							216.0	183.0	194.0					X																	32663166		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32663166A>C	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1064T>G	X.37:g.32663166A>C	ENSP00000354923:p.Leu355Arg		Somatic				DMD_uc004dcz.2_Missense_Mutation_p.L232R|DMD_uc004dcy.1_Missense_Mutation_p.L351R|DMD_uc004ddb.1_Missense_Mutation_p.L347R|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.L347R|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Missense_Mutation_p.L66R	p.L355R	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			10	1308	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	355			Spectrin 1.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.1064T>G	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465140	0.84425	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.66638	-0.22;-0.22;-0.22	5.67	5.67	0.87782	.	0.000000	0.33712	U	0.004637	D	0.83936	0.5362	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.993;1.0	D	0.86984	0.2106	10	0.87932	D	0	.	15.105	0.72315	1.0:0.0:0.0:0.0	.	351;347;347;355;351	B1AK23;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	R	347;351;355;355;232;347	ENSP00000367948:L351R;ENSP00000354923:L355R;ENSP00000288447:L347R	ENSP00000288447:L347R	L	-	2	0	DMD	32573087	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.156000	0.94705	2.018000	0.59344	0.486000	0.48141	CTT		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		13	95	0	0	0	0.001368	0	13	95				
CXorf22	170063	broad.mit.edu	37	X	35974306	35974306	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:35974306G>T	ENST00000297866.5	+	8	1469	c.1403G>T	c.(1402-1404)gGt>gTt	p.G468V		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	468								p.G468V(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						ACTGGAGGGGGTATGGTGGTA	0.358																																							uc004ddj.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|ovary(1)	3						c.(1402-1404)GGT>GTT		hypothetical protein LOC170063							48.0	45.0	46.0					X																	35974306		2202	4299	6501	SO:0001583	missense	170063							g.chrX:35974306G>T	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1403G>T	X.37:g.35974306G>T	ENSP00000297866:p.Gly468Val		Somatic				CXorf22_uc010ngv.2_RNA	p.G468V	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			8	1462	+			468					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.1403G>T	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	1.521	-0.546968	0.04024	.	.	ENSG00000165164	ENST00000297866	T	0.52057	0.68	5.2	4.32	0.51571	.	0.548564	0.21424	N	0.074765	T	0.27313	0.0670	N	0.22421	0.69	0.09310	N	0.999999	B	0.31054	0.306	B	0.26693	0.072	T	0.06972	-1.0797	10	0.33940	T	0.23	-14.2037	4.6735	0.12701	0.1912:0.2044:0.6044:0.0	.	468	Q6ZTR5	CX022_HUMAN	V	468	ENSP00000297866:G468V	ENSP00000297866:G468V	G	+	2	0	CXorf22	35884227	0.970000	0.33590	0.036000	0.18154	0.002000	0.02628	2.191000	0.42640	2.300000	0.77407	0.594000	0.82650	GGT		0.358	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		15	8	1	0	6.31663e-08	0.003163	9.25143e-08	15	8				
DGKK	139189	broad.mit.edu	37	X	50112015	50112015	+	RNA	SNP	T	T	C			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:50112015T>C	ENST00000376025.2	-	0	3798							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					GTGCCATAAATTGCCTTCAGA	0.433																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(3739-3741)AAT>AGT		diacylglycerol kinase kappa							108.0	89.0	95.0					X																	50112015		1910	4117	6027			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50112015T>C	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50112015T>C			Somatic					p.N1247S	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			29	3800	-	Ovarian(276;0.236)		1247			Required for localization to the plasma membrane.		B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.3740A>G																																																																																					0.433	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		3	31	0	0	0	0.000248	0	3	31				
