#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF11	440560	broad.mit.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	C	G	rs199623827	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:12885059C>G	ENST00000535591.1	-	4	1247	c.1052G>C	c.(1051-1053)tGc>tCc	p.C351S	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	351					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.C351S(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GGTGGCCATGCAGATGGGATT	0.532													.|||	21	0.00419329	0.003	0.0072	5008	,	,		19682	0.001		0.0089	False		,,,				2504	0.002						uc001auk.2		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(1051-1053)TGC>TCC		PRAME family member 11							36.0	29.0	31.0					1																	12885059		692	1579	2271	SO:0001583	missense	440560							g.chr1:12885059C>G	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1052G>C	1.37:g.12885059C>G	ENSP00000439551:p.Cys351Ser		Somatic					p.C351S	NM_001146344	NP_001139816	WXS	Illumina HiSeq	Unspecified	O60813	PRA11_HUMAN			4	1248	-			351			LRR 6.			Missense_Mutation	SNP	ENST00000535591.1	37	c.1052G>C	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.316351	0.00235	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.06371	3.31;3.31	1.52	1.52	0.23074	.	0.067349	0.64402	N	0.000012	T	0.00608	0.0020	N	0.00003	-3.455	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	10	0.02654	T	1	.	5.7253	0.18010	0.0:0.3438:0.6562:0.0	.	351	O60813	PRA11_HUMAN	S	351;392;351	ENSP00000439551:C351S;ENSP00000391839:C351S	ENSP00000328783:C392S	C	-	2	0	PRAMEF11	12807646	0.578000	0.26717	0.014000	0.15608	0.005000	0.04900	0.846000	0.27682	0.208000	0.20626	-0.483000	0.04790	TGC		0.532	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		6	364	0	0	0	0.00307968	0	6	364				
AKR7A2	8574	broad.mit.edu	37	1	19633532	19633532	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:19633532A>G	ENST00000235835.3	-	5	773	c.752T>C	c.(751-753)tTc>tCc	p.F251S	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	251					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ATTCCCAAAGAAGCGGCCCAC	0.597																																							uc001bbw.2		NA																	0				central_nervous_system(1)	1						c.(751-753)TTC>TCC		aldo-keto reductase family 7, member A2							100.0	108.0	105.0					1																	19633532		2203	4300	6503	SO:0001583	missense	8574				carbohydrate metabolic process|cellular aldehyde metabolic process	Golgi apparatus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity	g.chr1:19633532A>G	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.752T>C	1.37:g.19633532A>G	ENSP00000235835:p.Phe251Ser		Somatic				AKR7A2_uc001bbx.2_Missense_Mutation_p.F216S	p.F251S	NM_003689	NP_003680	WXS	Illumina HiSeq	Unspecified	O43488	ARK72_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	5	774	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	251					O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	37	c.752T>C	CCDS194.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770491	0.90108	.	.	ENSG00000053371	ENST00000235835;ENST00000330072	T;T	0.04156	3.69;3.69	5.17	5.17	0.71159	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	M	0.83223	2.63	0.58432	D	0.999998	D	0.71674	0.998	D	0.83275	0.996	T	0.00995	-1.1487	10	0.66056	D	0.02	.	14.1287	0.65238	1.0:0.0:0.0:0.0	.	251	O43488	ARK72_HUMAN	S	251;206	ENSP00000235835:F251S;ENSP00000339084:F206S	ENSP00000235835:F251S	F	-	2	0	AKR7A2	19506119	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.871000	0.92346	2.064000	0.61679	0.533000	0.62120	TTC		0.597	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689		24	173	0	0	0	0.000720815	0	24	173				
GRHL3	57822	broad.mit.edu	37	1	24668675	24668675	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:24668675A>G	ENST00000350501.5	+	9	1245	c.1118A>G	c.(1117-1119)aAc>aGc	p.N373S	GRHL3_ENST00000236255.4_Missense_Mutation_p.N378S|GRHL3_ENST00000342072.4_Missense_Mutation_p.N280S|GRHL3_ENST00000361548.4_Missense_Mutation_p.N373S|GRHL3_ENST00000356046.2_Missense_Mutation_p.N327S	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	373					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		GTCCCCCTGAACCTGCAGATT	0.562																																							uc001biy.2		NA																	0				ovary(1)	1						c.(1132-1134)AAC>AGC		sister-of-mammalian grainyhead protein isoform							102.0	102.0	102.0					1																	24668675		2203	4300	6503	SO:0001583	missense	57822				regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr1:24668675A>G	AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.1118A>G	1.37:g.24668675A>G	ENSP00000288955:p.Asn373Ser		Somatic				GRHL3_uc001bix.2_Missense_Mutation_p.N373S|GRHL3_uc001biz.2_Missense_Mutation_p.N280S	p.N378S	NM_021180	NP_067003	WXS	Illumina HiSeq	Unspecified	Q8TE85	GRHL3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)	9	1179	+		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)	373					A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Missense_Mutation	SNP	ENST00000350501.5	37	c.1133A>G	CCDS252.2	.	.	.	.	.	.	.	.	.	.	A	14.01	2.408314	0.42715	.	.	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29	5.65	5.65	0.86999	.	0.178584	0.64402	D	0.000016	T	0.23249	0.0562	M	0.69823	2.125	0.52501	D	0.999952	B;B;B	0.26744	0.025;0.158;0.158	B;B;B	0.21546	0.019;0.035;0.035	T	0.01988	-1.1234	10	0.62326	D	0.03	-37.3422	15.2098	0.73214	1.0:0.0:0.0:0.0	.	327;378;373	A2A297;Q8TE85-2;G3XAF0	.;.;.	S	373;280;373;327;378	ENSP00000354943:N373S;ENSP00000340543:N280S;ENSP00000288955:N373S;ENSP00000348333:N327S;ENSP00000236255:N378S	ENSP00000236255:N378S	N	+	2	0	GRHL3	24541262	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.138000	0.58017	2.371000	0.80710	0.533000	0.62120	AAC		0.562	GRHL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000009047.2	NM_021180		14	154	0	0	0	0.00316338	0	14	154				
EPHA10	284656	broad.mit.edu	37	1	38227383	38227383	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:38227383G>A	ENST00000373048.4	-	3	543	c.544C>T	c.(544-546)Ccg>Tcg	p.P182S	EPHA10_ENST00000319637.6_Missense_Mutation_p.P182S|EPHA10_ENST00000427468.2_Missense_Mutation_p.P182S	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	182	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGCTGAGCGGTCCGATCTCG	0.657																																							uc009vvi.2		NA																	0				breast(4)|stomach(3)|lung(1)	8						c.(544-546)CCG>TCG		EPH receptor A10 isofom 3							35.0	43.0	40.0					1																	38227383		2196	4298	6494	SO:0001583	missense	284656					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity	g.chr1:38227383G>A	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.544C>T	1.37:g.38227383G>A	ENSP00000362139:p.Pro182Ser		Somatic				EPHA10_uc001cbw.3_Missense_Mutation_p.P182S	p.P182S	NM_001099439	NP_001092909	WXS	Illumina HiSeq	Unspecified	Q5JZY3	EPHAA_HUMAN			3	630	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	182			Extracellular (Potential).		A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	c.544C>T	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256046	0.80246	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.10288	2.89;2.89;2.89	4.75	4.75	0.60458	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.41294	D	0.000913	T	0.40473	0.1118	M	0.91354	3.2	0.80722	D	1	D;D	0.76494	0.999;0.99	D;P	0.63793	0.918;0.854	T	0.53056	-0.8492	10	0.87932	D	0	.	17.2504	0.87041	0.0:0.0:1.0:0.0	.	182;182	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	S	182	ENSP00000397746:P182S;ENSP00000362139:P182S;ENSP00000316395:P182S	ENSP00000316395:P182S	P	-	1	0	EPHA10	37999970	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.664000	0.83830	2.598000	0.87819	0.643000	0.83706	CCG		0.657	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641		42	38	0	0	0	0.00361006	0	42	38				
KANK4	163782	broad.mit.edu	37	1	62740052	62740052	+	Missense_Mutation	SNP	G	G	T	rs375360104		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:62740052G>T	ENST00000371153.4	-	3	1102	c.724C>A	c.(724-726)Cca>Aca	p.P242T	KANK4_ENST00000371150.1_5'Flank|KANK4_ENST00000354381.3_Intron	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	242	Pro-rich.					cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGGTGATTTGGAACCTTCACC	0.542																																							uc001dah.3		NA																	0				ovary(3)|skin(2)|lung(1)	6						c.(724-726)CCA>ACA		ankyrin repeat domain 38							49.0	45.0	46.0					1																	62740052		2203	4300	6503	SO:0001583	missense	163782							g.chr1:62740052G>T	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.724C>A	1.37:g.62740052G>T	ENSP00000360195:p.Pro242Thr		Somatic				KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	p.P242T	NM_181712	NP_859063	WXS	Illumina HiSeq	Unspecified	Q5T7N3	KANK4_HUMAN			3	1101	-			242			Pro-rich.		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.724C>A	CCDS620.1	.	.	.	.	.	.	.	.	.	.	G	1.892	-0.455342	0.04540	.	.	ENSG00000132854	ENST00000371153	T	0.47177	0.85	4.88	-5.49	0.02584	.	1.462960	0.04617	N	0.401220	T	0.32285	0.0824	L	0.40543	1.245	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.44682	-0.9312	10	0.02654	T	1	6.8153	10.8981	0.47034	0.1317:0.6516:0.1283:0.0884	.	242	Q5T7N3	KANK4_HUMAN	T	242	ENSP00000360195:P242T	ENSP00000360195:P242T	P	-	1	0	KANK4	62512640	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.235000	0.09016	-1.446000	0.01945	-0.300000	0.09419	CCA		0.542	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		17	49	1	0	1.45105e-14	0.00074312	6.44537e-14	17	49				
CHIA	27159	broad.mit.edu	37	1	111857983	111857983	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:111857983G>T	ENST00000369740.1	+	6	509	c.406G>T	c.(406-408)Gac>Tac	p.D136Y	RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Intron|CHIA_ENST00000430615.1_Missense_Mutation_p.D28Y|CHIA_ENST00000343320.6_Missense_Mutation_p.D136Y|CHIA_ENST00000451398.2_5'UTR|CHIA_ENST00000353665.6_Intron	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	136					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TGACGGGCTGGACTTTGACTG	0.542																																							uc001eas.2		NA																	0				ovary(1)	1						c.(406-408)GAC>TAC		acidic chitinase isoform c							90.0	85.0	87.0					1																	111857983		2203	4300	6503	SO:0001583	missense	27159				apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding	g.chr1:111857983G>T	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.406G>T	1.37:g.111857983G>T	ENSP00000358755:p.Asp136Tyr		Somatic				CHIA_uc001ear.2_Missense_Mutation_p.D28Y|CHIA_uc001eaq.2_Missense_Mutation_p.D28Y|CHIA_uc009wgc.2_Missense_Mutation_p.D28Y|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_5'UTR|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	p.D136Y	NM_201653	NP_970615	WXS	Illumina HiSeq	Unspecified	Q9BZP6	CHIA_HUMAN		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)	6	509	+		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)	136					Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	ENST00000369740.1	37	c.406G>T	CCDS41368.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931278	0.73327	.	.	ENSG00000134216	ENST00000422815;ENST00000369740;ENST00000343320;ENST00000430615	T;T;T;T	0.21031	2.03;2.03;2.03;2.03	4.72	3.79	0.43588	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000002	T	0.55513	0.1925	H	0.99555	4.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71424	-0.4597	10	0.87932	D	0	-28.8778	10.1387	0.42723	0.1022:0.0:0.8978:0.0	.	136	Q9BZP6	CHIA_HUMAN	Y	80;136;136;28	ENSP00000387671:D80Y;ENSP00000358755:D136Y;ENSP00000341828:D136Y;ENSP00000391132:D28Y	ENSP00000341828:D136Y	D	+	1	0	CHIA	111659506	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.767000	0.74975	1.077000	0.40990	0.655000	0.94253	GAC		0.542	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1			69	83	1	0	4.46356e-37	0.00361006	2.02986e-36	69	83				
NUDT17	200035	broad.mit.edu	37	1	145586632	145586633	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:145586632_145586633CA>AT	ENST00000334513.5	-	8	954_955	c.943_944TG>AT	c.(943-945)TGg>ATg	p.W315M	NUDT17_ENST00000444015.2_5'Flank	NM_001012758.2	NP_001012776.1	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 17	315							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(2)	9	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTCCATGTTCCATTCTTCCTTT	0.52																																							uc001eoe.2		NA																	0					0						c.(943-945)TGG>ATG		nudix (nucleoside diphosphate linked moiety																																				SO:0001583	missense	200035						hydrolase activity|metal ion binding	g.chr1:145586632_145586633CA>AT	BC046352	CCDS72865.1	1q21.1	2008-02-05			ENSG00000186364	ENSG00000186364		"""Nudix motif containing"""	26618	protein-coding gene	gene with protein product						12477932	Standard	NM_001012758		Approved	FLJ34433	uc001eoe.3	P0C025	OTTHUMG00000013752	ENST00000334513.5:c.943_944delinsAT	1.37:g.145586632_145586633delinsAT	ENSP00000334437:p.Trp315Met		Somatic				NBPF10_uc001emp.3_Intron	p.W315M	NM_001012758	NP_001012776	WXS	Illumina HiSeq	Unspecified	P0C025	NUD17_HUMAN			8	951_952	-	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		315						Missense_Mutation	DNP	ENST00000334513.5	37	c.943_944TG>AT	CCDS30830.1																																																																																				0.520	NUDT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038541.3	XM_496395		9	113	0	0	0	6.4e-05	0	9	113				
ASH1L	55870	broad.mit.edu	37	1	155349869	155349869	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:155349869G>A	ENST00000368346.3	-	8	6796	c.6157C>T	c.(6157-6159)Cct>Tct	p.P2053S	ASH1L_ENST00000392403.3_Missense_Mutation_p.P2048S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2053					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATATCATAAGGAAGCTGGAAG	0.368																																							uc009wqq.2		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(6157-6159)CCT>TCT		absent, small, or homeotic 1-like							108.0	109.0	109.0					1																	155349869		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155349869G>A	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.6157C>T	1.37:g.155349869G>A	ENSP00000357330:p.Pro2053Ser		Somatic				RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.P2048S	p.P2053S	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		8	6637	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		2053					Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.6157C>T		.	.	.	.	.	.	.	.	.	.	G	24.4	4.522401	0.85600	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.93189	-3.14;-3.18	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.93618	0.7962	M	0.81112	2.525	0.80722	D	1	P;P	0.39665	0.554;0.682	B;B	0.43508	0.242;0.422	D	0.94144	0.7399	10	0.72032	D	0.01	.	18.1363	0.89620	0.0:0.0:1.0:0.0	.	2053;2048	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	2053;2048	ENSP00000357330:P2053S;ENSP00000376204:P2048S	ENSP00000357330:P2053S	P	-	1	0	ASH1L	153616493	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.687000	0.84139	2.826000	0.97356	0.561000	0.74099	CCT		0.368	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		30	95	0	0	0	0.00283554	0	30	95				
CD1B	910	broad.mit.edu	37	1	158299774	158299774	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:158299774C>G	ENST00000368168.3	-	3	582	c.475G>C	c.(475-477)Gca>Cca	p.A159P		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	159					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					AATTTCTGTGCCCTGCTGCCA	0.483																																							uc001frx.2		NA																	0				ovary(2)	2						c.(475-477)GCA>CCA		CD1B antigen precursor							132.0	127.0	129.0					1																	158299774		2203	4300	6503	SO:0001583	missense	910				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding	g.chr1:158299774C>G	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.475G>C	1.37:g.158299774C>G	ENSP00000357150:p.Ala159Pro		Somatic				CD1B_uc001frw.2_Missense_Mutation_p.A52P	p.A159P	NM_001764	NP_001755	WXS	Illumina HiSeq	Unspecified	P29016	CD1B_HUMAN			3	583	-	all_hematologic(112;0.0378)		159			Extracellular (Potential).		Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	37	c.475G>C	CCDS1176.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.80|17.80	3.477876|3.477876	0.63849|0.63849	.|.	.|.	ENSG00000158485|ENSG00000158485	ENST00000368168|ENST00000451207	T|.	0.19669|.	2.13|.	4.46|4.46	4.46|4.46	0.54185|0.54185	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.150029|.	0.31392|.	N|.	0.007729|.	T|T	0.65365|0.65365	0.2684|0.2684	M|M	0.91300|0.91300	3.195|3.195	0.09310|0.09310	N|N	0.999994|0.999994	D;D|.	0.89917|.	0.995;1.0|.	D;D|.	0.74674|.	0.94;0.984|.	T|T	0.60929|0.60929	-0.7165|-0.7165	10|5	0.87932|.	D|.	0|.	-17.7828|-17.7828	12.8005|12.8005	0.57584|0.57584	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	159;159|.	P29016;P29016-2|.	CD1B_HUMAN;.|.	P|A	159|126	ENSP00000357150:A159P|.	ENSP00000357150:A159P|.	A|G	-|-	1|2	0|0	CD1B|CD1B	156566398|156566398	0.003000|0.003000	0.15002|0.15002	0.080000|0.080000	0.20451|0.20451	0.169000|0.169000	0.22640|0.22640	0.433000|0.433000	0.21477|0.21477	2.472000|2.472000	0.83506|0.83506	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.483	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764		4	260	0	0	0	0.000602214	0	4	260				
LAMB3	3914	broad.mit.edu	37	1	209807939	209807939	+	Silent	SNP	G	G	A	rs201554705		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:209807939G>A	ENST00000356082.4	-	6	551	c.417C>T	c.(415-417)ttC>ttT	p.F139F	LAMB3_ENST00000391911.1_Silent_p.F139F|LAMB3_ENST00000367030.3_Silent_p.F139F	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	139	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		AGGTCTTACCGAAGTCTGAGG	0.667																																							uc001hhg.2		NA																	0				central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(415-417)TTC>TTT		laminin, beta 3 precursor							56.0	47.0	50.0					1																	209807939		2203	4300	6503	SO:0001819	synonymous_variant	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209807939G>A	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.417C>T	1.37:g.209807939G>A			Somatic				LAMB3_uc009xco.2_Silent_p.F139F|LAMB3_uc001hhh.2_Silent_p.F139F|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Intron	p.F139F	NM_001017402	NP_001017402	WXS	Illumina HiSeq	Unspecified	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	5	807	-			139			Laminin N-terminal.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Silent	SNP	ENST00000356082.4	37	c.417C>T	CCDS1487.1																																																																																				0.667	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228		7	30	0	0	0	0.00198382	0	7	30				
FAM71A	149647	broad.mit.edu	37	1	212798521	212798521	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:212798521A>C	ENST00000294829.3	+	1	733	c.302A>C	c.(301-303)cAt>cCt	p.H101P	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	101						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		TATGCTGGACATGGCCAGGCC	0.557																																							uc001hjk.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(301-303)CAT>CCT		hypothetical protein LOC149647							61.0	60.0	60.0					1																	212798521		2203	4300	6503	SO:0001583	missense	149647							g.chr1:212798521A>C		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.302A>C	1.37:g.212798521A>C	ENSP00000294829:p.His101Pro		Somatic				uc010pth.1_Intron	p.H101P	NM_153606	NP_705834	WXS	Illumina HiSeq	Unspecified	Q8IYT1	FA71A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)	1	706	+			101					Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	c.302A>C	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	A	2.483	-0.319166	0.05386	.	.	ENSG00000162771	ENST00000294829	T	0.03772	3.81	3.88	-6.41	0.01938	.	2.460560	0.01647	N	0.024357	T	0.02119	0.0066	N	0.11560	0.145	0.09310	N	1	P	0.45126	0.851	B	0.32724	0.151	T	0.42344	-0.9457	10	0.27082	T	0.32	-0.5284	7.1371	0.25535	0.6429:0.0:0.226:0.1312	.	101	Q8IYT1	FA71A_HUMAN	P	101	ENSP00000294829:H101P	ENSP00000294829:H101P	H	+	2	0	FAM71A	210865144	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.087000	0.14958	-1.359000	0.02174	-0.379000	0.06801	CAT		0.557	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606		32	82	0	0	0	0.00178596	0	32	82				
RYR2	6262	broad.mit.edu	37	1	237947335	237947335	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr1:237947335A>G	ENST00000366574.2	+	90	12640	c.12323A>G	c.(12322-12324)cAc>cGc	p.H4108R	RYR2_ENST00000542537.1_Missense_Mutation_p.H4092R|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.H4114R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4108					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCTCTGAGCACATGCCCAAC	0.512																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12322-12324)CAC>CGC		cardiac muscle ryanodine receptor							56.0	55.0	55.0					1																	237947335		1980	4187	6167	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947335A>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12323A>G	1.37:g.237947335A>G	ENSP00000355533:p.His4108Arg		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.H523R	p.H4108R	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12443	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4108					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12323A>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198598	0.79015	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.99282	-5.68;-5.68;-5.68	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000002	D	0.99312	0.9759	M	0.74647	2.275	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.81914	0.989;0.995	D	0.99253	1.0888	10	0.87932	D	0	.	15.806	0.78513	1.0:0.0:0.0:0.0	.	1082;4108	B4DGV4;Q92736	.;RYR2_HUMAN	R	4108;4114;4092;1082	ENSP00000355533:H4108R;ENSP00000353174:H4114R;ENSP00000443798:H4092R	ENSP00000353174:H4114R	H	+	2	0	RYR2	236013958	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.287000	0.95975	2.142000	0.66516	0.459000	0.35465	CAC		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		9	63	0	0	0	0.000442599	0	9	63				
NODAL	4838	broad.mit.edu	37	10	72195117	72195117	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr10:72195117G>A	ENST00000287139.3	-	2	815	c.816C>T	c.(814-816)aaC>aaT	p.N272N	AC022532.1_ENST00000420338.2_Missense_Mutation_p.V22I	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	272					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						AGCGATAGGCGTTGTACTGCT	0.557																																							uc001jrc.2		NA																	0				large_intestine(1)|kidney(1)	2						c.(814-816)AAC>AAT		nodal precursor							96.0	76.0	83.0					10																	72195117		2203	4300	6503	SO:0001819	synonymous_variant	4838				growth	extracellular space	cytokine activity|growth factor activity	g.chr10:72195117G>A	BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.816C>T	10.37:g.72195117G>A			Somatic					p.N272N	NM_018055	NP_060525	WXS	Illumina HiSeq	Unspecified	Q96S42	NODAL_HUMAN			2	858	-			272					Q2M3A5|Q8N4V3	Silent	SNP	ENST00000287139.3	37	c.816C>T	CCDS7304.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285395	0.40394	.	.	ENSG00000197604	ENST00000420338	.	.	.	5.88	-9.11	0.00711	.	.	.	.	.	T	0.54743	0.1877	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68610	-0.5363	5	0.87932	D	0	.	7.3737	0.26817	0.3409:0.0858:0.4889:0.0845	.	.	.	.	I	22	.	ENSP00000411125:V22I	V	+	1	0	AC022532.1	71865123	0.059000	0.20769	0.937000	0.37676	0.907000	0.53573	-0.667000	0.05274	-0.985000	0.03503	-1.202000	0.01658	GTT		0.557	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048511.1	NM_018055		27	13	0	0	0	0.000878237	0	27	13				