PBDC1	51260	broad.mit.edu	37	X	75396788	75396788	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:75396788G>T	ENST00000373358.3	+	5	573	c.370G>T	c.(370-372)Gat>Tat	p.D124Y	PBDC1_ENST00000373357.3_Intron	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	124								p.D124Y(1)									GCTGCGACTAGATTGTTCTCA	0.423																																							uc004ecl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)GAT>TAT		hypothetical protein LOC51260							212.0	173.0	186.0					X																	75396788		2203	4300	6503	SO:0001583	missense	51260							g.chrX:75396788G>T	BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.370G>T	X.37:g.75396788G>T	ENSP00000362456:p.Asp124Tyr		Somatic					p.D124Y	NM_016500	NP_057584	WXS	Illumina HiSeq	Unspecified	Q9BVG4	CX026_HUMAN			5	573	+			124						Missense_Mutation	SNP	ENST00000373358.3	37	c.370G>T	CCDS14432.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.794290	0.70452	.	.	ENSG00000102390	ENST00000373358	.	.	.	4.94	4.05	0.47172	Yst0336-like domain (1);	0.044170	0.85682	D	0.000000	T	0.79522	0.4460	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.81571	-0.0872	9	0.87932	D	0	-8.763	9.3531	0.38151	0.1106:0.0:0.8894:0.0	.	124	Q9BVG4	CX026_HUMAN	Y	124	.	ENSP00000362456:D124Y	D	+	1	0	CXorf26	75313191	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.402000	0.66332	1.169000	0.42739	0.529000	0.55759	GAT		0.423	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500		29	23	1	0	3.90053e-15	0.002445	6.65466e-15	29	23				
TNMD	64102	broad.mit.edu	37	X	99854659	99854659	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:99854659G>T	ENST00000373031.4	+	7	1116	c.899G>T	c.(898-900)tGt>tTt	p.C300F		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	300					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.C300F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						CGAGTCATCTGTCGTGTCATC	0.507																																							uc004efy.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(898-900)TGT>TTT		tenomodulin							98.0	60.0	73.0					X																	99854659		2203	4300	6503	SO:0001583	missense	64102					integral to membrane		g.chrX:99854659G>T	AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.899G>T	X.37:g.99854659G>T	ENSP00000362122:p.Cys300Phe		Somatic				TNMD_uc004efz.2_3'UTR	p.C300F	NM_022144	NP_071427	WXS	Illumina HiSeq	Unspecified	Q9H2S6	TNMD_HUMAN			7	1125	+			300			Extracellular (Potential).		Q9HBX0|Q9UJG0	Missense_Mutation	SNP	ENST00000373031.4	37	c.899G>T	CCDS14469.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493608	0.84962	.	.	ENSG00000000005	ENST00000373031	T	0.60424	0.19	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.71500	0.3347	L	0.43152	1.355	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.73304	-0.4025	10	0.87932	D	0	-11.4716	19.1351	0.93424	0.0:0.0:1.0:0.0	.	300	Q9H2S6	TNMD_HUMAN	F	300	ENSP00000362122:C300F	ENSP00000362122:C300F	C	+	2	0	TNMD	99741315	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.469000	0.83416	0.594000	0.82650	TGT		0.507	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144		13	8	1	0	5.50884e-06	0.001368	7.36575e-06	13	8				
TENM1	10178	broad.mit.edu	37	X	123554295	123554295	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:123554295C>A	ENST00000371130.3	-	24	4890	c.4827G>T	c.(4825-4827)tgG>tgT	p.W1609C	TENM1_ENST00000422452.2_Missense_Mutation_p.W1616C|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1609					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.W1611C(1)									TTATAGTCAGCCAGTATACTT	0.527																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(4825-4827)TGG>TGT		odz, odd Oz/ten-m homolog 1 isoform 3							77.0	58.0	65.0					X																	123554295		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123554295C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4827G>T	X.37:g.123554295C>A	ENSP00000360171:p.Trp1609Cys		Somatic				ODZ1_uc011muj.1_Missense_Mutation_p.W1615C|ODZ1_uc010nqy.2_Missense_Mutation_p.W1616C	p.W1609C	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			24	4891	-			1609			Extracellular (Potential).|YD 3.		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.4827G>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	c	18.37	3.609798	0.66558	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85702	-2.02;-1.99	5.49	5.49	0.81192	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.92456	0.7605	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.926;0.964	D	0.92283	0.5835	10	0.46703	T	0.11	.	18.459	0.90731	0.0:1.0:0.0:0.0	.	1615;1616;1609	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	C	1609;1616	ENSP00000360171:W1609C;ENSP00000403954:W1616C	ENSP00000360171:W1609C	W	-	3	0	ODZ1	123381976	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	7.813000	0.86123	2.300000	0.77407	0.597000	0.82753	TGG		0.527	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		13	21	1	0	2.27111e-07	0.001368	3.20786e-07	13	21				
TENM1	10178	broad.mit.edu	37	X	123787580	123787580	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:123787580C>A	ENST00000371130.3	-	7	1285	c.1222G>T	c.(1222-1224)Gtc>Ttc	p.V408F	TENM1_ENST00000422452.2_Missense_Mutation_p.V408F	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	408					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V410F(1)									GTCTGCATGACCTGTGCACCA	0.398																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(1222-1224)GTC>TTC		odz, odd Oz/ten-m homolog 1 isoform 3							144.0	122.0	130.0					X																	123787580		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123787580C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1222G>T	X.37:g.123787580C>A	ENSP00000360171:p.Val408Phe		Somatic				ODZ1_uc011muj.1_Missense_Mutation_p.V407F|ODZ1_uc010nqy.2_Missense_Mutation_p.V408F	p.V408F	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			7	1286	-			408			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.1222G>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098893	0.56183	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.25250	1.81;1.81	5.6	5.6	0.85130	.	0.151545	0.44902	D	0.000401	T	0.32041	0.0816	L	0.52011	1.625	0.41067	D	0.985423	P;P;P	0.51791	0.868;0.868;0.948	B;B;P	0.48921	0.23;0.23;0.595	T	0.05852	-1.0860	10	0.59425	D	0.04	.	12.1062	0.53813	0.0:0.9196:0.0:0.0804	.	407;408;408	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	F	408	ENSP00000360171:V408F;ENSP00000403954:V408F	ENSP00000360171:V408F	V	-	1	0	ODZ1	123615261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.518000	0.45537	2.351000	0.79841	0.529000	0.55759	GTC		0.398	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		4	89	1	0	0.00116845	0.001168	0.00145979	4	89				
PASD1	139135	broad.mit.edu	37	X	150828215	150828215	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chrX:150828215T>G	ENST00000370357.4	+	10	993	c.748T>G	c.(748-750)Tat>Gat	p.Y250D		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	250						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.Y250D(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					GGTTGAGCAGTATGGACCACA	0.393																																							uc004fev.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(748-750)TAT>GAT		PAS domain containing 1							225.0	179.0	194.0					X																	150828215		2203	4300	6503	SO:0001583	missense	139135					nucleus	signal transducer activity	g.chrX:150828215T>G	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.748T>G	X.37:g.150828215T>G	ENSP00000359382:p.Tyr250Asp		Somatic					p.Y250D	NM_173493	NP_775764	WXS	Illumina HiSeq	Unspecified	Q8IV76	PASD1_HUMAN			10	1080	+	Acute lymphoblastic leukemia(192;6.56e-05)		250					Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	c.748T>G	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	T	8.867	0.948459	0.18356	.	.	ENSG00000166049	ENST00000370357	T	0.67171	-0.25	3.47	-1.38	0.09027	.	.	.	.	.	T	0.46092	0.1375	N	0.24115	0.695	0.09310	N	1	B	0.15473	0.013	B	0.15870	0.014	T	0.33394	-0.9870	9	0.62326	D	0.03	-10.966	3.5257	0.07759	0.0:0.2567:0.3397:0.4036	.	250	Q8IV76	PASD1_HUMAN	D	250	ENSP00000359382:Y250D	ENSP00000359382:Y250D	Y	+	1	0	PASD1	150578871	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.089000	0.03376	-0.388000	0.07797	-0.335000	0.08231	TAT		0.393	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		5	64	0	0	0	0.000602	0	5	64				
OR10Z1	128368	broad.mit.edu	37	1	158576531	158576532	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:158576531_158576532insTT	ENST00000361284.1	+	1	303_304	c.303_304insTT	c.(304-306)ttcfs	p.F102fs		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					CTGCCCAGATGTTCTTTTCTGC	0.554																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(301-306)ATGTTCfs		olfactory receptor, family 10, subfamily Z,																																				SO:0001589	frameshift_variant	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158576531_158576532insTT	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.304_305dupTT	1.37:g.158576532_158576533dupTT	ENSP00000354707:p.Phe102fs		Somatic					p.M101fs	NM_001004478	NP_001004478	WXS	Illumina HiSeq	Unspecified	Q8NGY1	O10Z1_HUMAN			1	303_304	+	all_hematologic(112;0.0378)		101_102			Helical; Name=3; (Potential).		Q5VYL0|Q6IFR7	Frame_Shift_Ins	INS	ENST00000361284.1	37	c.303_304insTT	CCDS30901.1																																																																																				0.554	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		8	362	NA	NA	NA	NA	NA	8	362	---	---	---	---