C10orf55	414236	broad.mit.edu	37	10	75673358	75673358	+	Intron	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr10:75673358G>A	ENST00000409178.1	-	3	268				PLAU_ENST00000446342.1_Silent_p.R157R|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372762.4_Silent_p.R138R|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372764.3_Silent_p.R174R	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					AGACTCTGAGGCCCCGCTTTA	0.532																																							uc001jwa.2		NA																	0				ovary(2)|kidney(1)	3						c.(520-522)AGG>AGA		plasminogen activator, urokinase isoform 1	Amiloride(DB00594)|Urokinase(DB00013)						142.0	169.0	160.0					10																	75673358		2203	4300	6503	SO:0001627	intron_variant	5328				blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity	g.chr10:75673358G>A		CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-525C>T	10.37:g.75673358G>A			Somatic				C10orf55_uc001jvz.1_Intron|PLAU_uc010qkw.1_Silent_p.R157R|PLAU_uc010qkx.1_Silent_p.R88R|PLAU_uc001jwb.2_RNA|PLAU_uc001jwc.2_Silent_p.R174R|PLAU_uc009xrq.1_Silent_p.R138R	p.R174R	NM_002658	NP_002649	WXS	Illumina HiSeq	Unspecified	P00749	UROK_HUMAN			7	668	+	Prostate(51;0.0112)		174			Connecting peptide.		Q3KRG4|Q8NAK4	Silent	SNP	ENST00000409178.1	37	c.522G>A	CCDS53541.1																																																																																				0.532	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791		41	275	0	0	0	0.00195071	0	41	275				
MAT1A	4143	broad.mit.edu	37	10	82049168	82049168	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr10:82049168C>T	ENST00000372213.3	-	1	272	c.12G>A	c.(10-12)ccG>ccA	p.P4P		NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	4					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AGCCATCCACCGGTCCATTCA	0.468																																							uc001kbw.2		NA																	0					0						c.(10-12)CCG>CCA		methionine adenosyltransferase I, alpha	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)						169.0	151.0	158.0					10																	82049168		2203	4300	6503	SO:0001819	synonymous_variant	4143				methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity	g.chr10:82049168C>T		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.12G>A	10.37:g.82049168C>T			Somatic					p.P4P	NM_000429	NP_000420	WXS	Illumina HiSeq	Unspecified	Q00266	METK1_HUMAN	Colorectal(32;0.229)		1	267	-			4					D3DWD5|Q5QP09	Silent	SNP	ENST00000372213.3	37	c.12G>A	CCDS7365.1																																																																																				0.468	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429		31	70	0	0	0	0.00209593	0	31	70				
LRRC27	80313	broad.mit.edu	37	10	134179056	134179056	+	Splice_Site	SNP	T	T	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr10:134179056T>G	ENST00000368614.3	+	10	1521		c.e10+2		LRRC27_ENST00000368613.4_Splice_Site|LRRC27_ENST00000368610.3_Splice_Site|LRRC27_ENST00000475747.1_Splice_Site|LRRC27_ENST00000392638.2_Splice_Site|LRRC27_ENST00000368612.1_Splice_Site|LRRC27_ENST00000432555.2_Splice_Site	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27											breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CTGGAAATTGTAAGGATTTCT	0.438																																							uc010quw.1		NA																	0				ovary(1)	1						c.e10+2		leucine rich repeat containing 27 isoform a							47.0	45.0	45.0					10																	134179056		2202	4297	6499	SO:0001630	splice_region_variant	80313							g.chr10:134179056T>G	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.1416+2T>G	10.37:g.134179056T>G			Somatic				LRRC27_uc001llg.2_Splice_Site|LRRC27_uc001lli.2_Splice_Site_p.I472_splice|LRRC27_uc001llj.2_Splice_Site_p.I410_splice|LRRC27_uc001llk.3_Splice_Site_p.I345_splice	p.I472_splice	NM_030626	NP_085129	WXS	Illumina HiSeq	Unspecified	Q9C0I9	LRC27_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)	10	1611	+		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)						A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Splice_Site	SNP	ENST00000368614.3	37	c.1416_splice	CCDS31316.1	.	.	.	.	.	.	.	.	.	.	T	1.303	-0.604223	0.03717	.	.	ENSG00000148814	ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610;ENST00000432555	.	.	.	2.6	0.177	0.15054	.	.	.	.	.	.	.	.	.	.	.	0.22787	N	0.998735	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.9375	0.05819	0.0:0.15:0.2616:0.5884	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC27	134029046	0.096000	0.21769	0.002000	0.10522	0.006000	0.05464	0.447000	0.21710	0.017000	0.15025	-0.742000	0.03525	.		0.438	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462	Intron	6	48	0	0	0	0.00116845	0	6	48				
OR52E6	390078	broad.mit.edu	37	11	5862730	5862730	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:5862730C>T	ENST00000329322.5	-	1	397	c.398G>A	c.(397-399)tGg>tAg	p.W133*	OR52E6_ENST00000379946.2_Nonsense_Mutation_p.W137*|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	133			W -> R (in dbSNP:rs10838719).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATGGTGTACCAAAGAGGTTT	0.468																																							uc010qzq.1		NA																	0				central_nervous_system(1)	1						c.(397-399)TGG>TAG		olfactory receptor, family 52, subfamily E,							207.0	188.0	194.0					11																	5862730		2201	4296	6497	SO:0001587	stop_gained	390078				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5862730C>T	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.398G>A	11.37:g.5862730C>T	ENSP00000328878:p.Trp133*		Somatic				TRIM5_uc001mbq.1_Intron	p.W133*	NM_001005167	NP_001005167	WXS	Illumina HiSeq	Unspecified	Q96RD3	O52E6_HUMAN		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	398	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	133			Cytoplasmic (Potential).		Q6IFF8	Nonsense_Mutation	SNP	ENST00000329322.5	37	c.398G>A	CCDS53597.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829265	0.50845	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	.	.	.	3.45	-1.02	0.10135	.	1.171350	0.06439	N	0.725641	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	4.5194	0.11952	0.1508:0.5563:0.0:0.2929	.	.	.	.	X	133;137	.	ENSP00000328878:W133X	W	-	2	0	OR52E6	5819306	0.000000	0.05858	0.000000	0.03702	0.880000	0.50808	-0.675000	0.05227	-0.121000	0.11787	-0.234000	0.12200	TGG		0.468	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167		53	216	0	0	0	0.00361006	0	53	216				
KCNC1	3746	broad.mit.edu	37	11	17757771	17757771	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:17757771C>T	ENST00000379472.3	+	1	252	c.222C>T	c.(220-222)ggC>ggT	p.G74G	KCNC1_ENST00000265969.6_Silent_p.G74G	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	74					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	ACCGCACGGGCAAGCTGCACT	0.652																																							uc001mnk.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(220-222)GGC>GGT		Shaw-related voltage-gated potassium channel							49.0	46.0	47.0					11																	17757771		2200	4293	6493	SO:0001819	synonymous_variant	3746					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:17757771C>T	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.222C>T	11.37:g.17757771C>T			Somatic				KCNC1_uc009yhc.1_Silent_p.G74G	p.G74G	NM_004976	NP_004967	WXS	Illumina HiSeq	Unspecified	P48547	KCNC1_HUMAN			1	277	+			74			Cytoplasmic (Potential).		K4DI87	Silent	SNP	ENST00000379472.3	37	c.222C>T	CCDS7827.1																																																																																				0.652	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976		5	75	0	0	0	0.000602214	0	5	75				
OR8H3	390152	broad.mit.edu	37	11	55890553	55890553	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:55890553G>C	ENST00000313472.3	+	1	705	c.705G>C	c.(703-705)caG>caC	p.Q235H		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					CAGGAAAGCAGAAAGCTTTCT	0.413																																							uc001nii.1		NA																	0				ovary(2)	2						c.(703-705)CAG>CAC		olfactory receptor, family 8, subfamily H,							129.0	122.0	125.0					11																	55890553		2201	4294	6495	SO:0001583	missense	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890553G>C	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.705G>C	11.37:g.55890553G>C	ENSP00000323928:p.Gln235His		Somatic					p.Q235H	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	705	+	Esophageal squamous(21;0.00693)		235			Cytoplasmic (Potential).		Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	c.705G>C	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	G	0.686	-0.796254	0.02862	.	.	ENSG00000181761	ENST00000313472	T	0.00028	8.92	3.62	-7.23	0.01480	GPCR, rhodopsin-like superfamily (1);	1.116660	0.06758	N	0.781309	T	0.00073	0.0002	N	0.17800	0.525	0.19575	N	0.999963	B	0.14012	0.009	B	0.18561	0.022	T	0.02751	-1.1115	10	0.16896	T	0.51	.	5.0053	0.14284	0.1733:0.5469:0.1872:0.0927	.	235	Q8N146	OR8H3_HUMAN	H	235	ENSP00000323928:Q235H	ENSP00000323928:Q235H	Q	+	3	2	OR8H3	55647129	0.000000	0.05858	0.761000	0.31378	0.386000	0.30323	-3.687000	0.00393	-1.479000	0.01867	0.173000	0.16961	CAG		0.413	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		38	112	0	0	0	0.00111076	0	38	112				
TNKS1BP1	85456	broad.mit.edu	37	11	57080491	57080491	+	Silent	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:57080491A>G	ENST00000532437.1	-	4	1982	c.1671T>C	c.(1669-1671)gaT>gaC	p.D557D	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Silent_p.D557D			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	557	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GACTCTCCCCATCGCCCTTCT	0.592																																							uc001njr.2		NA																	0				skin(1)	1						c.(1669-1671)GAT>GAC		tankyrase 1-binding protein 1							75.0	68.0	70.0					11																	57080491		2201	4296	6497	SO:0001819	synonymous_variant	85456				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding	g.chr11:57080491A>G	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1671T>C	11.37:g.57080491A>G			Somatic				TNKS1BP1_uc001njs.2_Silent_p.D557D|TNKS1BP1_uc009ymd.1_Silent_p.D8D	p.D557D	NM_033396	NP_203754	WXS	Illumina HiSeq	Unspecified	Q9C0C2	TB182_HUMAN			4	1983	-		all_epithelial(135;0.21)	557			Pro-rich.|Acidic.		A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	c.1671T>C	CCDS7951.1																																																																																				0.592	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		12	37	0	0	0	0.00185496	0	12	37				
OR4D6	219983	broad.mit.edu	37	11	59225216	59225216	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:59225216C>T	ENST00000300127.2	+	1	806	c.783C>T	c.(781-783)ccC>ccT	p.P261P		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						ACTGCCGGCCCTTCATGACGC	0.527																																							uc010rku.1		NA																	0				ovary(1)	1						c.(781-783)CCC>CCT		olfactory receptor, family 4, subfamily D,							114.0	108.0	110.0					11																	59225216		2201	4295	6496	SO:0001819	synonymous_variant	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59225216C>T	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.783C>T	11.37:g.59225216C>T			Somatic					p.P261P	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	783	+			261			Extracellular (Potential).		B2RNP7|Q6IFF5|Q96R74	Silent	SNP	ENST00000300127.2	37	c.783C>T	CCDS31562.1																																																																																				0.527	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		47	97	0	0	0	0.00361006	0	47	97				
AHNAK	79026	broad.mit.edu	37	11	62288527	62288527	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:62288527G>A	ENST00000378024.4	-	5	13636	c.13362C>T	c.(13360-13362)atC>atT	p.I4454I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4454					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGAGCTTTGATGTTCATCT	0.443																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(13360-13362)ATC>ATT		AHNAK nucleoprotein isoform 1							117.0	126.0	123.0					11																	62288527		2202	4299	6501	SO:0001819	synonymous_variant	79026				nervous system development	nucleus	protein binding	g.chr11:62288527G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13362C>T	11.37:g.62288527G>A			Somatic				AHNAK_uc001ntk.1_Intron	p.I4454I	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	13662	-		Melanoma(852;0.155)	4454					A1A586	Silent	SNP	ENST00000378024.4	37	c.13362C>T	CCDS31584.1																																																																																				0.443	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		16	232	0	0	0	0.00400662	0	16	232				
SCN2B	6327	broad.mit.edu	37	11	118047142	118047142	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:118047142T>A	ENST00000278947.5	-	1	246	c.5A>T	c.(4-6)cAc>cTc	p.H2L		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	2				H -> Q (in Ref. 1; AAC26013). {ECO:0000305}.	cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GGCATCTCTGTGCATTTTCAG	0.522																																							uc001psf.2		NA																	0					0						c.(4-6)CAC>CTC		sodium channel, voltage-gated, type II, beta							131.0	119.0	123.0					11																	118047142		2200	4296	6496	SO:0001583	missense	6327				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr11:118047142T>A	AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.5A>T	11.37:g.118047142T>A	ENSP00000278947:p.His2Leu		Somatic					p.H2L	NM_004588	NP_004579	WXS	Illumina HiSeq	Unspecified	O60939	SCN2B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	1	196	-	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	2	H -> Q (in Ref. 1; AAC26013).				O75302|Q9UNN3	Missense_Mutation	SNP	ENST00000278947.5	37	c.5A>T	CCDS8390.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.749628	0.49257	.	.	ENSG00000149575	ENST00000278947	D	0.96967	-4.19	5.67	4.52	0.55395	.	0.594351	0.17455	N	0.173647	D	0.91229	0.7236	N	0.22421	0.69	0.32299	N	0.565227	B	0.23058	0.079	B	0.21546	0.035	D	0.88909	0.3358	10	0.72032	D	0.01	-11.7965	5.9404	0.19189	0.0:0.0839:0.168:0.7481	.	2	O60939	SCN2B_HUMAN	L	2	ENSP00000278947:H2L	ENSP00000278947:H2L	H	-	2	0	SCN2B	117552352	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.996000	0.29719	0.946000	0.37632	0.482000	0.46254	CAC		0.522	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588		14	87	0	0	0	0.00244969	0	14	87				
VWA5A	4013	broad.mit.edu	37	11	123988563	123988563	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr11:123988563A>C	ENST00000456829.2	+	4	478	c.227A>C	c.(226-228)gAa>gCa	p.E76A	VWA5A_ENST00000449321.1_Missense_Mutation_p.E76A|VWA5A_ENST00000360334.4_Missense_Mutation_p.E76A|VWA5A_ENST00000361352.5_Missense_Mutation_p.E76A|VWA5A_ENST00000392744.4_Missense_Mutation_p.E92A|VWA5A_ENST00000392748.1_Missense_Mutation_p.E76A	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	76	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.									autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						ATTGTAGCAGAATTACAAGAC	0.413																																							uc001pzu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(226-228)GAA>GCA		BCSC-1 isoform 1							95.0	99.0	98.0					11																	123988563		2201	4299	6500	SO:0001583	missense	4013							g.chr11:123988563A>C	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.227A>C	11.37:g.123988563A>C	ENSP00000407726:p.Glu76Ala		Somatic				VWA5A_uc001pzr.2_Missense_Mutation_p.E76A|VWA5A_uc001pzs.2_Missense_Mutation_p.E76A|VWA5A_uc010sae.1_Missense_Mutation_p.E92A|VWA5A_uc001pzt.2_Missense_Mutation_p.E76A	p.E76A	NM_001130142	NP_001123614	WXS	Illumina HiSeq	Unspecified	O00534	VMA5A_HUMAN			4	436	+			76			VIT.		Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	ENST00000456829.2	37	c.227A>C	CCDS8444.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.628657	0.87560	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82	5.6	5.6	0.85130	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	M	0.81497	2.545	0.58432	D	0.999994	P;D	0.56521	0.935;0.976	P;D	0.63192	0.824;0.912	T	0.45948	-0.9226	10	0.18710	T	0.47	-28.121	13.7238	0.62745	1.0:0.0:0.0:0.0	.	92;76	B4DHS6;O00534	.;VMA5A_HUMAN	A	76;76;76;76;76;76;76;92	ENSP00000407726:E76A;ENSP00000353485:E76A;ENSP00000376504:E76A;ENSP00000355070:E76A;ENSP00000404683:E76A;ENSP00000376501:E92A	ENSP00000353485:E76A	E	+	2	0	VWA5A	123493773	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	5.943000	0.70211	2.140000	0.66376	0.533000	0.62120	GAA		0.413	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622		72	38	0	0	0	0.00361006	0	72	38				
Unknown	0	broad.mit.edu	37	12	92000	92000	+	IGR	SNP	A	A	T	rs372724029		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:92000A>T								AC215219.1 (18678 upstream) : AC026369.1 (55051 downstream)																							GGTCCTGGCAACACTCTGGAC	0.572																																							uc010sdi.1		NA																	0					NA						c.(310-312)TTG>ATG		SubName: Full=DEAD/H box polypeptide 11 like 11;																																				SO:0001628	intergenic_variant	0							g.chr12:92000A>T																													12.37:g.92000A>T			Somatic				uc010sdj.1_RNA	p.L104M			WXS	Illumina HiSeq	Unspecified					2	338	-									Missense_Mutation	SNP		37	c.310T>A																																																																																				0	0.572									6	8	0	0	0	0.00307968	0	6	8				
DDX12P	440081	broad.mit.edu	37	12	9574020	9574020	+	IGR	SNP	T	T	C	rs200847155		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:9574020T>C								RP13-735L24.1 (23807 upstream) : SNORA75 (23633 downstream)														p.L672L(1)									ACGTGAATTCTAGCGGCTGGT	0.597																																							uc010sgs.1		NA																	1	Substitution - coding silent(1)		endometrium(1)		0						c.(2014-2016)CTA>CTG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12							53.0	57.0	55.0					12																	9574020		692	1591	2283	SO:0001628	intergenic_variant	440081							g.chr12:9574020T>C																													12.37:g.9574020T>C			Somatic				DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	p.L672L	NM_004400	NP_004391	WXS	Illumina HiSeq	Unspecified					20	2211	-									Silent	SNP		37	c.2016A>G																																																																																				0	0.597									3	59	0	0	0	0.000602214	0	3	59				
CLEC1A	51267	broad.mit.edu	37	12	10233993	10233993	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:10233993G>A	ENST00000315330.4	-	3	296	c.234C>T	c.(232-234)ctC>ctT	p.L78L	CLEC1A_ENST00000420265.2_Intron|RN7SKP161_ENST00000411110.1_RNA|CLEC1A_ENST00000457018.2_Silent_p.L45L	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	78					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						CAGTATTGGAGAGCTGGTAGT	0.383																																							uc001qxb.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(232-234)CTC>CTT		C-type lectin-like receptor-1							103.0	104.0	104.0					12																	10233993		2203	4300	6503	SO:0001819	synonymous_variant	51267				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity	g.chr12:10233993G>A	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.234C>T	12.37:g.10233993G>A			Somatic				CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Silent_p.L35L|CLEC1A_uc010sgx.1_Intron	p.L78L	NM_016511	NP_057595	WXS	Illumina HiSeq	Unspecified	Q8NC01	CLC1A_HUMAN			3	318	-			78			Extracellular (Potential).		Q8IUW7|Q9NZH3	Silent	SNP	ENST00000315330.4	37	c.234C>T	CCDS8612.1																																																																																				0.383	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511		9	48	0	0	0	0.000442599	0	9	48				
ZDHHC17	23390	broad.mit.edu	37	12	77220764	77220764	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:77220764T>C	ENST00000426126.2	+	9	1623	c.974T>C	c.(973-975)aTt>aCt	p.I325T	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.I325T	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	325					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						GACCTAAATATTGATTCTTGG	0.338																																							uc001syk.1		NA																	0					0						c.(973-975)ATT>ACT		huntingtin interacting protein 14							181.0	175.0	177.0					12																	77220764		1827	4079	5906	SO:0001583	missense	23390				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding	g.chr12:77220764T>C	AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.974T>C	12.37:g.77220764T>C	ENSP00000403397:p.Ile325Thr		Somatic				ZDHHC17_uc001syj.2_RNA	p.I325T	NM_015336	NP_056151	WXS	Illumina HiSeq	Unspecified	Q8IUH5	ZDH17_HUMAN			9	1137	+			325			Helical; (Potential).		B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	ENST00000426126.2	37	c.974T>C	CCDS44946.1	.	.	.	.	.	.	.	.	.	.	T	7.959	0.746503	0.15710	.	.	ENSG00000186908	ENST00000426126;ENST00000334822	T;T	0.35605	1.3;1.3	5.73	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.16769	0.0403	N	0.03324	-0.35	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.08411	-1.0723	10	0.22706	T	0.39	-12.3391	12.2458	0.54571	0.127:0.0:0.0:0.873	.	325	Q8IUH5	ZDH17_HUMAN	T	325	ENSP00000403397:I325T;ENSP00000334868:I325T	ENSP00000334868:I325T	I	+	2	0	ZDHHC17	75744895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.203000	0.58453	2.171000	0.68590	0.528000	0.53228	ATT		0.338	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336		5	116	0	0	0	0.00116845	0	5	116				
MED13L	23389	broad.mit.edu	37	12	116446313	116446313	+	Silent	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:116446313A>G	ENST00000281928.3	-	10	2111	c.1905T>C	c.(1903-1905)agT>agC	p.S635S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	635						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GGAGACGATAACTATGCCACC	0.522																																							uc001tvw.2		NA																	0				skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(1903-1905)AGT>AGC		mediator complex subunit 13-like							79.0	67.0	71.0					12																	116446313		2203	4300	6503	SO:0001819	synonymous_variant	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116446313A>G	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.1905T>C	12.37:g.116446313A>G			Somatic					p.S635S	NM_015335	NP_056150	WXS	Illumina HiSeq	Unspecified	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	10	1960	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		635					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	37	c.1905T>C	CCDS9177.1																																																																																				0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			7	34	0	0	0	0.00198382	0	7	34				
CIT	11113	broad.mit.edu	37	12	120306960	120306960	+	Silent	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr12:120306960G>T	ENST00000261833.7	-	3	194	c.142C>A	c.(142-144)Cga>Aga	p.R48R	CIT_ENST00000392521.2_Silent_p.R48R	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	48					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ATCCCTTCTCGGGAAAGAGGA	0.433																																							uc001txi.1		NA																	0				ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(142-144)CGA>AGA		citron							147.0	149.0	148.0					12																	120306960		2203	4300	6503	SO:0001819	synonymous_variant	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120306960G>T	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.142C>A	12.37:g.120306960G>T			Somatic				CIT_uc001txj.1_Silent_p.R48R	p.R48R	NM_007174	NP_009105	WXS	Illumina HiSeq	Unspecified	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	3	195	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	48					Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	c.142C>A	CCDS9192.1																																																																																				0.433	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		6	189	1	0	0.00198382	0.00198382	0.0081779	6	189				
SOHLH2	54937	broad.mit.edu	37	13	36748974	36748974	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr13:36748974C>G	ENST00000379881.3	-	7	762	c.674G>C	c.(673-675)cGt>cCt	p.R225P	SOHLH2_ENST00000554962.1_Missense_Mutation_p.R302P|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.R302P	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	225	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R225H(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CAAGAGAGTACGCAGCTGCTC	0.393																																							uc001uvj.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(673-675)CGT>CCT		spermatogenesis and oogenesis specific basic							78.0	75.0	76.0					13																	36748974		2203	4300	6503	SO:0001583	missense	54937				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding	g.chr13:36748974C>G	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.674G>C	13.37:g.36748974C>G	ENSP00000369210:p.Arg225Pro		Somatic				SOHLH2_uc010tei.1_Missense_Mutation_p.R302P	p.R225P	NM_017826	NP_060296	WXS	Illumina HiSeq	Unspecified	Q9NX45	SOLH2_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)	7	763	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	225			Helix-loop-helix motif.		B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	c.674G>C	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974492	0.53720	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	D;D;D	0.98747	-5.11;-5.11;-5.11	5.11	5.11	0.69529	Helix-loop-helix DNA-binding (5);	0.096082	0.46758	D	0.000265	D	0.99171	0.9713	M	0.88105	2.93	0.39377	D	0.96619	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99869	1.1094	10	0.87932	D	0	-8.7694	14.041	0.64674	0.0:1.0:0.0:0.0	.	302;225	B4DX90;Q9NX45	.;SOLH2_HUMAN	P	225;302;302	ENSP00000369210:R225P;ENSP00000451542:R302P;ENSP00000421868:R302P	ENSP00000421868:R302P	R	-	2	0	CCDC169-SOHLH2;SOHLH2	35646974	0.988000	0.35896	0.942000	0.38095	0.250000	0.25880	3.639000	0.54339	2.392000	0.81423	0.650000	0.86243	CGT		0.393	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826		3	54	0	0	0	6.4e-05	0	3	54				
NEK5	341676	broad.mit.edu	37	13	52686454	52686454	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr13:52686454G>A	ENST00000355568.4	-	5	401	c.262C>T	c.(262-264)Ctc>Ttc	p.L88F		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		CTTTTCATGAGATCCCCTCCA	0.373																																							uc001vge.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(262-264)CTC>TTC		NIMA-related kinase 5							138.0	125.0	130.0					13																	52686454		2203	4300	6503	SO:0001583	missense	341676						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr13:52686454G>A	BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.262C>T	13.37:g.52686454G>A	ENSP00000347767:p.Leu88Phe		Somatic				NEK5_uc001vgf.2_Missense_Mutation_p.L88F	p.L88F	NM_199289	NP_954983	WXS	Illumina HiSeq	Unspecified	Q6P3R8	NEK5_HUMAN		GBM - Glioblastoma multiforme(99;3.7e-08)	5	402	-		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)	88			Protein kinase.		Q5TAP5	Missense_Mutation	SNP	ENST00000355568.4	37	c.262C>T	CCDS31979.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785809	0.70337	.	.	ENSG00000197168	ENST00000355568	T	0.62498	0.02	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000070	T	0.81805	0.4900	M	0.92219	3.285	0.44432	D	0.997352	D	0.89917	1.0	D	0.97110	1.0	D	0.84823	0.0797	10	0.87932	D	0	.	9.6626	0.39965	0.1613:0.0:0.8387:0.0	.	88	Q6P3R8	NEK5_HUMAN	F	88	ENSP00000347767:L88F	ENSP00000347767:L88F	L	-	1	0	NEK5	51584455	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	5.676000	0.68131	2.627000	0.88993	0.467000	0.42956	CTC		0.373	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3	NM_199289		6	80	0	0	0	0.00198382	0	6	80				
DIS3	22894	broad.mit.edu	37	13	73355908	73355908	+	Silent	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr13:73355908G>C	ENST00000377767.4	-	1	163	c.63C>G	c.(61-63)cgC>cgG	p.R21R	DIS3_ENST00000377780.4_Silent_p.R21R|DIS3_ENST00000475871.1_5'UTR|DIS3_ENST00000545453.1_5'UTR|PIBF1_ENST00000326291.6_5'Flank	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	21					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		GGTAGTGCTCGCGCACGATCT	0.677										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(61-63)CGC>CGG		DIS3 mitotic control isoform a							10.0	13.0	12.0					13																	73355908		2193	4285	6478	SO:0001819	synonymous_variant	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73355908G>C	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.63C>G	13.37:g.73355908G>C		Multiple Myeloma(4;0.011)	Somatic				PIBF1_uc001vja.1_5'Flank|PIBF1_uc010aeo.1_5'Flank|PIBF1_uc001vjb.2_5'Flank|PIBF1_uc001vjc.2_5'Flank|PIBF1_uc010aep.2_5'Flank|DIS3_uc001viy.3_Silent_p.R21R|DIS3_uc001viz.2_RNA	p.R21R	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	1	437	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	21					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	ENST00000377767.4	37	c.63C>G	CCDS9447.1																																																																																				0.677	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		13	10	0	0	0	0.00185496	0	13	10				
OR4K5	79317	broad.mit.edu	37	14	20389038	20389038	+	Silent	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr14:20389038C>G	ENST00000315915.4	+	1	298	c.273C>G	c.(271-273)acC>acG	p.T91T		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CACACGAGACCATATCTTTCA	0.418																																							uc010tkw.1		NA																	0				ovary(1)|skin(1)	2						c.(271-273)ACC>ACG		olfactory receptor, family 4, subfamily K,							273.0	290.0	284.0					14																	20389038		2203	4299	6502	SO:0001819	synonymous_variant	79317				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20389038C>G	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.273C>G	14.37:g.20389038C>G			Somatic					p.T91T	NM_001005483	NP_001005483	WXS	Illumina HiSeq	Unspecified	Q8NGD3	OR4K5_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	273	+	all_cancers(95;0.00108)		91			Extracellular (Potential).		Q6IFA7	Silent	SNP	ENST00000315915.4	37	c.273C>G	CCDS32024.1																																																																																				0.418	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483		29	580	0	0	0	0.001512	0	29	580				
LOC101927079	101927079	broad.mit.edu	37	15	22332432	22332432	+	RNA	SNP	C	C	T	rs376977769		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr15:22332432C>T	ENST00000558896.1	+	0	239																											AAGATTCTAACGTGACAGAAC	0.343																																							uc001yuc.1		NA																	0				ovary(4)|skin(1)	5						c.(-744--740)AACGT>AATGT		olfactory receptor, family 4, subfamily N,																																						283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22332432C>T																													15.37:g.22332432C>T			Somatic				LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron		NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	3	239	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)							Translation_Start_Site	SNP	ENST00000558896.1	37	c.-742C>T																																																																																					0.343	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000417625.1			11	57	0	0	0	0.00136819	0	11	57				
UBR1	197131	broad.mit.edu	37	15	43398195	43398195	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr15:43398195G>T	ENST00000290650.4	-	1	104	c.26C>A	c.(25-27)aCt>aAt	p.T9N	UBR1_ENST00000382177.2_Missense_Mutation_p.T9N	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	9					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CATCCTCTCAGTACCTCCAGC	0.612																																							uc001zqq.2		NA																	0				lung(1)	1						c.(25-27)ACT>AAT		ubiquitin protein ligase E3 component n-recognin							63.0	46.0	52.0					15																	43398195		2203	4299	6502	SO:0001583	missense	197131				cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding	g.chr15:43398195G>T		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.26C>A	15.37:g.43398195G>T	ENSP00000290650:p.Thr9Asn		Somatic				UBR1_uc010udk.1_Missense_Mutation_p.T9N	p.T9N	NM_174916	NP_777576	WXS	Illumina HiSeq	Unspecified	Q8IWV7	UBR1_HUMAN		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)	1	92	-		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)	9					O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	c.26C>A	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	G	7.495	0.651436	0.14516	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.70399	0.36;-0.48	4.18	-1.31	0.09230	.	1.042500	0.07578	N	0.919851	T	0.43233	0.1238	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.003	T	0.17806	-1.0357	10	0.18710	T	0.47	-3.6146	3.4862	0.07620	0.4336:0.0:0.3879:0.1786	.	9;9	B4DYL2;Q8IWV7	.;UBR1_HUMAN	N	9	ENSP00000290650:T9N;ENSP00000371612:T9N	ENSP00000290650:T9N	T	-	2	0	UBR1	41185487	0.001000	0.12720	0.002000	0.10522	0.164000	0.22412	-0.144000	0.10280	-0.221000	0.09973	0.650000	0.86243	ACT		0.612	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916		10	5	1	0	1.58986e-06	0.000673444	6.74809e-06	10	5				
CEP152	22995	broad.mit.edu	37	15	49089914	49089914	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr15:49089914C>T	ENST00000380950.2	-	4	392	c.205G>A	c.(205-207)Gag>Aag	p.E69K	CEP152_ENST00000325747.5_Missense_Mutation_p.E69K|CEP152_ENST00000399334.3_Missense_Mutation_p.E69K	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	69					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TCCAATTGCTCAGGATGATGT	0.388																																							uc001zwy.2		NA																	0				lung(2)	2						c.(205-207)GAG>AAG		centrosomal protein 152kDa							172.0	155.0	160.0					15																	49089914		1937	4137	6074	SO:0001583	missense	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49089914C>T	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.205G>A	15.37:g.49089914C>T	ENSP00000370337:p.Glu69Lys		Somatic				CEP152_uc001zwz.2_Missense_Mutation_p.E69K|CEP152_uc001zxa.1_Missense_Mutation_p.E69K	p.E69K	NM_014985	NP_055800	WXS	Illumina HiSeq	Unspecified	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	4	239	-		all_lung(180;0.0428)	69					E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	c.205G>A	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244967	0.39697	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334;ENST00000541880	T;T;T	0.54675	1.94;0.56;1.94	5.87	4.0	0.46444	.	0.813419	0.11486	N	0.559194	T	0.45438	0.1342	L	0.57536	1.79	0.22034	N	0.999407	P;P;P	0.38078	0.465;0.617;0.458	B;B;B	0.35039	0.124;0.121;0.194	T	0.23797	-1.0178	10	0.18276	T	0.48	-12.3721	9.9651	0.41719	0.1123:0.6213:0.2664:0.0	.	69;69;69	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	K	69	ENSP00000370337:E69K;ENSP00000321000:E69K;ENSP00000382271:E69K	ENSP00000321000:E69K	E	-	1	0	CEP152	46877206	0.970000	0.33590	0.999000	0.59377	0.901000	0.52897	0.540000	0.23191	1.479000	0.48272	0.655000	0.94253	GAG		0.388	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		8	83	0	0	0	0.000274275	0	8	83				
AGBL1	123624	broad.mit.edu	37	15	86687016	86687016	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr15:86687016C>T	ENST00000441037.2	+	2	159	c.64C>T	c.(64-66)Cct>Tct	p.P22S	AGBL1_ENST00000421325.2_Missense_Mutation_p.P22S	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	22					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GAGGACAGCTCCTCCAGACTA	0.547																																							uc002blz.1		NA																	0					0						c.(64-66)CCT>TCT		ATP/GTP binding protein-like 1							102.0	112.0	108.0					15																	86687016		2051	4190	6241	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86687016C>T	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.64C>T	15.37:g.86687016C>T	ENSP00000413001:p.Pro22Ser		Somatic					p.P22S	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			2	144	+			22					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.64C>T	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	2.454	-0.325760	0.05350	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.28666	1.6	5.61	-3.2	0.05156	Armadillo-type fold (1);	.	.	.	.	T	0.07369	0.0186	N	0.01168	-0.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30297	-0.9983	9	0.14252	T	0.57	-1.7628	2.0639	0.03598	0.1359:0.3638:0.14:0.3603	.	22	Q96MI9	CBPC4_HUMAN	S	51;22	ENSP00000397173:P22S	ENSP00000397173:P22S	P	+	1	0	AGBL1	84488020	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	0.135000	0.15952	-0.790000	0.04492	-1.731000	0.00696	CCT		0.547	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		20	49	0	0	0	0.00121646	0	20	49				
SPSB3	90864	broad.mit.edu	37	16	1828259	1828259	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr16:1828259C>T	ENST00000566339.1	-	4	698	c.368G>A	c.(367-369)cGt>cAt	p.R123H	SPSB3_ENST00000301717.4_Missense_Mutation_p.R123H	NM_080861.3	NP_543137.2	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box containing 3	123	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(1)|kidney(4)|lung(3)|prostate(2)	10						GCTGACCTTACGGTTGTCACA	0.597																																							uc002cmr.2		NA																	0					0						c.(367-369)CGT>CAT		splA/ryanodine receptor domain and SOCS box							41.0	44.0	43.0					16																	1828259		2198	4300	6498	SO:0001583	missense	90864				intracellular signal transduction			g.chr16:1828259C>T		CCDS32365.1	16p13.3	2008-02-05				ENSG00000162032			30629	protein-coding gene	gene with protein product		611659	"""chromosome 16 open reading frame 31"""	C16orf31		12076535	Standard	NM_080861		Approved	SSB-3	uc002cmu.3	Q6PJ21		ENST00000566339.1:c.368G>A	16.37:g.1828259C>T	ENSP00000457206:p.Arg123His		Somatic				SPSB3_uc002cms.2_5'UTR|SPSB3_uc002cmt.2_5'UTR|SPSB3_uc002cmu.2_Missense_Mutation_p.R123H|SPSB3_uc002cmv.2_5'UTR|SPSB3_uc010uvm.1_3'UTR	p.R123H	NM_080861	NP_543137	WXS	Illumina HiSeq	Unspecified	Q6PJ21	SPSB3_HUMAN			3	401	-			123			B30.2/SPRY.		D3DU78|Q49A96|Q86X18|Q8WXK5|Q96IE6|Q96RY2	Missense_Mutation	SNP	ENST00000566339.1	37	c.368G>A	CCDS32365.1	.	.	.	.	.	.	.	.	.	.	C	33	5.271105	0.95429	.	.	ENSG00000162032	ENST00000301717	T	0.62639	0.01	4.82	4.82	0.62117	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.79446	0.4447	M	0.77313	2.365	0.58432	D	0.999999	D	0.89917	1.0	D	0.76071	0.987	T	0.82641	-0.0357	10	0.72032	D	0.01	-4.8269	16.4866	0.84185	0.0:1.0:0.0:0.0	.	123	Q6PJ21	SPSB3_HUMAN	H	123	ENSP00000301717:R123H	ENSP00000301717:R123H	R	-	2	0	SPSB3	1768260	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	7.314000	0.78988	2.226000	0.72624	0.561000	0.74099	CGT		0.597	SPSB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433512.1	NM_080861		6	32	0	0	0	0.00198382	0	6	32				
SMG1	23049	broad.mit.edu	37	16	18896929	18896929	+	Silent	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr16:18896929A>G	ENST00000446231.2	-	7	1294	c.882T>C	c.(880-882)tgT>tgC	p.C294C	SMG1_ENST00000389467.3_Silent_p.C294C|SMG1_ENST00000565224.1_Silent_p.C268C			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	294	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TAACACATTTACAAAGCAATT	0.373																																							uc002dfm.2		NA																	0				breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						c.(880-882)TGT>TGC		PI-3-kinase-related kinase SMG-1							102.0	106.0	105.0					16																	18896929		999	2082	3081	SO:0001819	synonymous_variant	23049				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr16:18896929A>G	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.882T>C	16.37:g.18896929A>G			Somatic				SMG1_uc010bwb.2_Silent_p.C154C	p.C294C	NM_015092	NP_055907	WXS	Illumina HiSeq	Unspecified	Q96Q15	SMG1_HUMAN			7	1245	-			294			Interaction with SMG8 and SMG9.		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	c.882T>C	CCDS45430.1																																																																																				0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		3	117	0	0	0	0.00024832	0	3	117				
ACSM1	116285	broad.mit.edu	37	16	20702350	20702350	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr16:20702350T>A	ENST00000307493.4	-	1	228	c.161A>T	c.(160-162)tAt>tTt	p.Y54F	ACSM1_ENST00000219151.4_5'UTR|ACSM1_ENST00000520010.1_Missense_Mutation_p.Y54F	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	54					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						GTCCAGTACATAACTTGCAAA	0.478																																							uc002dhm.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(160-162)TAT>TTT		acyl-CoA synthetase medium-chain family member							112.0	109.0	110.0					16																	20702350		2201	4300	6501	SO:0001583	missense	116285				benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20702350T>A	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.161A>T	16.37:g.20702350T>A	ENSP00000301956:p.Tyr54Phe		Somatic				ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Missense_Mutation_p.Y54F	p.Y54F	NM_052956	NP_443188	WXS	Illumina HiSeq	Unspecified	Q08AH1	ACSM1_HUMAN			1	229	-			54					Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	37	c.161A>T	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	t	7.518	0.656146	0.14580	.	.	ENSG00000166743	ENST00000307493;ENST00000520010;ENST00000523065	T;T;T	0.49139	0.79;0.79;0.79	4.88	1.28	0.21552	.	1.167840	0.06401	N	0.718859	T	0.27967	0.0689	N	0.08118	0	0.29487	N	0.855945	B	0.28971	0.229	B	0.19666	0.026	T	0.26395	-1.0104	10	0.87932	D	0	.	8.4886	0.33086	0.0:0.1053:0.1168:0.7779	.	54	Q08AH1	ACSM1_HUMAN	F	54	ENSP00000301956:Y54F;ENSP00000428047:Y54F;ENSP00000428830:Y54F	ENSP00000301956:Y54F	Y	-	2	0	ACSM1	20609851	0.486000	0.25980	0.000000	0.03702	0.020000	0.10135	1.984000	0.40658	-0.171000	0.10797	-1.285000	0.01374	TAT		0.478	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956		14	116	0	0	0	0.00244969	0	14	116				
CHD9	80205	broad.mit.edu	37	16	53191330	53191330	+	Silent	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr16:53191330T>C	ENST00000398510.3	+	1	1416	c.1329T>C	c.(1327-1329)caT>caC	p.H443H	CHD9_ENST00000447540.1_Silent_p.H443H|CHD9_ENST00000564845.1_Silent_p.H443H|CHD9_ENST00000566029.1_Silent_p.H443H			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	443					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TTACTTCGCATCTGGTAACAC	0.423																																							uc002ehb.2		NA																	0				lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(1327-1329)CAT>CAC		chromodomain helicase DNA binding protein 9							102.0	94.0	97.0					16																	53191330		1937	4156	6093	SO:0001819	synonymous_variant	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53191330T>C	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1329T>C	16.37:g.53191330T>C			Somatic				CHD9_uc002egy.2_Silent_p.H443H|CHD9_uc002egz.1_Silent_p.H443H|CHD9_uc002eha.1_Silent_p.H443H|CHD9_uc002ehc.2_Silent_p.H443H	p.H443H	NM_025134	NP_079410	WXS	Illumina HiSeq	Unspecified	Q3L8U1	CHD9_HUMAN			1	1493	+		all_cancers(37;0.0212)	443					B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	37	c.1329T>C																																																																																					0.423	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		8	49	0	0	0	0.000978159	0	8	49				
CLEC3A	10143	broad.mit.edu	37	16	78062031	78062031	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr16:78062031T>C	ENST00000575655.1	+	2	224	c.143T>C	c.(142-144)aTt>aCt	p.I48T	CLEC3A_ENST00000299642.4_Missense_Mutation_p.I57T|RP11-281J9.2_ENST00000563114.1_RNA	NM_005752.4	NP_005743.4	O75596	CLC3A_HUMAN	C-type lectin domain family 3, member A	48					skeletal system development (GO:0001501)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	18						AAGACTCAAATTGAAAAGCTC	0.448																																							uc002ffh.3		NA																	0					0						c.(142-144)ATT>ACT		C-type lectin domain family 3 member A							90.0	87.0	88.0					16																	78062031		2198	4300	6498	SO:0001583	missense	10143				skeletal system development	extracellular region	sugar binding	g.chr16:78062031T>C	AF077345	CCDS10927.1, CCDS10927.2	16q23	2008-02-05	2005-02-09	2005-02-11	ENSG00000166509	ENSG00000166509		"""C-type lectin domain containing"""	2052	protein-coding gene	gene with protein product		613588	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1 (cartilage-derived)"""	CLECSF1		10524194	Standard	NM_001244755		Approved		uc002ffh.5	O75596	OTTHUMG00000137620	ENST00000575655.1:c.143T>C	16.37:g.78062031T>C	ENSP00000460682:p.Ile48Thr		Somatic					p.I48T	NM_005752	NP_005743	WXS	Illumina HiSeq	Unspecified	O75596	CLC3A_HUMAN			2	224	+			48					B2R8C4|Q3SX91|Q6UXF5	Missense_Mutation	SNP	ENST00000575655.1	37	c.143T>C		.	.	.	.	.	.	.	.	.	.	T	18.36	3.606385	0.66445	.	.	ENSG00000166509	ENST00000299642	.	.	.	5.58	5.58	0.84498	.	0.219186	0.45126	D	0.000393	T	0.58438	0.2122	L	0.49126	1.545	0.54753	D	0.999985	B	0.24258	0.1	B	0.21151	0.033	T	0.58532	-0.7620	9	0.66056	D	0.02	-7.7111	15.4039	0.74863	0.0:0.0:0.0:1.0	.	48	O75596	CLC3A_HUMAN	T	48	.	ENSP00000299642:I48T	I	+	2	0	CLEC3A	76619532	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.763000	0.68818	2.118000	0.64928	0.459000	0.35465	ATT		0.448	CLEC3A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005752		16	80	0	0	0	0.000566183	0	16	80				
TP53	7157	broad.mit.edu	37	17	7579358	7579358	+	Missense_Mutation	SNP	C	C	A	rs11540654|rs587780066	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:7579358C>A	ENST00000269305.4	-	4	518	c.329G>T	c.(328-330)cGt>cTt	p.R110L	TP53_ENST00000413465.2_Missense_Mutation_p.R110L|TP53_ENST00000359597.4_Missense_Mutation_p.R110L|TP53_ENST00000455263.2_Missense_Mutation_p.R110L|TP53_ENST00000420246.2_Missense_Mutation_p.R110L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R110L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110L(36)|p.R110P(9)|p.0?(8)|p.G59fs*23(3)|p.R110fs*13(2)|p.F109_R110delFR(2)|p.R110H(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCCCAGACGGAAACCGTA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		71	Substitution - Missense(47)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(3)|Complex - deletion inframe(2)|Insertion - Frameshift(1)	p.R110L(24)|p.R110P(8)|p.0?(7)|p.R110fs*13(5)|p.R110C(4)|p.G59fs*23(3)|p.F109_R110delFR(2)|p.R110H(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)	upper_aerodigestive_tract(15)|lung(13)|breast(8)|large_intestine(5)|urinary_tract(5)|liver(4)|bone(4)|soft_tissue(3)|oesophagus(3)|ovary(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|skin(1)|pancreas(1)|autonomic_ganglia(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM984590	TP53	M	rs11540654	c.(328-330)CGT>CTT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							63.0	60.0	61.0					17																	7579358		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579358C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.329G>T	17.37:g.7579358C>A	ENSP00000269305:p.Arg110Leu	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.R110L|TP53_uc002gih.2_Missense_Mutation_p.R110L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.R110L|TP53_uc010cni.1_Missense_Mutation_p.R110L|TP53_uc002gij.2_Missense_Mutation_p.R110L|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.R71L|TP53_uc010cnk.1_Missense_Mutation_p.R125L	p.R110L	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	523	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	110		R -> G (in a sporadic cancer; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).	Interaction with HIPK1 (By similarity).||Interaction with WWOX.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.329G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091694	0.55968	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	4.75	-0.964	0.10326	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.808524	0.11806	N	0.527643	D	0.99242	0.9736	L	0.52759	1.655	0.09310	N	1	P;P;P;B;B;B;P	0.51537	0.946;0.941;0.459;0.347;0.373;0.362;0.782	P;P;B;B;B;P;B	0.57152	0.523;0.814;0.269;0.211;0.405;0.49;0.337	D	0.99938	1.1378	10	0.66056	D	0.02	-0.2466	4.9119	0.13825	0.0:0.3943:0.154:0.4517	rs11540654;rs11540654	71;110;110;110;110;110;110	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	110	ENSP00000410739:R110L;ENSP00000352610:R110L;ENSP00000269305:R110L;ENSP00000398846:R110L;ENSP00000391127:R110L;ENSP00000391478:R110L;ENSP00000424104:R110L;ENSP00000426252:R110L	ENSP00000269305:R110L	R	-	2	0	TP53	7520083	0.012000	0.17670	0.014000	0.15608	0.952000	0.60782	0.563000	0.23547	-0.185000	0.10550	0.655000	0.94253	CGT		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		52	17	1	0	6.3008e-33	0.00361006	2.8428e-32	52	17				
MYH4	4622	broad.mit.edu	37	17	10366250	10366250	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:10366250C>T	ENST00000255381.2	-	11	1050	c.940G>A	c.(940-942)Gca>Aca	p.A314T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	314	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTGACAAATGCGAAGTCATAT	0.403																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(940-942)GCA>ACA		myosin, heavy polypeptide 4, skeletal muscle							129.0	124.0	125.0					17																	10366250		2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10366250C>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.940G>A	17.37:g.10366250C>T	ENSP00000255381:p.Ala314Thr		Somatic				uc002gml.1_Intron	p.A314T	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			11	1051	-			314			Myosin head-like.			Missense_Mutation	SNP	ENST00000255381.2	37	c.940G>A	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.430257	0.43122	.	.	ENSG00000141048	ENST00000255381	D	0.88124	-2.34	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.509088	0.14496	U	0.316021	T	0.81800	0.4899	L	0.35644	1.08	0.34512	D	0.707256	B	0.09022	0.002	B	0.11329	0.006	T	0.79085	-0.1948	10	0.23891	T	0.37	.	14.0611	0.64800	0.0:0.7304:0.2696:0.0	.	314	Q9Y623	MYH4_HUMAN	T	314	ENSP00000255381:A314T	ENSP00000255381:A314T	A	-	1	0	MYH4	10306975	0.008000	0.16893	0.972000	0.41901	0.638000	0.38207	0.541000	0.23207	2.666000	0.90696	0.650000	0.86243	GCA		0.403	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		22	41	0	0	0	0.000720815	0	22	41				