LAD1	3898	broad.mit.edu	37	1	201355939	201355939	+	Frame_Shift_Del	DEL	A	A	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr1:201355939delA	ENST00000391967.2	-	3	851	c.550delT	c.(550-552)tccfs	p.S184fs	LAD1_ENST00000367313.3_Frame_Shift_Del_p.S198fs	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	184						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						TTTGGCATGGAGGACTTCTCC	0.562																																							uc001gwm.2		NA																	0					0						c.(550-552)TCCfs		ladinin 1							73.0	81.0	78.0					1																	201355939		2203	4300	6503	SO:0001589	frameshift_variant	3898					basement membrane	structural molecule activity	g.chr1:201355939delA	U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.550delT	1.37:g.201355939delA	ENSP00000375829:p.Ser184fs		Somatic				LAD1_uc009wzu.1_Frame_Shift_Del_p.S206fs	p.S184fs	NM_005558	NP_005549	WXS	Illumina HiSeq	Unspecified	O00515	LAD1_HUMAN			3	785	-			184					O95614|Q96GD8	Frame_Shift_Del	DEL	ENST00000391967.2	37	c.550delT	CCDS1410.1																																																																																				0.562	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558		57	135	NA	NA	NA	NA	NA	57	135	---	---	---	---
NLRP10	338322	broad.mit.edu	37	11	7981515	7981515	+	Frame_Shift_Del	DEL	A	A	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:7981515delA	ENST00000328600.2	-	2	1805	c.1644delT	c.(1642-1644)tttfs	p.F548fs		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	548					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCTGTTCTTTAAAATGCTTCA	0.393																																							uc001mfv.1		NA																	0				lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1642-1644)TTTfs		NLR family, pyrin domain containing 10							59.0	60.0	60.0					11																	7981515		2201	4296	6497	SO:0001589	frameshift_variant	338322						ATP binding	g.chr11:7981515delA	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1644delT	11.37:g.7981515delA	ENSP00000327763:p.Phe548fs		Somatic					p.F548fs	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1661	-			548					Q2M3C4|Q6JGT0	Frame_Shift_Del	DEL	ENST00000328600.2	37	c.1644delT	CCDS7784.1																																																																																				0.393	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		26	106	NA	NA	NA	NA	NA	26	106	---	---	---	---
ARAP1	116985	broad.mit.edu	37	11	72422487	72422487	+	Frame_Shift_Del	DEL	A	A	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:72422487delA	ENST00000393609.3	-	8	1282	c.1080delT	c.(1078-1080)tttfs	p.F360fs	ARAP1_ENST00000393605.3_Frame_Shift_Del_p.F120fs|ARAP1_ENST00000359373.5_Frame_Shift_Del_p.F360fs|ARAP1_ENST00000429686.1_Frame_Shift_Del_p.F115fs|ARAP1_ENST00000426523.1_Frame_Shift_Del_p.F115fs|ARAP1_ENST00000455638.2_Frame_Shift_Del_p.F360fs|ARAP1_ENST00000334211.8_Frame_Shift_Del_p.F115fs	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	360	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGTTACTGTCAAAGTATCGCA	0.567																																					Ovarian(102;1198 1520 13195 17913 37529)	Ovarian(102;1198 1520 13195 17913 37529)	uc001osu.2		NA																	0				skin(1)	1						c.(1078-1080)TTTfs		ArfGAP with RhoGAP domain, ankyrin repeat and PH							143.0	121.0	128.0					11																	72422487		2200	4293	6493	SO:0001589	frameshift_variant	116985				actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding	g.chr11:72422487delA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.1080delT	11.37:g.72422487delA	ENSP00000377233:p.Phe360fs		Somatic				ARAP1_uc001osv.2_Frame_Shift_Del_p.F360fs|ARAP1_uc001osr.2_Frame_Shift_Del_p.F120fs|ARAP1_uc001oss.2_Frame_Shift_Del_p.F115fs|ARAP1_uc009yth.2_Frame_Shift_Del_p.F115fs|ARAP1_uc010rre.1_Frame_Shift_Del_p.F115fs	p.F360fs	NM_001040118	NP_001035207	WXS	Illumina HiSeq	Unspecified	Q96P48	ARAP1_HUMAN			8	1269	-			360			PH 1.		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Del	DEL	ENST00000393609.3	37	c.1080delT	CCDS41687.1																																																																																				0.567	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118		37	106	NA	NA	NA	NA	NA	37	106	---	---	---	---