CCDC144A	9720	broad.mit.edu	37	17	16612212	16612212	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:16612212G>A	ENST00000360524.8	+	5	917	c.841G>A	c.(841-843)Gaa>Aaa	p.E281K	CCDC144A_ENST00000443444.2_Missense_Mutation_p.E281K|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.E281K|CCDC144A_ENST00000340621.5_Missense_Mutation_p.E280K|RN7SL620P_ENST00000580704.1_RNA|CCDC144A_ENST00000399273.1_Missense_Mutation_p.E281K|CCDC144A_ENST00000456009.1_Intron	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	281																	AATGTGGATTGAACAAGGCAA	0.358																																							uc002gqk.1		NA																	0					0						c.(841-843)GAA>AAA		coiled-coil domain containing 144A							30.0	29.0	30.0					17																	16612212		1812	4068	5880	SO:0001583	missense	9720							g.chr17:16612212G>A	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.841G>A	17.37:g.16612212G>A	ENSP00000353717:p.Glu281Lys		Somatic				CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_5'Flank	p.E281K	NM_014695	NP_055510	WXS	Illumina HiSeq	Unspecified	A2RUR9	C144A_HUMAN			5	917	+			281					O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	c.841G>A	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	2.914	-0.224622	0.06061	.	.	ENSG00000170160	ENST00000340621;ENST00000399273;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000360495	T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81	1.71	-3.13	0.05266	.	.	.	.	.	T	0.10809	0.0264	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.33059	-0.9883	8	.	.	.	.	4.1621	0.10289	0.2484:0.2342:0.5174:0.0	.	281	A2RUR9	C144A_HUMAN	K	280;281;281;281;281;281	ENSP00000344740:E280K;ENSP00000382215:E281K;ENSP00000439262:E281K;ENSP00000440655:E281K;ENSP00000353717:E281K;ENSP00000353685:E281K	.	E	+	1	0	CCDC144A	16552937	1.000000	0.71417	0.055000	0.19348	0.015000	0.08874	1.392000	0.34486	-0.590000	0.05866	0.175000	0.17021	GAA		0.358	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			30	39	0	0	0	0.00428921	0	30	39				
SUPT6H	6830	broad.mit.edu	37	17	27016420	27016420	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:27016420G>C	ENST00000314616.6	+	25	3466	c.3183G>C	c.(3181-3183)gaG>gaC	p.E1061D	SUPT6H_ENST00000347486.4_Missense_Mutation_p.E1061D	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1061	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TCCACCCTGAGACTTATGAGT	0.473																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(3181-3183)GAG>GAC		suppressor of Ty 6 homolog							114.0	101.0	105.0					17																	27016420		2203	4300	6503	SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27016420G>C	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3183G>C	17.37:g.27016420G>C	ENSP00000319104:p.Glu1061Asp		Somatic				SUPT6H_uc010crt.2_Missense_Mutation_p.E1061D|SUPT6H_uc002hbz.1_5'UTR	p.E1061D	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			25	3273	+	Lung NSC(42;0.00431)		1061					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.3183G>C	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278720	0.59758	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.61	1.29	0.21616	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79405	0.4440	M	0.91354	3.2	0.80722	D	1	D	0.65815	0.995	D	0.67103	0.949	T	0.80221	-0.1472	9	0.59425	D	0.04	-22.2035	10.3788	0.44099	0.3628:0.0:0.6372:0.0	.	1061	Q7KZ85	SPT6H_HUMAN	D	1061	.	ENSP00000319104:E1061D	E	+	3	2	SUPT6H	24040547	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.202000	0.32271	0.302000	0.22762	0.655000	0.94253	GAG		0.473	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		23	71	0	0	0	0.00332997	0	23	71				
KRTAP4-9	100132386	broad.mit.edu	37	17	39261822	39261822	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:39261822A>C	ENST00000391415.1	+	1	239	c.182A>C	c.(181-183)cAa>cCa	p.Q61P		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	61	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						GTGTGCTGCCAACCCACTTGT	0.647																																							uc010wfp.1		NA																	0					0						c.(181-183)CAA>CCA		keratin associated protein 4-9							21.0	28.0	26.0					17																	39261822		686	1591	2277	SO:0001583	missense	100132386					keratin filament		g.chr17:39261822A>C	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.182A>C	17.37:g.39261822A>C	ENSP00000375234:p.Gln61Pro		Somatic					p.Q61P	NM_001146041	NP_001139513	WXS	Illumina HiSeq	Unspecified	Q9BYQ8	KRA49_HUMAN			1	182	+			61			8.|29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].			Missense_Mutation	SNP	ENST00000391415.1	37	c.182A>C	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	11.79	1.742670	0.30865	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.35789	1.29	2.64	-1.99	0.07457	.	159.297000	0.00864	U	0.001946	T	0.43299	0.1241	M	0.86953	2.85	0.09310	N	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.39418	-0.9615	10	0.72032	D	0.01	.	4.2269	0.10584	0.5169:0.1842:0.2989:0.0	.	61	Q9BYQ8	KRA49_HUMAN	P	61	ENSP00000375234:Q61P	ENSP00000334461:Q61P	Q	+	2	0	KRTAP4-9	36515348	0.210000	0.23517	0.001000	0.08648	0.320000	0.28249	0.342000	0.19926	-0.357000	0.08175	0.254000	0.18369	CAA		0.647	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041		4	118	0	0	0	0.00024832	0	4	118				
LOC101927755	101927755	broad.mit.edu	37	17	58075543	58075543	+	lincRNA	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:58075543T>C	ENST00000586209.1	+	0	3206																											TATTGGTGGATATGACACATT	0.338																																							uc002iyf.2		NA																	0					0						c.(298-300)ATA>ATG		Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 40 pseudogene, mRNA (cDNA clone IMAGE:5170263).																																						653645							g.chr17:58075543T>C																													17.37:g.58075543T>C			Somatic					p.I100M	NR_002924		WXS	Illumina HiSeq	Unspecified					7	535	-									Missense_Mutation	SNP	ENST00000586209.1	37	c.300A>G																																																																																					0.338	RP11-178C3.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449162.1			34	23	0	0	0	0.00128727	0	34	23				
CSH2	1443	broad.mit.edu	37	17	61950686	61950686	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:61950686G>A	ENST00000392886.2	-	2	175	c.24C>T	c.(22-24)tcC>tcT	p.S8S	CSH2_ENST00000345366.7_Silent_p.S8S|CSH2_ENST00000336844.5_Silent_p.S8S|CSH2_ENST00000560142.1_Silent_p.S8S	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2	8						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						CCAGGAGCAGGGACGTCCGGG	0.607																																							uc002jch.2		NA																	0					0						c.(22-24)TCC>TCT		chorionic somatomammotropin hormone 2 isoform 1							16.0	17.0	17.0					17																	61950686		2200	4293	6493	SO:0001819	synonymous_variant	1443				female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding	g.chr17:61950686G>A	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.24C>T	17.37:g.61950686G>A			Somatic				CSH2_uc002jcg.2_Silent_p.S8S|CSH2_uc002jci.2_Silent_p.S8S|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Silent_p.S8S	p.S8S	NM_020991	NP_066271	WXS	Illumina HiSeq	Unspecified	P01243	CSH_HUMAN			2	139	-			8					P01243|Q0VDB1|Q14407	Silent	SNP	ENST00000392886.2	37	c.24C>T	CCDS42369.1																																																																																				0.607	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	NM_020991		27	49	0	0	0	0.00428921	0	27	49				
GH1	2688	broad.mit.edu	37	17	61994726	61994726	+	Silent	SNP	G	G	A	rs142704768	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:61994726G>A	ENST00000323322.5	-	5	639	c.597C>T	c.(595-597)gtC>gtT	p.V199V	CSHL1_ENST00000392824.4_Intron|GH1_ENST00000342364.4_Silent_p.V104V|GH1_ENST00000351388.4_Silent_p.V159V|GH1_ENST00000458650.2_Silent_p.V184V	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	199					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GGAATGTCTCGACCTTGTCCA	0.582																																							uc002jdj.2		NA																	0					0						c.(595-597)GTC>GTT		growth hormone 1 isoform 1							189.0	145.0	160.0					17																	61994726		2203	4297	6500	SO:0001819	synonymous_variant	2688				glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding	g.chr17:61994726G>A	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.597C>T	17.37:g.61994726G>A			Somatic				GH1_uc002jdi.2_Silent_p.V184V|GH1_uc002jdk.2_Silent_p.V159V|GH1_uc002jdl.2_Silent_p.V104V|GH1_uc002jdm.2_3'UTR|GH1_uc002jdn.2_Missense_Mutation_p.S153L	p.V199V	NM_000515	NP_000506	WXS	Illumina HiSeq	Unspecified	P01241	SOMA_HUMAN			5	659	-			199					A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Silent	SNP	ENST00000323322.5	37	c.597C>T	CCDS11653.1																																																																																				0.582	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515		16	53	0	0	0	0.000566183	0	16	53				
DNAI2	64446	broad.mit.edu	37	17	72287186	72287186	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:72287186T>A	ENST00000311014.6	+	6	705	c.638T>A	c.(637-639)cTg>cAg	p.L213Q	DNAI2_ENST00000582036.1_Missense_Mutation_p.L213Q|DNAI2_ENST00000446837.2_Missense_Mutation_p.L213Q|DNAI2_ENST00000307504.5_Missense_Mutation_p.L70Q|DNAI2_ENST00000579490.1_Missense_Mutation_p.L270Q			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	213					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GAACTTGCTCTGAAGCCATCG	0.498									Kartagener syndrome																														uc002jkf.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(637-639)CTG>CAG		dynein, axonemal, intermediate polypeptide 2							184.0	192.0	189.0					17																	72287186		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72287186T>A	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.638T>A	17.37:g.72287186T>A	ENSP00000308312:p.Leu213Gln		Somatic				DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	p.L213Q	NM_023036	NP_075462	WXS	Illumina HiSeq	Unspecified	Q9GZS0	DNAI2_HUMAN			6	737	+			213					C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.638T>A	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.681235	0.68042	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	D;D;D	0.86097	-2.07;-2.07;-2.07	4.72	4.72	0.59763	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.137348	0.50627	D	0.000112	D	0.94401	0.8199	H	0.96365	3.81	0.58432	D	0.999999	D	0.76494	0.999	D	0.70487	0.969	D	0.95964	0.8964	10	0.87932	D	0	-25.6811	14.0798	0.64914	0.0:0.0:0.0:1.0	.	213	Q9GZS0	DNAI2_HUMAN	Q	213;70;213	ENSP00000308312:L213Q;ENSP00000302929:L70Q;ENSP00000400252:L213Q	ENSP00000302929:L70Q	L	+	2	0	DNAI2	69798781	1.000000	0.71417	0.866000	0.34008	0.531000	0.34715	7.185000	0.77714	1.993000	0.58246	0.467000	0.42956	CTG		0.498	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		88	465	0	0	0	0.00361006	0	88	465				
SETBP1	26040	broad.mit.edu	37	18	42531615	42531615	+	Silent	SNP	G	G	A	rs373845529		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr18:42531615G>A	ENST00000282030.5	+	4	2606	c.2310G>A	c.(2308-2310)gcG>gcA	p.A770A		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	770						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACTTGTGGCGTCTTCACCAG	0.527									Schinzel-Giedion syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		19117	0.0		0.0	False		,,,				2504	0.0						uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2308-2310)GCG>GCA		SET binding protein 1 isoform a		G		1,4405	2.1+/-5.4	0,1,2202	60.0	61.0	61.0		2310	-9.1	0.8	18		61	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SETBP1	NM_015559.2		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		770/1597	42531615	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42531615G>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2310G>A	18.37:g.42531615G>A			Somatic					p.A770A	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	2606	+			770					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.2310G>A	CCDS11923.2																																																																																				0.527	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		17	53	0	0	0	0.00400662	0	17	53				
MBD2	8932	broad.mit.edu	37	18	51715381	51715381	+	Splice_Site	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr18:51715381C>G	ENST00000256429.3	-	3	931	c.703G>C	c.(703-705)Ggt>Cgt	p.G235R		NM_003927.4	NP_003918.1	Q9UBB5	MBD2_HUMAN	methyl-CpG binding domain protein 2	235					ATP-dependent chromatin remodeling (GO:0043044)|cellular protein complex assembly (GO:0043623)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|protein domain specific binding (GO:0019904)|satellite DNA binding (GO:0003696)|siRNA binding (GO:0035197)			breast(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)		TCTGGTTTACCCTGTGaatat	0.269																																							uc002lfg.1		NA																	0					0						c.(703-705)GGT>CGT		methyl-CpG binding domain protein 2 isoform 1	Hexobarbital(DB01355)						125.0	122.0	123.0					18																	51715381		2202	4300	6502	SO:0001630	splice_region_variant	8932				transcription, DNA-dependent		C2H2 zinc finger domain binding|methyl-CpG binding|satellite DNA binding	g.chr18:51715381C>G	AF072242	CCDS11953.1, CCDS45871.1	18q21	2008-08-01			ENSG00000134046	ENSG00000134046			6917	protein-coding gene	gene with protein product		603547				9774669, 10441743	Standard	NM_003927		Approved		uc002lfg.2	Q9UBB5	OTTHUMG00000132705	ENST00000256429.3:c.703-1G>C	18.37:g.51715381C>G			Somatic					p.G235R	NM_003927	NP_003918	WXS	Illumina HiSeq	Unspecified	Q9UBB5	MBD2_HUMAN		Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)	3	932	-			235					O95242|Q9UIS8	Missense_Mutation	SNP	ENST00000256429.3	37	c.703G>C	CCDS11953.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.532433	0.27387	.	.	ENSG00000134046	ENST00000256429	D	0.95980	-3.87	5.88	5.88	0.94601	Methyl-CpG DNA binding (1);DNA-binding, integrase-type (1);	0.068304	0.64402	D	0.000014	D	0.95570	0.8560	L	0.58969	1.84	0.80722	D	1	D	0.59357	0.985	P	0.58520	0.84	D	0.92755	0.6219	10	0.12430	T	0.62	-10.182	12.3566	0.55178	0.0:0.9219:0.0:0.0781	.	235	Q9UBB5	MBD2_HUMAN	R	235	ENSP00000256429:G235R	ENSP00000256429:G235R	G	-	1	0	MBD2	49969379	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.929000	0.70096	2.791000	0.96007	0.563000	0.77884	GGT		0.269	MBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256003.2	NM_003927	Missense_Mutation	6	112	0	0	0	0.00116845	0	6	112				
FBN3	84467	broad.mit.edu	37	19	8130962	8130962	+	Silent	SNP	G	G	A	rs372292848		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr19:8130962G>A	ENST00000600128.1	-	64	8685	c.8271C>T	c.(8269-8271)ggC>ggT	p.G2757G	FBN3_ENST00000601739.1_Silent_p.G2757G|FBN3_ENST00000270509.2_Silent_p.G2757G			Q75N90	FBN3_HUMAN	fibrillin 3	2757						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGGAGCTGACGCCACGGAGGT	0.682																																							uc002mjf.2		NA																	0				ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(8269-8271)GGC>GGT		fibrillin 3 precursor		G		0,4406		0,0,2203	60.0	62.0	61.0		8271	-9.3	0.0	19		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FBN3	NM_032447.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		2757/2810	8130962	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8130962G>A		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.8271C>T	19.37:g.8130962G>A			Somatic				FBN3_uc002mje.2_Silent_p.G553G	p.G2757G	NM_032447	NP_115823	WXS	Illumina HiSeq	Unspecified	Q75N90	FBN3_HUMAN			63	8292	-			2757					Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	c.8271C>T	CCDS12196.1																																																																																				0.682	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		10	100	0	0	0	0.00185496	0	10	100				
UNC13A	23025	broad.mit.edu	37	19	17756535	17756535	+	Silent	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr19:17756535C>G	ENST00000519716.2	-	19	2303	c.2304G>C	c.(2302-2304)acG>acC	p.T768T	UNC13A_ENST00000550896.1_Silent_p.T766T|UNC13A_ENST00000551649.1_Silent_p.T768T|UNC13A_ENST00000252773.7_Silent_p.T768T|UNC13A_ENST00000552293.1_Silent_p.T768T|UNC13A_ENST00000428389.2_Silent_p.T856T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	768	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCTCAATGATCGTCTGCCCCA	0.597																																							uc002nhd.2		NA																	0				ovary(3)	3						c.(2566-2568)ACG>ACC		unc-13 homolog A							91.0	94.0	93.0					19																	17756535		2159	4277	6436	SO:0001819	synonymous_variant	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17756535C>G	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2304G>C	19.37:g.17756535C>G			Somatic					p.T856T	NM_001080421	NP_001073890	WXS	Illumina HiSeq	Unspecified	Q9UPW8	UN13A_HUMAN			19	2568	-			768			C2 2.		E5RHY9	Silent	SNP	ENST00000519716.2	37	c.2568G>C	CCDS46013.2																																																																																				0.597	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		5	52	0	0	0	0.00116845	0	5	52				
ZFP36	7538	broad.mit.edu	37	19	39899162	39899162	+	Silent	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr19:39899162G>C	ENST00000248673.3	+	2	862	c.804G>C	c.(802-804)ctG>ctC	p.L268L	ZFP36_ENST00000597629.1_Silent_p.L274L|MIR4530_ENST00000581459.1_RNA	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	268					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGGGTGGCCTGGTTCGGACCC	0.677																																					NSCLC(67;1164 1324 12056 21056 30097)	NSCLC(67;1164 1324 12056 21056 30097)	uc002olh.1		NA																	0				pancreas(1)	1						c.(802-804)CTG>CTC		zinc finger protein 36, C3H type, homolog							29.0	33.0	32.0					19																	39899162		2203	4300	6503	SO:0001819	synonymous_variant	7538				positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding	g.chr19:39899162G>C	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.804G>C	19.37:g.39899162G>C			Somatic				ZFP36_uc010egn.1_Missense_Mutation_p.W141S	p.L268L	NM_003407	NP_003398	WXS	Illumina HiSeq	Unspecified	P26651	TTP_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)		2	862	+	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		268					B2RA54	Silent	SNP	ENST00000248673.3	37	c.804G>C																																																																																					0.677	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				6	54	0	0	0	0.00116845	0	6	54				
CPT1C	126129	broad.mit.edu	37	19	50208490	50208490	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr19:50208490G>A	ENST00000392518.4	+	10	1271	c.899G>A	c.(898-900)cGc>cAc	p.R300H	CPT1C_ENST00000323446.5_Missense_Mutation_p.R300H|CPT1C_ENST00000598293.1_Missense_Mutation_p.R300H|CPT1C_ENST00000405931.2_Missense_Mutation_p.R289H|CPT1C_ENST00000354199.5_Missense_Mutation_p.R300H	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	300					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		ATGGGAATGCGCCCCTTATGC	0.587																																							uc002ppj.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(898-900)CGC>CAC		carnitine palmitoyltransferase 1C isoform 2							158.0	144.0	149.0					19																	50208490		2203	4300	6503	SO:0001583	missense	126129				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr19:50208490G>A	AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.899G>A	19.37:g.50208490G>A	ENSP00000376303:p.Arg300His		Somatic				CPT1C_uc002ppl.3_Missense_Mutation_p.R266H|CPT1C_uc002ppi.2_Missense_Mutation_p.R217H|CPT1C_uc002ppk.2_Missense_Mutation_p.R289H|CPT1C_uc010eng.2_Missense_Mutation_p.R300H|CPT1C_uc010enh.2_Missense_Mutation_p.R300H|CPT1C_uc010ybc.1_Missense_Mutation_p.R171H|CPT1C_uc010eni.1_5'Flank	p.R300H	NM_152359	NP_689572	WXS	Illumina HiSeq	Unspecified	Q8TCG5	CPT1C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)	9	1104	+		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)	300			Cytoplasmic (Potential).		A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	ENST00000392518.4	37	c.899G>A	CCDS12779.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.042169	0.75732	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446;ENST00000295404	D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46	4.34	4.34	0.51931	.	0.000000	0.48767	D	0.000176	D	0.87418	0.6172	N	0.12569	0.235	0.28575	N	0.910444	P;D;D;P	0.76494	0.838;0.999;0.987;0.888	P;D;P;P	0.66196	0.49;0.942;0.616;0.806	T	0.82561	-0.0396	10	0.87932	D	0	-25.342	12.2071	0.54358	0.0:0.0:1.0:0.0	.	171;300;289;300	C9IY45;Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;.;CPT1C_HUMAN	H	300;300;289;300;171	ENSP00000376303:R300H;ENSP00000346138:R300H;ENSP00000384465:R289H;ENSP00000319343:R300H	ENSP00000295404:R171H	R	+	2	0	CPT1C	54900302	0.948000	0.32251	0.777000	0.31699	0.956000	0.61745	-0.232000	0.09055	2.260000	0.74910	0.561000	0.74099	CGC		0.587	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359		17	128	0	0	0	0.00074312	0	17	128				
ZNF835	90485	broad.mit.edu	37	19	57176150	57176150	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr19:57176150C>T	ENST00000537055.2	-	2	648	c.417G>A	c.(415-417)gcG>gcA	p.A139A		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						ACTCGGGGCACGCAAATGGCT	0.632																																							uc010ygo.1		NA																	0				pancreas(3)|skin(1)	4						c.(481-483)GCG>GCA		zinc finger protein 835							54.0	63.0	60.0					19																	57176150		2203	4300	6503	SO:0001819	synonymous_variant	90485							g.chr19:57176150C>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.417G>A	19.37:g.57176150C>T			Somatic				ZNF835_uc010ygn.1_Silent_p.A139A	p.A161A	NM_001005850	NP_001005850	WXS	Illumina HiSeq	Unspecified					2	483	-								B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	37	c.483G>A	CCDS56105.1																																																																																				0.632	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		38	73	0	0	0	0.00428921	0	38	73				
MAP4K3	8491	broad.mit.edu	37	2	39514010	39514010	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr2:39514010C>G	ENST00000263881.3	-	21	1894	c.1570G>C	c.(1570-1572)Gaa>Caa	p.E524Q	MAP4K3_ENST00000437545.1_Missense_Mutation_p.E440Q|MAP4K3_ENST00000536018.1_Missense_Mutation_p.E77Q|MAP4K3_ENST00000341681.5_Missense_Mutation_p.E503Q	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	524					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				TCTTTCTTTTCTTTTCTTGAA	0.338																																							uc002rro.2		NA																	0				ovary(3)|lung(3)|stomach(1)|pancreas(1)	8						c.(1570-1572)GAA>CAA		mitogen-activated protein kinase kinase kinase							84.0	82.0	83.0					2																	39514010		2203	4298	6501	SO:0001583	missense	8491				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr2:39514010C>G	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.1570G>C	2.37:g.39514010C>G	ENSP00000263881:p.Glu524Gln		Somatic				MAP4K3_uc002rrp.2_Missense_Mutation_p.E503Q|MAP4K3_uc010yns.1_Missense_Mutation_p.E77Q	p.E524Q	NM_003618	NP_003609	WXS	Illumina HiSeq	Unspecified	Q8IVH8	M4K3_HUMAN			21	1661	-		all_hematologic(82;0.211)	524					Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	c.1570G>C	CCDS1803.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.119729	0.37436	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681;ENST00000536018	T;T;T;T	0.72835	-0.69;-0.54;-0.69;2.23	5.49	5.49	0.81192	.	0.213108	0.48767	D	0.000180	T	0.61375	0.2342	L	0.31578	0.945	0.50813	D	0.999895	B;B	0.28512	0.214;0.136	B;B	0.32022	0.139;0.066	T	0.57148	-0.7861	10	0.09590	T	0.72	.	19.3725	0.94493	0.0:1.0:0.0:0.0	.	503;524	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	Q	524;440;503;77	ENSP00000263881:E524Q;ENSP00000416958:E440Q;ENSP00000345434:E503Q;ENSP00000440580:E77Q	ENSP00000263881:E524Q	E	-	1	0	MAP4K3	39367514	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.136000	0.64783	2.565000	0.86533	0.585000	0.79938	GAA		0.338	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		15	54	0	0	0	0.00316338	0	15	54				