KMT2A	4297	broad.mit.edu	37	11	118380757	118380758	+	Frame_Shift_Ins	INS	-	-	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr11:118380757_118380758insA	ENST00000389506.5	+	30	10986_10987	c.10986_10987insA	c.(10987-10989)aaafs	p.K3663fs	RP11-770J1.3_ENST00000532597.1_RNA|KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.K3666fs|KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.K3625fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3663					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GCATTACTGAGAAAAAACCCAA	0.396																																							uc001pta.2		NA								T|O					MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB		AML|ALL		0				lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25						c.(10984-10989)GAGAAAfs		myeloid/lymphoid or mixed-lineage leukemia																																				SO:0001589	frameshift_variant	4297				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding	g.chr11:118380757_118380758insA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10992dupA	11.37:g.118380763_118380763dupA	ENSP00000374157:p.Lys3663fs		Somatic				MLL_uc001ptb.2_Frame_Shift_Ins_p.E3665fs	p.E3662fs	NM_005933	NP_005924	WXS	Illumina HiSeq	Unspecified	Q03164	MLL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)	30	11009_11010	+	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)	3662_3663					E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	ENST00000389506.5	37	c.10986_10987insA	CCDS31686.1																																																																																				0.396	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		40	85	NA	NA	NA	NA	NA	40	85	---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109845649	109845649	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr12:109845649delG	ENST00000431443.2	+	9	1038	c.1038delG	c.(1036-1038)atgfs	p.M346fs	MYO1H_ENST00000310903.5_Frame_Shift_Del_p.M346fs|MYO1H_ENST00000542883.1_3'UTR	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	346	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GAGATGCAATGGCAAAGGCTG	0.443																																							uc010sxn.1		NA																	0					0						c.(1036-1038)ATGfs		myosin 1H							154.0	143.0	147.0					12																	109845649		1941	4139	6080	SO:0001589	frameshift_variant	283446					myosin complex	motor activity	g.chr12:109845649delG		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1038delG	12.37:g.109845649delG	ENSP00000444076:p.Met346fs		Somatic					p.M346fs	NM_001101421	NP_001094891	WXS	Illumina HiSeq	Unspecified	Q8N1T3	MYO1H_HUMAN			9	1038	+			Error:Variant_position_missing_in_B4DNW6_after_alignment					F5H3C6	Frame_Shift_Del	DEL	ENST00000431443.2	37	c.1038delG																																																																																					0.443	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597		33	88	NA	NA	NA	NA	NA	33	88	---	---	---	---
POSTN	10631	broad.mit.edu	37	13	38148759	38148759	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr13:38148759delG	ENST00000379747.4	-	17	2156	c.2039delC	c.(2038-2040)ccafs	p.P680fs	POSTN_ENST00000541179.1_Intron|POSTN_ENST00000379742.4_Intron|POSTN_ENST00000379749.4_Frame_Shift_Del_p.P680fs|POSTN_ENST00000379743.4_Intron|POSTN_ENST00000541481.1_Intron	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	680					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTTAATTTTTGGTTCCACAAC	0.269																																							uc001uwo.3		NA																	0				ovary(2)	2						c.(2038-2040)CCAfs		periostin, osteoblast specific factor isoform 1							60.0	57.0	58.0					13																	38148759		2199	4285	6484	SO:0001589	frameshift_variant	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38148759delG	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2039delC	13.37:g.38148759delG	ENSP00000369071:p.Pro680fs		Somatic				POSTN_uc010tet.1_Intron|POSTN_uc001uwp.3_Intron|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Intron|POSTN_uc010tev.1_Intron|POSTN_uc010tew.1_Intron	p.P680fs	NM_006475	NP_006466	WXS	Illumina HiSeq	Unspecified	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	17	2157	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	680					B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Frame_Shift_Del	DEL	ENST00000379747.4	37	c.2039delC	CCDS9364.1																																																																																				0.269	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475		10	28	NA	NA	NA	NA	NA	10	28	---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210560407	210560408	+	Frame_Shift_Ins	INS	-	-	T			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr2:210560407_210560408insT	ENST00000360351.4	+	7	4019_4020	c.3513_3514insT	c.