WDPCP	51057	broad.mit.edu	37	2	63712095	63712095	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr2:63712095T>C	ENST00000272321.7	-	5	807	c.280A>G	c.(280-282)Aac>Gac	p.N94D	WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_Missense_Mutation_p.N94D	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	94					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GGGCGTCTGTTTTTGAGCGTC	0.363																																							uc002sch.2		NA																	0					0						c.(280-282)AAC>GAC		hypothetical protein LOC51057 isoform 2							98.0	87.0	90.0					2																	63712095		1808	4076	5884	SO:0001583	missense	51057				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane		g.chr2:63712095T>C		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.280A>G	2.37:g.63712095T>C	ENSP00000272321:p.Asn94Asp		Somatic				C2orf86_uc002sci.1_Missense_Mutation_p.N70D|C2orf86_uc010fcr.1_5'Flank	p.N94D	NM_015910	NP_056994	WXS	Illumina HiSeq	Unspecified	O95876	FRITZ_HUMAN			5	726	-			94					Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	c.280A>G	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463644	0.84425	.	.	ENSG00000143951	ENST00000272321;ENST00000409562;ENST00000431065	T;T;D	0.83506	0.21;0.21;-1.73	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.91002	0.7170	M	0.78637	2.42	0.50171	D	0.999852	D;D	0.89917	0.971;1.0	P;D	0.75020	0.54;0.985	D	0.91882	0.5516	10	0.72032	D	0.01	-17.8294	16.4447	0.83919	0.0:0.0:0.0:1.0	.	94;94	O95876-2;O95876	.;FRITZ_HUMAN	D	94;94;79	ENSP00000272321:N94D;ENSP00000387222:N94D;ENSP00000396226:N79D	ENSP00000272321:N94D	N	-	1	0	WDPCP	63565599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.363000	0.73082	2.284000	0.76573	0.528000	0.53228	AAC		0.363	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910		5	82	0	0	0	0.00116845	0	5	82				
CYP26B1	56603	broad.mit.edu	37	2	72360161	72360161	+	Silent	SNP	G	G	A	rs188235033		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr2:72360161G>A	ENST00000001146.2	-	5	1340	c.1137C>T	c.(1135-1137)ttC>ttT	p.F379F	CYP26B1_ENST00000412253.1_Silent_p.F188F|CYP26B1_ENST00000546307.1_Silent_p.F304F	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	379					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CATCAAGCTCGAAGGTCTGCA	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16478	0.0		0.001	False		,,,				2504	0.0						uc002sih.1		NA																	0				skin(2)	2						c.(1135-1137)TTC>TTT		cytochrome P450, family 26, subfamily b,							47.0	43.0	44.0					2																	72360161		2202	4300	6502	SO:0001819	synonymous_variant	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72360161G>A		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1137C>T	2.37:g.72360161G>A			Somatic				CYP26B1_uc010yra.1_Silent_p.F362F|CYP26B1_uc010yrb.1_Silent_p.F304F	p.F379F	NM_019885	NP_063938	WXS	Illumina HiSeq	Unspecified	Q9NR63	CP26B_HUMAN			5	1137	-			379					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	ENST00000001146.2	37	c.1137C>T	CCDS1919.1																																																																																				0.662	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		11	36	0	0	0	0.000673444	0	11	36				
STEAP3	55240	broad.mit.edu	37	2	120003328	120003328	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr2:120003328G>C	ENST00000354888.5	+	3	760	c.256G>C	c.(256-258)Gtc>Ctc	p.V86L	STEAP3_ENST00000393108.2_Missense_Mutation_p.V86L|STEAP3_ENST00000425223.2_Missense_Mutation_p.V86L|STEAP3_ENST00000393110.2_Missense_Mutation_p.V96L|STEAP3_ENST00000450943.2_Missense_Mutation_p.V86L|STEAP3_ENST00000393106.2_Missense_Mutation_p.V86L|STEAP3_ENST00000409811.1_Missense_Mutation_p.V86L|STEAP3_ENST00000393107.2_Missense_Mutation_p.V86L|STEAP3-AS1_ENST00000454260.1_RNA	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	86					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						CTCCCCGGAGGTCATCTTTGT	0.592																																							uc002tlp.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(256-258)GTC>CTC		dudulin 2 isoform b							63.0	58.0	59.0					2																	120003328		2203	4300	6503	SO:0001583	missense	55240				apoptosis|cell cycle|cellular iron ion homeostasis|protein secretion|transferrin transport|transmembrane transport	endosome membrane|integral to membrane|multivesicular body	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding	g.chr2:120003328G>C	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.256G>C	2.37:g.120003328G>C	ENSP00000346961:p.Val86Leu		Somatic				STEAP3_uc002tlq.2_Missense_Mutation_p.V96L|STEAP3_uc002tlr.2_Missense_Mutation_p.V86L|STEAP3_uc010fle.2_Missense_Mutation_p.V86L	p.V86L	NM_018234	NP_060704	WXS	Illumina HiSeq	Unspecified	Q658P3	STEA3_HUMAN			3	413	+			86			Cytoplasmic (Potential).		A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	ENST00000354888.5	37	c.256G>C	CCDS2125.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.358794	0.24598	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000450943;ENST00000393110;ENST00000393106;ENST00000409811;ENST00000393107;ENST00000425223	T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	4.96	1.35	0.21983	NAD(P)-binding domain (1);	0.249318	0.31760	N	0.007118	T	0.25568	0.0622	N	0.16567	0.415	0.27924	N	0.938135	B;B;B	0.16166	0.016;0.007;0.001	B;B;B	0.21151	0.033;0.017;0.021	T	0.14337	-1.0476	9	.	.	.	-36.3939	6.3448	0.21343	0.2676:0.1392:0.5932:0.0	.	86;96;86	B8ZZX6;Q658P3-2;Q658P3	.;.;STEA3_HUMAN	L	86;86;86;96;86;86;86;86	ENSP00000376820:V86L;ENSP00000346961:V86L;ENSP00000396873:V86L;ENSP00000376822:V96L;ENSP00000376818:V86L;ENSP00000386510:V86L;ENSP00000376819:V86L;ENSP00000396214:V86L	.	V	+	1	0	STEAP3	119719798	0.000000	0.05858	0.522000	0.27862	0.696000	0.40369	-0.354000	0.07681	0.291000	0.22468	0.655000	0.94253	GTC		0.592	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234		12	28	0	0	0	0.00136819	0	12	28				
SCRT2	85508	broad.mit.edu	37	20	644541	644541	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr20:644541G>T	ENST00000246104.6	-	2	1275	c.698C>A	c.(697-699)tCg>tAg	p.S233*	RP5-850E9.3_ENST00000488788.2_Intron	NM_033129.3	NP_149120.1	Q9NQ03	SCRT2_HUMAN	scratch family zinc finger 2	233					negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			kidney(1)|liver(1)|ovary(1)	3						GCCGGTGTGCGAGCGCATGTG	0.692																																							uc002wec.2		NA																	0					0						c.(697-699)TCG>TAG		scratch 2 protein							18.0	17.0	17.0					20																	644541		2195	4295	6490	SO:0001587	stop_gained	85508				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:644541G>T		CCDS13006.1	20p13	2013-10-09	2013-10-09		ENSG00000215397	ENSG00000215397		"""Zinc fingers, C2H2-type"""	15952	protein-coding gene	gene with protein product			"""scratch (drosophila homolog) 2, zinc finger protein"", ""scratch homolog 2, zinc finger protein (Drosophila)"""			11274425	Standard	NM_033129		Approved	ZNF898B	uc002wec.3	Q9NQ03	OTTHUMG00000130829	ENST00000246104.6:c.698C>A	20.37:g.644541G>T	ENSP00000246104:p.Ser233*		Somatic				SRXN1_uc002web.2_Intron	p.S233*	NM_033129	NP_149120	WXS	Illumina HiSeq	Unspecified	Q9NQ03	SCRT2_HUMAN			2	1276	-			233			C2H2-type 3.			Nonsense_Mutation	SNP	ENST00000246104.6	37	c.698C>A	CCDS13006.1	.	.	.	.	.	.	.	.	.	.	g	41	9.004258	0.99033	.	.	ENSG00000215397	ENST00000246104	.	.	.	3.39	1.4	0.22301	.	0.000000	0.64402	U	0.000017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-8.8118	7.6705	0.28455	0.2162:0.0:0.7837:0.0	.	.	.	.	X	233	.	ENSP00000246104:S233X	S	-	2	0	SCRT2	592541	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	6.129000	0.71657	0.150000	0.19136	0.457000	0.33378	TCG		0.692	SCRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253383.2	NM_033129		20	9	1	0	7.41877e-09	0.00188189	3.17236e-08	20	9				
RSPH1	89765	broad.mit.edu	37	21	43896056	43896056	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr21:43896056C>A	ENST00000291536.3	-	8	996	c.829G>T	c.(829-831)Gag>Tag	p.E277*	RSPH1_ENST00000398352.3_Nonsense_Mutation_p.E239*	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	277					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						TCCCGGCTCTCTTCCCGGAGG	0.642																																					Esophageal Squamous(23;63 706 6286 10288 12913)	Esophageal Squamous(23;63 706 6286 10288 12913)	uc002zbg.2		NA																	0				ovary(1)	1						c.(829-831)GAG>TAG		testis-specific gene A2							170.0	133.0	145.0					21																	43896056		2203	4300	6503	SO:0001587	stop_gained	89765				meiosis	cytosol|nucleus		g.chr21:43896056C>A	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.829G>T	21.37:g.43896056C>A	ENSP00000291536:p.Glu277*		Somatic					p.E277*	NM_080860	NP_543136	WXS	Illumina HiSeq	Unspecified	Q8WYR4	RSPH1_HUMAN			8	934	-			277					A8MWV0|B2RBN9|Q3MJA1	Nonsense_Mutation	SNP	ENST00000291536.3	37	c.829G>T	CCDS13688.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303024	0.40795	.	.	ENSG00000160188	ENST00000291536;ENST00000398352	.	.	.	3.03	3.03	0.35002	.	3.374130	0.02984	U	0.146024	.	.	.	.	.	.	0.48135	D	0.999591	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	9.794	0.40724	0.0:1.0:0.0:0.0	.	.	.	.	X	277;239	.	ENSP00000291536:E277X	E	-	1	0	RSPH1	42769125	0.007000	0.16637	0.009000	0.14445	0.001000	0.01503	1.297000	0.33400	2.018000	0.59344	0.561000	0.74099	GAG		0.642	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1			11	100	1	0	6.40141e-05	0.000978159	0.000267738	11	100				
CRYBA4	1413	broad.mit.edu	37	22	27021529	27021529	+	Silent	SNP	C	C	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr22:27021529C>A	ENST00000354760.3	+	4	278	c.243C>A	c.(241-243)ggC>ggA	p.G81G	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	81	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						ATGCCTGGGGCGGCAACACGG	0.632																																							uc003acz.3		NA																	0					0						c.(241-243)GGC>GGA		crystallin, beta A4							116.0	112.0	113.0					22																	27021529		2203	4300	6503	SO:0001819	synonymous_variant	1413				camera-type eye development|visual perception	soluble fraction	structural constituent of eye lens	g.chr22:27021529C>A		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.243C>A	22.37:g.27021529C>A			Somatic					p.G81G	NM_001886	NP_001877	WXS	Illumina HiSeq	Unspecified	P53673	CRBA4_HUMAN			4	278	+			81			Beta/gamma crystallin 'Greek key' 2.		Q4VB22|Q6ICE4	Silent	SNP	ENST00000354760.3	37	c.243C>A	CCDS13841.1																																																																																				0.632	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886		8	288	1	0	0.000157383	0.00307968	0.000653483	8	288				
DEPDC5	9681	broad.mit.edu	37	22	32234733	32234733	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr22:32234733G>A	ENST00000382112.3	+	26	2460	c.2390G>A	c.(2389-2391)cGt>cAt	p.R797H	RNU6-201P_ENST00000517100.1_RNA|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R797H|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R797H|DEPDC5_ENST00000382105.2_Missense_Mutation_p.R728H|DEPDC5_ENST00000400246.1_Missense_Mutation_p.R806H|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R806H|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R728H|DEPDC5_ENST00000382111.2_Missense_Mutation_p.R806H	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	806					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATTTGCCAACGTCTCATGCAG	0.517																																							uc003als.2		NA																	0				ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(2389-2391)CGT>CAT		DEP domain containing 5 isoform 1							138.0	141.0	140.0					22																	32234733		1988	4163	6151	SO:0001583	missense	9681				intracellular signal transduction			g.chr22:32234733G>A	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2390G>A	22.37:g.32234733G>A	ENSP00000371546:p.Arg797His		Somatic				DEPDC5_uc011als.1_Missense_Mutation_p.R728H|DEPDC5_uc011alu.1_Missense_Mutation_p.R806H|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.R797H|DEPDC5_uc003alu.2_Missense_Mutation_p.R246H|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.R127H|DEPDC5_uc003alw.2_Missense_Mutation_p.R95H|DEPDC5_uc011alx.1_Intron	p.R797H	NM_014662	NP_055477	WXS	Illumina HiSeq	Unspecified	O75140	DEPD5_HUMAN			27	2532	+			797					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	c.2390G>A	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	G	36	5.704906	0.96812	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.65	5.65	0.86999	.	0.054000	0.64402	D	0.000001	T	0.51736	0.1692	M	0.81682	2.555	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.998;0.996;0.998;0.996;0.996	T	0.54840	-0.8233	10	0.87932	D	0	.	18.7211	0.91694	0.0:0.0:1.0:0.0	.	127;806;728;806;797;797	B4DSS1;B9EGN9;B4DH93;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	H	728;806;797;728;806;728;797;806;797	ENSP00000440210:R728H;ENSP00000266091:R806H;ENSP00000383108:R797H;ENSP00000383105:R806H;ENSP00000371539:R728H;ENSP00000371546:R797H;ENSP00000371545:R806H;ENSP00000383107:R797H	ENSP00000266091:R806H	R	+	2	0	DEPDC5	30564733	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.263000	0.95617	2.663000	0.90544	0.655000	0.94253	CGT		0.517	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		15	539	0	0	0	0.00400662	0	15	539				
ENTHD1	150350	broad.mit.edu	37	22	40217072	40217072	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr22:40217072G>T	ENST00000325157.6	-	5	1008	c.758C>A	c.(757-759)gCa>gAa	p.A253E		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	253										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					AGGAGGTGTTGCTAGTAAAGG	0.393																																							uc003ayg.2		NA																	0				ovary(2)|skin(1)	3						c.(757-759)GCA>GAA		ENTH domain containing 1							104.0	97.0	99.0					22																	40217072		2203	4300	6503	SO:0001583	missense	150350							g.chr22:40217072G>T	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.758C>A	22.37:g.40217072G>T	ENSP00000317431:p.Ala253Glu		Somatic					p.A253E	NM_152512	NP_689725	WXS	Illumina HiSeq	Unspecified	Q8IYW4	ENTD1_HUMAN			5	1009	-	Melanoma(58;0.0749)		253					B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	37	c.758C>A	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534838	0.27475	.	.	ENSG00000176177	ENST00000325157	T	0.42131	0.98	5.25	1.95	0.26073	.	1.523510	0.03964	N	0.290566	T	0.27629	0.0679	N	0.22421	0.69	0.09310	N	1	B	0.29432	0.244	B	0.27500	0.08	T	0.17592	-1.0364	10	0.15066	T	0.55	2.6284	5.3635	0.16101	0.1867:0.1745:0.6388:0.0	.	253	Q8IYW4	ENTD1_HUMAN	E	253	ENSP00000317431:A253E	ENSP00000317431:A253E	A	-	2	0	ENTHD1	38547018	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.045000	0.12003	0.280000	0.22209	0.591000	0.81541	GCA		0.393	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		19	50	1	0	1.87028e-06	0.00188189	7.87994e-06	19	50				
PHF21B	112885	broad.mit.edu	37	22	45283868	45283868	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr22:45283868C>T	ENST00000313237.5	-	10	1322	c.1172G>A	c.(1171-1173)tGg>tAg	p.W391*	PHF21B_ENST00000404079.2_Nonsense_Mutation_p.W337*|PHF21B_ENST00000396103.3_Nonsense_Mutation_p.W349*|PHF21B_ENST00000403565.1_Nonsense_Mutation_p.W187*	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	391							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGGCACACCCACACGCCCTT	0.697																																							uc003bfn.2		NA																	0				ovary(2)|skin(1)	3						c.(1171-1173)TGG>TAG		PHD finger protein 21B isoform 1							14.0	13.0	13.0					22																	45283868		2189	4285	6474	SO:0001587	stop_gained	112885						zinc ion binding	g.chr22:45283868C>T	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.1172G>A	22.37:g.45283868C>T	ENSP00000324403:p.Trp391*		Somatic				PHF21B_uc003bfm.2_Nonsense_Mutation_p.W187*|PHF21B_uc011aqk.1_Nonsense_Mutation_p.W337*|PHF21B_uc011aql.1_Nonsense_Mutation_p.W349*|PHF21B_uc011aqm.1_3'UTR	p.W391*	NM_138415	NP_612424	WXS	Illumina HiSeq	Unspecified	Q96EK2	PF21B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)	10	1323	-		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)	391			PHD-type.		B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Nonsense_Mutation	SNP	ENST00000313237.5	37	c.1172G>A	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	C	33	5.242580	0.95272	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079	.	.	.	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5461	16.5776	0.84705	0.0:1.0:0.0:0.0	.	.	.	.	X	187;391;349;337	.	ENSP00000324403:W391X	W	-	2	0	PHF21B	43662532	1.000000	0.71417	0.980000	0.43619	0.959000	0.62525	7.403000	0.79983	2.106000	0.64143	0.462000	0.41574	TGG		0.697	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415		5	16	0	0	0	0.00198382	0	5	16				
KCNH8	131096	broad.mit.edu	37	3	19436748	19436748	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:19436748G>C	ENST00000328405.2	+	7	1388	c.1122G>C	c.(1120-1122)tgG>tgC	p.W374C	KCNH8_ENST00000475063.1_3'UTR|KCNH8_ENST00000537696.1_Missense_Mutation_p.W15C	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	374					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.W374C(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CGTGTATCTGGTACGTCATTG	0.433																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(1)	5						c.(1120-1122)TGG>TGC		potassium voltage-gated channel, subfamily H,							157.0	139.0	145.0					3																	19436748		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19436748G>C	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1122G>C	3.37:g.19436748G>C	ENSP00000328813:p.Trp374Cys		Somatic				KCNH8_uc011awe.1_Missense_Mutation_p.W374C|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_Missense_Mutation_p.W5C	p.W374C	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			7	1317	+			374			Helical; Name=Segment S5; (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.1122G>C	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569676	0.86439	.	.	ENSG00000183960	ENST00000328405;ENST00000537696	D;T	0.97455	-4.39;1.82	5.79	5.79	0.91817	Ion transport (1);	0.000000	0.30920	U	0.008609	D	0.98852	0.9612	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99184	1.0868	9	.	.	.	.	20.0326	0.97545	0.0:0.0:1.0:0.0	.	15;374;374	B7Z2I7;B7Z398;Q96L42	.;.;KCNH8_HUMAN	C	374;15	ENSP00000328813:W374C;ENSP00000446294:W15C	.	W	+	3	0	KCNH8	19411752	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.869000	0.99810	2.732000	0.93576	0.557000	0.71058	TGG		0.433	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		39	63	0	0	0	0.0025221	0	39	63				
ULK4	54986	broad.mit.edu	37	3	41795941	41795941	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:41795941A>C	ENST00000301831.4	-	22	2695	c.2233T>G	c.(2233-2235)Tca>Gca	p.S745A		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	745					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		ATGCATGTTGAGGGGCTGTCA	0.368																																							uc003ckv.3		NA																	0					0						c.(2233-2235)TCA>GCA		unc-51-like kinase 4							96.0	92.0	93.0					3																	41795941		1828	4083	5911	SO:0001583	missense	54986						ATP binding|protein serine/threonine kinase activity	g.chr3:41795941A>C	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2233T>G	3.37:g.41795941A>C	ENSP00000301831:p.Ser745Ala		Somatic					p.S745A	NM_017886	NP_060356	WXS	Illumina HiSeq	Unspecified	Q96C45	ULK4_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	22	2434	-			745					A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	c.2233T>G	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.709539	0.48517	.	.	ENSG00000168038	ENST00000301831	T	0.68025	-0.3	5.3	5.3	0.74995	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.64402	U	0.000001	T	0.78342	0.4268	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78838	-0.2046	10	0.48119	T	0.1	.	14.2105	0.65762	1.0:0.0:0.0:0.0	.	745	Q96C45	ULK4_HUMAN	A	745	ENSP00000301831:S745A	ENSP00000301831:S745A	S	-	1	0	ULK4	41770945	1.000000	0.71417	0.227000	0.23927	0.229000	0.25112	6.798000	0.75155	1.995000	0.58328	0.482000	0.46254	TCA		0.368	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		7	82	0	0	0	0.00307968	0	7	82				
PVRL3	25945	broad.mit.edu	37	3	110845158	110845158	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:110845158G>C	ENST00000485303.1	+	5	1320	c.1045G>C	c.(1045-1047)Gac>Cac	p.D349H	PVRL3_ENST00000493615.1_Missense_Mutation_p.D326H|PVRL3_ENST00000319792.3_Missense_Mutation_p.D349H	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	349	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TCAAAGAAGTGACCAAAAAGT	0.318																																							uc003dxt.1		NA																	0				upper_aerodigestive_tract(2)	2						c.(1045-1047)GAC>CAC		poliovirus receptor-related 3 precursor							84.0	82.0	83.0					3																	110845158		2202	4300	6502	SO:0001583	missense	25945				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity	g.chr3:110845158G>C	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1045G>C	3.37:g.110845158G>C	ENSP00000418070:p.Asp349His		Somatic				PVRL3_uc003dxu.1_Missense_Mutation_p.D326H	p.D349H	NM_015480	NP_056295	WXS	Illumina HiSeq	Unspecified	Q9NQS3	PVRL3_HUMAN			5	1045	+			349			Extracellular (Potential).|Ig-like C2-type 2.		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	c.1045G>C	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088301	0.36855	.	.	ENSG00000177707	ENST00000485303;ENST00000319792;ENST00000493615	T;T;T	0.15017	2.46;2.46;2.46	5.5	4.6	0.57074	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.490738	0.25063	N	0.033437	T	0.14356	0.0347	L	0.28556	0.865	0.37733	D	0.925333	B;B	0.27192	0.171;0.139	B;B	0.26770	0.073;0.037	T	0.08186	-1.0734	10	0.38643	T	0.18	.	14.2714	0.66154	0.0:0.1502:0.8498:0.0	.	326;349	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	H	349;349;326	ENSP00000418070:D349H;ENSP00000321514:D349H;ENSP00000420579:D326H	ENSP00000321514:D349H	D	+	1	0	PVRL3	112327848	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.877000	0.56123	1.402000	0.46780	0.591000	0.81541	GAC		0.318	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480		10	48	0	0	0	0.000978159	0	10	48				
KALRN	8997	broad.mit.edu	37	3	123983428	123983428	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:123983428C>T	ENST00000240874.3	+	4	498	c.341C>T	c.(340-342)aCg>aTg	p.T114M	KALRN_ENST00000360013.3_Missense_Mutation_p.T114M|KALRN_ENST00000460856.1_Missense_Mutation_p.T114M	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	114	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CTCCTCAAAACGCTGCAGGAA	0.537																																							uc003ehg.2		NA																	0				large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						c.(340-342)ACG>ATG		kalirin, RhoGEF kinase isoform 1							89.0	80.0	83.0					3																	123983428		2203	4300	6503	SO:0001583	missense	8997				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr3:123983428C>T	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.341C>T	3.37:g.123983428C>T	ENSP00000240874:p.Thr114Met		Somatic				KALRN_uc010hrv.1_Missense_Mutation_p.T114M|KALRN_uc003ehf.1_Missense_Mutation_p.T114M|KALRN_uc011bjy.1_Missense_Mutation_p.T114M	p.T114M	NM_001024660	NP_001019831	WXS	Illumina HiSeq	Unspecified	O60229	KALRN_HUMAN			4	468	+			114			CRAL-TRIO.		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	c.341C>T	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.350616|4.350616	0.82132|0.82132	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000448253;ENST00000354186|ENST00000460856;ENST00000240874;ENST00000360013	.|D;D;D	.|0.84223	.|-1.82;-1.82;-1.82	4.58|4.58	4.58|4.58	0.56647|0.56647	.|Cellular retinaldehyde-binding/triple function, C-terminal (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86548|0.86548	0.5959|0.5959	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.992;0.999;0.99	.|P;D;P	.|0.66196	.|0.88;0.942;0.81	D|D	0.86819|0.86819	0.2003|0.2003	5|10	.|0.41790	.|T	.|0.15	.|.	17.9308|17.9308	0.88996|0.88996	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|114;114;114	.|C9IZQ6;O60229;O60229-2	.|.;KALRN_HUMAN;.	C|M	142;92|114	.|ENSP00000418611:T114M;ENSP00000240874:T114M;ENSP00000353109:T114M	.|ENSP00000240874:T114M	R|T	+|+	1|2	0|0	KALRN|KALRN	125466118|125466118	0.564000|0.564000	0.26602|0.26602	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.261000|1.261000	0.32980|0.32980	2.543000|2.543000	0.85770|0.85770	0.655000|0.655000	0.94253|0.94253	CGC|ACG		0.537	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947		25	24	0	0	0	0.00395357	0	25	24				
SLC41A3	54946	broad.mit.edu	37	3	125786931	125786931	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:125786931C>G	ENST00000315891.6	-	2	370	c.132G>C	c.(130-132)gaG>gaC	p.E44D	AC117422.1_ENST00000581281.1_RNA|SLC41A3_ENST00000346785.5_Missense_Mutation_p.E44D|SLC41A3_ENST00000360370.4_Missense_Mutation_p.E44D|SLC41A3_ENST00000508835.1_Intron|SLC41A3_ENST00000514023.1_5'UTR	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		CGCTTTGGCTCTCAGGGGCCC	0.627																																							uc003eij.2		NA																	0					0						c.(130-132)GAG>GAC		solute carrier family 41, member 3 isoform 1																																				SO:0001583	missense	54946					integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr3:125786931C>G		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.132G>C	3.37:g.125786931C>G	ENSP00000326070:p.Glu44Asp		Somatic				SLC41A3_uc003eil.2_Missense_Mutation_p.E44D|SLC41A3_uc003eik.2_Missense_Mutation_p.E44D|SLC41A3_uc011bkh.1_Intron|SLC41A3_uc010hsd.1_Missense_Mutation_p.E44D	p.E44D	NM_001008485	NP_001008485	WXS	Illumina HiSeq	Unspecified	Q96GZ6	S41A3_HUMAN		GBM - Glioblastoma multiforme(114;0.167)	2	358	-			44					A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	ENST00000315891.6	37	c.132G>C	CCDS33843.1	.	.	.	.	.	.	.	.	.	.	C	6.399	0.441650	0.12164	.	.	ENSG00000114544	ENST00000360370;ENST00000346785;ENST00000458524;ENST00000315891;ENST00000514677;ENST00000513723;ENST00000512470;ENST00000510651;ENST00000514333;ENST00000507280;ENST00000514891;ENST00000504035;ENST00000509064;ENST00000509452	T;T;T;T;T;T;T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48	3.95	-0.238	0.13055	.	0.734122	0.11829	N	0.525388	T	0.14270	0.0345	N	0.14661	0.345	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.27673	-1.0067	10	0.23891	T	0.37	-17.5931	4.8627	0.13592	0.0:0.4646:0.3329:0.2026	.	44;44;44;44	A8MQ22;E7ENY4;Q96GZ6-3;Q96GZ6	.;.;.;S41A3_HUMAN	D	44	ENSP00000353533:E44D;ENSP00000264471:E44D;ENSP00000326070:E44D;ENSP00000422828:E44D;ENSP00000425373:E44D;ENSP00000421008:E44D;ENSP00000423524:E44D;ENSP00000422458:E44D;ENSP00000422531:E44D;ENSP00000423154:E44D;ENSP00000421940:E44D;ENSP00000424882:E44D;ENSP00000422150:E44D	ENSP00000326070:E44D	E	-	3	2	SLC41A3	127269621	0.001000	0.12720	0.019000	0.16419	0.044000	0.14063	-0.049000	0.11924	-0.167000	0.10871	-0.175000	0.13238	GAG		0.627	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836		9	124	0	0	0	0.000442599	0	9	124				
ARHGEF26	26084	broad.mit.edu	37	3	153905608	153905608	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:153905608G>A	ENST00000356448.4	+	7	1906	c.1622G>A	c.(1621-1623)cGa>cAa	p.R541Q	ARHGEF26_ENST00000465817.1_Intron|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.R541Q	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	541	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						TACCAACAACGAACACTACAA	0.323																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)		uc011bog.1		NA																	0				large_intestine(1)	1						c.(1621-1623)CGA>CAA		Src homology 3 domain-containing guanine							79.0	72.0	74.0					3																	153905608		1883	4102	5985	SO:0001583	missense	26084				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity	g.chr3:153905608G>A	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1622G>A	3.37:g.153905608G>A	ENSP00000348828:p.Arg541Gln		Somatic				SGEF_uc011boh.1_Missense_Mutation_p.R541Q	p.R541Q	NM_015595	NP_056410	WXS	Illumina HiSeq	Unspecified	Q96DR7	ARHGQ_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		7	1833	+			541			DH.		B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	37	c.1622G>A	CCDS46938.1	.	.	.	.	.	.	.	.	.	.	G	37	6.291555	0.97449	.	.	ENSG00000114790	ENST00000356448;ENST00000465093	T;T	0.62105	0.05;0.05	5.91	5.91	0.95273	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79557	0.4466	M	0.65975	2.015	0.80722	D	1	P;D	0.89917	0.921;1.0	P;D	0.87578	0.803;0.998	T	0.79147	-0.1923	10	0.62326	D	0.03	-18.4768	20.2985	0.98592	0.0:0.0:1.0:0.0	.	541;541	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	Q	541	ENSP00000348828:R541Q;ENSP00000423418:R541Q	ENSP00000348828:R541Q	R	+	2	0	ARHGEF26	155388298	1.000000	0.71417	0.241000	0.24154	0.698000	0.40448	9.276000	0.95745	2.793000	0.96121	0.655000	0.94253	CGA		0.323	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595		10	9	0	0	0	0.000978159	0	10	9				
HTR3D	200909	broad.mit.edu	37	3	183756208	183756208	+	Missense_Mutation	SNP	G	G	A	rs113942045		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:183756208G>A	ENST00000382489.3	+	7	931	c.931G>A	c.(931-933)Gcc>Acc	p.A311T	HTR3D_ENST00000334128.2_Missense_Mutation_p.A136T|HTR3D_ENST00000428798.2_Missense_Mutation_p.A261T|HTR3D_ENST00000453435.1_Missense_Mutation_p.A90T	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	311					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	TGTCTACTTCGCCCTGTGCCT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17478	0.0		0.0	False		,,,				2504	0.0						uc011bqv.1		NA																	0					0						c.(931-933)GCC>ACC		5-hydroxytryptamine receptor 3 subunit D isoform							81.0	77.0	78.0					3																	183756208		2203	4300	6503	SO:0001583	missense	200909					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity	g.chr3:183756208G>A	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.931G>A	3.37:g.183756208G>A	ENSP00000371929:p.Ala311Thr		Somatic				HTR3D_uc003fmj.2_Missense_Mutation_p.A136T|HTR3D_uc011bqu.1_Missense_Mutation_p.A261T|HTR3D_uc010hxp.2_Missense_Mutation_p.A90T	p.A311T	NM_001163646	NP_001157118	WXS	Illumina HiSeq	Unspecified	Q70Z44	5HT3D_HUMAN	Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		7	931	+	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		311			Helical; Name=3; (Potential).		C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	c.931G>A	CCDS54685.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	12.44	1.939207	0.34189	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489;ENST00000453435	D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06	3.36	2.48	0.30137	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.262140	0.31554	N	0.007456	D	0.82604	0.5073	L	0.41632	1.29	0.22017	N	0.999413	P;D;D;P	0.54601	0.806;0.967;0.967;0.943	B;P;P;P	0.55545	0.435;0.778;0.778;0.701	T	0.71178	-0.4669	10	0.26408	T	0.33	-8.0152	6.8263	0.23885	0.1325:0.0:0.8675:0.0	.	311;136;90;136	Q70Z44;Q70Z44-2;Q70Z44-3;F6WC43	5HT3D_HUMAN;.;.;.	T	136;261;311;90	ENSP00000334315:A136T;ENSP00000405409:A261T;ENSP00000371929:A311T;ENSP00000389268:A90T	ENSP00000334315:A136T	A	+	1	0	HTR3D	185238902	0.983000	0.35010	1.000000	0.80357	0.197000	0.23852	1.661000	0.37408	0.750000	0.32877	-0.448000	0.05591	GCC		0.592	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537		34	38	0	0	0	0.00283554	0	34	38				
SDHAP1	255812	broad.mit.edu	37	3	195692311	195692311	+	RNA	SNP	T	T	C	rs62282793	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:195692311T>C	ENST00000427841.1	-	0	2191					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTCCCAGTGCTGACGTCCACA	0.607																																					Ovarian(67;1158 1227 12109 20189 43170)	Ovarian(67;1158 1227 12109 20189 43170)	uc003fvy.2		NA																	0					0						c.(232-234)AGC>GGC		Homo sapiens full length insert cDNA clone ZC24D06.																																						255812							g.chr3:195692311T>C	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195692311T>C			Somatic				SDHAP1_uc003fvx.3_RNA	p.S78G			WXS	Illumina HiSeq	Unspecified					3	346	-									Missense_Mutation	SNP	ENST00000427841.1	37	c.232A>G																																																																																					0.607	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			4	11	0	0	0	0.000602214	0	4	11				
SDHAP1	255812	broad.mit.edu	37	3	195692347	195692347	+	RNA	SNP	G	G	A	rs62282794		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:195692347G>A	ENST00000427841.1	-	0	2155					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTCCTCCAGTGCTCCTCAAAG	0.572																																					Ovarian(67;1158 1227 12109 20189 43170)	Ovarian(67;1158 1227 12109 20189 43170)	uc003fvy.2		NA																	0					0						c.(196-198)CAC>TAC		Homo sapiens full length insert cDNA clone ZC24D06.																																						255812							g.chr3:195692347G>A	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195692347G>A			Somatic				SDHAP1_uc003fvx.3_RNA	p.H66Y			WXS	Illumina HiSeq	Unspecified					3	310	-									Missense_Mutation	SNP	ENST00000427841.1	37	c.196C>T																																																																																					0.572	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			7	15	0	0	0	0.000978159	0	7	15				
SLIT2	9353	broad.mit.edu	37	4	20530615	20530615	+	Silent	SNP	G	G	A	rs576915758		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr4:20530615G>A	ENST00000504154.1	+	16	1758	c.1506G>A	c.(1504-1506)gcG>gcA	p.A502A	MIR218-1_ENST00000384999.1_RNA|SLIT2_ENST00000503837.1_Silent_p.A498A|SLIT2_ENST00000503823.1_Silent_p.A494A|SLIT2_ENST00000273739.5_Silent_p.A506A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	502	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACTGCTTTGCGGATCTGGCTT	0.393																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1504-1506)GCG>GCA		slit homolog 2 precursor							119.0	121.0	120.0					4																	20530615		2203	4300	6503	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20530615G>A	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1506G>A	4.37:g.20530615G>A			Somatic				SLIT2_uc003gps.1_Silent_p.A494A	p.A502A	NM_004787	NP_004778	WXS	Illumina HiSeq	Unspecified	O94813	SLIT2_HUMAN			16	1710	+			502			LRRNT 3.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.1506G>A	CCDS3426.1																																																																																				0.393	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			5	141	0	0	0	0.000602214	0	5	141				
GABRA2	2555	broad.mit.edu	37	4	46334683	46334683	+	Silent	SNP	G	G	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr4:46334683G>C	ENST00000510861.1	-	4	377	c.204C>G	c.(202-204)gtC>gtG	p.V68V	GABRA2_ENST00000356504.1_Silent_p.V68V|GABRA2_ENST00000515082.1_Silent_p.V68V|GABRA2_ENST00000514090.1_Silent_p.V68V|GABRA2_ENST00000381620.4_Silent_p.V68V|GABRA2_ENST00000540012.1_Intron|GABRA2_ENST00000507069.1_Silent_p.V68V			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	68					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TGTTAGTGAAGACTTCAGTAA	0.358																																							uc003gxc.3		NA																	0				ovary(2)|skin(2)	4						c.(202-204)GTC>GTG		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						83.0	86.0	85.0					4																	46334683		2203	4300	6503	SO:0001819	synonymous_variant	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46334683G>C		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.204C>G	4.37:g.46334683G>C			Somatic				GABRA2_uc010igc.2_Silent_p.V68V|GABRA2_uc011bzc.1_Intron|GABRA2_uc003gxe.2_Silent_p.V68V	p.V68V	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			3	877	-			68			Extracellular (Probable).		A8K0U7|B7Z1H8|Q59G14	Silent	SNP	ENST00000510861.1	37	c.204C>G	CCDS3471.1																																																																																				0.358	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			26	82	0	0	0	0.00395357	0	26	82				
FDCSP	260436	broad.mit.edu	37	4	71099895	71099895	+	Silent	SNP	C	C	T	rs200937610		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr4:71099895C>T	ENST00000317987.5	+	4	361	c.249C>T	c.(247-249)agC>agT	p.S83S		NM_152997.3	NP_694542.1	Q8NFU4	FDSCP_HUMAN	follicular dendritic cell secreted protein	83	O-glycosylated at one site.					extracellular region (GO:0005576)											CCCTTCCTAGCGAAAAGTAAA	0.373																																							uc003hfd.2		NA																	0				central_nervous_system(1)	1						c.(247-249)AGC>AGT		chromosome 4 open reading frame 7 precursor							92.0	85.0	88.0					4																	71099895		2203	4299	6502	SO:0001819	synonymous_variant	260436					extracellular region		g.chr4:71099895C>T	AF435080	CCDS3537.1	4q13	2011-12-12	2011-12-12	2011-12-12	ENSG00000181617	ENSG00000181617			19215	protein-coding gene	gene with protein product		607241	"""chromosome 4 open reading frame 7"""	C4orf7		12193705, 17548624, 20811673	Standard	NM_152997		Approved	FDC-SP	uc003hfd.3	Q8NFU4	OTTHUMG00000129393	ENST00000317987.5:c.249C>T	4.37:g.71099895C>T			Somatic					p.S83S	NM_152997	NP_694542	WXS	Illumina HiSeq	Unspecified	Q8NFU4	FDSCP_HUMAN			4	334	+			83						Silent	SNP	ENST00000317987.5	37	c.249C>T	CCDS3537.1																																																																																				0.373	FDCSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251549.1	NM_152997		16	42	0	0	0	0.00316338	0	16	42				
INTU	27152	broad.mit.edu	37	4	128565010	128565010	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr4:128565010G>T	ENST00000335251.6	+	2	584	c.481G>T	c.(481-483)Gtg>Ttg	p.V161L	INTU_ENST00000296461.5_Missense_Mutation_p.V161L	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	161					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						ATACAAAGATGTGAATGTTTA	0.393																																							uc003ifk.1		NA																	0				ovary(1)	1						c.(481-483)GTG>TTG		PDZ domain containing 6							99.0	98.0	98.0					4																	128565010		2203	4300	6503	SO:0001583	missense	27152							g.chr4:128565010G>T	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.481G>T	4.37:g.128565010G>T	ENSP00000334003:p.Val161Leu		Somatic				INTU_uc011cgq.1_RNA	p.V161L	NM_015693	NP_056508	WXS	Illumina HiSeq	Unspecified	Q9ULD6	PDZD6_HUMAN			2	551	+			161					A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	c.481G>T	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784192	0.31593	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.61510	0.1	5.1	4.27	0.50696	.	0.306079	0.32190	N	0.006442	T	0.53514	0.1801	M	0.63843	1.955	0.39354	D	0.965804	B	0.29612	0.251	B	0.32928	0.155	T	0.58629	-0.7603	10	0.66056	D	0.02	-7.1781	8.0886	0.30786	0.2872:0.0:0.7128:0.0	.	161	Q9ULD6	PDZD6_HUMAN	L	142;161;161	ENSP00000296461:V161L	ENSP00000296461:V161L	V	+	1	0	INTU	128784460	1.000000	0.71417	0.494000	0.27515	0.536000	0.34869	4.053000	0.57427	1.392000	0.46585	0.655000	0.94253	GTG		0.393	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		49	42	1	0	9.52127e-25	0.00361006	4.26225e-24	49	42				
PCDHB16	57717	broad.mit.edu	37	5	140568073	140568073	+	IGR	SNP	A	A	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr5:140568073A>G	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTTTCTGAAACCGTCTGTTG	0.413																																							uc003liw.1		NA																	0					0						c.(1180-1182)AAA>AAG		protocadherin beta 9 precursor							85.0	91.0	89.0					5																	140568073		2203	4300	6503	SO:0001628	intergenic_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140568073A>G	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140568073A>G			Somatic					p.K394K	NM_019119	NP_061992	WXS	Illumina HiSeq	Unspecified	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		3	1182	+			394			Extracellular (Potential).|Cadherin 4.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	c.1182A>G	CCDS4251.1																																																																																				0.413	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		3	89	0	0	0	6.4e-05	0	3	89				
DOCK2	1794	broad.mit.edu	37	5	169472907	169472907	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr5:169472907C>T	ENST00000256935.8	+	39	4044	c.3964C>T	c.(3964-3966)Ctg>Ttg	p.L1322L	DOCK2_ENST00000540750.1_Silent_p.L383L|DOCK2_ENST00000520908.1_Silent_p.L814L|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1322	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGCCAGAACCTGGTAAGGCA	0.592																																							uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(3964-3966)CTG>TTG		dedicator of cytokinesis 2							130.0	117.0	121.0					5																	169472907		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169472907C>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3964C>T	5.37:g.169472907C>T			Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.L814L	p.L1322L	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		39	4044	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1322			DHR-2.|Interaction with CRKL.		Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.3964C>T	CCDS4371.1																																																																																				0.592	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		4	89	0	0	0	0.000602214	0	4	89				
ZNF311	282890	broad.mit.edu	37	6	28963438	28963438	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr6:28963438C>A	ENST00000377179.3	-	7	1853	c.1341G>T	c.(1339-1341)caG>caT	p.Q447H	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	447					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						CTTTTCCACACTGGGGACACC	0.493																																							uc003nlu.2		NA																	0					0						c.(1339-1341)CAG>CAT		zinc finger protein 311							149.0	132.0	138.0					6																	28963438		1511	2709	4220	SO:0001583	missense	282890				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:28963438C>A	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1341G>T	6.37:g.28963438C>A	ENSP00000366384:p.Gln447His		Somatic				ZNF311_uc011dlk.1_Missense_Mutation_p.Q355H|ZNF311_uc003nlv.2_Missense_Mutation_p.Q355H	p.Q447H	NM_001010877	NP_001010877	WXS	Illumina HiSeq	Unspecified	Q5JNZ3	ZN311_HUMAN			7	1854	-			447			C2H2-type 8.		A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	ENST00000377179.3	37	c.1341G>T	CCDS34357.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965790	0.34659	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.35973	1.28	3.69	-0.343	0.12632	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09642	0.0237	L	0.35542	1.07	0.09310	N	0.999999	B	0.18461	0.028	B	0.11329	0.006	T	0.34304	-0.9834	9	0.87932	D	0	-1.6243	4.5344	0.12020	0.0:0.5134:0.1696:0.3169	.	447	Q5JNZ3	ZN311_HUMAN	H	447;355	ENSP00000366384:Q447H	ENSP00000366384:Q447H	Q	-	3	2	ZNF311	29071417	0.000000	0.05858	0.002000	0.10522	0.837000	0.47467	-0.839000	0.04368	0.002000	0.14630	-0.225000	0.12378	CAG		0.493	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581		8	170	1	0	5.4927e-09	0.000274275	2.36641e-08	8	170				
OR12D2	26529	broad.mit.edu	37	6	29365367	29365367	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr6:29365367G>A	ENST00000383555.2	+	1	952	c.891G>A	c.(889-891)aaG>aaA	p.K297K	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						AGGAAGTGAAGGGGGCCTTGG	0.433																																							uc003nmf.3		NA																	0				ovary(1)	1						c.(889-891)AAG>AAA		olfactory receptor, family 12, subfamily D,							95.0	104.0	101.0					6																	29365367		1508	2707	4215	SO:0001819	synonymous_variant	26529				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29365367G>A		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.891G>A	6.37:g.29365367G>A			Somatic					p.K297K	NM_013936	NP_039224	WXS	Illumina HiSeq	Unspecified	P58182	O12D2_HUMAN			1	952	+			297			Cytoplasmic (Potential).		B0S862|Q5SUN9|Q6IET9	Silent	SNP	ENST00000383555.2	37	c.891G>A	CCDS4659.1																																																																																				0.433	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			5	124	0	0	0	0.00116845	0	5	124				
STK38	11329	broad.mit.edu	37	6	36507865	36507865	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr6:36507865C>A	ENST00000229812.7	-	2	400	c.115G>T	c.(115-117)Gaa>Taa	p.E39*		NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCTCGTTCTTCATGTTGAGCG	0.378																																					Colon(180;997 3561 16158)	Colon(180;997 3561 16158)	uc003omg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						c.(115-117)GAA>TAA		serine/threonine kinase 38							238.0	224.0	228.0					6																	36507865		2203	4300	6503	SO:0001587	stop_gained	11329				intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity	g.chr6:36507865C>A		CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.115G>T	6.37:g.36507865C>A	ENSP00000229812:p.Glu39*		Somatic				STK38_uc003omh.2_Nonsense_Mutation_p.E39*|STK38_uc003omi.2_Nonsense_Mutation_p.E39*	p.E39*	NM_007271	NP_009202	WXS	Illumina HiSeq	Unspecified	Q15208	STK38_HUMAN			1	703	-			39						Nonsense_Mutation	SNP	ENST00000229812.7	37	c.115G>T	CCDS4822.1	.	.	.	.	.	.	.	.	.	.	C	40	7.980672	0.98594	.	.	ENSG00000112079	ENST00000229812	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	19.3556	0.94412	0.0:1.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000229812:E39X	E	-	1	0	STK38	36615843	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.442000	0.80503	2.672000	0.90937	0.591000	0.81541	GAA		0.378	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271		19	270	1	0	1.10513e-12	0.00229938	4.8339e-12	19	270				
SHPRH	257218	broad.mit.edu	37	6	146262927	146262927	+	Silent	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr6:146262927T>C	ENST00000367505.2	-	10	2586	c.2322A>G	c.(2320-2322)gtA>gtG	p.V774V	SHPRH_ENST00000438092.2_Silent_p.V774V|SHPRH_ENST00000367503.3_Silent_p.V774V|SHPRH_ENST00000275233.7_Silent_p.V774V			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	774	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CTGAACGCAGTACATCATAGG	0.413																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(2320-2322)GTA>GTG		SNF2 histone linker PHD RING helicase isoform a							67.0	69.0	68.0					6																	146262927		1949	4148	6097	SO:0001819	synonymous_variant	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146262927T>C	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2322A>G	6.37:g.146262927T>C			Somatic				SHPRH_uc003qld.2_Silent_p.V774V|SHPRH_uc003qle.2_Silent_p.V774V|SHPRH_uc003qlg.1_Silent_p.V330V|SHPRH_uc003qlj.1_Silent_p.V663V	p.V774V	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	10	2721	-		Ovarian(120;0.0365)	774			Helicase ATP-binding; second part.		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Silent	SNP	ENST00000367505.2	37	c.2322A>G	CCDS43513.2																																																																																				0.413	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		46	46	0	0	0	0.00321405	0	46	46				
AIMP2	7965	broad.mit.edu	37	7	6063250	6063250	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:6063250C>T	ENST00000223029.3	+	4	1010	c.891C>T	c.(889-891)gcC>gcT	p.A297A	AIMP2_ENST00000400479.2_Silent_p.A219A|AIMP2_ENST00000395236.2_Silent_p.A228A|EIF2AK1_ENST00000199389.6_3'UTR	NM_006303.3	NP_006294.2	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 2	297	GST C-terminal.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|tRNA aminoacylation for protein translation (GO:0006418)|Type II pneumocyte differentiation (GO:0060510)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						CAGTGCCAGCCAATGTGCAGA	0.522																																							uc003spo.2		NA																	0				ovary(1)	1						c.(889-891)GCC>GCT		aminoacyl tRNA synthetase complex-interacting							88.0	71.0	77.0					7																	6063250		2203	4300	6503	SO:0001819	synonymous_variant	7965				apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding	g.chr7:6063250C>T	U24169	CCDS5344.1	7p22.1	2009-05-29			ENSG00000106305	ENSG00000106305			20609	protein-coding gene	gene with protein product		600859				8666379, 18695251	Standard	NM_006303		Approved	p38, PRO0992, JTV-1, JTV1	uc003spo.3	Q13155	OTTHUMG00000122077	ENST00000223029.3:c.891C>T	7.37:g.6063250C>T			Somatic				EIF2AK1_uc003spp.2_3'UTR|EIF2AK1_uc003spq.2_3'UTR	p.A297A	NM_006303	NP_006294	WXS	Illumina HiSeq	Unspecified	Q13155	AIMP2_HUMAN			4	1004	+			297			GST C-terminal.		Q75MR1|Q96CZ5|Q9P1L2	Silent	SNP	ENST00000223029.3	37	c.891C>T	CCDS5344.1																																																																																				0.522	AIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242834.2	NM_006303		33	83	0	0	0	0.00327116	0	33	83				