(3514-3516)gaafs	p.E1172fs	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Frame_Shift_Ins_p.E1168fs|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1172					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AATTGTCAGTGGAAATACCTTG	0.441																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	0				ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(3511-3516)GTGGAAfs		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)																																			SO:0001589	frameshift_variant	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210560407_210560408insT		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	Exception_encountered	2.37:g.210560407_210560408insT	ENSP00000353508:p.Glu1172fs		Somatic				MAP2_uc002vdc.1_Frame_Shift_Ins_p.V1171fs|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Frame_Shift_Ins_p.V1167fs	p.V1171fs	NM_002374	NP_002365	WXS	Illumina HiSeq	Unspecified	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	3761_3762	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1171_1172					Q17S04|Q8IUX2|Q99975|Q99976	Frame_Shift_Ins	INS	ENST00000360351.4	37	c.3513_3514insT	CCDS2384.1																																																																																				0.441	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		26	63	NA	NA	NA	NA	NA	26	63	---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62453151	62453152	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr4:62453151_62453152delTC	ENST00000514591.1	+	4	591_592	c.262_263delTC	c.(262-264)tctfs	p.S88fs	LPHN3_ENST00000507625.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000511324.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000506746.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000512091.2_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000506720.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000506700.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000509896.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000514996.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000507164.1_Frame_Shift_Del_p.S156fs|LPHN3_ENST00000514157.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000508946.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000545650.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000504896.1_Frame_Shift_Del_p.S88fs|LPHN3_ENST00000508693.1_Frame_Shift_Del_p.S156fs			Q9HAR2	LPHN3_HUMAN	latrophilin 3	88	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TAAGATTATGTCTCAAAGGTAT	0.361																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(262-264)TCTfs		latrophilin 3 precursor																																				SO:0001589	frameshift_variant	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62453151_62453152delTC	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.262_263delTC	4.37:g.62453153_62453154delTC	ENSP00000422533:p.Ser88fs		Somatic				LPHN3_uc003hcq.3_Frame_Shift_Del_p.S88fs|LPHN3_uc010ihg.1_Frame_Shift_Del_p.S156fs	p.S88fs	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			2	435_436	+			88			SUEL-type lectin.|Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Frame_Shift_Del	DEL	ENST00000514591.1	37	c.262_263delTC	CCDS54768.1																																																																																				0.361	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			8	25	NA	NA	NA	NA	NA	8	25	---	---	---	---
TGFBI	7045	broad.mit.edu	37	5	135379758	135379758	+	Frame_Shift_Del	DEL	A	A	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:135379758delA	ENST00000442011.2	+	3	406	c.245delA	c.(244-246)tacfs	p.Y82fs	TGFBI_ENST00000305126.8_Frame_Shift_Del_p.Y82fs|TGFBI_ENST00000504185.1_3'UTR	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	82	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTCATCAGCTACGAGTGCTGT	0.537																																							uc003lbf.3		NA																	0				breast(3)|ovary(1)	4						c.(244-246)TACfs		transforming growth factor, beta-induced, 68kDa							187.0	188.0	188.0					5																	135379758		2034	4195	6229	SO:0001589	frameshift_variant	7045				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding	g.chr5:135379758delA	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.245delA	5.37:g.135379758delA	ENSP00000416330:p.Tyr82fs		Somatic				TGFBI_uc003lbg.3_5'UTR|TGFBI_uc003lbh.3_5'UTR|TGFBI_uc011cyb.1_5'Flank	p.Y82fs	NM_000358	NP_000349	WXS	Illumina HiSeq	Unspecified	Q15582	BGH3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		3	406	+			82			EMI.		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Frame_Shift_Del	DEL	ENST00000442011.2	37	c.245delA	CCDS47266.1																																																																																				0.537	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			39	160	NA	NA	NA	NA	NA	39	160	---	---	---	---