NPC1L1	29881	broad.mit.edu	37	7	44553240	44553240	+	Missense_Mutation	SNP	C	C	T	rs201187589		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:44553240C>T	ENST00000289547.4	-	20	3941	c.3886G>A	c.(3886-3888)Gtt>Att	p.V1296I	NPC1L1_ENST00000546276.1_Missense_Mutation_p.V1223I|NPC1L1_ENST00000381160.3_Missense_Mutation_p.V1269I	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1296					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GCCGGGTTAACGTCAGGCCCT	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18752	0.0		0.0	False		,,,				2504	0.0						uc003tlb.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3886-3888)GTT>ATT		Niemann-Pick C1-like protein 1 isoform 1	Ezetimibe(DB00973)						52.0	54.0	54.0					7																	44553240		2203	4300	6503	SO:0001583	missense	29881				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding	g.chr7:44553240C>T		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3886G>A	7.37:g.44553240C>T	ENSP00000289547:p.Val1296Ile		Somatic				NPC1L1_uc003tlc.2_Missense_Mutation_p.V1269I|NPC1L1_uc011kbw.1_Missense_Mutation_p.V1223I|NPC1L1_uc003tla.2_3'UTR	p.V1296I	NM_013389	NP_037521	WXS	Illumina HiSeq	Unspecified	Q9UHC9	NPCL1_HUMAN			20	3942	-			1296			Cytoplasmic (Potential).		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	c.3886G>A	CCDS5491.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	0.368	-0.935364	0.02340	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	T;T;T	0.62941	-0.01;-0.01;-0.01	3.49	-0.402	0.12404	.	0.551419	0.16971	N	0.192106	T	0.41166	0.1147	N	0.20986	0.625	0.32526	N	0.535607	B;B;B	0.24368	0.102;0.062;0.004	B;B;B	0.15870	0.011;0.014;0.003	T	0.34129	-0.9841	10	0.34782	T	0.22	-34.0443	8.1797	0.31302	0.0:0.5888:0.0:0.4112	.	1223;1269;1296	B7ZLE6;Q17RV5;D3DVK9	.;.;.	I	1296;1269;1223	ENSP00000289547:V1296I;ENSP00000370552:V1269I;ENSP00000438033:V1223I	ENSP00000289547:V1296I	V	-	1	0	NPC1L1	44519765	0.024000	0.19004	0.248000	0.24265	0.024000	0.10985	-0.182000	0.09726	-0.094000	0.12374	-1.327000	0.01280	GTT		0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		46	53	0	0	0	0.00361006	0	46	53				
EGFR	1956	broad.mit.edu	37	7	55259524	55259524	+	Missense_Mutation	SNP	T	T	A	rs121913444		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:55259524T>A	ENST00000275493.2	+	21	2759	c.2582T>A	c.(2581-2583)cTg>cAg	p.L861Q	EGFR_ENST00000454757.2_Missense_Mutation_p.L808Q|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.L816Q|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	861	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> Q (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type; dbSNP:rs121913444). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L861Q(53)|p.L861R(6)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CTGGCCAAACTGCTGGGTGCG	0.557		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		59	Substitution - Missense(59)	p.L861Q(96)|p.L861R(10)|p.A859_L883>V(2)|p.L861F(1)|p.L861V(1)|p.L861P(1)	lung(57)|upper_aerodigestive_tract(1)|central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2581-2583)CTG>CAG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						102.0	96.0	98.0					7																	55259524		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259524T>A		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2582T>A	7.37:g.55259524T>A	ENSP00000275493:p.Leu861Gln	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.L816Q|EGFR_uc011kco.1_Missense_Mutation_p.L808Q|uc003tqo.2_5'Flank	p.L861Q	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2828	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		861		L -> Q (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2582T>A	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955260	0.73902	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.82255	-1.59;-1.59;-1.59	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85513	0.5714	N	0.25332	0.735	0.58432	D	0.999998	P;D	0.76494	0.481;0.999	B;D	0.71414	0.287;0.973	D	0.87493	0.2428	10	0.87932	D	0	.	15.0046	0.71501	0.0:0.0:0.0:1.0	.	816;861	Q504U8;P00533	.;EGFR_HUMAN	Q	816;731;861;808	ENSP00000415559:L816Q;ENSP00000275493:L861Q;ENSP00000395243:L808Q	ENSP00000275493:L861Q	L	+	2	0	EGFR	55227018	1.000000	0.71417	0.971000	0.41717	0.664000	0.39144	7.911000	0.87458	2.221000	0.72209	0.528000	0.53228	CTG		0.557	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		871	40	0	0	0	0.00361006	0	871	40				
EPHB4	2050	broad.mit.edu	37	7	100403236	100403236	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:100403236G>A	ENST00000358173.3	-	15	3033	c.2565C>T	c.(2563-2565)gaC>gaT	p.D855D	EPHB4_ENST00000360620.3_Silent_p.D855D	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	855	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					TCTGCCAACAGTCCAGCATGA	0.632																																					GBM(200;2113 3072 25865 52728)	GBM(200;2113 3072 25865 52728)	uc003uwn.1		NA																	0				lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15						c.(2563-2565)GAC>GAT		EPH receptor B4 precursor							67.0	76.0	73.0					7																	100403236		2203	4300	6503	SO:0001819	synonymous_variant	2050				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:100403236G>A	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2565C>T	7.37:g.100403236G>A			Somatic				EPHB4_uc003uwm.1_Silent_p.D762D|EPHB4_uc010lhj.1_Silent_p.D855D	p.D855D	NM_004444	NP_004435	WXS	Illumina HiSeq	Unspecified	P54760	EPHB4_HUMAN			15	3056	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		855			Cytoplasmic (Potential).|Protein kinase.		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	c.2565C>T	CCDS5706.1																																																																																				0.632	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		9	219	0	0	0	0.000442599	0	9	219				
PRKAR2B	5577	broad.mit.edu	37	7	106797681	106797681	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:106797681G>A	ENST00000265717.4	+	10	1294	c.1035G>A	c.(1033-1035)tcG>tcA	p.S345S		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	345					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						CTCGATGCTCGCGGGGACAGT	0.458																																							uc003vdx.2		NA																	0				ovary(1)	1						c.(1033-1035)TCG>TCA		cAMP-dependent protein kinase, regulatory							119.0	111.0	114.0					7																	106797681		2203	4300	6503	SO:0001819	synonymous_variant	5577				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity	g.chr7:106797681G>A		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.1035G>A	7.37:g.106797681G>A			Somatic					p.S345S	NM_002736	NP_002727	WXS	Illumina HiSeq	Unspecified	P31323	KAP3_HUMAN			10	1210	+			345			cAMP 2.		A4D0R9	Silent	SNP	ENST00000265717.4	37	c.1035G>A	CCDS5740.1																																																																																				0.458	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1			38	42	0	0	0	0.00195071	0	38	42				
SLC26A4	5172	broad.mit.edu	37	7	107335138	107335138	+	Missense_Mutation	SNP	T	T	C	rs373738509		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:107335138T>C	ENST00000265715.3	+	12	1638	c.1414T>C	c.(1414-1416)Tgg>Cgg	p.W472R	SLC26A4_ENST00000541474.1_Missense_Mutation_p.W33R|SLC26A4_ENST00000543100.1_Missense_Mutation_p.W41R|SLC26A4_ENST00000544569.1_Missense_Mutation_p.W59R|SLC26A4_ENST00000480841.1_3'UTR	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	472					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TCCTCGTCTGTGGAGACAGAA	0.428									Pendred syndrome																														uc003vep.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1414-1416)TGG>CGG		pendrin		T	ARG/TRP	1,4405	2.1+/-5.4	0,1,2202	160.0	143.0	149.0		1414	5.8	1.0	7		149	0,8600		0,0,4300	no	missense	SLC26A4	NM_000441.1	101	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	472/781	107335138	1,13005	2203	4300	6503	SO:0001583	missense	5172	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity	g.chr7:107335138T>C	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1414T>C	7.37:g.107335138T>C	ENSP00000265715:p.Trp472Arg		Somatic				SLC26A4_uc011kmb.1_Missense_Mutation_p.W59R|SLC26A4_uc011kmc.1_Missense_Mutation_p.W33R|SLC26A4_uc011kmd.1_Missense_Mutation_p.W41R	p.W472R	NM_000441	NP_000432	WXS	Illumina HiSeq	Unspecified	O43511	S26A4_HUMAN			12	1638	+			472			Extracellular (Potential).		B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	c.1414T>C	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382932	0.82792	2.27E-4	0.0	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.96992	-3.26;-4.2;-3.26;-3.26	5.76	5.76	0.90799	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	M	0.93720	3.45	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.99741	1.1015	10	0.87932	D	0	.	16.3634	0.83296	0.0:0.0:0.0:1.0	.	33;59;472	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	R	472;33;59;41	ENSP00000265715:W472R;ENSP00000439743:W33R;ENSP00000437427:W59R;ENSP00000441209:W41R	ENSP00000265715:W472R	W	+	1	0	SLC26A4	107122374	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.346000	0.79347	2.324000	0.78689	0.533000	0.62120	TGG		0.428	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441		5	102	0	0	0	0.00198382	0	5	102				
MET	4233	broad.mit.edu	37	7	116340099	116340099	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:116340099T>C	ENST00000318493.6	+	2	1148	c.961T>C	c.(961-963)Tat>Cat	p.Y321H	MET_ENST00000397752.3_Missense_Mutation_p.Y321H|MET_ENST00000436117.2_Missense_Mutation_p.Y321H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCAGGCTGCGTATGTCAGCAA	0.453			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		0				upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(961-963)TAT>CAT		met proto-oncogene isoform b precursor							51.0	50.0	50.0					7																	116340099		1889	4095	5984	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116340099T>C	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.961T>C	7.37:g.116340099T>C	ENSP00000317272:p.Tyr321His		Somatic				MET_uc010lkh.2_Missense_Mutation_p.Y321H|MET_uc011knc.1_Missense_Mutation_p.Y321H|MET_uc011knd.1_Missense_Mutation_p.Y321H|MET_uc011kne.1_Missense_Mutation_p.Y321H|MET_uc011knf.1_Missense_Mutation_p.Y321H|MET_uc011kng.1_Missense_Mutation_p.Y321H|MET_uc011knh.1_Missense_Mutation_p.Y321H|MET_uc011kni.1_Missense_Mutation_p.Y321H|MET_uc003vii.1_Missense_Mutation_p.Y340H|MET_uc010lkg.2_Missense_Mutation_p.Y321H|MET_uc011kmz.1_Missense_Mutation_p.Y321H|MET_uc011kna.1_Missense_Mutation_p.Y321H|MET_uc011knb.1_Missense_Mutation_p.Y321H	p.Y321H	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		2	1148	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	321			Extracellular (Potential).|Sema.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.961T>C	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	2.316	-0.356876	0.05138	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.10382	2.88;2.88;2.88	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.172622	0.51477	D	0.000085	T	0.24851	0.0603	L	0.49455	1.56	0.80722	D	1	P;P;D;P;P;P;P;B;P;P;P;D;D	0.89917	0.476;0.811;0.972;0.568;0.701;0.811;0.701;0.363;0.576;0.454;0.51;1.0;1.0	B;P;P;P;P;P;P;P;P;B;P;D;D	0.91635	0.299;0.705;0.793;0.615;0.705;0.705;0.705;0.46;0.5;0.211;0.46;0.999;0.999	T	0.04413	-1.0953	10	0.07030	T	0.85	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	321;321;321;321;321;321;321;321;321;321;321;321;321	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	H	321	ENSP00000380860:Y321H;ENSP00000317272:Y321H;ENSP00000410980:Y321H	ENSP00000317272:Y321H	Y	+	1	0	MET	116127335	0.997000	0.39634	0.967000	0.41034	0.974000	0.67602	2.952000	0.49097	2.317000	0.78254	0.460000	0.39030	TAT		0.453	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			3	94	0	0	0	6.4e-05	0	3	94				
FAM3C	10447	broad.mit.edu	37	7	120990539	120990539	+	Silent	SNP	T	T	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:120990539T>A	ENST00000359943.3	-	10	873	c.660A>T	c.(658-660)ggA>ggT	p.G220G		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	220					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					GGGGGATGCATCCTTCCATTT	0.368																																							uc003vjx.2		NA																	0					0						c.(658-660)GGA>GGT		family with sequence similarity 3, member C							140.0	133.0	136.0					7																	120990539		2203	4297	6500	SO:0001819	synonymous_variant	10447				multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity	g.chr7:120990539T>A	D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.660A>T	7.37:g.120990539T>A			Somatic				FAM3C_uc010lkm.2_Silent_p.G220G	p.G220G	NM_014888	NP_055703	WXS	Illumina HiSeq	Unspecified	Q92520	FAM3C_HUMAN			10	908	-	all_neural(327;0.117)		220					A6NDN2|A8K3R7	Silent	SNP	ENST00000359943.3	37	c.660A>T	CCDS5782.1																																																																																				0.368	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346945.1	NM_001040020		80	88	0	0	0	0.00361006	0	80	88				
SMARCD3	6604	broad.mit.edu	37	7	150936506	150936506	+	Silent	SNP	G	G	A	rs139287814	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr7:150936506G>A	ENST00000262188.8	-	12	1784	c.1374C>T	c.(1372-1374)gcC>gcT	p.A458A	SMARCD3_ENST00000477169.1_5'Flank|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000392811.2_Silent_p.A445A|SMARCD3_ENST00000356800.2_Silent_p.A445A	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	458					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCGACTGACGGCCTCCTGGG	0.612													G|||	2	0.000399361	0.0	0.0029	5008	,	,		17969	0.0		0.0	False		,,,				2504	0.0						uc003wjs.2		NA																	0				ovary(1)|lung(1)	2						c.(1372-1374)GCC>GCT		SWI/SNF related, matrix associated, actin		G	,,	1,4405	2.1+/-5.4	0,1,2202	45.0	50.0	48.0		1374,1335,1335	-10.0	0.0	7	dbSNP_134	48	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	SMARCD3	NM_001003801.1,NM_001003802.1,NM_003078.3	,,	0,7,6496	AA,AG,GG		0.0698,0.0227,0.0538	,,	458/484,445/471,445/471	150936506	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	6604				cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding	g.chr7:150936506G>A	U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.1374C>T	7.37:g.150936506G>A			Somatic				SMARCD3_uc003wjt.2_Silent_p.A445A|SMARCD3_uc003wju.2_Silent_p.A445A	p.A458A	NM_001003801	NP_001003801	WXS	Illumina HiSeq	Unspecified	Q6STE5	SMRD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	12	1475	-			458					D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Silent	SNP	ENST00000262188.8	37	c.1374C>T	CCDS34780.1																																																																																				0.612	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801		27	48	0	0	0	0.001512	0	27	48				
RP1L1	94137	broad.mit.edu	37	8	10468680	10468680	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:10468680C>T	ENST00000382483.3	-	4	3151	c.2928G>A	c.(2926-2928)gcG>gcA	p.A976A		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	976					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGGTCTCGTCCGCCAACTCAT	0.632																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(2926-2928)GCG>GCA		retinitis pigmentosa 1-like 1							53.0	58.0	56.0					8																	10468680		1951	4132	6083	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10468680C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2928G>A	8.37:g.10468680C>T			Somatic					p.A976A	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	3157	-			976					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.2928G>A	CCDS43708.1																																																																																				0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			27	12	0	0	0	0.00106085	0	27	12				
PENK	5179	broad.mit.edu	37	8	57353979	57353979	+	Missense_Mutation	SNP	C	C	T	rs201807450	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:57353979C>T	ENST00000314922.3	-	2	732	c.656G>A	c.(655-657)cGc>cAc	p.R219H	PENK_ENST00000451791.2_Missense_Mutation_p.R219H|PENK_ENST00000523274.1_5'UTR	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	219					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			CCACTCTGGGCGACCTACTCT	0.532													C|||	2	0.000399361	0.0	0.0	5008	,	,		17516	0.002		0.0	False		,,,				2504	0.0						uc003xsz.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(655-657)CGC>CAC		proenkephalin		C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	97.0	99.0	98.0		656,656	5.9	1.0	8		98	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PENK	NM_001135690.1,NM_006211.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	219/268,219/268	57353979	1,13005	2203	4300	6503	SO:0001583	missense	5179				neuropeptide signaling pathway	extracellular region	neuropeptide hormone activity|opioid peptide activity	g.chr8:57353979C>T		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.656G>A	8.37:g.57353979C>T	ENSP00000324248:p.Arg219His		Somatic				PENK_uc003xta.3_Missense_Mutation_p.R219H	p.R219H	NM_006211	NP_006202	WXS	Illumina HiSeq	Unspecified	P01210	PENK_HUMAN	Epithelial(17;0.000873)|all cancers(17;0.0069)		2	737	-		all_lung(136;0.229)	219					B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	ENST00000314922.3	37	c.656G>A	CCDS6168.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969209	0.92855	0.0	1.16E-4	ENSG00000181195	ENST00000314922;ENST00000451791	T;T	0.20200	2.09;2.09	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.52917	0.1764	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.55579	-0.8119	10	0.87932	D	0	-27.2085	19.2867	0.94077	0.0:1.0:0.0:0.0	.	219	P01210	PENK_HUMAN	H	219	ENSP00000324248:R219H;ENSP00000400894:R219H	ENSP00000324248:R219H	R	-	2	0	PENK	57516533	1.000000	0.71417	0.975000	0.42487	0.727000	0.41649	7.061000	0.76699	2.793000	0.96121	0.655000	0.94253	CGC		0.532	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378645.1			10	169	0	0	0	0.000442599	0	10	169				
C8orf34	116328	broad.mit.edu	37	8	69434041	69434041	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:69434041T>G	ENST00000539993.1	+	6	1064	c.515T>G	c.(514-516)gTg>gGg	p.V172G	C8orf34_ENST00000518698.1_Missense_Mutation_p.V258G|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000348340.2_Missense_Mutation_p.V172G|C8orf34_ENST00000337103.4_Missense_Mutation_p.V147G			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	172										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CAGGAAACAGTGACATTTAAT	0.398																																							uc010lyz.2		NA																	0				large_intestine(1)	1						c.(514-516)GTG>GGG		hypothetical protein LOC116328							68.0	68.0	68.0					8																	69434041		2203	4300	6503	SO:0001583	missense	116328				signal transduction		cAMP-dependent protein kinase regulator activity	g.chr8:69434041T>G	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.515T>G	8.37:g.69434041T>G	ENSP00000438159:p.Val172Gly		Somatic				C8orf34_uc010lyy.1_Missense_Mutation_p.V172G|C8orf34_uc003xyb.2_Missense_Mutation_p.V147G	p.V172G	NM_052958	NP_443190	WXS	Illumina HiSeq	Unspecified	Q49A92	CH034_HUMAN	Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)		6	564	+			172					A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	37	c.515T>G		.	.	.	.	.	.	.	.	.	.	T	10.68	1.419668	0.25552	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.44083	0.93;0.97;0.97	5.31	4.15	0.48705	.	0.978054	0.08427	N	0.947503	T	0.17238	0.0414	N	0.02011	-0.69	0.34205	D	0.673608	B;B	0.17667	0.009;0.023	B;B	0.23852	0.015;0.049	T	0.35699	-0.9778	9	.	.	.	0.6282	4.101	0.10014	0.0:0.2152:0.1769:0.6079	.	172;172	Q49A92;Q49A92-3	CH034_HUMAN;.	G	258;172;172;147	ENSP00000427820:V258G;ENSP00000438159:V172G;ENSP00000337174:V147G	.	V	+	2	0	C8orf34	69596595	0.743000	0.28239	0.845000	0.33349	0.973000	0.67179	1.296000	0.33389	0.952000	0.37798	0.460000	0.39030	GTG		0.398	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958		8	13	0	0	0	0.00307968	0	8	13				
CA2	760	broad.mit.edu	37	8	86392932	86392932	+	Nonsense_Mutation	SNP	G	G	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:86392932G>T	ENST00000285379.5	+	7	927	c.697G>T	c.(697-699)Gag>Tag	p.E233*		NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II	233					angiotensin-activated signaling pathway (GO:0038166)|bicarbonate transport (GO:0015701)|kidney development (GO:0001822)|morphogenesis of an epithelium (GO:0002009)|odontogenesis of dentin-containing tooth (GO:0042475)|one-carbon metabolic process (GO:0006730)|positive regulation of bone resorption (GO:0045780)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of dipeptide transmembrane transport (GO:2001150)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of anion transport (GO:0044070)|regulation of chloride transport (GO:2001225)|regulation of intracellular pH (GO:0051453)|response to estrogen (GO:0043627)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Furosemide(DB00695)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CTTCAATGGGGAGGGTGAACC	0.393																																							uc003ydk.2		NA																	0				central_nervous_system(1)	1						c.(697-699)GAG>TAG		carbonic anhydrase II	Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)						96.0	91.0	93.0					8																	86392932		2203	4300	6503	SO:0001587	stop_gained	760				one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding	g.chr8:86392932G>T	J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	4.2.1.1	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492				3107918	Standard	NM_000067		Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.697G>T	8.37:g.86392932G>T	ENSP00000285379:p.Glu233*		Somatic					p.E233*	NM_000067	NP_000058	WXS	Illumina HiSeq	Unspecified	P00918	CAH2_HUMAN			7	877	+			233					B2R7G8|Q6FI12|Q96ET9	Nonsense_Mutation	SNP	ENST00000285379.5	37	c.697G>T	CCDS6239.1	.	.	.	.	.	.	.	.	.	.	G	37	6.340690	0.97489	.	.	ENSG00000104267	ENST00000285379	.	.	.	5.63	5.63	0.86233	.	0.372790	0.32836	N	0.005591	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	0.4597	18.6669	0.91493	0.0:0.0:1.0:0.0	.	.	.	.	X	233	.	ENSP00000285379:E233X	E	+	1	0	CA2	86580184	1.000000	0.71417	0.050000	0.19076	0.702000	0.40608	5.326000	0.65875	2.636000	0.89361	0.655000	0.94253	GAG		0.393	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381097.2	NM_000067		28	119	1	0	1.17739e-12	0.000878237	5.11096e-12	28	119				
CCNE2	9134	broad.mit.edu	37	8	95895049	95895049	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:95895049C>G	ENST00000520509.1	-	10	1155	c.903G>C	c.(901-903)ttG>ttC	p.L301F	RP11-347C18.5_ENST00000605911.1_RNA|CCNE2_ENST00000308108.4_Missense_Mutation_p.L301F|CCNE2_ENST00000396133.3_Missense_Mutation_p.L301F|CCNE2_ENST00000523476.1_5'Flank			O96020	CCNE2_HUMAN	cyclin E2	301					cell cycle checkpoint (GO:0000075)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|prostate(1)	11	Breast(36;8.75e-07)					TAAAATGGCACAAGGCAGCAG	0.383																																							uc003yhc.2		NA																	0					0						c.(901-903)TTG>TTC		cyclin E2							151.0	145.0	147.0					8																	95895049		2203	4300	6503	SO:0001583	missense	9134				cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding	g.chr8:95895049C>G	AF091433	CCDS6264.1	8q22.1	2005-10-18			ENSG00000175305	ENSG00000175305			1590	protein-coding gene	gene with protein product		603775				9840927, 9840943	Standard	NM_057749		Approved	CYCE2	uc003yhc.3	O96020	OTTHUMG00000164696	ENST00000520509.1:c.903G>C	8.37:g.95895049C>G	ENSP00000429089:p.Leu301Phe		Somatic				CCNE2_uc003yhd.2_Missense_Mutation_p.L301F	p.L301F	NM_057749	NP_477097	WXS	Illumina HiSeq	Unspecified	O96020	CCNE2_HUMAN			10	1012	-	Breast(36;8.75e-07)		301					O95439	Missense_Mutation	SNP	ENST00000520509.1	37	c.903G>C	CCDS6264.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286678	0.59867	.	.	ENSG00000175305	ENST00000520509;ENST00000308108;ENST00000542725;ENST00000396133	T;T;T	0.29142	1.58;1.58;1.58	6.17	-1.33	0.09172	Cyclin, C-terminal (1);Cyclin-like (1);	0.119010	0.56097	D	0.000033	T	0.25344	0.0616	L	0.31371	0.925	0.38422	D	0.946203	P;B	0.48834	0.916;0.373	P;B	0.53988	0.739;0.187	T	0.14035	-1.0487	10	0.34782	T	0.22	.	3.9812	0.09495	0.095:0.3674:0.1022:0.4354	.	301;301	Q8WUE3;O96020	.;CCNE2_HUMAN	F	301;301;193;301	ENSP00000429089:L301F;ENSP00000309181:L301F;ENSP00000379437:L301F	ENSP00000309181:L301F	L	-	3	2	CCNE2	95964225	0.134000	0.22483	0.957000	0.39632	0.985000	0.73830	-0.498000	0.06420	-0.158000	0.11040	-0.137000	0.14449	TTG		0.383	CCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379808.1	NM_057749, NM_004702		42	197	0	0	0	0.00285205	0	42	197				