PCDHGA2	56113	broad.mit.edu	37	5	140720800	140720801	+	Frame_Shift_Ins	INS	-	-	A			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr5:140720800_140720801insA	ENST00000394576.2	+	1	2262_2263	c.2262_2263insA	c.(2263-2265)cacfs	p.H755fs	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_5'Flank	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	755					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGACCTATTCCCACGAGGTCTC	0.599																																							uc003ljk.1		NA																	0				skin(2)|ovary(1)	3						c.(2260-2265)TCCCACfs		protocadherin gamma subfamily A, 2 isoform 1																																				SO:0001589	frameshift_variant	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140720800_140720801insA	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	Exception_encountered	5.37:g.140720800_140720801insA	ENSP00000378077:p.His755fs		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA3_uc003ljm.1_5'Flank|PCDHGA3_uc010jfx.1_5'Flank|PCDHGA2_uc011dao.1_Frame_Shift_Ins_p.S754fs|PCDHGA3_uc011dap.1_5'Flank	p.S754fs	NM_018915	NP_061738	WXS	Illumina HiSeq	Unspecified	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2447_2448	+			754_755			Cytoplasmic (Potential).		Q52LL6|Q9Y5D5	Frame_Shift_Ins	INS	ENST00000394576.2	37	c.2262_2263insA	CCDS47289.1																																																																																				0.599	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		48	104	NA	NA	NA	NA	NA	48	104	---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76572390	76572390	+	Frame_Shift_Del	DEL	C	C	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr6:76572390delC	ENST00000369977.3	+	16	1763	c.1624delC	c.(1624-1626)cacfs	p.H542fs	MYO6_ENST00000369981.3_Frame_Shift_Del_p.H542fs|RNA5SP209_ENST00000411237.1_RNA|MYO6_ENST00000369975.1_Frame_Shift_Del_p.H542fs|MYO6_ENST00000369985.4_Frame_Shift_Del_p.H542fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	542	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAGTGATCAACACTTTACATC	0.373																																							uc003pih.1		NA																	0				kidney(1)|pancreas(1)	2						c.(1624-1626)CACfs		myosin VI							130.0	111.0	117.0					6																	76572390		2203	4300	6503	SO:0001589	frameshift_variant	4646				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding	g.chr6:76572390delC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.1624delC	6.37:g.76572390delC	ENSP00000358994:p.His542fs		Somatic				MYO6_uc003pig.1_Frame_Shift_Del_p.H542fs|MYO6_uc003pii.1_Frame_Shift_Del_p.H542fs	p.H542fs	NM_004999	NP_004990	WXS	Illumina HiSeq	Unspecified	Q9UM54	MYO6_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.223)	16	1903	+		all_hematologic(105;0.189)	542			Myosin head-like.		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Del	DEL	ENST00000369977.3	37	c.1624delC	CCDS34487.1																																																																																				0.373	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999		9	70	NA	NA	NA	NA	NA	9	70	---	---	---	---
SND1	27044	broad.mit.edu	37	7	127732042	127732046	+	Splice_Site	DEL	CAGCT	CAGCT	-	rs113048090		TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	CAGCT	CAGCT	-	-	CAGCT	CAGCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:127732042_127732046delCAGCT	ENST00000354725.3	+	24	2861_2863	c.2667_2669delCAGCT	c.(2665-2670)agcagc>agc	p.SS889fs		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	889					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TTTTTTCTTACAGCTGAACCTGTGG	0.571																																							uc003vmi.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.e24-1		staphylococcal nuclease domain containing 1																																				SO:0001630	splice_region_variant	27044				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity	g.chr7:127732042_127732046delCAGCT		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2668-1CAGCT>-	7.37:g.127732042_127732046delCAGCT			Somatic				SND1_uc010lle.2_Splice_Site_p.L543_splice	p.L890_splice	NM_014390	NP_055205	WXS	Illumina HiSeq	Unspecified	Q7KZF4	SND1_HUMAN			24	2894	+								Q13122|Q96AG0	Splice_Site	DEL	ENST00000354725.3	37	c.2668_splice	CCDS34747.1																																																																																				0.571	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	Frame_Shift_Del	18	284	NA	NA	NA	NA	NA	18	284	---	---	---	---