ERICH5	203111	broad.mit.edu	37	8	99101611	99101611	+	Silent	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:99101611G>A	ENST00000318528.3	+	2	725	c.366G>A	c.(364-366)gaG>gaA	p.E122E	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		122										kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			GTGGCAAAGAGGATGCCCCAG	0.557																																							uc003yih.1		NA																	0					0						c.(364-366)GAG>GAA		hypothetical protein LOC203111							61.0	66.0	65.0					8																	99101611		2203	4300	6503	SO:0001819	synonymous_variant	203111							g.chr8:99101611G>A																												ENST00000318528.3:c.366G>A	8.37:g.99101611G>A			Somatic					p.E122E	NM_173549	NP_775820	WXS	Illumina HiSeq	Unspecified	Q6P6B1	CH047_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.214)		2	514	+	Breast(36;2.31e-06)		122					G3V1K4|Q8N1L8	Silent	SNP	ENST00000318528.3	37	c.366G>A	CCDS34929.1																																																																																				0.557	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380465.1			11	147	0	0	0	0.000978159	0	11	147				
TBC1D31	93594	broad.mit.edu	37	8	124156985	124156985	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:124156985G>A	ENST00000287380.1	+	20	2954	c.2864G>A	c.(2863-2865)cGt>cAt	p.R955H	TBC1D31_ENST00000521676.1_Missense_Mutation_p.R832H|TBC1D31_ENST00000518805.1_Missense_Mutation_p.R509H|TBC1D31_ENST00000309336.3_Missense_Mutation_p.R890H|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R850H|TBC1D31_ENST00000327098.5_Missense_Mutation_p.R859H|TBC1D31_ENST00000378080.2_3'UTR	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	955						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										AAAGAGTTCCGTTTGAGATCA	0.358																																							uc003ypp.1		NA																	0				skin(1)	1						c.(2863-2865)CGT>CAT		WD repeat domain 67 isoform 1							71.0	72.0	72.0					8																	124156985		2203	4300	6503	SO:0001583	missense	93594					centrosome	Rab GTPase activator activity	g.chr8:124156985G>A	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.2864G>A	8.37:g.124156985G>A	ENSP00000287380:p.Arg955His		Somatic				WDR67_uc011lig.1_Missense_Mutation_p.R859H|WDR67_uc011lih.1_Missense_Mutation_p.R845H|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_Missense_Mutation_p.R589H|WDR67_uc003ypt.1_Missense_Mutation_p.R347H|WDR67_uc003ypu.1_Missense_Mutation_p.R347H	p.R955H	NM_145647	NP_663622	WXS	Illumina HiSeq	Unspecified	Q96DN5	WDR67_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		20	2954	+	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		955					B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	37	c.2864G>A	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	G	0.341	-0.950235	0.02285	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000518805	D;T;T;D;D;D	0.86497	-2.13;-0.02;-0.01;-2.13;-2.13;-2.13	5.13	-2.22	0.06952	.	0.722904	0.13939	N	0.352330	T	0.61689	0.2367	N	0.01576	-0.805	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.55198	-0.8178	10	0.27785	T	0.31	-0.1241	5.7885	0.18347	0.5561:0.1345:0.3094:0.0	.	859;890;850;955	B7ZL19;Q96DN5-2;E7ERK7;Q96DN5	.;.;.;WDR67_HUMAN	H	955;890;859;850;832;509	ENSP00000287380:R955H;ENSP00000308358:R890H;ENSP00000312701:R859H;ENSP00000429334:R850H;ENSP00000430628:R832H;ENSP00000429494:R509H	ENSP00000287380:R955H	R	+	2	0	WDR67	124226166	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.577000	0.23758	-0.090000	0.12462	-0.948000	0.02665	CGT		0.358	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647		54	24	0	0	0	0.00361006	0	54	24				
FAM135B	51059	broad.mit.edu	37	8	139189617	139189617	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:139189617A>C	ENST00000395297.1	-	11	1246	c.1076T>G	c.(1075-1077)cTt>cGt	p.L359R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	359								p.L359P(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAGGACTGCAAGTTTTTGGTG	0.418										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(1075-1077)CTT>CGT		hypothetical protein LOC51059							115.0	109.0	111.0					8																	139189617		1922	4128	6050	SO:0001583	missense	51059							g.chr8:139189617A>C	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1076T>G	8.37:g.139189617A>C	ENSP00000378710:p.Leu359Arg	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.L260R|FAM135B_uc003yuz.2_RNA	p.L359R	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		11	1247	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		359					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.1076T>G	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	A	5.620	0.299050	0.10622	.	.	ENSG00000147724	ENST00000395297	D	0.89050	-2.46	5.14	2.76	0.32466	.	0.353208	0.28072	N	0.016716	T	0.80934	0.4719	L	0.47716	1.5	0.09310	N	1	B	0.27192	0.171	B	0.28849	0.095	T	0.63060	-0.6721	10	0.16420	T	0.52	-6.9402	3.3542	0.07163	0.6541:0.0:0.1773:0.1686	.	359	Q49AJ0	F135B_HUMAN	R	359	ENSP00000378710:L359R	ENSP00000276737:L359R	L	-	2	0	FAM135B	139258799	0.061000	0.20836	0.015000	0.15790	0.427000	0.31564	0.929000	0.28844	0.427000	0.26145	-0.433000	0.05886	CTT		0.418	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		4	76	0	0	0	0.00024832	0	4	76				
AGO2	27161	broad.mit.edu	37	8	141559311	141559311	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:141559311C>G	ENST00000220592.5	-	12	1602	c.1490G>C	c.(1489-1491)gGg>gCg	p.G497A	AGO2_ENST00000519980.1_Missense_Mutation_p.G497A	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	497					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GCTGTCCGCCCCCTGCGCGTA	0.637																																							uc003yvn.2		NA																	0					0						c.(1489-1491)GGG>GCG		argonaute 2 isoform 1							52.0	50.0	50.0					8																	141559311		2203	4300	6503	SO:0001583	missense	27161				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity	g.chr8:141559311C>G	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1490G>C	8.37:g.141559311C>G	ENSP00000220592:p.Gly497Ala		Somatic				EIF2C2_uc010men.2_Missense_Mutation_p.G420A|EIF2C2_uc010meo.2_Missense_Mutation_p.G497A	p.G497A	NM_012154	NP_036286	WXS	Illumina HiSeq	Unspecified	Q9UKV8	AGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.158)		12	1530	-	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	497					Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	c.1490G>C	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276958	0.59758	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.05081	3.51;3.5	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.17408	0.0418	M	0.91561	3.22	0.80722	D	1	P;P	0.39696	0.683;0.555	B;B	0.36845	0.234;0.071	T	0.08597	-1.0714	10	0.41790	T	0.15	-6.8386	19.5632	0.95380	0.0:1.0:0.0:0.0	.	497;497	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	A	497	ENSP00000220592:G497A;ENSP00000430176:G497A	ENSP00000220592:G497A	G	-	2	0	EIF2C2	141628493	1.000000	0.71417	0.959000	0.39883	0.449000	0.32228	7.713000	0.84693	2.710000	0.92621	0.655000	0.94253	GGG		0.637	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			6	71	0	0	0	0.00198382	0	6	71				
OPLAH	26873	broad.mit.edu	37	8	145111554	145111554	+	Missense_Mutation	SNP	C	C	T	rs200399200		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:145111554C>T	ENST00000426825.1	-	13	1892	c.1811G>A	c.(1810-1812)cGt>cAt	p.R604H	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	604					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTCCCCCGCACGGGGCGAGCG	0.667																																							uc003zar.3		NA																	0					0						c.(1810-1812)CGT>CAT		5-oxoprolinase (ATP-hydrolysing)	L-Glutamic Acid(DB00142)	C	HIS/ARG	0,4232		0,0,2116	20.0	27.0	24.0		1811	0.8	0.0	8		24	1,8449		0,1,4224	no	missense	OPLAH	NM_017570.3	29	0,1,6340	TT,TC,CC		0.0118,0.0,0.0079	possibly-damaging	604/1289	145111554	1,12681	2116	4225	6341	SO:0001583	missense	26873						5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding	g.chr8:145111554C>T	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1811G>A	8.37:g.145111554C>T	ENSP00000475943:p.Arg604His		Somatic				OPLAH_uc003zas.1_5'Flank	p.R604H	NM_017570	NP_060040	WXS	Illumina HiSeq	Unspecified	O14841	OPLA_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		13	1893	-	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		604					A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37	c.1811G>A		.	.	.	.	.	.	.	.	.	.	C	5.999	0.368217	0.11352	0.0	1.18E-4	ENSG00000178814	ENST00000426825	.	.	.	4.69	0.788	0.18601	.	0.196928	0.44097	D	0.000484	T	0.22589	0.0545	.	.	.	0.40220	D	0.977721	P	0.43701	0.815	B	0.38712	0.28	T	0.19289	-1.0310	7	0.45353	T	0.12	.	4.0517	0.09798	0.1541:0.4819:0.0:0.364	.	604	O14841	OPLA_HUMAN	H	604	.	ENSP00000412071:R604H	R	-	2	0	OPLAH	145183542	0.007000	0.16637	0.012000	0.15200	0.255000	0.26057	0.188000	0.17018	0.093000	0.17368	0.514000	0.50259	CGT		0.667	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570		6	58	0	0	0	0.00307968	0	6	58				
WWC3	55841	broad.mit.edu	37	X	10062261	10062261	+	Silent	SNP	C	C	T			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chrX:10062261C>T	ENST00000380861.4	+	7	988	c.597C>T	c.(595-597)ggC>ggT	p.G199G	WWC3_ENST00000454666.1_Silent_p.G199G	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	199					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GCGTGCCTGGCGATGCTGGTG	0.592																																							uc004csx.3		NA																	0				ovary(4)	4						c.(595-597)GGC>GGT		WWC family member 3							128.0	112.0	118.0					X																	10062261		2203	4300	6503	SO:0001819	synonymous_variant	55841							g.chrX:10062261C>T	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.597C>T	X.37:g.10062261C>T			Somatic				WWC3_uc010nds.2_5'UTR|WWC3_uc010ndt.2_RNA	p.G199G	NM_015691	NP_056506	WXS	Illumina HiSeq	Unspecified	Q9ULE0	WWC3_HUMAN			7	795	+			199					A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	c.597C>T	CCDS14136.1																																																																																				0.592	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		7	107	0	0	0	0.00307968	0	7	107				
TENM1	10178	broad.mit.edu	37	X	123587298	123587298	+	Silent	SNP	C	C	A			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chrX:123587298C>A	ENST00000371130.3	-	22	4035	c.3972G>T	c.(3970-3972)ggG>ggT	p.G1324G	TENM1_ENST00000422452.2_Silent_p.G1331G|TENM1_ENST00000461429.1_5'Flank	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1324					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GAATCATAGTCCCATCCACAA	0.428																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(3970-3972)GGG>GGT		odz, odd Oz/ten-m homolog 1 isoform 3							261.0	183.0	209.0					X																	123587298		2203	4300	6503	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123587298C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3972G>T	X.37:g.123587298C>A			Somatic				ODZ1_uc011muj.1_Silent_p.G1330G|ODZ1_uc010nqy.2_Silent_p.G1331G	p.G1324G	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			22	4036	-			1324			NHL 2.|Extracellular (Potential).		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.3972G>T	CCDS14609.1																																																																																				0.428	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		15	43	1	0	2.62699e-14	0.00316338	1.1579e-13	15	43				
RB1	5925	broad.mit.edu	37	13	48916758	48916758	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr13:48916758delG	ENST00000267163.4	+	3	426	c.288delG	c.(286-288)aagfs	p.K96fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	96					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(5)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAAAGAAAAAGGAACTGTGGG	0.313		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		20	Whole gene deletion(15)|Unknown(5)	p.?(4)	bone(10)|breast(6)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358	GRCh37	CD931046	RB1	D		c.(286-288)AAGfs		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						83.0	94.0	90.0					13																	48916758		2203	4300	6503	SO:0001589	frameshift_variant	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:48916758delG	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.288delG	13.37:g.48916758delG	ENSP00000267163:p.Lys96fs	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)	Somatic				RB1_uc010acs.1_Intron	p.K96fs	NM_000321	NP_000312	WXS	Illumina HiSeq	Unspecified	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	3	454	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	96					A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	37	c.288delG	CCDS31973.1																																																																																				0.313	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			161	22	NA	NA	NA	NA	NA	161	22	---	---	---	---
ATAD5	79915	broad.mit.edu	37	17	29162473	29162474	+	Frame_Shift_Ins	INS	-	-	C			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr17:29162473_29162474insC	ENST00000321990.4	+	2	1752_1753	c.1374_1375insC	c.(1375-1377)ggcfs	p.G459fs	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	459					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TTTCAAAAAATGGCAATTTACA	0.302																																							uc002hfs.1		NA																	0				ovary(3)	3						c.(1372-1377)AATGGCfs		ATPase family, AAA domain containing 5																																				SO:0001589	frameshift_variant	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29162473_29162474insC		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	Exception_encountered	17.37:g.29162473_29162474insC	ENSP00000313171:p.Gly459fs		Somatic				ATAD5_uc002hft.1_Frame_Shift_Ins_p.N355fs	p.N458fs	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			2	1720_1721	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	458_459					Q05DH0|Q69YR6|Q9H9I1	Frame_Shift_Ins	INS	ENST00000321990.4	37	c.1374_1375insC	CCDS11260.1																																																																																				0.302	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		30	76	NA	NA	NA	NA	NA	30	76	---	---	---	---
POMC	5443	broad.mit.edu	37	2	25384456	25384457	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs10654394	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr2:25384456_25384457insGCCGCTGCT	ENST00000405623.1	-	3	752_753	c.297_298insAGCAGCGGC	c.(295-300)ggcgca>ggcAGCAGCGGCgca	p.98_99insGSS	POMC_ENST00000380794.1_In_Frame_Ins_p.98_99insGSS|POMC_ENST00000264708.3_In_Frame_Ins_p.98_99insGSS|POMC_ENST00000395826.2_In_Frame_Ins_p.98_99insGSS|RP11-509E16.1_ENST00000567599.1_lincRNA			P01189	COLI_HUMAN	proopiomelanocortin	98			Missing. {ECO:0000269|PubMed:11244459, ECO:0000269|PubMed:7828531, ECO:0000269|PubMed:9768693}.		cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	TTCTGCCCTGCgccgctgctgc	0.728														386	0.0770767	0.2027	0.0317	5008	,	,		17351	0.0		0.0427	False		,,,				2504	0.0542				Colon(110;1515 1566 8452 10082 43216)	Colon(110;1515 1566 8452 10082 43216)	uc002rfy.1		NA																	0				ovary(1)	1	GRCh37	CI042901|CI984063	POMC	I	rs10654394	c.(295-300)insAGCAGCGGC		proopiomelanocortin preproprotein	Hydrocortisone(DB00741)|Loperamide(DB00836)|Trilostane(DB01108)		,	619,2251		169,281,985					,	2.6	0.6		dbSNP_119	5	273,5657		76,121,2768	no	coding,coding	POMC	NM_001035256.1,NM_000939.2	,	245,402,3753	A1A1,A1R,RR		4.6037,21.5679,10.1364	,	,		892,7908				SO:0001652	inframe_insertion	5443				cell-cell signaling|cellular nitrogen compound metabolic process|cellular pigmentation|generation of precursor metabolites and energy|hormone biosynthetic process|negative regulation of tumor necrosis factor production|neuropeptide signaling pathway|peptide hormone processing|positive regulation of transcription from RNA polymerase II promoter|regulation of appetite|regulation of blood pressure	extracellular space|stored secretory granule	hormone activity|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding	g.chr2:25384456_25384457insGCCGCTGCT		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.289_297dupAGCAGCGGC	2.37:g.25384457_25384465dupGCCGCTGCT	ENSP00000384092:p.Gly96_Ser98dup		Somatic				POMC_uc002rfz.1_In_Frame_Ins_p.99_100insSSG|POMC_uc002rga.1_In_Frame_Ins_p.99_100insSSG	p.99_100insSSG	NM_001035256	NP_001030333	WXS	Illumina HiSeq	Unspecified	P01189	COLI_HUMAN			4	560_561	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		99_100					P78442|Q53T23|Q9UD39|Q9UD40	In_Frame_Ins	INS	ENST00000405623.1	37	c.297_298insAGCAGCGGC	CCDS1717.1																																																																																				0.728	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256		3	4	NA	NA	NA	NA	NA	3	4	---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36708256	36708257	+	Frame_Shift_Ins	INS	-	-	G	rs145517108	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr22:36708256_36708257insG	ENST00000216181.5	-	14	1795_1796	c.1565_1566insC	c.(1564-1566)ccgfs	p.P522fs		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	522	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCAGAATGCCCGGGGGGCCTGC	0.639			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(1564-1566)CCGfs		myosin, heavy polypeptide 9, non-muscle																																				SO:0001589	frameshift_variant	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36708256_36708257insG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1566dupC	22.37:g.36708262_36708262dupG	ENSP00000216181:p.Pro522fs		Somatic				MYH9_uc003aph.1_Frame_Shift_Ins_p.P386fs	p.P522fs	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			14	1796_1797	-			522			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Frame_Shift_Ins	INS	ENST00000216181.5	37	c.1565_1566insC	CCDS13927.1																																																																																				0.639	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		14	200	NA	NA	NA	NA	NA	14	200	---	---	---	---
LPP	4026	broad.mit.edu	37	3	188124020	188124024	+	Frame_Shift_Del	DEL	ACACA	ACACA	-	rs149742671	byFrequency	TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	ACACA	ACACA	-	-	ACACA	ACACA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr3:188124020_188124024delACACA	ENST00000312675.4	+	3	358_362	c.112_116delACACA	c.(112-117)acacaafs	p.TQ38fs	LPP_ENST00000543006.1_Frame_Shift_Del_p.TQ38fs|LPP_ENST00000448637.1_Frame_Shift_Del_p.TQ38fs	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	38					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TTCAGTGTCTACACAACAGCCACCC	0.527			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																		uc003frs.1		NA		Dom	yes		3	3q28	4026	T	LIM domain containing preferred translocation partner in lipoma			"""L, M"""	HMGA2|MLL|C12orf9		lipoma|leukemia	HMGA2/LPP(161)	0				soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165						c.(112-117)ACACAAfs		LIM domain containing preferred translocation																																				SO:0001589	frameshift_variant	4026				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding	g.chr3:188124020_188124024delACACA	AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.112_116delACACA	3.37:g.188124020_188124024delACACA	ENSP00000318089:p.Thr38fs		Somatic				LPP_uc011bsg.1_Frame_Shift_Del_p.T38fs|LPP_uc011bsi.1_Frame_Shift_Del_p.T38fs|LPP_uc003frt.2_Frame_Shift_Del_p.T38fs	p.T38fs	NM_005578	NP_005569	WXS	Illumina HiSeq	Unspecified	Q93052	LPP_HUMAN		GBM - Glioblastoma multiforme(93;0.00602)	3	358_362	+	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)	38_39					A1L4L6|D3DNV6|Q8NFX5	Frame_Shift_Del	DEL	ENST00000312675.4	37	c.112_116delACACA	CCDS3291.1																																																																																				0.527	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578		28	151	NA	NA	NA	NA	NA	28	151	---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61714143	61714143	+	Frame_Shift_Del	DEL	A	A	-			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:61714143delA	ENST00000423902.2	+	6	2912	c.2433delA	c.(2431-2433)gtafs	p.V811fs	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000525508.1_Frame_Shift_Del_p.V811fs	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	811	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.556_871dup(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTCGTTCAGTAAAAAAGCAGG	0.358																																							uc003xue.2		NA																	1	Insertion - In frame(1)	p.556_871dup(1)	lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(2431-2433)GTAfs		chromodomain helicase DNA binding protein 7							59.0	53.0	54.0					8																	61714143		1826	4074	5900	SO:0001589	frameshift_variant	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61714143delA	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2433delA	8.37:g.61714143delA	ENSP00000392028:p.Val811fs		Somatic					p.V811fs	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		6	2910	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	811			Chromo 1.		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Frame_Shift_Del	DEL	ENST00000423902.2	37	c.2433delA	CCDS47865.1																																																																																				0.358	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
TBC1D31	93594	broad.mit.edu	37	8	124140520	124140521	+	Splice_Site	INS	-	-	T	rs570441854		TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr8:124140520_124140521insT	ENST00000287380.1	+	14	1974_1975		c.e14-1		TBC1D31_ENST00000521676.1_Splice_Site|TBC1D31_ENST00000518805.1_Intron|TBC1D31_ENST00000309336.3_Splice_Site|TBC1D31_ENST00000522420.1_Splice_Site|TBC1D31_ENST00000327098.5_Splice_Site|TBC1D31_ENST00000378080.2_Splice_Site	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31							centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TTTTCTTACAGTTTTTTTTTCA	0.322																																							uc003ypp.1		NA																	0				skin(1)	1						c.e14-1		WD repeat domain 67 isoform 1			,	6,4258		0,6,2126					,	5.7	1.0			76	8,8246		0,8,4119	no	frameshift-near-splice,frameshift-near-splice	WDR67	NM_145647.3,NM_001145088.1	,	0,14,6245	A1A1,A1R,RR		0.0969,0.1407,0.1118	,	,		14,12504				SO:0001630	splice_region_variant	93594					centrosome	Rab GTPase activator activity	g.chr8:124140520_124140521insT	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1885-1->T	8.37:g.124140529_124140529dupT			Somatic				WDR67_uc011lig.1_Splice_Site_p.F629_splice|WDR67_uc011lih.1_Splice_Site_p.F519_splice|WDR67_uc003ypq.1_Splice_Site|WDR67_uc003yps.1_Intron|WDR67_uc003ypt.1_Splice_Site_p.F86_splice|WDR67_uc003ypu.1_Splice_Site_p.F86_splice	p.F629_splice	NM_145647	NP_663622	WXS	Illumina HiSeq	Unspecified	Q96DN5	WDR67_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		14	1975	+	Lung NSC(37;7e-10)|Ovarian(258;0.0205)							B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Splice_Site	INS	ENST00000287380.1	37	c.1885_splice	CCDS6338.1																																																																																				0.322	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	Intron	7	146	NA	NA	NA	NA	NA	7	146	---	---	---	---
COQ4	51117	broad.mit.edu	37	9	131094439	131094439	+	Frame_Shift_Del	DEL	C	C	-			TCGA-91-6847-01A-11D-1945-08	TCGA-91-6847-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	020fab36-c7de-4933-b2bf-dc7b019a1326	b9542378-b8c6-4c0a-a0db-456396a45554	g.chr9:131094439delC	ENST00000300452.3	+	5	733	c.410delC	c.(409-411)tccfs	p.S137fs	COQ4_ENST00000461102.1_3'UTR	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						CAGAGGGTCTCCCCAGACACC	0.587																																							uc004bur.3		NA																	0					0						c.(409-411)TCCfs		coenzyme Q4 homolog precursor							61.0	43.0	49.0					9																	131094439		2199	4294	6493	SO:0001589	frameshift_variant	51117				ubiquinone biosynthetic process	mitochondrial inner membrane		g.chr9:131094439delC	AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.410delC	9.37:g.131094439delC	ENSP00000300452:p.Ser137fs		Somatic				COQ4_uc004bus.2_Frame_Shift_Del_p.S113fs|COQ4_uc010mxy.2_Frame_Shift_Del_p.S113fs	p.S137fs	NM_016035	NP_057119	WXS	Illumina HiSeq	Unspecified	Q9Y3A0	COQ4_HUMAN			5	757	+			137						Frame_Shift_Del	DEL	ENST00000300452.3	37	c.410delC	CCDS6898.1																																																																																				0.587	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054427.1	NM_016035		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