PTN	5764	broad.mit.edu	37	7	136936041	136936041	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr7:136936041delG	ENST00000348225.2	-	4	814	c.387delC	c.(385-387)gccfs	p.A129fs	PTN_ENST00000393083.2_Frame_Shift_Del_p.A129fs	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	129					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						TCTGGCATTCGGCATTGTGCA	0.507																																							uc003vtq.2		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(385-387)GCCfs		pleiotrophin							305.0	278.0	287.0					7																	136936041		2203	4300	6503	SO:0001589	frameshift_variant	5764				nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity	g.chr7:136936041delG	M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.387delC	7.37:g.136936041delG	ENSP00000341170:p.Ala129fs		Somatic				PTN_uc010lmx.2_Frame_Shift_Del_p.A129fs|PTN_uc003vtr.1_Frame_Shift_Del_p.A129fs	p.A129fs	NM_002825	NP_002816	WXS	Illumina HiSeq	Unspecified	P21246	PTN_HUMAN			4	750	-			129					Q5U0B0|Q6ICQ5|Q9UCC6	Frame_Shift_Del	DEL	ENST00000348225.2	37	c.387delC	CCDS5844.1																																																																																				0.507	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825		65	303	NA	NA	NA	NA	NA	65	303	---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52370103	52370103	+	Frame_Shift_Del	DEL	C	C	-			TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr8:52370103delC	ENST00000356297.4	-	9	1037	c.937delG	c.(937-939)gaafs	p.E313fs	PXDNL_ENST00000543296.1_Frame_Shift_Del_p.E313fs	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	313	Ig-like C2-type 1.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTCTTGGCTTCCCCAGCGGAA	0.428																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(937-939)GAAfs		peroxidasin homolog-like precursor							129.0	126.0	127.0					8																	52370103		1930	4148	6078	SO:0001589	frameshift_variant	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52370103delC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.937delG	8.37:g.52370103delC	ENSP00000348645:p.Glu313fs		Somatic					p.E313fs	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			9	1038	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	313			Ig-like C2-type 1.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Frame_Shift_Del	DEL	ENST00000356297.4	37	c.937delG	CCDS47855.1																																																																																				0.428	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		47	152	NA	NA	NA	NA	NA	47	152	---	---	---	---
ANKRD20A1	84210	broad.mit.edu	37	9	67934791	67934794	+	Frame_Shift_Del	DEL	AAAG	AAAG	-	rs375030402|rs550666541	byFrequency	TCGA-91-6828-01A-11D-1855-08	TCGA-91-6828-10A-01D-1855-08	AAAG	AAAG	-	-	AAAG	AAAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	99f819f2-4340-4303-8ff0-fdb03ef0151a	e202283d-04a1-4fbc-9e8e-8b5abae14385	g.chr9:67934791_67934794delAAAG	ENST00000377477.2	+	4	673_676	c.561_564delAAAG	c.(559-564)aaaaagfs	p.KK187fs	RNU6-368P_ENST00000391117.1_RNA	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	187						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						TTTTATTGAAAAAGAAAGCAAGTT	0.309														73	0.0145767	0.0	0.0086	5008	,	,		20736	0.003		0.0239	False		,,,				2504	0.0409						uc004aeu.2		NA																	0					0						c.(559-564)AAAAGGfs		ankyrin repeat domain 20 family, member A3																																				SO:0001589	frameshift_variant	441425							g.chr9:67934791_67934794delAAAG	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.561_564delAAAG	9.37:g.67934795_67934798delAAAG	ENSP00000366697:p.Lys187fs		Somatic				ANKRD20A3_uc010mnn.2_Frame_Shift_Del_p.K187fs	p.K187fs	NM_001012419	NP_001012419	WXS	Illumina HiSeq	Unspecified	Q5VUR7	A20A3_HUMAN			4	673_676	+			187_188			ANK 4.		Q9H0H6	Frame_Shift_Del	DEL	ENST00000377477.2	37	c.561_564delAAAG	CCDS6620.1																																																																																				0.309	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083800.1			2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
